BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176295.1)
Select a Genome:
|
BAKTA Annotations for GCA_030176295.1
|
Search & Sort all 4131 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | JASNUB010000001.1 | GCA030176295_00579 | gene | open | 146500-147399 | lysR | ||
| 502 | JASNUB010000001.1 | GCA030176295_00580 | gene | open | 147543-148070 | |||
| 503 | JASNUB010000001.1 | GCA030176295_00581 | gene | open | 148103-148966 | |||
| 504 | JASNUB010000001.1 | GCA030176295_00582 | gene | open | 148960-149586 | |||
| 505 | JASNUB010000001.1 | GCA030176295_00583 | gene | open | 149580-150353 | |||
| 506 | JASNUB010000001.1 | GCA030176295_00584 | gene | open | 150434-151717 | |||
| 507 | JASNUB010000001.1 | GCA030176295_00585 | gene | open | 151911-152582 | |||
| 508 | JASNUB010000001.1 | GCA030176295_00586 | gene | open | 152602-153741 | |||
| 509 | JASNUB010000001.1 | GCA030176295_00587 | gene | open | 154119-154703 | |||
| 510 | JASNUB010000001.1 | GCA030176295_00588 | gene | open | 154708-156699 | |||
| 511 | JASNUB010000001.1 | GCA030176295_00589 | gene | open | 156719-157327 | |||
| 512 | JASNUB010000001.1 | GCA030176295_00590 | gene | open | 158596-158904 | yjdM | ||
| 513 | JASNUB010000001.1 | GCA030176295_00591 | gene | open | 159187-160590 | |||
| 514 | JASNUB010000001.1 | GCA030176295_00592 | gene | open | 160723-161733 | glpX | ||
| 515 | JASNUB010000001.1 | GCA030176295_00593 | gene | open | 161836-162534 | |||
| 516 | JASNUB010000001.1 | GCA030176295_00594 | gene | open | 162543-162836 | |||
| 517 | JASNUB010000001.1 | GCA030176295_00595 | gene | open | 162929-163747 | |||
| 518 | JASNUB010000001.1 | GCA030176295_00596 | gene | open | 163954-164247 | |||
| 519 | JASNUB010000001.1 | GCA030176295_00597 | gene | open | 164342-165583 | xseA | ||
| 520 | JASNUB010000001.1 | GCA030176295_00598 | gene | open | 165676-166659 | |||
| 521 | JASNUB010000001.1 | GCA030176295_00599 | gene | open | 166676-167473 | |||
| 522 | JASNUB010000001.1 | GCA030176295_00600 | gene | open | 167485-168678 | rmuC | ||
| 523 | JASNUB010000001.1 | GCA030176295_00601 | gene | open | 168711-170219 | |||
| 524 | JASNUB010000001.1 | GCA030176295_00602 | gene | open | 170359-171444 | ychF | ||
| 525 | JASNUB010000001.1 | GCA030176295_00603 | gene | open | 171480-172184 | |||
| 526 | JASNUB010000001.1 | GCA030176295_00604 | gene | open | 172200-172952 | |||
| 527 | JASNUB010000001.1 | GCA030176295_00605 | gene | open | 172949-173677 | |||
| 528 | JASNUB010000001.1 | GCA030176295_00606 | gene | open | 173855-174622 | zupT | ||
| 529 | JASNUB010000001.1 | GCA030176295_00607 | gene | open | 174663-175289 | |||
| 530 | JASNUB010000001.1 | GCA030176295_00608 | gene | open | 175309-176055 | |||
| 531 | JASNUB010000001.1 | GCA030176295_00609 | gene | open | 176503-178407 | typA | ||
| 532 | JASNUB010000001.1 | GCA030176295_00610 | gene | open | 178444-180339 | |||
| 533 | JASNUB010000001.1 | GCA030176295_00611 | gene | open | 180400-181251 | |||
| 534 | JASNUB010000001.1 | GCA030176295_00612 | gene | open | 181236-181613 | |||
| 535 | JASNUB010000001.1 | GCA030176295_00613 | gene | open | 181636-181968 | fdxA | ||
| 536 | JASNUB010000001.1 | GCA030176295_00614 | gene | open | 182054-183148 | dapC | ||
| 537 | JASNUB010000001.1 | GCA030176295_00615 | gene | open | 183148-183747 | |||
| 538 | JASNUB010000001.1 | GCA030176295_00616 | gene | open | 183802-184773 | dapD | ||
| 539 | JASNUB010000001.1 | GCA030176295_00617 | gene | open | 184903-186309 | |||
| 540 | JASNUB010000001.1 | GCA030176295_00618 | gene | open | 186586-187836 | dapE | ||
| 541 | JASNUB010000001.1 | GCA030176295_00619 | gene | open | 187838-188740 | |||
| 542 | JASNUB010000001.1 | GCA030176295_00620 | gene | open | 188733-189557 | folP | ||
| 543 | JASNUB010000001.1 | GCA030176295_00621 | gene | open | 189554-190411 | |||
| 544 | JASNUB010000001.1 | GCA030176295_00622 | gene | open | 190473-190826 | |||
| 545 | JASNUB010000001.1 | GCA030176295_00623 | gene | open | 190840-191721 | |||
| 546 | JASNUB010000001.1 | GCA030176295_00624 | gene | open | 191763-193238 | |||
| 547 | JASNUB010000001.1 | GCA030176295_00625 | gene | open | 193349-193978 | |||
| 548 | JASNUB010000001.1 | GCA030176295_00626 | gene | open | 194298-194924 | sigE | ||
| 549 | JASNUB010000001.1 | GCA030176295_00627 | gene | open | 194929-195369 | |||
| 550 | JASNUB010000001.1 | GCA030176295_00628 | gene | open | 195386-195958 | tatB | ||
| 551 | JASNUB010000001.1 | GCA030176295_00629 | gene | open | 196028-197152 | |||
| 552 | JASNUB010000001.1 | GCA030176295_00630 | gene | open | 197217-197963 | |||
| 553 | JASNUB010000001.1 | GCA030176295_00631 | gene | open | 198298-202086 | |||
| 554 | JASNUB010000001.1 | GCA030176295_00632 | gene | open | 202300-203877 | |||
| 555 | JASNUB010000001.1 | GCA030176295_00633 | gene | open | 203902-204597 | |||
| 556 | JASNUB010000001.1 | GCA030176295_00634 | gene | open | 204659-205186 | |||
| 557 | JASNUB010000001.1 | GCA030176295_00635 | gene | open | 205287-206543 | |||
| 558 | JASNUB010000001.1 | GCA030176295_00636 | gene | open | 206547-206873 | |||
| 559 | JASNUB010000001.1 | GCA030176295_00637 | gene | open | 207009-208952 | deaD | ||
| 560 | JASNUB010000001.1 | GCA030176295_00638 | gene | open | 209111-209584 | |||
| 561 | JASNUB010000001.1 | GCA030176295_00639 | gene | open | 209653-210447 | |||
| 562 | JASNUB010000001.1 | GCA030176295_00640 | gene | open | 210651-212222 | putP | ||
| 563 | JASNUB010000001.1 | GCA030176295_00641 | gene | open | 212596-215700 | |||
| 564 | JASNUB010000001.1 | GCA030176295_00642 | gene | open | 215703-216575 | |||
| 565 | JASNUB010000001.1 | GCA030176295_00643 | gene | open | 216605-217795 | |||
| 566 | JASNUB010000001.1 | GCA030176295_00644 | gene | open | 217795-220701 | |||
| 567 | JASNUB010000001.1 | GCA030176295_00645 | gene | open | 220784-221311 | |||
| 568 | JASNUB010000001.1 | GCA030176295_00647 | gene | open | 221572-223188 | |||
| 569 | JASNUB010000001.1 | GCA030176295_00648 | gene | open | 223368-225020 | argS | ||
| 570 | JASNUB010000001.1 | GCA030176295_00649 | gene | open | 225025-226380 | lysA | ||
| 571 | JASNUB010000001.1 | GCA030176295_00650 | gene | open | 226594-227925 | |||
| 572 | JASNUB010000001.1 | GCA030176295_00651 | gene | open | 227950-228879 | thrB | ||
| 573 | JASNUB010000001.1 | GCA030176295_00652 | gene | open | 229044-231002 | |||
| 574 | JASNUB010000001.1 | GCA030176295_00653 | gene | open | 231026-231847 | modA | ||
| 575 | JASNUB010000001.1 | GCA030176295_00654 | gene | open | 231871-232824 | fdhD | ||
| 576 | JASNUB010000001.1 | GCA030176295_00655 | gene | open | 232835-233200 | |||
| 577 | JASNUB010000001.1 | GCA030176295_00656 | gene | open | 233293-233556 | |||
| 578 | JASNUB010000001.1 | GCA030176295_00657 | gene | open | 233768-235090 | |||
| 579 | JASNUB010000001.1 | GCA030176295_00658 | gene | open | 235270-236811 | |||
| 580 | JASNUB010000001.1 | GCA030176295_00659 | gene | open | 236947-237516 | |||
| 581 | JASNUB010000001.1 | GCA030176295_00660 | gene | open | 237497-237997 | |||
| 582 | JASNUB010000001.1 | GCA030176295_00661 | gene | open | 238055-239209 | |||
| 583 | JASNUB010000001.1 | GCA030176295_00662 | gene | open | 239274-239921 | |||
| 584 | JASNUB010000001.1 | GCA030176295_00663 | gene | open | 239950-240429 | moaC | ||
| 585 | JASNUB010000001.1 | GCA030176295_00664 | gene | open | 240454-241821 | |||
| 586 | JASNUB010000001.1 | GCA030176295_00665 | gene | open | 241837-242955 | moaA | ||
| 587 | JASNUB010000001.1 | GCA030176295_00666 | gene | open | 243016-244833 | |||
| 588 | JASNUB010000001.1 | GCA030176295_00667 | gene | open | 245267-247426 | rho | ||
| 589 | JASNUB010000001.1 | GCA030176295_00668 | gene | open | 247430-248503 | prfA | ||
| 590 | JASNUB010000001.1 | GCA030176295_00669 | gene | open | 248519-249397 | prmC | ||
| 591 | JASNUB010000001.1 | GCA030176295_00670 | gene | open | 249463-250194 | |||
| 592 | JASNUB010000001.1 | GCA030176295_00671 | gene | open | 250194-251369 | |||
| 593 | JASNUB010000001.1 | GCA030176295_00672 | gene | open | 251496-251981 | |||
| 594 | JASNUB010000001.1 | GCA030176295_00673 | gene | open | 252347-253150 | atpB | ||
| 595 | JASNUB010000001.1 | GCA030176295_00674 | gene | open | 253245-253481 | |||
| 596 | JASNUB010000001.1 | GCA030176295_00675 | gene | open | 253527-254096 | |||
| 597 | JASNUB010000001.1 | GCA030176295_00676 | gene | open | 254103-254930 | |||
| 598 | JASNUB010000001.1 | GCA030176295_00677 | gene | open | 255011-256651 | atpA | ||
| 599 | JASNUB010000001.1 | GCA030176295_00678 | gene | open | 256709-257683 | |||
| 600 | JASNUB010000001.1 | GCA030176295_00679 | gene | open | 257687-259138 | atpD | ||
| 601 | JASNUB010000001.1 | GCA030176295_00680 | gene | open | 259155-259526 | |||
| 602 | JASNUB010000001.1 | GCA030176295_00681 | gene | open | 259696-260145 | |||
| 603 | JASNUB010000001.1 | GCA030176295_00682 | gene | open | 260156-260848 | nucS | ||
| 604 | JASNUB010000001.1 | GCA030176295_00683 | gene | open | 261039-261539 | |||
| 605 | JASNUB010000001.1 | GCA030176295_00684 | gene | open | 261661-262680 | |||
| 606 | JASNUB010000001.1 | GCA030176295_00685 | gene | open | 262840-262953 | |||
| 607 | JASNUB010000001.1 | GCA030176295_00686 | gene | open | 262957-263808 | |||
| 608 | JASNUB010000001.1 | GCA030176295_00687 | gene | open | 263825-264706 | |||
| 609 | JASNUB010000001.1 | GCA030176295_00688 | gene | open | 264905-265708 | |||
| 610 | JASNUB010000001.1 | GCA030176295_00689 | gene | open | 265736-266701 | |||
| 611 | JASNUB010000001.1 | GCA030176295_00690 | gene | open | 266775-267896 | |||
| 612 | JASNUB010000001.1 | GCA030176295_00691 | gene | open | 267907-268746 | |||
| 613 | JASNUB010000001.1 | GCA030176295_00692 | gene | open | 268867-269940 | mnmA | ||
| 614 | JASNUB010000001.1 | GCA030176295_00693 | gene | open | 269961-271070 | metE | ||
| 615 | JASNUB010000001.1 | GCA030176295_00694 | gene | open | 271067-271342 | |||
| 616 | JASNUB010000001.1 | GCA030176295_00695 | gene | open | 271342-272355 | |||
| 617 | JASNUB010000001.1 | GCA030176295_00696 | gene | open | 272372-273022 | |||
| 618 | JASNUB010000001.1 | GCA030176295_00697 | gene | open | 273042-275231 | ligA | ||
| 619 | JASNUB010000001.1 | GCA030176295_00698 | gene | open | 275228-275890 | |||
| 620 | JASNUB010000001.1 | GCA030176295_00699 | gene | open | 276087-276377 | gatC | ||
| 621 | JASNUB010000001.1 | GCA030176295_00700 | gene | open | 276438-277925 | gatA | ||
| 622 | JASNUB010000001.1 | GCA030176295_00701 | gene | open | 277994-278317 | |||
| 623 | JASNUB010000001.1 | GCA030176295_00702 | gene | open | 278366-279796 | |||
| 624 | JASNUB010000001.1 | GCA030176295_00703 | gene | open | 279913-280944 | |||
| 625 | JASNUB010000001.1 | GCA030176295_00704 | gene | open | 280964-282511 | gatB | ||
| 626 | JASNUB010000001.1 | GCA030176295_00705 | gene | open | 282605-284017 | ykvI | ||
| 627 | JASNUB010000001.1 | GCA030176295_00706 | gene | open | 284047-285141 | |||
| 628 | JASNUB010000001.1 | GCA030176295_00707 | gene | open | 285254-286021 | |||
| 629 | JASNUB010000001.1 | GCA030176295_00708 | gene | open | 286088-287281 | doxX | ||
| 630 | JASNUB010000001.1 | GCA030176295_00709 | gene | open | 287278-288621 | |||
| 631 | JASNUB010000001.1 | GCA030176295_00710 | gene | open | 288569-290410 | ilvD | ||
| 632 | JASNUB010000001.1 | GCA030176295_00711 | gene | open | 290477-291136 | |||
| 633 | JASNUB010000001.1 | GCA030176295_00712 | gene | open | 291160-292392 | mscS | ||
| 634 | JASNUB010000001.1 | GCA030176295_00713 | gene | open | 292708-294579 | |||
| 635 | JASNUB010000001.1 | GCA030176295_00714 | gene | open | 294582-295097 | ilvN | ||
| 636 | JASNUB010000001.1 | GCA030176295_00715 | gene | open | 295203-296216 | ilvC | ||
| 637 | JASNUB010000001.1 | GCA030176295_00716 | gene | open | 296203-297153 | |||
| 638 | JASNUB010000001.1 | GCA030176295_00717 | gene | open | 297284-298864 | serA | ||
| 639 | JASNUB010000001.1 | GCA030176295_00718 | gene | open | 298970-300208 | |||
| 640 | JASNUB010000001.1 | GCA030176295_00719 | gene | open | 300205-300918 | |||
| 641 | JASNUB010000001.1 | GCA030176295_00720 | gene | open | 301063-301905 | |||
| 642 | JASNUB010000001.1 | GCA030176295_00721 | gene | open | 302000-303019 | |||
| 643 | JASNUB010000001.1 | GCA030176295_00722 | gene | open | 303030-304802 | |||
| 644 | JASNUB010000001.1 | GCA030176295_00723 | gene | open | 304974-306743 | |||
| 645 | JASNUB010000001.1 | GCA030176295_00724 | gene | open | 306760-307410 | |||
| 646 | JASNUB010000001.1 | GCA030176295_00725 | gene | open | 307444-308238 | |||
| 647 | JASNUB010000001.1 | GCA030176295_00726 | gene | open | 308309-309406 | |||
| 648 | JASNUB010000001.1 | GCA030176295_00727 | gene | open | 309456-310955 | gltX | ||
| 649 | JASNUB010000001.1 | GCA030176295_00730 | gene | open | 311456-311749 | |||
| 650 | JASNUB010000001.1 | GCA030176295_00731 | gene | open | 311943-312782 | |||
| 651 | JASNUB010000001.1 | GCA030176295_00732 | gene | open | 312794-313711 | eamA | ||
| 652 | JASNUB010000001.1 | GCA030176295_00733 | gene | open | 313727-314968 | |||
| 653 | JASNUB010000001.1 | GCA030176295_00734 | gene | open | 315199-316572 | |||
| 654 | JASNUB010000001.1 | GCA030176295_00735 | gene | open | 316653-318212 | |||
| 655 | JASNUB010000001.1 | GCA030176295_00736 | gene | open | 318246-318947 | |||
| 656 | JASNUB010000001.1 | GCA030176295_00737 | gene | open | 318998-320410 | |||
| 657 | JASNUB010000001.1 | GCA030176295_00738 | gene | open | 320442-321032 | |||
| 658 | JASNUB010000001.1 | GCA030176295_00739 | gene | open | 321029-322060 | |||
| 659 | JASNUB010000001.1 | GCA030176295_00740 | gene | open | 322115-323107 | |||
| 660 | JASNUB010000001.1 | GCA030176295_00741 | gene | open | 323147-324217 | |||
| 661 | JASNUB010000001.1 | GCA030176295_00742 | gene | open | 324269-325435 | |||
| 662 | JASNUB010000001.1 | GCA030176295_00743 | gene | open | 325477-326499 | |||
| 663 | JASNUB010000001.1 | GCA030176295_00744 | gene | open | 326496-327224 | |||
| 664 | JASNUB010000001.1 | GCA030176295_00745 | gene | open | 327244-328947 | dhaL | ||
| 665 | JASNUB010000001.1 | GCA030176295_00746 | gene | open | 328949-331189 | recG | ||
| 666 | JASNUB010000001.1 | GCA030176295_00747 | gene | open | 331237-331818 | rsmD | ||
| 667 | JASNUB010000001.1 | GCA030176295_00748 | gene | open | 331917-332414 | coaD | ||
| 668 | JASNUB010000001.1 | GCA030176295_00749 | gene | open | 332411-333241 | |||
| 669 | JASNUB010000001.1 | GCA030176295_00751 | gene | open | 333689-334435 | |||
| 670 | JASNUB010000001.1 | GCA030176295_00752 | gene | open | 334426-334722 | |||
| 671 | JASNUB010000001.1 | GCA030176295_00753 | gene | open | 335217-335588 | pqqD | ||
| 672 | JASNUB010000001.1 | GCA030176295_00754 | gene | open | 335599-335778 | |||
| 673 | JASNUB010000001.1 | GCA030176295_00755 | gene | open | 335719-335880 | |||
| 674 | JASNUB010000001.1 | GCA030176295_00756 | gene | open | 335870-336037 | |||
| 675 | JASNUB010000001.1 | GCA030176295_00757 | gene | open | 336123-336239 | |||
| 676 | JASNUB010000001.1 | GCA030176295_00758 | gene | open | 336454-336681 | |||
| 677 | JASNUB010000001.1 | GCA030176295_00759 | gene | open | 336671-336805 | |||
| 678 | JASNUB010000001.1 | GCA030176295_00760 | gene | open | 337233-337409 | |||
| 679 | JASNUB010000001.1 | GCA030176295_00761 | gene | open | 337387-337638 | |||
| 680 | JASNUB010000001.1 | GCA030176295_00762 | gene | open | 337645-337854 | |||
| 681 | JASNUB010000001.1 | GCA030176295_00763 | gene | open | 337898-338179 | |||
| 682 | JASNUB010000001.1 | GCA030176295_00764 | gene | open | 338351-338500 | |||
| 683 | JASNUB010000001.1 | GCA030176295_00765 | gene | open | 338703-339059 | |||
| 684 | JASNUB010000001.1 | GCA030176295_00766 | gene | open | 339138-339509 | pqqD | ||
| 685 | JASNUB010000001.1 | GCA030176295_00767 | gene | open | 339602-339739 | |||
| 686 | JASNUB010000001.1 | GCA030176295_00768 | gene | open | 339792-340619 | |||
| 687 | JASNUB010000001.1 | GCA030176295_00769 | gene | open | 341239-341904 | |||
| 688 | JASNUB010000001.1 | GCA030176295_00770 | gene | open | 342157-343788 | |||
| 689 | JASNUB010000001.1 | GCA030176295_00771 | gene | open | 343916-344149 | |||
| 690 | JASNUB010000001.1 | GCA030176295_00772 | gene | open | 344259-344423 | |||
| 691 | JASNUB010000001.1 | GCA030176295_00773 | gene | open | 344457-344726 | |||
| 692 | JASNUB010000001.1 | GCA030176295_00774 | gene | open | 344650-345594 | |||
| 693 | JASNUB010000001.1 | GCA030176295_00775 | gene | open | 345633-346025 | |||
| 694 | JASNUB010000001.1 | GCA030176295_00776 | gene | open | 346112-348736 | polA | ||
| 695 | JASNUB010000001.1 | GCA030176295_00777 | gene | open | 348830-350590 | |||
| 696 | JASNUB010000001.1 | GCA030176295_00778 | gene | open | 350688-352376 | nikD | ||
| 697 | JASNUB010000001.1 | GCA030176295_00779 | gene | open | 352379-353341 | |||
| 698 | JASNUB010000001.1 | GCA030176295_00780 | gene | open | 353331-354260 | |||
| 699 | JASNUB010000001.1 | GCA030176295_00781 | gene | open | 354761-356356 | |||
| 700 | JASNUB010000001.1 | GCA030176295_00782 | gene | open | 356667-358133 | rpsA | ||
| 701 | JASNUB010000001.1 | GCA030176295_00783 | gene | open | 358250-358867 | coaE | ||
| 702 | JASNUB010000001.1 | GCA030176295_00784 | gene | open | 358886-360991 | uvrB | ||
| 703 | JASNUB010000001.1 | GCA030176295_00785 | gene | open | 361111-361581 | uspA | ||
| 704 | JASNUB010000001.1 | GCA030176295_00786 | gene | open | 361603-362091 | uspA | ||
| 705 | JASNUB010000001.1 | GCA030176295_00787 | gene | open | 362185-364488 | |||
| 706 | JASNUB010000001.1 | GCA030176295_00788 | gene | open | 364503-365354 | doxX | ||
| 707 | JASNUB010000001.1 | GCA030176295_00789 | gene | open | 365447-366046 | |||
| 708 | JASNUB010000001.1 | GCA030176295_00790 | gene | open | 366067-369018 | uvrA | ||
| 709 | JASNUB010000001.1 | GCA030176295_00791 | gene | open | 369510-369854 | infC | ||
| 710 | JASNUB010000001.1 | GCA030176295_00792 | gene | open | 369888-370082 | rpmI | ||
| 711 | JASNUB010000001.1 | GCA030176295_00793 | gene | open | 370141-370524 | rplT | ||
| 712 | JASNUB010000001.1 | GCA030176295_00794 | gene | open | 370629-371450 | |||
| 713 | JASNUB010000001.1 | GCA030176295_00795 | gene | open | 371572-372630 | pheS | ||
| 714 | JASNUB010000001.1 | GCA030176295_00796 | gene | open | 372660-375164 | pheT | ||
| 715 | JASNUB010000001.1 | GCA030176295_00797 | gene | open | 375436-376464 | |||
| 716 | JASNUB010000001.1 | GCA030176295_00798 | gene | open | 376556-378037 | |||
| 717 | JASNUB010000001.1 | GCA030176295_00799 | gene | open | 378240-378464 | |||
| 718 | JASNUB010000001.1 | GCA030176295_00800 | gene | open | 378413-379432 | |||
| 719 | JASNUB010000001.1 | GCA030176295_00801 | gene | open | 379584-380627 | argC | ||
| 720 | JASNUB010000001.1 | GCA030176295_00802 | gene | open | 380744-381979 | argJ | ||
| 721 | JASNUB010000001.1 | GCA030176295_00803 | gene | open | 382023-382958 | |||
| 722 | JASNUB010000001.1 | GCA030176295_00804 | gene | open | 382955-384127 | |||
| 723 | JASNUB010000001.1 | GCA030176295_00805 | gene | open | 384136-385131 | argF | ||
| 724 | JASNUB010000001.1 | GCA030176295_00806 | gene | open | 385128-385625 | |||
| 725 | JASNUB010000001.1 | GCA030176295_00807 | gene | open | 385787-386989 | |||
| 726 | JASNUB010000001.1 | GCA030176295_00808 | gene | open | 386989-388443 | argH | ||
| 727 | JASNUB010000001.1 | GCA030176295_00809 | gene | open | 388453-388644 | |||
| 728 | JASNUB010000001.1 | GCA030176295_00810 | gene | open | 388647-389912 | tyrS | ||
| 729 | JASNUB010000001.1 | GCA030176295_00466 | gene | open | 28043-28115 | trnR | ||
| 730 | JASNUB010000001.1 | GCA030176295_00550 | gene | open | 117694-117765 | trnQ | ||
| 731 | JASNUB010000001.1 | GCA030176295_00564 | gene | open | 133830-133903 | trnL | ||
| 732 | JASNUB010000001.1 | GCA030176295_00646 | gene | open | 221401-221474 | trnR | ||
| 733 | JASNUB010000001.1 | GCA030176295_00728 | gene | open | 311207-311278 | trnQ | ||
| 734 | JASNUB010000001.1 | GCA030176295_00729 | gene | open | 311312-311384 | trnE | ||
| 735 | JASNUB010000001.1 | GCA030176295_00750 | gene | open | 333397-333473 | trnL | ||
| 736 | JASNUB010000001.1 | GCA030176295_00466 | tRNA | open | 28043-28115 | trnR | tRNA-Arg(cct) | |
| 737 | JASNUB010000001.1 | GCA030176295_00550 | tRNA | open | 117694-117765 | trnQ | tRNA-Gln(ttg) | |
| 738 | JASNUB010000001.1 | GCA030176295_00564 | tRNA | open | 133830-133903 | trnL | tRNA-Leu(taa) | |
| 739 | JASNUB010000001.1 | GCA030176295_00646 | tRNA | open | 221401-221474 | trnR | tRNA-Arg(ccg) | |
| 740 | JASNUB010000001.1 | GCA030176295_00728 | tRNA | open | 311207-311278 | trnQ | tRNA-Gln(ctg) | |
| 741 | JASNUB010000001.1 | GCA030176295_00729 | tRNA | open | 311312-311384 | trnE | tRNA-Glu(ctc) | |
| 742 | JASNUB010000001.1 | GCA030176295_00750 | tRNA | open | 333397-333473 | trnL | tRNA-Leu(caa) | |
| 743 | JASNUB010000002.1 | GCA030176295_00880 | gene | open | 73855-74144 | 5_ureB_sRNA | ||
| 744 | JASNUB010000002.1 | GCA030176295_00955 | gene | open | 157598-158033 | RNaseP_bact_a | ||
| 745 | JASNUB010000002.1 | GCA030176295_00880 | ncRNA | open | 73855-74144 | 5' ureB small RNA | ||
| 746 | JASNUB010000002.1 | GCA030176295_00955 | ncRNA | open | 157598-158033 | Bacterial RNase P class A | ||
| 747 | JASNUB010000002.1 | regulatory_region | open | 107805-107910 | mraW RNA | |||
| 748 | JASNUB010000002.1 | repeat_region | open | 61358-63042 | CRISPR array with 28 repeats of length 27%2C consensus sequence CTCTTCTCCGCGCATGCGGAGGTAATT and spacer length 34 | |||
| 749 | JASNUB010000002.1 | GCA030176295_00811 | CDS | open | 1667-2908 | _na 413_aa | Amidohydrolase | |
| 750 | JASNUB010000002.1 | GCA030176295_00812 | CDS | open | 2949-4379 | _na 476_aa | pyk | pyruvate kinase |
| 751 | JASNUB010000002.1 | GCA030176295_00813 | CDS | open | 4410-5309 | _na 299_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 752 | JASNUB010000002.1 | GCA030176295_00814 | CDS | open | 5424-6302 | _na 292_aa | indole-3-glycerol-phosphate synthase | |
| 753 | JASNUB010000002.1 | GCA030176295_00815 | CDS | open | 6280-6396 | _na 38_aa | hypothetical protein | |
| 754 | JASNUB010000002.1 | GCA030176295_00816 | CDS | open | 6462-7133 | _na 223_aa | TIGR02234 family membrane protein | |
| 755 | JASNUB010000002.1 | GCA030176295_00817 | CDS | open | 7138-7503 | _na 121_aa | hisI | phosphoribosyl-AMP cyclohydrolase |
| 756 | JASNUB010000002.1 | GCA030176295_00818 | CDS | open | 7500-8279 | _na 259_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 757 | JASNUB010000002.1 | GCA030176295_00819 | CDS | open | 8371-9192 | _na 273_aa | Inositol-phosphate phosphatase | |
| 758 | JASNUB010000002.1 | GCA030176295_00820 | CDS | open | 9205-9966 | _na 253_aa | priA | bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA |
| 759 | JASNUB010000002.1 | GCA030176295_00821 | CDS | open | 10008-10640 | _na 210_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 760 | JASNUB010000002.1 | GCA030176295_00822 | CDS | open | 10656-12038 | _na 460_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 761 | JASNUB010000002.1 | GCA030176295_00823 | CDS | open | 12095-12262 | _na 55_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 762 | JASNUB010000002.1 | GCA030176295_00824 | CDS | open | 12262-12867 | _na 201_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 763 | JASNUB010000002.1 | GCA030176295_00825 | CDS | open | 12864-13958 | _na 364_aa | histidinol-phosphate transaminase | |
| 764 | JASNUB010000002.1 | GCA030176295_00826 | CDS | open | 13962-15287 | _na 441_aa | Histidinol dehydrogenase | |
| 765 | JASNUB010000002.1 | GCA030176295_00827 | CDS | open | 15310-15846 | _na 178_aa | DUF2567 domain-containing protein | |
| 766 | JASNUB010000002.1 | GCA030176295_00828 | CDS | open | 15850-16557 | _na 235_aa | DUF4878 domain-containing protein | |
| 767 | JASNUB010000002.1 | GCA030176295_00829 | CDS | open | 16657-17436 | _na 259_aa | HTH tetR-type domain-containing protein | |
| 768 | JASNUB010000002.1 | GCA030176295_00830 | CDS | open | 17520-18896 | _na 458_aa | BRCT domain-containing protein | |
| 769 | JASNUB010000002.1 | GCA030176295_00831 | CDS | open | 18996-20753 | _na 585_aa | BCCT family transporter | |
| 770 | JASNUB010000002.1 | GCA030176295_00832 | CDS | open | 20790-21479 | _na 229_aa | Peptidase S1 domain-containing protein | |
| 771 | JASNUB010000002.1 | GCA030176295_00833 | CDS | open | 21578-22411 | _na 277_aa | ABC transporter domain-containing protein | |
| 772 | JASNUB010000002.1 | GCA030176295_00834 | CDS | open | 22417-24471 | _na 684_aa | ABC transporter domain-containing protein | |
| 773 | JASNUB010000002.1 | GCA030176295_00835 | CDS | open | 24471-25436 | _na 321_aa | ABC transmembrane type-1 domain-containing protein | |
| 774 | JASNUB010000002.1 | GCA030176295_00836 | CDS | open | 25448-27091 | _na 547_aa | Solute-binding protein family 5 domain-containing protein | |
| 775 | JASNUB010000002.1 | GCA030176295_00837 | CDS | open | 27461-28162 | _na 233_aa | HTH gntR-type domain-containing protein | |
| 776 | JASNUB010000002.1 | GCA030176295_00838 | CDS | open | 28209-28940 | _na 243_aa | N-acylglucosamine-6-phosphate 2-epimerase | |
| 777 | JASNUB010000002.1 | GCA030176295_00839 | CDS | open | 29093-30097 | _na 334_aa | Glucokinase | |
| 778 | JASNUB010000002.1 | GCA030176295_00840 | CDS | open | 30100-31041 | _na 313_aa | N-acetylneuraminate lyase | |
| 779 | JASNUB010000002.1 | GCA030176295_00841 | CDS | open | 31195-32379 | _na 394_aa | Amidohydrolase-related domain-containing protein | |
| 780 | JASNUB010000002.1 | GCA030176295_00842 | CDS | open | 32419-33192 | _na 257_aa | Glucosamine-6-phosphate deaminase | |
| 781 | JASNUB010000002.1 | GCA030176295_00843 | CDS | open | 33247-36168 | _na 973_aa | D-lactate dehydrogenase (cytochrome) | |
| 782 | JASNUB010000002.1 | GCA030176295_00844 | CDS | open | 36321-36989 | _na 222_aa | hypothetical protein | |
| 783 | JASNUB010000002.1 | GCA030176295_00845 | CDS | open | 37046-37444 | _na 132_aa | RNA-binding S4 domain-containing protein | |
| 784 | JASNUB010000002.1 | GCA030176295_00846 | CDS | open | 37453-37689 | _na 78_aa | Secreted protein | |
| 785 | JASNUB010000002.1 | GCA030176295_00847 | CDS | open | 37696-38343 | _na 215_aa | yigZ | YigZ family protein |
| 786 | JASNUB010000002.1 | GCA030176295_00848 | CDS | open | 38357-39658 | _na 433_aa | ilvA | threonine ammonia-lyase IlvA |
| 787 | JASNUB010000002.1 | GCA030176295_00849 | CDS | open | 39746-43324 | _na 1192_aa | dnaE | DNA polymerase III subunit alpha |
| 788 | JASNUB010000002.1 | GCA030176295_00850 | CDS | open | 43348-43539 | _na 63_aa | Lipoprotein | |
| 789 | JASNUB010000002.1 | GCA030176295_00851 | CDS | open | 43550-44251 | _na 233_aa | Secreted protein | |
| 790 | JASNUB010000002.1 | GCA030176295_00852 | CDS | open | 44292-45227 | _na 311_aa | Pseudouridine synthase | |
| 791 | JASNUB010000002.1 | GCA030176295_00853 | CDS | open | 45217-45744 | _na 175_aa | lspA | signal peptidase II |
| 792 | JASNUB010000002.1 | GCA030176295_00854 | CDS | open | 46001-47062 | _na 353_aa | Oxidoreductase | |
| 793 | JASNUB010000002.1 | GCA030176295_00855 | CDS | open | 47435-49108 | _na 557_aa | L-lactate permease | |
| 794 | JASNUB010000002.1 | GCA030176295_00856 | CDS | open | 49211-49834 | _na 207_aa | Secreted protein | |
| 795 | JASNUB010000002.1 | GCA030176295_00857 | CDS | open | 49942-50898 | _na 318_aa | L-asparaginase | |
| 796 | JASNUB010000002.1 | GCA030176295_00858 | CDS | open | 50895-52334 | _na 479_aa | DNA polymerase IV | |
| 797 | JASNUB010000002.1 | GCA030176295_00859 | CDS | open | 52414-53127 | _na 237_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 798 | JASNUB010000002.1 | GCA030176295_00860 | CDS | open | 53120-54205 | _na 361_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 799 | JASNUB010000002.1 | GCA030176295_00861 | CDS | open | 54226-54867 | _na 213_aa | Type I-E CRISPR-associated protein Cse2/CasB | |
| 800 | JASNUB010000002.1 | GCA030176295_00862 | CDS | open | 54864-56504 | _na 546_aa | type I-E CRISPR-associated protein Cse1/CasA | |
| 801 | JASNUB010000002.1 | GCA030176295_00863 | CDS | open | 56846-57415 | _na 189_aa | Type I-E CRISPR-associated protein Cas6/Cse3/CasE | |
| 802 | JASNUB010000002.1 | GCA030176295_00864 | CDS | open | 57412-60087 | _na 891_aa | HD Cas3-type domain-containing protein | |
| 803 | JASNUB010000002.1 | GCA030176295_00865 | CDS | open | 60089-61024 | _na 311_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 804 | JASNUB010000002.1 | GCA030176295_00866 | CDS | open | 61025-61336 | _na 103_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 805 | JASNUB010000002.1 | GCA030176295_00867 | CDS | open | 63904-64014 | _na 36_aa | hypothetical protein | |
| 806 | JASNUB010000002.1 | GCA030176295_00868 | CDS | open | 64311-65384 | _na 357_aa | htaA | HtaA protein |
| 807 | JASNUB010000002.1 | GCA030176295_00869 | CDS | open | 65471-65932 | _na 153_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 808 | JASNUB010000002.1 | GCA030176295_00870 | CDS | open | 66122-66649 | _na 175_aa | ABC transporter ATP-binding protein | |
| 809 | JASNUB010000002.1 | GCA030176295_00871 | CDS | open | 66849-68219 | _na 456_aa | apeA | ApeA N-terminal domain-containing protein |
| 810 | JASNUB010000002.1 | GCA030176295_00872 | CDS | open | 68409-68552 | _na 47_aa | hypothetical protein | |
| 811 | JASNUB010000002.1 | GCA030176295_00873 | CDS | open | 68549-69172 | _na 207_aa | iron ABC transporter permease | |
| 812 | JASNUB010000002.1 | GCA030176295_00874 | CDS | open | 69387-69692 | _na 101_aa | Transcriptional regulator | |
| 813 | JASNUB010000002.1 | GCA030176295_00875 | CDS | open | 69762-70637 | _na 291_aa | ureD | Urease accessory protein UreD |
| 814 | JASNUB010000002.1 | GCA030176295_00876 | CDS | open | 70639-71253 | _na 204_aa | ureG | urease accessory protein UreG |
| 815 | JASNUB010000002.1 | GCA030176295_00877 | CDS | open | 71335-72084 | _na 249_aa | ureF | Urease accessory protein UreF |
| 816 | JASNUB010000002.1 | GCA030176295_00878 | CDS | open | 72065-72538 | _na 157_aa | ureE | urease accessory protein UreE |
| 817 | JASNUB010000002.1 | GCA030176295_00879 | CDS | open | 72587-74299 | _na 570_aa | ureC | urease subunit alpha |
| 818 | JASNUB010000002.1 | GCA030176295_00881 | CDS | open | 74353-74664 | _na 103_aa | urease subunit beta | |
| 819 | JASNUB010000002.1 | GCA030176295_00882 | CDS | open | 74710-75012 | _na 100_aa | urease subunit gamma | |
| 820 | JASNUB010000002.1 | GCA030176295_00883 | CDS | open | 75113-76294 | _na 393_aa | eamA | EamA domain-containing protein |
| 821 | JASNUB010000002.1 | GCA030176295_00884 | CDS | open | 76927-77529 | _na 200_aa | DUF5666 domain-containing protein | |
| 822 | JASNUB010000002.1 | GCA030176295_00885 | CDS | open | 77565-78659 | _na 364_aa | DUF5666 domain-containing protein | |
| 823 | JASNUB010000002.1 | GCA030176295_00886 | CDS | open | 78859-79866 | _na 335_aa | hypothetical protein | |
| 824 | JASNUB010000002.1 | GCA030176295_00887 | CDS | open | 80327-83584 | _na 1085_aa | ileS | isoleucine--tRNA ligase |
| 825 | JASNUB010000002.1 | GCA030176295_00888 | CDS | open | 83822-83974 | _na 50_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 826 | JASNUB010000002.1 | GCA030176295_00889 | CDS | open | 84199-85002 | _na 267_aa | Cysteine-rich domain-containing protein | |
| 827 | JASNUB010000002.1 | GCA030176295_00890 | CDS | open | 85002-86477 | _na 491_aa | LutB/LldF family L-lactate oxidation iron-sulfur protein | |
| 828 | JASNUB010000002.1 | GCA030176295_00891 | CDS | open | 86477-87112 | _na 211_aa | LUD domain-containing protein | |
| 829 | JASNUB010000002.1 | GCA030176295_00892 | CDS | open | 87418-88494 | _na 358_aa | Cell wall synthesis protein Wag31 | |
| 830 | JASNUB010000002.1 | GCA030176295_00893 | CDS | open | 88701-88985 | _na 94_aa | yggT | YggT family protein |
| 831 | JASNUB010000002.1 | GCA030176295_00894 | CDS | open | 89026-89607 | _na 193_aa | sepF | Cell division protein SepF |
| 832 | JASNUB010000002.1 | GCA030176295_00895 | CDS | open | 89664-90470 | _na 268_aa | Pyridoxal phosphate homeostasis protein | |
| 833 | JASNUB010000002.1 | GCA030176295_00896 | CDS | open | 90484-91254 | _na 256_aa | pgeF | peptidoglycan editing factor PgeF |
| 834 | JASNUB010000002.1 | GCA030176295_00897 | CDS | open | 91264-92514 | _na 416_aa | ftsZ | cell division protein FtsZ |
| 835 | JASNUB010000002.1 | GCA030176295_00898 | CDS | open | 92716-93372 | _na 218_aa | POTRA domain-containing protein | |
| 836 | JASNUB010000002.1 | GCA030176295_00899 | CDS | open | 93375-94979 | _na 534_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 837 | JASNUB010000002.1 | GCA030176295_00900 | CDS | open | 95004-96146 | _na 380_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 838 | JASNUB010000002.1 | GCA030176295_00901 | CDS | open | 96119-97576 | _na 485_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 839 | JASNUB010000002.1 | GCA030176295_00902 | CDS | open | 97666-99183 | _na 505_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 840 | JASNUB010000002.1 | GCA030176295_00903 | CDS | open | 99191-100288 | _na 365_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 841 | JASNUB010000002.1 | GCA030176295_00904 | CDS | open | 100363-101886 | _na 507_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 842 | JASNUB010000002.1 | GCA030176295_00905 | CDS | open | 101886-103472 | _na 528_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 843 | JASNUB010000002.1 | GCA030176295_00906 | CDS | open | 103594-105510 | _na 638_aa | Penicillin-binding protein | |
| 844 | JASNUB010000002.1 | GCA030176295_00907 | CDS | open | 105611-106591 | _na 326_aa | ftsL | Cell division protein FtsL |
| 845 | JASNUB010000002.1 | GCA030176295_00908 | CDS | open | 106594-107772 | _na 392_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 846 | JASNUB010000002.1 | GCA030176295_00909 | CDS | open | 107917-108351 | _na 144_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 847 | JASNUB010000002.1 | GCA030176295_00910 | CDS | open | 108813-109268 | _na 151_aa | DUF3040 domain-containing protein | |
| 848 | JASNUB010000002.1 | GCA030176295_00911 | CDS | open | 109447-109887 | _na 146_aa | SAV-6107-like HEPN domain-containing protein | |
| 849 | JASNUB010000002.1 | GCA030176295_00912 | CDS | open | 109856-109981 | _na 41_aa | hypothetical protein | |
| 850 | JASNUB010000002.1 | GCA030176295_00913 | CDS | open | 110104-110673 | _na 189_aa | N-acetyltransferase domain-containing protein | |
| 851 | JASNUB010000002.1 | GCA030176295_00914 | CDS | open | 110722-111834 | _na 370_aa | Geranylgeranyl pyrophosphate synthase | |
| 852 | JASNUB010000002.1 | GCA030176295_00915 | CDS | open | 111834-113366 | _na 510_aa | alpha-(1->6)-mannopyranosyltransferase A | |
| 853 | JASNUB010000002.1 | GCA030176295_00916 | CDS | open | 113363-113746 | _na 127_aa | Rv2175c C-terminal domain-containing protein | |
| 854 | JASNUB010000002.1 | GCA030176295_00917 | CDS | open | 113888-115228 | _na 446_aa | non-specific serine/threonine protein kinase | |
| 855 | JASNUB010000002.1 | GCA030176295_00918 | CDS | open | 115394-116782 | _na 462_aa | class II 3-deoxy-7-phosphoheptulonate synthase | |
| 856 | JASNUB010000002.1 | GCA030176295_00919 | CDS | open | 116815-117330 | _na 171_aa | polyadenylate-specific 3'-exoribonuclease AS | |
| 857 | JASNUB010000002.1 | GCA030176295_00920 | CDS | open | 117374-117529 | _na 51_aa | hypothetical protein | |
| 858 | JASNUB010000002.1 | GCA030176295_00921 | CDS | open | 117575-118672 | _na 365_aa | Acyltransferase 3 domain-containing protein | |
| 859 | JASNUB010000002.1 | GCA030176295_00922 | CDS | open | 118686-119450 | _na 254_aa | Phospholipid/glycerol acyltransferase domain-containing protein | |
| 860 | JASNUB010000002.1 | GCA030176295_00923 | CDS | open | 119491-120468 | _na 325_aa | Glucokinase | |
| 861 | JASNUB010000002.1 | GCA030176295_00924 | CDS | open | 120623-121660 | _na 345_aa | NlpC/P60 domain-containing protein | |
| 862 | JASNUB010000002.1 | GCA030176295_00925 | CDS | open | 121751-122344 | _na 197_aa | NlpC/P60 domain-containing protein | |
| 863 | JASNUB010000002.1 | GCA030176295_00926 | CDS | open | 123045-124670 | _na 541_aa | Cytochrome bc1 complex cytochrome b subunit | |
| 864 | JASNUB010000002.1 | GCA030176295_00927 | CDS | open | 124670-125890 | _na 406_aa | Cytochrome bc1 complex Rieske iron-sulfur subunit | |
| 865 | JASNUB010000002.1 | GCA030176295_00928 | CDS | open | 125890-126780 | _na 296_aa | Cytochrome bc1 complex cytochrome c subunit | |
| 866 | JASNUB010000002.1 | GCA030176295_00929 | CDS | open | 126848-127468 | _na 206_aa | cytochrome-c oxidase | |
| 867 | JASNUB010000002.1 | GCA030176295_00930 | CDS | open | 127992-128423 | _na 143_aa | Cytochrome c oxidase polypeptide 4 | |
| 868 | JASNUB010000002.1 | GCA030176295_00931 | CDS | open | 128444-129535 | _na 363_aa | cytochrome-c oxidase | |
| 869 | JASNUB010000002.1 | GCA030176295_00932 | CDS | open | 129959-131881 | _na 640_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 870 | JASNUB010000002.1 | GCA030176295_00933 | CDS | open | 132027-132371 | _na 114_aa | FeS cluster biogenesis domain-containing protein | |
| 871 | JASNUB010000002.1 | GCA030176295_00934 | CDS | open | 132426-133322 | _na 298_aa | DUF3043 domain-containing protein | |
| 872 | JASNUB010000002.1 | GCA030176295_00935 | CDS | open | 133379-134512 | _na 377_aa | Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase | |
| 873 | JASNUB010000002.1 | GCA030176295_00936 | CDS | open | 134495-135583 | _na 362_aa | branched-chain amino acid aminotransferase | |
| 874 | JASNUB010000002.1 | GCA030176295_00937 | CDS | open | 135733-137283 | _na 516_aa | leucyl aminopeptidase | |
| 875 | JASNUB010000002.1 | GCA030176295_00938 | CDS | open | 137280-137672 | _na 130_aa | Oxidoreductase | |
| 876 | JASNUB010000002.1 | GCA030176295_00939 | CDS | open | 137799-139982 | _na 727_aa | sucB | 2-oxoglutarate dehydrogenase%2C E2 component%2C dihydrolipoamide succinyltransferase |
| 877 | JASNUB010000002.1 | GCA030176295_00940 | CDS | open | 140267-141481 | _na 404_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 878 | JASNUB010000002.1 | GCA030176295_00941 | CDS | open | 141518-142288 | _na 256_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 879 | JASNUB010000002.1 | GCA030176295_00942 | CDS | open | 142343-143386 | _na 347_aa | lipA | lipoyl synthase |
| 880 | JASNUB010000002.1 | GCA030176295_00943 | CDS | open | 143583-144362 | _na 259_aa | DUF4191 domain-containing protein | |
| 881 | JASNUB010000002.1 | GCA030176295_00944 | CDS | open | 144369-144857 | _na 162_aa | RDD domain-containing protein | |
| 882 | JASNUB010000002.1 | GCA030176295_00945 | CDS | open | 144988-145920 | _na 310_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 883 | JASNUB010000002.1 | GCA030176295_00946 | CDS | open | 145913-146452 | _na 179_aa | Nudix hydrolase domain-containing protein | |
| 884 | JASNUB010000002.1 | GCA030176295_00947 | CDS | open | 146471-147547 | _na 358_aa | Trypsin-like serine protease | |
| 885 | JASNUB010000002.1 | GCA030176295_00948 | CDS | open | 147578-149044 | _na 488_aa | thrC | threonine synthase |
| 886 | JASNUB010000002.1 | GCA030176295_00949 | CDS | open | 149062-150552 | _na 496_aa | Lysosomal dipeptide transporter MFSD1 | |
| 887 | JASNUB010000002.1 | GCA030176295_00950 | CDS | open | 150458-151027 | _na 189_aa | hypothetical protein | |
| 888 | JASNUB010000002.1 | GCA030176295_00951 | CDS | open | 151237-154452 | _na 1071_aa | bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase | |
| 889 | JASNUB010000002.1 | GCA030176295_00952 | CDS | open | 154475-155812 | _na 445_aa | glnA | type I glutamate--ammonia ligase |
| 890 | JASNUB010000002.1 | GCA030176295_00953 | CDS | open | 155871-156083 | _na 70_aa | SPOR domain-containing protein | |
| 891 | JASNUB010000002.1 | GCA030176295_00954 | CDS | open | 156309-157604 | _na 431_aa | Galactokinase N-terminal domain-containing protein | |
| 892 | JASNUB010000002.1 | GCA030176295_00956 | CDS | open | 158138-159202 | _na 354_aa | adhP | alcohol dehydrogenase AdhP |
| 893 | JASNUB010000002.1 | GCA030176295_00957 | CDS | open | 159399-160292 | _na 297_aa | Serine hydrolase | |
| 894 | JASNUB010000002.1 | GCA030176295_00958 | CDS | open | 160289-161491 | _na 400_aa | bifunctional RNase H/acid phosphatase | |
| 895 | JASNUB010000002.1 | GCA030176295_00959 | CDS | open | 161521-162282 | _na 253_aa | C4-type zinc ribbon domain-containing protein | |
| 896 | JASNUB010000002.1 | GCA030176295_00960 | CDS | open | 162344-163483 | _na 379_aa | Nif3-like dinuclear metal center hexameric protein | |
| 897 | JASNUB010000002.1 | GCA030176295_00961 | CDS | open | 163635-164054 | _na 139_aa | protein-tyrosine-phosphatase | |
| 898 | JASNUB010000002.1 | GCA030176295_00962 | CDS | open | 164108-165232 | _na 374_aa | SURF1-like protein | |
| 899 | JASNUB010000002.1 | GCA030176295_00963 | CDS | open | 165396-167975 | _na 859_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 900 | JASNUB010000002.1 | GCA030176295_00964 | CDS | open | 167972-170230 | _na 752_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 901 | JASNUB010000002.1 | GCA030176295_00965 | CDS | open | 170320-170829 | _na 169_aa | Phosphoesterase HXTX domain-containing protein | |
| 902 | JASNUB010000002.1 | GCA030176295_00966 | CDS | open | 170872-171183 | _na 103_aa | Polymerase beta nucleotidyltransferase domain-containing protein | |
| 903 | JASNUB010000002.1 | GCA030176295_00967 | CDS | open | 171396-172487 | _na 363_aa | Enoyl reductase (ER) domain-containing protein | |
| 904 | JASNUB010000002.1 | GCA030176295_00968 | CDS | open | 172575-172928 | _na 117_aa | SMODS and SLOG-associating 2TM effector domain-containing protein | |
| 905 | JASNUB010000002.1 | GCA030176295_00969 | CDS | open | 172885-173127 | _na 80_aa | hypothetical protein | |
| 906 | JASNUB010000002.1 | GCA030176295_00970 | CDS | open | 173129-174511 | _na 460_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 907 | JASNUB010000002.1 | GCA030176295_00971 | CDS | open | 174573-174773 | _na 66_aa | hypothetical protein | |
| 908 | JASNUB010000002.1 | GCA030176295_00972 | CDS | open | 174797-175603 | _na 268_aa | RelA/SpoT domain-containing protein | |
| 909 | JASNUB010000002.1 | GCA030176295_00973 | CDS | open | 175724-176662 | _na 312_aa | trypsin-like serine protease | |
| 910 | JASNUB010000002.1 | GCA030176295_00974 | CDS | open | 176712-177410 | _na 232_aa | alkB | Alkylated DNA repair protein AlkB |
| 911 | JASNUB010000002.1 | GCA030176295_00975 | CDS | open | 177479-179896 | _na 805_aa | Htaa domain-containing protein | |
| 912 | JASNUB010000002.1 | GCA030176295_00976 | CDS | open | 180133-181356 | _na 407_aa | Peptidase M20 dimerisation domain-containing protein | |
| 913 | JASNUB010000002.1 | GCA030176295_00977 | CDS | open | 181489-182796 | _na 435_aa | DUF3100 domain-containing protein | |
| 914 | JASNUB010000002.1 | GCA030176295_00978 | CDS | open | 183126-183299 | _na 57_aa | hypothetical protein | |
| 915 | JASNUB010000002.1 | GCA030176295_00979 | CDS | open | 184370-185248 | _na 292_aa | dprA | DNA-processing protein DprA |
| 916 | JASNUB010000002.1 | GCA030176295_00980 | CDS | open | 185248-185964 | _na 238_aa | Phosphoribosyltransferase domain-containing protein | |
| 917 | JASNUB010000002.1 | GCA030176295_00981 | CDS | open | 186281-186490 | _na 69_aa | hypothetical protein | |
| 918 | JASNUB010000002.1 | GCA030176295_00982 | CDS | open | 186685-188142 | _na 485_aa | Fic family protein | |
| 919 | JASNUB010000002.1 | GCA030176295_00983 | CDS | open | 188152-189018 | _na 288_aa | Class C sortase | |
| 920 | JASNUB010000002.1 | GCA030176295_00984 | CDS | open | 189029-189958 | _na 309_aa | Sortase | |
| 921 | JASNUB010000002.1 | GCA030176295_00985 | CDS | open | 189959-193054 | _na 1031_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 922 | JASNUB010000002.1 | GCA030176295_00986 | CDS | open | 193181-194839 | _na 552_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 923 | JASNUB010000002.1 | GCA030176295_00987 | CDS | open | 195093-195245 | _na 50_aa | AI-2E family transporter | |
| 924 | JASNUB010000002.1 | GCA030176295_00988 | CDS | open | 195347-196129 | _na 260_aa | Sortase | |
| 925 | JASNUB010000002.1 | GCA030176295_00989 | CDS | open | 196158-198413 | _na 751_aa | prealbumin-like fold domain-containing protein | |
| 926 | JASNUB010000002.1 | GCA030176295_00990 | CDS | open | 198687-201875 | _na 1062_aa | spaA | SpaA isopeptide-forming pilin-related protein |
| 927 | JASNUB010000002.1 | GCA030176295_00991 | CDS | open | 201897-202751 | _na 284_aa | LPXTG cell wall anchor domain-containing protein | |
| 928 | JASNUB010000002.1 | GCA030176295_00992 | CDS | open | 202741-203739 | _na 332_aa | Sortase | |
| 929 | JASNUB010000002.1 | GCA030176295_00993 | CDS | open | 203938-205560 | _na 540_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 930 | JASNUB010000002.1 | GCA030176295_00811 | gene | open | 1667-2908 | |||
| 931 | JASNUB010000002.1 | GCA030176295_00812 | gene | open | 2949-4379 | pyk | ||
| 932 | JASNUB010000002.1 | GCA030176295_00813 | gene | open | 4410-5309 | lgt | ||
| 933 | JASNUB010000002.1 | GCA030176295_00814 | gene | open | 5424-6302 | |||
| 934 | JASNUB010000002.1 | GCA030176295_00815 | gene | open | 6280-6396 | |||
| 935 | JASNUB010000002.1 | GCA030176295_00816 | gene | open | 6462-7133 | |||
| 936 | JASNUB010000002.1 | GCA030176295_00817 | gene | open | 7138-7503 | hisI | ||
| 937 | JASNUB010000002.1 | GCA030176295_00818 | gene | open | 7500-8279 | hisF | ||
| 938 | JASNUB010000002.1 | GCA030176295_00819 | gene | open | 8371-9192 | |||
| 939 | JASNUB010000002.1 | GCA030176295_00820 | gene | open | 9205-9966 | priA | ||
| 940 | JASNUB010000002.1 | GCA030176295_00821 | gene | open | 10008-10640 | hisH | ||
| 941 | JASNUB010000002.1 | GCA030176295_00822 | gene | open | 10656-12038 | |||
| 942 | JASNUB010000002.1 | GCA030176295_00823 | gene | open | 12095-12262 | |||
| 943 | JASNUB010000002.1 | GCA030176295_00824 | gene | open | 12262-12867 | hisB | ||
| 944 | JASNUB010000002.1 | GCA030176295_00825 | gene | open | 12864-13958 | |||
| 945 | JASNUB010000002.1 | GCA030176295_00826 | gene | open | 13962-15287 | |||
| 946 | JASNUB010000002.1 | GCA030176295_00827 | gene | open | 15310-15846 | |||
| 947 | JASNUB010000002.1 | GCA030176295_00828 | gene | open | 15850-16557 | |||
| 948 | JASNUB010000002.1 | GCA030176295_00829 | gene | open | 16657-17436 | |||
| 949 | JASNUB010000002.1 | GCA030176295_00830 | gene | open | 17520-18896 | |||
| 950 | JASNUB010000002.1 | GCA030176295_00831 | gene | open | 18996-20753 | |||
| 951 | JASNUB010000002.1 | GCA030176295_00832 | gene | open | 20790-21479 | |||
| 952 | JASNUB010000002.1 | GCA030176295_00833 | gene | open | 21578-22411 | |||
| 953 | JASNUB010000002.1 | GCA030176295_00834 | gene | open | 22417-24471 | |||
| 954 | JASNUB010000002.1 | GCA030176295_00835 | gene | open | 24471-25436 | |||
| 955 | JASNUB010000002.1 | GCA030176295_00836 | gene | open | 25448-27091 | |||
| 956 | JASNUB010000002.1 | GCA030176295_00837 | gene | open | 27461-28162 | |||
| 957 | JASNUB010000002.1 | GCA030176295_00838 | gene | open | 28209-28940 | |||
| 958 | JASNUB010000002.1 | GCA030176295_00839 | gene | open | 29093-30097 | |||
| 959 | JASNUB010000002.1 | GCA030176295_00840 | gene | open | 30100-31041 | |||
| 960 | JASNUB010000002.1 | GCA030176295_00841 | gene | open | 31195-32379 | |||
| 961 | JASNUB010000002.1 | GCA030176295_00842 | gene | open | 32419-33192 | |||
| 962 | JASNUB010000002.1 | GCA030176295_00843 | gene | open | 33247-36168 | |||
| 963 | JASNUB010000002.1 | GCA030176295_00844 | gene | open | 36321-36989 | |||
| 964 | JASNUB010000002.1 | GCA030176295_00845 | gene | open | 37046-37444 | |||
| 965 | JASNUB010000002.1 | GCA030176295_00846 | gene | open | 37453-37689 | |||
| 966 | JASNUB010000002.1 | GCA030176295_00847 | gene | open | 37696-38343 | yigZ | ||
| 967 | JASNUB010000002.1 | GCA030176295_00848 | gene | open | 38357-39658 | ilvA | ||
| 968 | JASNUB010000002.1 | GCA030176295_00849 | gene | open | 39746-43324 | dnaE | ||
| 969 | JASNUB010000002.1 | GCA030176295_00850 | gene | open | 43348-43539 | |||
| 970 | JASNUB010000002.1 | GCA030176295_00851 | gene | open | 43550-44251 | |||
| 971 | JASNUB010000002.1 | GCA030176295_00852 | gene | open | 44292-45227 | |||
| 972 | JASNUB010000002.1 | GCA030176295_00853 | gene | open | 45217-45744 | lspA | ||
| 973 | JASNUB010000002.1 | GCA030176295_00854 | gene | open | 46001-47062 | |||
| 974 | JASNUB010000002.1 | GCA030176295_00855 | gene | open | 47435-49108 | |||
| 975 | JASNUB010000002.1 | GCA030176295_00856 | gene | open | 49211-49834 | |||
| 976 | JASNUB010000002.1 | GCA030176295_00857 | gene | open | 49942-50898 | |||
| 977 | JASNUB010000002.1 | GCA030176295_00858 | gene | open | 50895-52334 | |||
| 978 | JASNUB010000002.1 | GCA030176295_00859 | gene | open | 52414-53127 | cas5e | ||
| 979 | JASNUB010000002.1 | GCA030176295_00860 | gene | open | 53120-54205 | cas7e | ||
| 980 | JASNUB010000002.1 | GCA030176295_00861 | gene | open | 54226-54867 | |||
| 981 | JASNUB010000002.1 | GCA030176295_00862 | gene | open | 54864-56504 | |||
| 982 | JASNUB010000002.1 | GCA030176295_00863 | gene | open | 56846-57415 | |||
| 983 | JASNUB010000002.1 | GCA030176295_00864 | gene | open | 57412-60087 | |||
| 984 | JASNUB010000002.1 | GCA030176295_00865 | gene | open | 60089-61024 | cas1e | ||
| 985 | JASNUB010000002.1 | GCA030176295_00866 | gene | open | 61025-61336 | cas2e | ||
| 986 | JASNUB010000002.1 | GCA030176295_00867 | gene | open | 63904-64014 | |||
| 987 | JASNUB010000002.1 | GCA030176295_00868 | gene | open | 64311-65384 | htaA | ||
| 988 | JASNUB010000002.1 | GCA030176295_00869 | gene | open | 65471-65932 | |||
| 989 | JASNUB010000002.1 | GCA030176295_00870 | gene | open | 66122-66649 | |||
| 990 | JASNUB010000002.1 | GCA030176295_00871 | gene | open | 66849-68219 | apeA | ||
| 991 | JASNUB010000002.1 | GCA030176295_00872 | gene | open | 68409-68552 | |||
| 992 | JASNUB010000002.1 | GCA030176295_00873 | gene | open | 68549-69172 | |||
| 993 | JASNUB010000002.1 | GCA030176295_00874 | gene | open | 69387-69692 | |||
| 994 | JASNUB010000002.1 | GCA030176295_00875 | gene | open | 69762-70637 | ureD | ||
| 995 | JASNUB010000002.1 | GCA030176295_00876 | gene | open | 70639-71253 | ureG | ||
| 996 | JASNUB010000002.1 | GCA030176295_00877 | gene | open | 71335-72084 | ureF | ||
| 997 | JASNUB010000002.1 | GCA030176295_00878 | gene | open | 72065-72538 | ureE | ||
| 998 | JASNUB010000002.1 | GCA030176295_00879 | gene | open | 72587-74299 | ureC | ||
| 999 | JASNUB010000002.1 | GCA030176295_00881 | gene | open | 74353-74664 | |||
| 1000 | JASNUB010000002.1 | GCA030176295_00882 | gene | open | 74710-75012 |

