HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030175855.1)

Select a Genome:
BAKTA Annotations for GCA_030175855.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
23 2,321,312 2093 4 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4303 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4303 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JASNTX010000001.1 GCA030175855_00248 gene open 43917-45638 cstA
502 JASNTX010000001.1 GCA030175855_00249 gene open 45661-45924
503 JASNTX010000001.1 GCA030175855_00250 gene open 45915-46913
504 JASNTX010000001.1 GCA030175855_00251 gene open 46918-47808
505 JASNTX010000001.1 GCA030175855_00252 gene open 47909-49162
506 JASNTX010000001.1 GCA030175855_00253 gene open 49177-49689
507 JASNTX010000001.1 GCA030175855_00254 gene open 49646-50170 folK
508 JASNTX010000001.1 GCA030175855_00255 gene open 50167-50517 folB
509 JASNTX010000001.1 GCA030175855_00256 gene open 50572-51510 folP
510 JASNTX010000001.1 GCA030175855_00257 gene open 51520-52116 folE
511 JASNTX010000001.1 GCA030175855_00258 gene open 52109-54448 ftsH
512 JASNTX010000001.1 GCA030175855_00259 gene open 54498-55109 hpt
513 JASNTX010000001.1 GCA030175855_00260 gene open 55194-56438 tilS
514 JASNTX010000001.1 GCA030175855_00261 gene open 56451-57788 dacB
515 JASNTX010000001.1 GCA030175855_00262 gene open 57963-58439
516 JASNTX010000001.1 GCA030175855_00263 gene open 58706-59518
517 JASNTX010000001.1 GCA030175855_00264 gene open 59686-60012
518 JASNTX010000001.1 GCA030175855_00265 gene open 60022-60921 ppk2
519 JASNTX010000001.1 GCA030175855_00266 gene open 61079-61201
520 JASNTX010000001.1 GCA030175855_00267 gene open 61287-61484
521 JASNTX010000001.1 GCA030175855_00268 gene open 62082-63728 groL
522 JASNTX010000001.1 GCA030175855_00269 gene open 63965-65404
523 JASNTX010000001.1 GCA030175855_00270 gene open 65424-66821
524 JASNTX010000001.1 GCA030175855_00271 gene open 66872-69931
525 JASNTX010000001.1 GCA030175855_00272 gene open 69931-70437
526 JASNTX010000001.1 GCA030175855_00273 gene open 70430-72208
527 JASNTX010000001.1 GCA030175855_00274 gene open 72208-72783
528 JASNTX010000001.1 GCA030175855_00275 gene open 72787-73062
529 JASNTX010000001.1 GCA030175855_00276 gene open 73065-73463
530 JASNTX010000001.1 GCA030175855_00277 gene open 73472-74725
531 JASNTX010000001.1 GCA030175855_00278 gene open 74725-75537
532 JASNTX010000001.1 GCA030175855_00279 gene open 75581-75835
533 JASNTX010000001.1 GCA030175855_00280 gene open 75852-76469
534 JASNTX010000001.1 GCA030175855_00281 gene open 76479-77549
535 JASNTX010000001.1 GCA030175855_00282 gene open 77585-78409
536 JASNTX010000001.1 GCA030175855_00283 gene open 78413-79933
537 JASNTX010000001.1 GCA030175855_00284 gene open 79943-80452
538 JASNTX010000001.1 GCA030175855_00285 gene open 80503-82029
539 JASNTX010000001.1 GCA030175855_00286 gene open 82026-83177
540 JASNTX010000001.1 GCA030175855_00287 gene open 83178-85649
541 JASNTX010000001.1 GCA030175855_00288 gene open 85646-87238 purT
542 JASNTX010000001.1 GCA030175855_00289 gene open 87245-88537
543 JASNTX010000001.1 GCA030175855_00290 gene open 88635-89612
544 JASNTX010000001.1 GCA030175855_00291 gene open 89664-90893
545 JASNTX010000001.1 GCA030175855_00292 gene open 90935-91969 fbaA
546 JASNTX010000001.1 GCA030175855_00293 gene open 92028-93233
547 JASNTX010000001.1 GCA030175855_00294 gene open 93345-94046 spoU
548 JASNTX010000001.1 GCA030175855_00295 gene open 94046-94603
549 JASNTX010000001.1 GCA030175855_00296 gene open 94621-96336
550 JASNTX010000001.1 GCA030175855_00297 gene open 96346-97176
551 JASNTX010000001.1 GCA030175855_00298 gene open 97234-99792 clpB
552 JASNTX010000001.1 GCA030175855_00299 gene open 99949-101346
553 JASNTX010000001.1 GCA030175855_00300 gene open 101604-102839
554 JASNTX010000001.1 GCA030175855_00301 gene open 103395-105434
555 JASNTX010000001.1 GCA030175855_00302 gene open 105503-106147
556 JASNTX010000001.1 GCA030175855_00303 gene open 106152-106979
557 JASNTX010000001.1 GCA030175855_00304 gene open 107092-107424
558 JASNTX010000001.1 GCA030175855_00305 gene open 107468-108703
559 JASNTX010000001.1 GCA030175855_00306 gene open 108724-110238
560 JASNTX010000001.1 GCA030175855_00307 gene open 110485-110946 hspR
561 JASNTX010000001.1 GCA030175855_00308 gene open 110977-112167 dnaJ
562 JASNTX010000001.1 GCA030175855_00309 gene open 112193-112915 grpE
563 JASNTX010000001.1 GCA030175855_00310 gene open 112916-114778 dnaK
564 JASNTX010000001.1 GCA030175855_00311 gene open 115205-118660
565 JASNTX010000001.1 GCA030175855_00312 gene open 118759-120132
566 JASNTX010000001.1 GCA030175855_00313 gene open 120158-121240
567 JASNTX010000001.1 GCA030175855_00314 gene open 121267-121773
568 JASNTX010000001.1 GCA030175855_00315 gene open 121949-122788
569 JASNTX010000001.1 GCA030175855_00316 gene open 122769-123509
570 JASNTX010000001.1 GCA030175855_00317 gene open 123500-124789
571 JASNTX010000001.1 GCA030175855_00318 gene open 124858-125484
572 JASNTX010000001.1 GCA030175855_00319 gene open 125506-126741
573 JASNTX010000001.1 GCA030175855_00320 gene open 126725-127276
574 JASNTX010000001.1 GCA030175855_00321 gene open 127383-128009
575 JASNTX010000001.1 GCA030175855_00322 gene open 128305-129693
576 JASNTX010000001.1 GCA030175855_00323 gene open 129763-131391
577 JASNTX010000001.1 GCA030175855_00324 gene open 131667-131807
578 JASNTX010000001.1 GCA030175855_00325 gene open 131847-133517
579 JASNTX010000001.1 GCA030175855_00326 gene open 133622-134956
580 JASNTX010000001.1 GCA030175855_00327 gene open 135009-135896 fepB
581 JASNTX010000001.1 GCA030175855_00328 gene open 135921-136106
582 JASNTX010000001.1 GCA030175855_00329 gene open 136177-137346
583 JASNTX010000001.1 GCA030175855_00330 gene open 137499-137981
584 JASNTX010000001.1 GCA030175855_00331 gene open 138337-139680
585 JASNTX010000001.1 GCA030175855_00332 gene open 139775-140338 dcd
586 JASNTX010000001.1 GCA030175855_00333 gene open 140402-142054
587 JASNTX010000001.1 GCA030175855_00334 gene open 142171-142686 uspA
588 JASNTX010000001.1 GCA030175855_00335 gene open 142728-142952
589 JASNTX010000001.1 GCA030175855_00336 gene open 142960-146340
590 JASNTX010000001.1 GCA030175855_00337 gene open 146247-147383
591 JASNTX010000001.1 GCA030175855_00338 gene open 147393-148196
592 JASNTX010000001.1 GCA030175855_00339 gene open 148186-148905
593 JASNTX010000001.1 GCA030175855_00340 gene open 149134-150480
594 JASNTX010000001.1 GCA030175855_00341 gene open 150484-151986
595 JASNTX010000001.1 GCA030175855_00343 gene open 152465-152713
596 JASNTX010000001.1 GCA030175855_00344 gene open 153510-153617
597 JASNTX010000001.1 GCA030175855_00345 gene open 153690-154430
598 JASNTX010000001.1 GCA030175855_00346 gene open 154755-155003
599 JASNTX010000001.1 GCA030175855_00347 gene open 154997-155932
600 JASNTX010000001.1 GCA030175855_00348 gene open 155951-156382
601 JASNTX010000001.1 GCA030175855_00349 gene open 156437-156688
602 JASNTX010000001.1 GCA030175855_00350 gene open 157327-157611
603 JASNTX010000001.1 GCA030175855_00351 gene open 157755-157916
604 JASNTX010000001.1 GCA030175855_00352 gene open 157907-158467
605 JASNTX010000001.1 GCA030175855_00353 gene open 158697-160349
606 JASNTX010000001.1 GCA030175855_00354 gene open 160526-160807
607 JASNTX010000001.1 GCA030175855_00355 gene open 160944-161564
608 JASNTX010000001.1 GCA030175855_00356 gene open 161602-162774
609 JASNTX010000001.1 GCA030175855_00357 gene open 162792-163499
610 JASNTX010000001.1 GCA030175855_00358 gene open 163586-164518
611 JASNTX010000001.1 GCA030175855_00359 gene open 164522-165253
612 JASNTX010000001.1 GCA030175855_00360 gene open 165347-165583
613 JASNTX010000001.1 GCA030175855_00361 gene open 165567-165830
614 JASNTX010000001.1 GCA030175855_00362 gene open 165873-166811
615 JASNTX010000001.1 GCA030175855_00363 gene open 167053-168447
616 JASNTX010000001.1 GCA030175855_00364 gene open 168475-169530
617 JASNTX010000001.1 GCA030175855_00365 gene open 169610-169861
618 JASNTX010000001.1 GCA030175855_00366 gene open 169858-170118
619 JASNTX010000001.1 GCA030175855_00367 gene open 170115-172151
620 JASNTX010000001.1 GCA030175855_00368 gene open 172402-173946
621 JASNTX010000001.1 GCA030175855_00369 gene open 173943-174743
622 JASNTX010000001.1 GCA030175855_00370 gene open 174801-175805 gluQRS
623 JASNTX010000001.1 GCA030175855_00371 gene open 175768-177018 tgt
624 JASNTX010000001.1 GCA030175855_00372 gene open 177081-179651
625 JASNTX010000001.1 GCA030175855_00374 gene open 180253-180477
626 JASNTX010000001.1 GCA030175855_00375 gene open 180535-181119
627 JASNTX010000001.1 GCA030175855_00376 gene open 181132-181626
628 JASNTX010000001.1 GCA030175855_00377 gene open 181693-182694
629 JASNTX010000001.1 GCA030175855_00378 gene open 182716-184902
630 JASNTX010000001.1 GCA030175855_00379 gene open 184941-186236
631 JASNTX010000001.1 GCA030175855_00380 gene open 186397-187713
632 JASNTX010000001.1 GCA030175855_00381 gene open 187739-188689
633 JASNTX010000001.1 GCA030175855_00382 gene open 188843-190042
634 JASNTX010000001.1 GCA030175855_00383 gene open 190302-190502
635 JASNTX010000001.1 GCA030175855_00384 gene open 190544-191368
636 JASNTX010000001.1 GCA030175855_00385 gene open 191507-192823
637 JASNTX010000001.1 GCA030175855_00386 gene open 193011-193502
638 JASNTX010000001.1 GCA030175855_00387 gene open 193901-194539
639 JASNTX010000001.1 GCA030175855_00388 gene open 194539-195363
640 JASNTX010000001.1 GCA030175855_00389 gene open 195360-195701
641 JASNTX010000001.1 GCA030175855_00390 gene open 195947-198796
642 JASNTX010000001.1 GCA030175855_00391 gene open 199358-199750
643 JASNTX010000001.1 GCA030175855_00392 gene open 200739-201659
644 JASNTX010000001.1 GCA030175855_00393 gene open 201656-201973
645 JASNTX010000001.1 GCA030175855_00394 gene open 202137-202427
646 JASNTX010000001.1 GCA030175855_00395 gene open 202592-202918 hicB
647 JASNTX010000001.1 GCA030175855_00396 gene open 203170-203790
648 JASNTX010000001.1 GCA030175855_00397 gene open 204300-204749
649 JASNTX010000001.1 GCA030175855_00398 gene open 205139-205840
650 JASNTX010000001.1 GCA030175855_00399 gene open 205937-206134
651 JASNTX010000001.1 GCA030175855_00400 gene open 206162-206458
652 JASNTX010000001.1 GCA030175855_00401 gene open 206771-210025
653 JASNTX010000001.1 GCA030175855_00402 gene open 210363-212237 selB
654 JASNTX010000001.1 GCA030175855_00403 gene open 212238-213671 selA
655 JASNTX010000001.1 GCA030175855_00405 gene open 213886-214983 selD
656 JASNTX010000001.1 GCA030175855_00406 gene open 215056-216174
657 JASNTX010000001.1 GCA030175855_00407 gene open 216171-217298
658 JASNTX010000001.1 GCA030175855_00408 gene open 217305-219896
659 JASNTX010000001.1 GCA030175855_00409 gene open 220005-220646
660 JASNTX010000001.1 GCA030175855_00410 gene open 220878-222392
661 JASNTX010000001.1 GCA030175855_00411 gene open 222801-223373
662 JASNTX010000001.1 GCA030175855_00412 gene open 223395-223862
663 JASNTX010000001.1 GCA030175855_00413 gene open 223927-224703
664 JASNTX010000001.1 GCA030175855_00414 gene open 224814-225500
665 JASNTX010000001.1 GCA030175855_00415 gene open 225572-226252 ubiG
666 JASNTX010000001.1 GCA030175855_00416 gene open 226296-228365
667 JASNTX010000001.1 GCA030175855_00417 gene open 228394-228852 cynS
668 JASNTX010000001.1 GCA030175855_00418 gene open 228897-229655
669 JASNTX010000001.1 GCA030175855_00419 gene open 229652-230617
670 JASNTX010000001.1 GCA030175855_00420 gene open 230607-231521
671 JASNTX010000001.1 GCA030175855_00421 gene open 231558-232559
672 JASNTX010000001.1 GCA030175855_00423 gene open 233090-234673
673 JASNTX010000001.1 GCA030175855_00424 gene open 234740-236104 mgtE
674 JASNTX010000001.1 GCA030175855_00425 gene open 236251-236991
675 JASNTX010000001.1 GCA030175855_00426 gene open 237021-238373
676 JASNTX010000001.1 GCA030175855_00428 gene open 238638-239678 hisC
677 JASNTX010000001.1 GCA030175855_00429 gene open 239678-240097
678 JASNTX010000001.1 GCA030175855_00431 gene open 240783-241823
679 JASNTX010000001.1 GCA030175855_00432 gene open 242146-243381
680 JASNTX010000001.1 GCA030175855_00433 gene open 243562-244455
681 JASNTX010000001.1 GCA030175855_00434 gene open 244501-245286
682 JASNTX010000001.1 GCA030175855_00435 gene open 245363-246307
683 JASNTX010000001.1 GCA030175855_00436 gene open 246383-246910
684 JASNTX010000001.1 GCA030175855_00437 gene open 246984-247451
685 JASNTX010000001.1 GCA030175855_00438 gene open 247520-248407
686 JASNTX010000001.1 GCA030175855_00439 gene open 248453-248701
687 JASNTX010000001.1 GCA030175855_00440 gene open 248710-250125
688 JASNTX010000001.1 GCA030175855_00441 gene open 250193-250954
689 JASNTX010000001.1 GCA030175855_00442 gene open 250984-252897
690 JASNTX010000001.1 GCA030175855_00443 gene open 252985-256320
691 JASNTX010000001.1 GCA030175855_00444 gene open 256324-258360
692 JASNTX010000001.1 GCA030175855_00445 gene open 258385-259317
693 JASNTX010000001.1 GCA030175855_00446 gene open 259394-259810
694 JASNTX010000001.1 GCA030175855_00447 gene open 259811-260503
695 JASNTX010000001.1 GCA030175855_00448 gene open 260520-261851
696 JASNTX010000001.1 GCA030175855_00449 gene open 261864-262766
697 JASNTX010000001.1 GCA030175855_00450 gene open 262766-263632
698 JASNTX010000001.1 GCA030175855_00451 gene open 263815-264429
699 JASNTX010000001.1 GCA030175855_00452 gene open 264499-266520
700 JASNTX010000001.1 GCA030175855_00453 gene open 266549-267286
701 JASNTX010000001.1 GCA030175855_00454 gene open 267289-268143 prsW
702 JASNTX010000001.1 GCA030175855_00455 gene open 268144-269817
703 JASNTX010000001.1 GCA030175855_00456 gene open 269824-270585
704 JASNTX010000001.1 GCA030175855_00457 gene open 270643-271584
705 JASNTX010000001.1 GCA030175855_00458 gene open 271724-271897
706 JASNTX010000001.1 GCA030175855_00459 gene open 272034-274193
707 JASNTX010000001.1 GCA030175855_00460 gene open 274413-276215 betA
708 JASNTX010000001.1 GCA030175855_00461 gene open 276232-277839
709 JASNTX010000001.1 GCA030175855_00462 gene open 278015-279028
710 JASNTX010000001.1 GCA030175855_00463 gene open 279227-280882
711 JASNTX010000001.1 GCA030175855_00464 gene open 280901-281221
712 JASNTX010000001.1 GCA030175855_00465 gene open 281236-282477 galT
713 JASNTX010000001.1 GCA030175855_00466 gene open 282470-283771 galK
714 JASNTX010000001.1 GCA030175855_00467 gene open 283834-285180
715 JASNTX010000001.1 GCA030175855_00468 gene open 285375-285776 panD
716 JASNTX010000001.1 GCA030175855_00469 gene open 285824-287149 dcuA
717 JASNTX010000001.1 GCA030175855_00470 gene open 287713-289359
718 JASNTX010000001.1 GCA030175855_00471 gene open 289384-290547
719 JASNTX010000001.1 GCA030175855_00472 gene open 290696-291361
720 JASNTX010000001.1 GCA030175855_00473 gene open 291489-292850
721 JASNTX010000001.1 GCA030175855_00474 gene open 293086-293916
722 JASNTX010000001.1 GCA030175855_00475 gene open 293916-294236
723 JASNTX010000001.1 GCA030175855_00476 gene open 294286-295005
724 JASNTX010000001.1 GCA030175855_00477 gene open 295047-296129
725 JASNTX010000001.1 GCA030175855_00478 gene open 296258-296464
726 JASNTX010000001.1 GCA030175855_00479 gene open 296542-296844
727 JASNTX010000001.1 GCA030175855_00480 gene open 297094-297576
728 JASNTX010000001.1 GCA030175855_00481 gene open 297569-297925
729 JASNTX010000001.1 GCA030175855_00482 gene open 297956-298990
730 JASNTX010000001.1 GCA030175855_00483 gene open 298990-299667
731 JASNTX010000001.1 GCA030175855_00484 gene open 299700-300161
732 JASNTX010000001.1 GCA030175855_00485 gene open 300414-301097
733 JASNTX010000001.1 GCA030175855_00486 gene open 301260-302996
734 JASNTX010000001.1 GCA030175855_00487 gene open 303107-304444
735 JASNTX010000001.1 GCA030175855_00488 gene open 304377-305063
736 JASNTX010000001.1 GCA030175855_00489 gene open 305103-305768
737 JASNTX010000001.1 GCA030175855_00490 gene open 305831-308047
738 JASNTX010000001.1 GCA030175855_00491 gene open 308210-308524
739 JASNTX010000001.1 GCA030175855_00492 gene open 308638-309495
740 JASNTX010000001.1 GCA030175855_00493 gene open 309492-310577
741 JASNTX010000001.1 GCA030175855_00494 gene open 310531-311658
742 JASNTX010000001.1 GCA030175855_00495 gene open 311734-313692 htaA
743 JASNTX010000001.1 GCA030175855_00496 gene open 313803-314387
744 JASNTX010000001.1 GCA030175855_00497 gene open 314499-317240 htaA
745 JASNTX010000001.1 GCA030175855_00498 gene open 317370-318362 htaA
746 JASNTX010000001.1 GCA030175855_00499 gene open 318818-321130 htaA
747 JASNTX010000001.1 GCA030175855_00500 gene open 321320-322324 nrdF
748 JASNTX010000001.1 GCA030175855_00501 gene open 322328-322786 nrdI
749 JASNTX010000001.1 GCA030175855_00502 gene open 323480-324700
750 JASNTX010000001.1 GCA030175855_00503 gene open 324736-325740
751 JASNTX010000001.1 GCA030175855_00504 gene open 325789-326094
752 JASNTX010000001.1 GCA030175855_00505 gene open 326125-327105 bioB
753 JASNTX010000001.1 GCA030175855_00506 gene open 327304-328005
754 JASNTX010000001.1 GCA030175855_00507 gene open 328042-329382
755 JASNTX010000001.1 GCA030175855_00508 gene open 329390-330436
756 JASNTX010000001.1 GCA030175855_00509 gene open 330439-331530
757 JASNTX010000001.1 GCA030175855_00510 gene open 331532-332215
758 JASNTX010000001.1 GCA030175855_00512 gene open 332839-333744
759 JASNTX010000001.1 GCA030175855_00513 gene open 333774-334241
760 JASNTX010000001.1 GCA030175855_00514 gene open 334242-335831
761 JASNTX010000001.1 GCA030175855_00515 gene open 335832-337340 ftsW
762 JASNTX010000001.1 GCA030175855_00516 gene open 337337-338764
763 JASNTX010000001.1 GCA030175855_00517 gene open 338768-340624
764 JASNTX010000001.1 GCA030175855_00518 gene open 340627-342690 pknB
765 JASNTX010000001.1 GCA030175855_00519 gene open 342806-343078 crgA
766 JASNTX010000001.1 GCA030175855_00520 gene open 343097-343801
767 JASNTX010000001.1 GCA030175855_00521 gene open 343805-344620
768 JASNTX010000001.1 GCA030175855_00522 gene open 344623-345024
769 JASNTX010000001.1 GCA030175855_00523 gene open 345212-345595
770 JASNTX010000001.1 GCA030175855_00524 gene open 345674-346198
771 JASNTX010000001.1 GCA030175855_00525 gene open 346198-347379
772 JASNTX010000001.1 GCA030175855_00526 gene open 348135-349844
773 JASNTX010000001.1 GCA030175855_00527 gene open 349918-352215 metE
774 JASNTX010000001.1 GCA030175855_00528 gene open 352343-353326
775 JASNTX010000001.1 GCA030175855_00529 gene open 353436-353597
776 JASNTX010000001.1 GCA030175855_00530 gene open 353659-354630
777 JASNTX010000001.1 GCA030175855_00531 gene open 354906-355118
778 JASNTX010000001.1 GCA030175855_00532 gene open 355128-356270
779 JASNTX010000001.1 GCA030175855_00533 gene open 356306-357532
780 JASNTX010000001.1 GCA030175855_00534 gene open 358508-358867 arsR
781 JASNTX010000001.1 GCA030175855_00535 gene open 358868-359464 cadD
782 JASNTX010000001.1 GCA030175855_00536 gene open 359324-359764
783 JASNTX010000001.1 GCA030175855_00537 gene open 359907-360053
784 JASNTX010000001.1 GCA030175855_00538 gene open 360561-360779
785 JASNTX010000001.1 GCA030175855_00541 gene open 361193-361543
786 JASNTX010000001.1 GCA030175855_00542 gene open 361548-364148 gyrA
787 JASNTX010000001.1 GCA030175855_00543 gene open 364210-365100 pdxS
788 JASNTX010000001.1 GCA030175855_00544 gene open 365191-367218 gyrB
789 JASNTX010000001.1 GCA030175855_00545 gene open 367352-368047 dciA
790 JASNTX010000001.1 GCA030175855_00546 gene open 368044-369378 recF
791 JASNTX010000001.1 GCA030175855_00547 gene open 369378-370565 dnaN
792 JASNTX010000001.1 GCA030175855_00548 gene open 371273-373021 dnaA
793 JASNTX010000001.1 GCA030175855_00549 gene open 373297-373623
794 JASNTX010000001.1 GCA030175855_00550 gene open 373883-374026 rpmH
795 JASNTX010000001.1 GCA030175855_00551 gene open 374114-374455 rnpA
796 JASNTX010000001.1 GCA030175855_00552 gene open 374400-374768 yidD
797 JASNTX010000001.1 GCA030175855_00553 gene open 374788-375795 yidC
798 JASNTX010000001.1 GCA030175855_00554 gene open 375795-376397 rsmG
799 JASNTX010000001.1 GCA030175855_00555 gene open 376408-377346
800 JASNTX010000001.1 GCA030175855_00556 gene open 377363-378589
801 JASNTX010000001.1 GCA030175855_00557 gene open 378810-379994
802 JASNTX010000001.1 GCA030175855_00558 gene open 380144-380467 trxA
803 JASNTX010000001.1 GCA030175855_00559 gene open 380744-381667 trxB
804 JASNTX010000001.1 GCA030175855_00560 gene open 381795-382406
805 JASNTX010000001.1 GCA030175855_00561 gene open 382499-386191 mviN
806 JASNTX010000001.1 GCA030175855_00562 gene open 386207-388558
807 JASNTX010000001.1 GCA030175855_00563 gene open 388555-389376
808 JASNTX010000001.1 GCA030175855_00564 gene open 389405-390865
809 JASNTX010000001.1 GCA030175855_00565 gene open 390922-391176
810 JASNTX010000001.1 GCA030175855_00566 gene open 391209-391544
811 JASNTX010000001.1 GCA030175855_00567 gene open 391572-391943
812 JASNTX010000001.1 GCA030175855_00568 gene open 392055-392519
813 JASNTX010000001.1 GCA030175855_00569 gene open 392613-393893
814 JASNTX010000001.1 GCA030175855_00570 gene open 394050-394880 trpA
815 JASNTX010000001.1 GCA030175855_00571 gene open 394883-396151 trpB
816 JASNTX010000001.1 GCA030175855_00572 gene open 396160-397677 trpF
817 JASNTX010000001.1 GCA030175855_00573 gene open 397667-398749
818 JASNTX010000001.1 GCA030175855_00574 gene open 398749-399402
819 JASNTX010000001.1 GCA030175855_00575 gene open 399402-401009
820 JASNTX010000001.1 GCA030175855_00576 gene open 401119-402324 hutI
821 JASNTX010000001.1 GCA030175855_00577 gene open 402548-404134 hutH
822 JASNTX010000001.1 GCA030175855_00578 gene open 404357-405379 hutG
823 JASNTX010000001.1 GCA030175855_00579 gene open 405437-406804
824 JASNTX010000001.1 GCA030175855_00580 gene open 406835-408280
825 JASNTX010000001.1 GCA030175855_00581 gene open 408380-409303
826 JASNTX010000001.1 GCA030175855_00582 gene open 409303-410985
827 JASNTX010000001.1 GCA030175855_00583 gene open 411509-414451
828 JASNTX010000001.1 GCA030175855_00584 gene open 414613-417270
829 JASNTX010000001.1 GCA030175855_00585 gene open 417277-419193
830 JASNTX010000001.1 GCA030175855_00586 gene open 419225-420820
831 JASNTX010000001.1 GCA030175855_00587 gene open 420836-421747
832 JASNTX010000001.1 GCA030175855_00588 gene open 421750-422484
833 JASNTX010000001.1 GCA030175855_00589 gene open 422513-423367
834 JASNTX010000001.1 GCA030175855_00590 gene open 423457-424938
835 JASNTX010000001.1 GCA030175855_00591 gene open 425079-425330
836 JASNTX010000001.1 GCA030175855_00592 gene open 425311-426078
837 JASNTX010000001.1 GCA030175855_00593 gene open 426115-426594
838 JASNTX010000001.1 GCA030175855_00594 gene open 426824-428149
839 JASNTX010000001.1 GCA030175855_00595 gene open 428187-431921
840 JASNTX010000001.1 GCA030175855_00596 gene open 431921-433513 narH
841 JASNTX010000001.1 GCA030175855_00597 gene open 433550-434383 narJ
842 JASNTX010000001.1 GCA030175855_00598 gene open 434425-435204 narI
843 JASNTX010000001.1 GCA030175855_00599 gene open 435768-436343 eamA
844 JASNTX010000001.1 GCA030175855_00600 gene open 436629-436976
845 JASNTX010000001.1 GCA030175855_00601 gene open 436833-437222 fluC
846 JASNTX010000001.1 GCA030175855_00602 gene open 437219-437665
847 JASNTX010000001.1 GCA030175855_00603 gene open 437735-438376
848 JASNTX010000001.1 GCA030175855_00604 gene open 438459-438680
849 JASNTX010000001.1 GCA030175855_00605 gene open 439066-440076
850 JASNTX010000001.1 GCA030175855_00606 gene open 440076-443099
851 JASNTX010000001.1 GCA030175855_00607 gene open 443643-444782
852 JASNTX010000001.1 GCA030175855_00608 gene open 444782-445456
853 JASNTX010000001.1 GCA030175855_00609 gene open 445579-446325
854 JASNTX010000001.1 GCA030175855_00610 gene open 446329-447075
855 JASNTX010000001.1 GCA030175855_00611 gene open 447065-447961
856 JASNTX010000001.1 GCA030175855_00612 gene open 447975-448208
857 JASNTX010000001.1 GCA030175855_00613 gene open 448619-448864
858 JASNTX010000001.1 GCA030175855_00614 gene open 449172-450203
859 JASNTX010000001.1 GCA030175855_00615 gene open 450415-450645 sdpI
860 JASNTX010000001.1 GCA030175855_00616 gene open 450735-450839
861 JASNTX010000001.1 GCA030175855_00617 gene open 450970-452409
862 JASNTX010000001.1 GCA030175855_00618 gene open 452406-453728 recG
863 JASNTX010000001.1 GCA030175855_00619 gene open 453969-455726
864 JASNTX010000001.1 GCA030175855_00620 gene open 455788-458655 leuS
865 JASNTX010000001.1 GCA030175855_00621 gene open 458694-459689
866 JASNTX010000001.1 GCA030175855_00622 gene open 459894-461180 phoU
867 JASNTX010000001.1 GCA030175855_00623 gene open 461245-461706
868 JASNTX010000001.1 GCA030175855_00624 gene open 461731-463197
869 JASNTX010000001.1 GCA030175855_00625 gene open 463252-463617 doxX
870 JASNTX010000001.1 GCA030175855_00626 gene open 464636-467611
871 JASNTX010000001.1 GCA030175855_00627 gene open 467691-469292
872 JASNTX010000001.1 GCA030175855_00628 gene open 469421-469624
873 JASNTX010000001.1 GCA030175855_00629 gene open 470070-470561
874 JASNTX010000001.1 GCA030175855_00630 gene open 470663-470788
875 JASNTX010000001.1 GCA030175855_00631 gene open 471386-471739
876 JASNTX010000001.1 GCA030175855_00632 gene open 471961-473385
877 JASNTX010000001.1 GCA030175855_00633 gene open 474019-474420
878 JASNTX010000001.1 GCA030175855_00634 gene open 474417-474809
879 JASNTX010000001.1 GCA030175855_00635 gene open 474870-475172
880 JASNTX010000001.1 GCA030175855_00636 gene open 475483-475668
881 JASNTX010000001.1 GCA030175855_00637 gene open 475802-476479
882 JASNTX010000001.1 GCA030175855_00638 gene open 476570-478291
883 JASNTX010000001.1 GCA030175855_00639 gene open 478562-479239
884 JASNTX010000001.1 GCA030175855_00640 gene open 479232-480554
885 JASNTX010000001.1 GCA030175855_00641 gene open 480665-482092
886 JASNTX010000001.1 GCA030175855_00642 gene open 482273-483808
887 JASNTX010000001.1 GCA030175855_00643 gene open 483810-484751
888 JASNTX010000001.1 GCA030175855_00644 gene open 484748-485578
889 JASNTX010000001.1 GCA030175855_00645 gene open 485568-486962 ccmA
890 JASNTX010000001.1 GCA030175855_00646 gene open 487019-487636
891 JASNTX010000001.1 GCA030175855_00647 gene open 487652-488926
892 JASNTX010000001.1 GCA030175855_00648 gene open 489067-490242
893 JASNTX010000001.1 GCA030175855_00649 gene open 490242-490952
894 JASNTX010000001.1 GCA030175855_00650 gene open 491006-492361 trkH
895 JASNTX010000001.1 GCA030175855_00651 gene open 492354-493013
896 JASNTX010000001.1 GCA030175855_00652 gene open 493266-493532
897 JASNTX010000001.1 GCA030175855_00653 gene open 493533-493838
898 JASNTX010000001.1 GCA030175855_00654 gene open 494004-494180
899 JASNTX010000001.1 GCA030175855_00655 gene open 494190-494456
900 JASNTX010000001.1 GCA030175855_00656 gene open 495047-495991
901 JASNTX010000001.1 GCA030175855_00657 gene open 496595-496768
902 JASNTX010000001.1 GCA030175855_00658 gene open 496729-497172
903 JASNTX010000001.1 GCA030175855_00659 gene open 497918-498697
904 JASNTX010000001.1 GCA030175855_00660 gene open 499181-499372
905 JASNTX010000001.1 GCA030175855_00661 gene open 499373-499612
906 JASNTX010000001.1 GCA030175855_00662 gene open 499727-500107
907 JASNTX010000001.1 GCA030175855_00663 gene open 500179-502026
908 JASNTX010000001.1 GCA030175855_00664 gene open 502083-502916
909 JASNTX010000001.1 GCA030175855_00665 gene open 503034-504527
910 JASNTX010000001.1 GCA030175855_00666 gene open 504605-505588
911 JASNTX010000001.1 GCA030175855_00667 gene open 505663-506130
912 JASNTX010000001.1 GCA030175855_00668 gene open 506174-507166 uspA
913 JASNTX010000001.1 GCA030175855_00669 gene open 507186-507641
914 JASNTX010000001.1 GCA030175855_00670 gene open 507652-508740
915 JASNTX010000001.1 GCA030175855_00671 gene open 508934-511222
916 JASNTX010000001.1 GCA030175855_00672 gene open 511222-512748
917 JASNTX010000001.1 GCA030175855_00673 gene open 512745-512936
918 JASNTX010000001.1 GCA030175855_00674 gene open 513167-513454 rpsF
919 JASNTX010000001.1 GCA030175855_00675 gene open 513516-514091
920 JASNTX010000001.1 GCA030175855_00676 gene open 514180-514641 rplI
921 JASNTX010000001.1 GCA030175855_00677 gene open 515218-516765 dnaB
922 JASNTX010000001.1 GCA030175855_00678 gene open 516949-517326 trxA
923 JASNTX010000001.1 GCA030175855_00679 gene open 517576-518844 sucC
924 JASNTX010000001.1 GCA030175855_00680 gene open 518863-519750 sucD
925 JASNTX010000001.1 GCA030175855_00681 gene open 519989-520807
926 JASNTX010000001.1 GCA030175855_00682 gene open 520994-522529
927 JASNTX010000001.1 GCA030175855_00211 gene open 2764-2836 trnT
928 JASNTX010000001.1 GCA030175855_00342 gene open 152058-152146 trnS
929 JASNTX010000001.1 GCA030175855_00373 gene open 179731-179821 trnS
930 JASNTX010000001.1 GCA030175855_00404 gene open 213725-213820 trnU
931 JASNTX010000001.1 GCA030175855_00422 gene open 232835-232907 trnR
932 JASNTX010000001.1 GCA030175855_00427 gene open 238469-238557 trnS
933 JASNTX010000001.1 GCA030175855_00430 gene open 240668-240755 trnS
934 JASNTX010000001.1 GCA030175855_00511 gene open 332449-332533 trnL
935 JASNTX010000001.1 GCA030175855_00539 gene open 360954-361026 trnA
936 JASNTX010000001.1 GCA030175855_00540 gene open 361040-361113 trnI
937 JASNTX010000001.1 GCA030175855_00211 tRNA open 2764-2836 trnT tRNA-Thr(tgt)
938 JASNTX010000001.1 GCA030175855_00342 tRNA open 152058-152146 trnS tRNA-Ser(gga)
939 JASNTX010000001.1 GCA030175855_00373 tRNA open 179731-179821 trnS tRNA-Ser(cga)
940 JASNTX010000001.1 GCA030175855_00404 tRNA open 213725-213820 trnU tRNA-SeC(tca)
941 JASNTX010000001.1 GCA030175855_00422 tRNA open 232835-232907 trnR tRNA-Arg(acg)
942 JASNTX010000001.1 GCA030175855_00427 tRNA open 238469-238557 trnS tRNA-Ser(gct)
943 JASNTX010000001.1 GCA030175855_00430 tRNA open 240668-240755 trnS tRNA-Ser(tga)
944 JASNTX010000001.1 GCA030175855_00511 tRNA open 332449-332533 trnL tRNA-Leu(cag)
945 JASNTX010000001.1 GCA030175855_00539 tRNA open 360954-361026 trnA tRNA-Ala(tgc)
946 JASNTX010000001.1 GCA030175855_00540 tRNA open 361040-361113 trnI tRNA-Ile(gat)
947 JASNTX010000002.1 GCA030175855_00691 gene open 6363-6459 Bacteria_small_SRP
948 JASNTX010000002.1 GCA030175855_00691 ncRNA open 6363-6459 Bacterial small signal recognition particle RNA
949 JASNTX010000002.1 repeat_region open 95887-96125 CRISPR array with 4 repeats of length 36%2C consensus sequence GCTGGGGTTCAGTTCTCATTACCCCTGATATACTTC and spacer length 28
950 JASNTX010000002.1 GCA030175855_00685 CDS open 134-322 _na     62_aa Ion transport domain-containing protein
951 JASNTX010000002.1 GCA030175855_00686 CDS open 390-1550 _na     386_aa Glycosyl transferase family 1 domain-containing protein
952 JASNTX010000002.1 GCA030175855_00687 CDS open 1645-2559 _na     304_aa FAD-binding FR-type domain-containing protein
953 JASNTX010000002.1 GCA030175855_00688 CDS open 2634-3026 _na     130_aa crcB Fluoride ion transporter CrcB
954 JASNTX010000002.1 GCA030175855_00689 CDS open 3149-4720 _na     523_aa HTH deoR-type domain-containing protein
955 JASNTX010000002.1 GCA030175855_00690 CDS open 4858-6231 _na     457_aa YibE/F family protein
956 JASNTX010000002.1 GCA030175855_00692 CDS open 6576-7391 _na     271_aa hypothetical protein
957 JASNTX010000002.1 GCA030175855_00693 CDS open 7415-7609 _na     64_aa hypothetical protein
958 JASNTX010000002.1 GCA030175855_00694 CDS open 7741-8949 _na     402_aa nitric oxide dioxygenase
959 JASNTX010000002.1 GCA030175855_00695 CDS open 8969-9454 _na     161_aa Rrf2 family transcriptional regulator
960 JASNTX010000002.1 GCA030175855_00696 CDS open 9695-9835 _na     46_aa hypothetical protein
961 JASNTX010000002.1 GCA030175855_00697 CDS open 9959-10330 _na     123_aa Transposase IS110-like N-terminal domain-containing protein
962 JASNTX010000002.1 GCA030175855_00698 CDS open 10348-10605 _na     85_aa hypothetical protein
963 JASNTX010000002.1 GCA030175855_00699 CDS open 10656-10853 _na     65_aa transposase
964 JASNTX010000002.1 GCA030175855_00700 CDS open 10905-11099 _na     64_aa DUF6968 domain-containing protein
965 JASNTX010000002.1 GCA030175855_00701 CDS open 12003-13193 _na     396_aa SsuA/THI5-like domain-containing protein
966 JASNTX010000002.1 GCA030175855_00702 CDS open 13203-14096 _na     297_aa ABC transporter permease
967 JASNTX010000002.1 GCA030175855_00703 CDS open 14089-14913 _na     274_aa ABC transporter domain-containing protein
968 JASNTX010000002.1 GCA030175855_00704 CDS open 15065-16333 _na     422_aa Aminotransferase class I/classII domain-containing protein
969 JASNTX010000002.1 GCA030175855_00705 CDS open 16281-16892 _na     203_aa Suppressor of fused-like domain-containing protein
970 JASNTX010000002.1 GCA030175855_00706 CDS open 16962-19763 _na     933_aa DNA polymerase III subunit gamma and tau
971 JASNTX010000002.1 GCA030175855_00707 CDS open 19890-20228 _na     112_aa YbaB/EbfC family nucleoid-associated protein
972 JASNTX010000002.1 GCA030175855_00708 CDS open 20229-20888 _na     219_aa recR recombination mediator RecR
973 JASNTX010000002.1 GCA030175855_00709 CDS open 20949-21866 _na     305_aa FAD-binding FR-type domain-containing protein
974 JASNTX010000002.1 GCA030175855_00710 CDS open 21914-22750 _na     278_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
975 JASNTX010000002.1 GCA030175855_00711 CDS open 22766-23995 _na     409_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
976 JASNTX010000002.1 GCA030175855_00712 CDS open 24036-24272 _na     78_aa hypothetical protein
977 JASNTX010000002.1 GCA030175855_00713 CDS open 24293-25747 _na     484_aa DNA polymerase III subunit epsilon
978 JASNTX010000002.1 GCA030175855_00714 CDS open 25864-27687 _na     607_aa leuA 2-isopropylmalate synthase
979 JASNTX010000002.1 GCA030175855_00715 CDS open 28022-29287 _na     421_aa aspartate kinase
980 JASNTX010000002.1 GCA030175855_00716 CDS open 29332-30369 _na     345_aa aspartate-semialdehyde dehydrogenase
981 JASNTX010000002.1 GCA030175855_00717 CDS open 30476-31783 _na     435_aa ykvI Membrane protein YkvI
982 JASNTX010000002.1 GCA030175855_00718 CDS open 31872-32420 _na     182_aa RNA polymerase sigma factor
983 JASNTX010000002.1 GCA030175855_00719 CDS open 32572-34119 _na     515_aa Catalase core domain-containing protein
984 JASNTX010000002.1 GCA030175855_00720 CDS open 34339-35871 _na     510_aa X-X-X-Leu-X-X-Gly heptad repeats protein
985 JASNTX010000002.1 GCA030175855_00721 CDS open 35959-36249 _na     96_aa Peptidase M23
986 JASNTX010000002.1 GCA030175855_00722 CDS open 36474-37889 _na     471_aa Collagen-like protein
987 JASNTX010000002.1 GCA030175855_00724 CDS open 38319-39221 _na     300_aa Calcineurin-like phosphoesterase domain-containing protein
988 JASNTX010000002.1 GCA030175855_00725 CDS open 39346-39837 _na     163_aa GatB/YqeY domain-containing protein
989 JASNTX010000002.1 GCA030175855_00726 CDS open 39834-42227 _na     797_aa peptidoglycan glycosyltransferase
990 JASNTX010000002.1 GCA030175855_00727 CDS open 42399-42752 _na     117_aa whiB Transcriptional regulator WhiB
991 JASNTX010000002.1 GCA030175855_00728 CDS open 42836-42991 _na     51_aa DUF4177 domain-containing protein
992 JASNTX010000002.1 GCA030175855_00729 CDS open 42993-43463 _na     156_aa Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein
993 JASNTX010000002.1 GCA030175855_00730 CDS open 43541-44368 _na     275_aa Metallo-beta-lactamase domain-containing protein
994 JASNTX010000002.1 GCA030175855_00731 CDS open 44549-45232 _na     227_aa Transcriptional regulator%2C Crp family protein
995 JASNTX010000002.1 GCA030175855_00732 CDS open 45591-46274 _na     227_aa Thioredoxin domain-containing protein
996 JASNTX010000002.1 GCA030175855_00733 CDS open 46274-47023 _na     249_aa Nudix hydrolase domain-containing protein
997 JASNTX010000002.1 GCA030175855_00734 CDS open 47059-48255 _na     398_aa marP MarP family serine protease
998 JASNTX010000002.1 GCA030175855_00735 CDS open 48294-49259 _na     321_aa AB hydrolase-1 domain-containing protein
999 JASNTX010000002.1 GCA030175855_00736 CDS open 49320-49823 _na     167_aa Phage holin family protein
1000 JASNTX010000002.1 GCA030175855_00737 CDS open 49820-50803 _na     327_aa HAD family hydrolase