HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176595.1)

Select a Genome:
BAKTA Annotations for GCA_030176595.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
34 2277291 2043 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4202 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4202 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JASNUR010000013.1 GCA030176595_00234 gene open 35420-35698
3002 JASNUR010000013.1 GCA030176595_00235 gene open 35814-36209
3003 JASNUR010000013.1 GCA030176595_00236 gene open 36221-36847 sseB
3004 JASNUR010000013.1 GCA030176595_00237 gene open 36959-39970
3005 JASNUR010000013.1 GCA030176595_00239 gene open 40352-40984
3006 JASNUR010000013.1 GCA030176595_00240 gene open 41004-41210
3007 JASNUR010000013.1 GCA030176595_00241 gene open 41410-42768
3008 JASNUR010000013.1 GCA030176595_00242 gene open 42791-43537
3009 JASNUR010000013.1 GCA030176595_00243 gene open 43662-45341
3010 JASNUR010000013.1 GCA030176595_00244 gene open 45384-45869
3011 JASNUR010000013.1 GCA030176595_00245 gene open 45905-46774 mscS
3012 JASNUR010000013.1 GCA030176595_00246 gene open 46774-47343
3013 JASNUR010000013.1 GCA030176595_00247 gene open 47541-48875
3014 JASNUR010000013.1 GCA030176595_00248 gene open 48951-49775 hisN
3015 JASNUR010000013.1 GCA030176595_00249 gene open 49768-50676
3016 JASNUR010000013.1 GCA030176595_00250 gene open 50869-52014 prfB
3017 JASNUR010000013.1 GCA030176595_00251 gene open 52011-53702 abgT
3018 JASNUR010000013.1 GCA030176595_00252 gene open 53863-54552 ftsE
3019 JASNUR010000013.1 GCA030176595_00253 gene open 54598-55500 ftsX
3020 JASNUR010000013.1 GCA030176595_00254 gene open 55523-56032 smpB
3021 JASNUR010000013.1 GCA030176595_00255 gene open 56111-58117
3022 JASNUR010000013.1 GCA030176595_00256 gene open 58204-59235
3023 JASNUR010000013.1 GCA030176595_00258 gene open 60283-61008
3024 JASNUR010000013.1 GCA030176595_00259 gene open 61012-61308
3025 JASNUR010000013.1 GCA030176595_00260 gene open 61395-62885
3026 JASNUR010000013.1 GCA030176595_00261 gene open 63069-63512 doxX
3027 JASNUR010000013.1 GCA030176595_00262 gene open 63740-64789
3028 JASNUR010000013.1 GCA030176595_00263 gene open 64953-65996
3029 JASNUR010000013.1 GCA030176595_00264 gene open 65989-67140
3030 JASNUR010000013.1 GCA030176595_00265 gene open 67137-67892
3031 JASNUR010000013.1 GCA030176595_00266 gene open 67958-68938
3032 JASNUR010000013.1 GCA030176595_00238 gene open 40174-40250 trnfM
3033 JASNUR010000013.1 GCA030176595_00238 tRNA open 40174-40250 trnfM tRNA-fMet(cat)
3034 JASNUR010000014.1 GCA030176595_00327 gene open 61128-61222 Bacteria_small_SRP
3035 JASNUR010000014.1 GCA030176595_00327 ncRNA open 61128-61222 Bacterial small signal recognition particle RNA
3036 JASNUR010000014.1 GCA030176595_00268 CDS open 291-1676 _na     461_aa DNA polymerase III subunit delta'
3037 JASNUR010000014.1 GCA030176595_00269 CDS open 1720-3246 _na     508_aa Adenylate cyclase
3038 JASNUR010000014.1 GCA030176595_00270 CDS open 3369-4718 _na     449_aa DUF418 domain-containing protein
3039 JASNUR010000014.1 GCA030176595_00271 CDS open 4722-7706 _na     994_aa topA type I DNA topoisomerase
3040 JASNUR010000014.1 GCA030176595_00272 CDS open 7933-8136 _na     67_aa Cold-shock protein A
3041 JASNUR010000014.1 GCA030176595_00273 CDS open 8323-10707 _na     794_aa DEAD/DEAH box helicase
3042 JASNUR010000014.1 GCA030176595_00274 CDS open 10741-11115 _na     124_aa Helicase/secretion neighborhood TadE-like protein
3043 JASNUR010000014.1 GCA030176595_00275 CDS open 11112-11492 _na     126_aa tadE TadE family protein
3044 JASNUR010000014.1 GCA030176595_00276 CDS open 11443-11751 _na     102_aa DUF4244 domain-containing protein
3045 JASNUR010000014.1 GCA030176595_00277 CDS open 11802-12386 _na     194_aa gspF Type II secretion system protein GspF domain-containing protein
3046 JASNUR010000014.1 GCA030176595_00278 CDS open 12383-13183 _na     266_aa gspF Type II secretion system protein GspF domain-containing protein
3047 JASNUR010000014.1 GCA030176595_00279 CDS open 13180-14394 _na     404_aa Helicase/secretion neighborhood ATPase
3048 JASNUR010000014.1 GCA030176595_00280 CDS open 14492-15706 _na     404_aa ssd septum site-determining protein Ssd
3049 JASNUR010000014.1 GCA030176595_00281 CDS open 15977-16960 _na     327_aa HAD family hydrolase
3050 JASNUR010000014.1 GCA030176595_00282 CDS open 16957-17460 _na     167_aa Phage holin family protein
3051 JASNUR010000014.1 GCA030176595_00283 CDS open 17521-18486 _na     321_aa AB hydrolase-1 domain-containing protein
3052 JASNUR010000014.1 GCA030176595_00284 CDS open 18525-19721 _na     398_aa marP MarP family serine protease
3053 JASNUR010000014.1 GCA030176595_00285 CDS open 19757-20506 _na     249_aa Nudix hydrolase domain-containing protein
3054 JASNUR010000014.1 GCA030176595_00286 CDS open 20506-21189 _na     227_aa Thioredoxin domain-containing protein
3055 JASNUR010000014.1 GCA030176595_00287 CDS open 21548-22231 _na     227_aa Transcriptional regulator%2C Crp family protein
3056 JASNUR010000014.1 GCA030176595_00288 CDS open 22437-23264 _na     275_aa Metallo-beta-lactamase domain-containing protein
3057 JASNUR010000014.1 GCA030176595_00289 CDS open 23342-23812 _na     156_aa Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein
3058 JASNUR010000014.1 GCA030176595_00290 CDS open 23814-23969 _na     51_aa DUF4177 domain-containing protein
3059 JASNUR010000014.1 GCA030176595_00291 CDS open 24045-24398 _na     117_aa whiB Transcriptional regulator WhiB
3060 JASNUR010000014.1 GCA030176595_00292 CDS open 24570-26960 _na     796_aa peptidoglycan glycosyltransferase
3061 JASNUR010000014.1 GCA030176595_00293 CDS open 26957-27448 _na     163_aa GatB/YqeY domain-containing protein
3062 JASNUR010000014.1 GCA030176595_00294 CDS open 27573-28475 _na     300_aa Calcineurin-like phosphoesterase domain-containing protein
3063 JASNUR010000014.1 GCA030176595_00296 CDS open 28998-30377 _na     459_aa Collagen-like protein
3064 JASNUR010000014.1 GCA030176595_00297 CDS open 30602-30892 _na     96_aa Peptidase M23
3065 JASNUR010000014.1 GCA030176595_00298 CDS open 30980-32512 _na     510_aa X-X-X-Leu-X-X-Gly heptad repeats protein
3066 JASNUR010000014.1 GCA030176595_00299 CDS open 32732-34279 _na     515_aa Catalase core domain-containing protein
3067 JASNUR010000014.1 GCA030176595_00300 CDS open 34431-34979 _na     182_aa RNA polymerase sigma factor
3068 JASNUR010000014.1 GCA030176595_00301 CDS open 35068-36375 _na     435_aa ykvI Membrane protein YkvI
3069 JASNUR010000014.1 GCA030176595_00302 CDS open 36482-37519 _na     345_aa aspartate-semialdehyde dehydrogenase
3070 JASNUR010000014.1 GCA030176595_00303 CDS open 37564-38829 _na     421_aa aspartate kinase
3071 JASNUR010000014.1 GCA030176595_00304 CDS open 39179-41002 _na     607_aa leuA 2-isopropylmalate synthase
3072 JASNUR010000014.1 GCA030176595_00305 CDS open 41119-42573 _na     484_aa DNA polymerase III subunit epsilon
3073 JASNUR010000014.1 GCA030176595_00306 CDS open 42604-44040 _na     478_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
3074 JASNUR010000014.1 GCA030176595_00307 CDS open 44056-44892 _na     278_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
3075 JASNUR010000014.1 GCA030176595_00308 CDS open 44942-45859 _na     305_aa FAD-binding FR-type domain-containing protein
3076 JASNUR010000014.1 GCA030176595_00309 CDS open 45918-46577 _na     219_aa recR recombination mediator RecR
3077 JASNUR010000014.1 GCA030176595_00310 CDS open 46578-46916 _na     112_aa YbaB/EbfC family nucleoid-associated protein
3078 JASNUR010000014.1 GCA030176595_00311 CDS open 47043-49835 _na     930_aa DNA polymerase III subunit gamma and tau
3079 JASNUR010000014.1 GCA030176595_00312 CDS open 49914-50525 _na     203_aa Suppressor of fused-like domain-containing protein
3080 JASNUR010000014.1 GCA030176595_00313 CDS open 50473-51741 _na     422_aa Aminotransferase class I/classII domain-containing protein
3081 JASNUR010000014.1 GCA030176595_00314 CDS open 51893-52723 _na     276_aa ABC transporter domain-containing protein
3082 JASNUR010000014.1 GCA030176595_00315 CDS open 52716-53609 _na     297_aa ABC transporter permease
3083 JASNUR010000014.1 GCA030176595_00316 CDS open 53619-54809 _na     396_aa SsuA/THI5-like domain-containing protein
3084 JASNUR010000014.1 GCA030176595_00317 CDS open 55655-55909 _na     84_aa DUF6968 domain-containing protein
3085 JASNUR010000014.1 GCA030176595_00318 CDS open 55964-56470 _na     168_aa Transposase IS116/IS110/IS902 C-terminal domain-containing protein
3086 JASNUR010000014.1 GCA030176595_00319 CDS open 56487-56858 _na     123_aa Transposase IS110-like N-terminal domain-containing protein
3087 JASNUR010000014.1 GCA030176595_00320 CDS open 56982-57122 _na     46_aa hypothetical protein
3088 JASNUR010000014.1 GCA030176595_00321 CDS open 57362-57847 _na     161_aa Rrf2 family transcriptional regulator
3089 JASNUR010000014.1 GCA030176595_00322 CDS open 57867-59075 _na     402_aa nitric oxide dioxygenase
3090 JASNUR010000014.1 GCA030176595_00323 CDS open 59207-59497 _na     96_aa hypothetical protein
3091 JASNUR010000014.1 GCA030176595_00324 CDS open 59649-59945 _na     98_aa Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein
3092 JASNUR010000014.1 GCA030176595_00325 CDS open 59926-60087 _na     53_aa hypothetical protein
3093 JASNUR010000014.1 GCA030176595_00326 CDS open 60194-61009 _na     271_aa hypothetical protein
3094 JASNUR010000014.1 GCA030176595_00328 CDS open 61354-62727 _na     457_aa YibE/F family protein
3095 JASNUR010000014.1 GCA030176595_00329 CDS open 62912-63661 _na     249_aa HTH deoR-type domain-containing protein
3096 JASNUR010000014.1 GCA030176595_00330 CDS open 63638-64555 _na     305_aa FAD-binding FR-type domain-containing protein
3097 JASNUR010000014.1 GCA030176595_00331 CDS open 64618-65778 _na     386_aa Glycosyl transferase family 1 domain-containing protein
3098 JASNUR010000014.1 GCA030176595_00332 CDS open 65872-66468 _na     198_aa hypothetical protein
3099 JASNUR010000014.1 GCA030176595_00333 CDS open 66844-67617 _na     257_aa Methyltransferase type 11 domain-containing protein
3100 JASNUR010000014.1 GCA030176595_00334 CDS open 67623-68081 _na     152_aa Phage holin family protein
3101 JASNUR010000014.1 GCA030176595_00335 CDS open 68053-68226 _na     57_aa hypothetical protein
3102 JASNUR010000014.1 GCA030176595_00268 gene open 291-1676
3103 JASNUR010000014.1 GCA030176595_00269 gene open 1720-3246
3104 JASNUR010000014.1 GCA030176595_00270 gene open 3369-4718
3105 JASNUR010000014.1 GCA030176595_00271 gene open 4722-7706 topA
3106 JASNUR010000014.1 GCA030176595_00272 gene open 7933-8136
3107 JASNUR010000014.1 GCA030176595_00273 gene open 8323-10707
3108 JASNUR010000014.1 GCA030176595_00274 gene open 10741-11115
3109 JASNUR010000014.1 GCA030176595_00275 gene open 11112-11492 tadE
3110 JASNUR010000014.1 GCA030176595_00276 gene open 11443-11751
3111 JASNUR010000014.1 GCA030176595_00277 gene open 11802-12386 gspF
3112 JASNUR010000014.1 GCA030176595_00278 gene open 12383-13183 gspF
3113 JASNUR010000014.1 GCA030176595_00279 gene open 13180-14394
3114 JASNUR010000014.1 GCA030176595_00280 gene open 14492-15706 ssd
3115 JASNUR010000014.1 GCA030176595_00281 gene open 15977-16960
3116 JASNUR010000014.1 GCA030176595_00282 gene open 16957-17460
3117 JASNUR010000014.1 GCA030176595_00283 gene open 17521-18486
3118 JASNUR010000014.1 GCA030176595_00284 gene open 18525-19721 marP
3119 JASNUR010000014.1 GCA030176595_00285 gene open 19757-20506
3120 JASNUR010000014.1 GCA030176595_00286 gene open 20506-21189
3121 JASNUR010000014.1 GCA030176595_00287 gene open 21548-22231
3122 JASNUR010000014.1 GCA030176595_00288 gene open 22437-23264
3123 JASNUR010000014.1 GCA030176595_00289 gene open 23342-23812
3124 JASNUR010000014.1 GCA030176595_00290 gene open 23814-23969
3125 JASNUR010000014.1 GCA030176595_00291 gene open 24045-24398 whiB
3126 JASNUR010000014.1 GCA030176595_00292 gene open 24570-26960
3127 JASNUR010000014.1 GCA030176595_00293 gene open 26957-27448
3128 JASNUR010000014.1 GCA030176595_00294 gene open 27573-28475
3129 JASNUR010000014.1 GCA030176595_00296 gene open 28998-30377
3130 JASNUR010000014.1 GCA030176595_00297 gene open 30602-30892
3131 JASNUR010000014.1 GCA030176595_00298 gene open 30980-32512
3132 JASNUR010000014.1 GCA030176595_00299 gene open 32732-34279
3133 JASNUR010000014.1 GCA030176595_00300 gene open 34431-34979
3134 JASNUR010000014.1 GCA030176595_00301 gene open 35068-36375 ykvI
3135 JASNUR010000014.1 GCA030176595_00302 gene open 36482-37519
3136 JASNUR010000014.1 GCA030176595_00303 gene open 37564-38829
3137 JASNUR010000014.1 GCA030176595_00304 gene open 39179-41002 leuA
3138 JASNUR010000014.1 GCA030176595_00305 gene open 41119-42573
3139 JASNUR010000014.1 GCA030176595_00306 gene open 42604-44040 murT
3140 JASNUR010000014.1 GCA030176595_00307 gene open 44056-44892 gatD
3141 JASNUR010000014.1 GCA030176595_00308 gene open 44942-45859
3142 JASNUR010000014.1 GCA030176595_00309 gene open 45918-46577 recR
3143 JASNUR010000014.1 GCA030176595_00310 gene open 46578-46916
3144 JASNUR010000014.1 GCA030176595_00311 gene open 47043-49835
3145 JASNUR010000014.1 GCA030176595_00312 gene open 49914-50525
3146 JASNUR010000014.1 GCA030176595_00313 gene open 50473-51741
3147 JASNUR010000014.1 GCA030176595_00314 gene open 51893-52723
3148 JASNUR010000014.1 GCA030176595_00315 gene open 52716-53609
3149 JASNUR010000014.1 GCA030176595_00316 gene open 53619-54809
3150 JASNUR010000014.1 GCA030176595_00317 gene open 55655-55909
3151 JASNUR010000014.1 GCA030176595_00318 gene open 55964-56470
3152 JASNUR010000014.1 GCA030176595_00319 gene open 56487-56858
3153 JASNUR010000014.1 GCA030176595_00320 gene open 56982-57122
3154 JASNUR010000014.1 GCA030176595_00321 gene open 57362-57847
3155 JASNUR010000014.1 GCA030176595_00322 gene open 57867-59075
3156 JASNUR010000014.1 GCA030176595_00323 gene open 59207-59497
3157 JASNUR010000014.1 GCA030176595_00324 gene open 59649-59945
3158 JASNUR010000014.1 GCA030176595_00325 gene open 59926-60087
3159 JASNUR010000014.1 GCA030176595_00326 gene open 60194-61009
3160 JASNUR010000014.1 GCA030176595_00328 gene open 61354-62727
3161 JASNUR010000014.1 GCA030176595_00329 gene open 62912-63661
3162 JASNUR010000014.1 GCA030176595_00330 gene open 63638-64555
3163 JASNUR010000014.1 GCA030176595_00331 gene open 64618-65778
3164 JASNUR010000014.1 GCA030176595_00332 gene open 65872-66468
3165 JASNUR010000014.1 GCA030176595_00333 gene open 66844-67617
3166 JASNUR010000014.1 GCA030176595_00334 gene open 67623-68081
3167 JASNUR010000014.1 GCA030176595_00335 gene open 68053-68226
3168 JASNUR010000014.1 GCA030176595_00267 gene open 74-149 trnT
3169 JASNUR010000014.1 GCA030176595_00295 gene open 28598-28671 trnP
3170 JASNUR010000014.1 GCA030176595_00267 tRNA open 74-149 trnT tRNA-Thr(cgt)
3171 JASNUR010000014.1 GCA030176595_00295 tRNA open 28598-28671 trnP tRNA-Pro(tgg)
3172 JASNUR010000015.1 GCA030176595_00336 CDS open 251-352 _na     33_aa 30S ribosomal protein bS22
3173 JASNUR010000015.1 GCA030176595_00337 CDS open 604-795 _na     63_aa Helix-turn-helix domain-containing protein
3174 JASNUR010000015.1 GCA030176595_00338 CDS open 1149-1997 _na     282_aa proC pyrroline-5-carboxylate reductase
3175 JASNUR010000015.1 GCA030176595_00339 CDS open 2121-3569 _na     482_aa hypothetical protein
3176 JASNUR010000015.1 GCA030176595_00340 CDS open 3581-4510 _na     309_aa Ppx/GppA phosphatase N-terminal domain-containing protein
3177 JASNUR010000015.1 GCA030176595_00341 CDS open 4544-5446 _na     300_aa DUF3109 domain-containing protein
3178 JASNUR010000015.1 GCA030176595_00342 CDS open 5478-6176 _na     232_aa regX3 Sensory transduction protein RegX3
3179 JASNUR010000015.1 GCA030176595_00343 CDS open 6287-7696 _na     469_aa senX3 Sensor-like histidine kinase SenX3
3180 JASNUR010000015.1 GCA030176595_00344 CDS open 7702-8490 _na     262_aa phosphoglyceromutase
3181 JASNUR010000015.1 GCA030176595_00345 CDS open 8572-9891 _na     439_aa mshA D-inositol-3-phosphate glycosyltransferase
3182 JASNUR010000015.1 GCA030176595_00346 CDS open 10134-11852 _na     572_aa long-chain-fatty-acid--CoA ligase
3183 JASNUR010000015.1 GCA030176595_00347 CDS open 12326-14134 _na     602_aa long-chain-fatty-acid--CoA ligase
3184 JASNUR010000015.1 GCA030176595_00348 CDS open 14391-16274 _na     627_aa long-chain-fatty-acid--CoA ligase
3185 JASNUR010000015.1 GCA030176595_00349 CDS open 16516-25812 _na     3098_aa Ketosynthase family 3 (KS3) domain-containing protein
3186 JASNUR010000015.1 GCA030176595_00350 CDS open 26031-26996 _na     321_aa Polysaccharide deacetylase family protein
3187 JASNUR010000015.1 GCA030176595_00351 CDS open 27011-27454 _na     147_aa Bacterial Pleckstrin-like y domain-containing protein
3188 JASNUR010000015.1 GCA030176595_00352 CDS open 27636-28877 _na     413_aa Esterase
3189 JASNUR010000015.1 GCA030176595_00353 CDS open 28975-29478 _na     167_aa Bacterial spore germination immunoglobulin-like domain-containing protein
3190 JASNUR010000015.1 GCA030176595_00354 CDS open 29512-30696 _na     394_aa UDP-N-acetylmuramate dehydrogenase
3191 JASNUR010000015.1 GCA030176595_00355 CDS open 30723-31214 _na     163_aa DUF2505 domain-containing protein
3192 JASNUR010000015.1 GCA030176595_00356 CDS open 31244-32134 _na     296_aa DUF2993 domain-containing protein
3193 JASNUR010000015.1 GCA030176595_00357 CDS open 32166-33029 _na     287_aa Deoxyribose-phosphate aldolase
3194 JASNUR010000015.1 GCA030176595_00358 CDS open 33076-33465 _na     129_aa DUF2516 domain-containing protein
3195 JASNUR010000015.1 GCA030176595_00359 CDS open 33579-34016 _na     145_aa Transposase
3196 JASNUR010000015.1 GCA030176595_00360 CDS open 34111-35499 _na     462_aa DUF445 domain-containing protein
3197 JASNUR010000015.1 GCA030176595_00361 CDS open 35620-35988 _na     122_aa DUF2628 domain-containing protein
3198 JASNUR010000015.1 GCA030176595_00362 CDS open 36127-36876 _na     249_aa succinate dehydrogenase
3199 JASNUR010000015.1 GCA030176595_00363 CDS open 36876-38885 _na     669_aa Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
3200 JASNUR010000015.1 GCA030176595_00364 CDS open 38952-39707 _na     251_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
3201 JASNUR010000015.1 GCA030176595_00365 CDS open 40062-41489 _na     475_aa lpdA dihydrolipoyl dehydrogenase
3202 JASNUR010000015.1 GCA030176595_00366 CDS open 41683-41790 _na     35_aa hypothetical protein
3203 JASNUR010000015.1 GCA030176595_00367 CDS open 42266-43390 _na     374_aa Esterase
3204 JASNUR010000015.1 GCA030176595_00368 CDS open 43624-44610 _na     328_aa rfbB dTDP-glucose 4%2C6-dehydratase
3205 JASNUR010000015.1 GCA030176595_00369 CDS open 44626-45990 _na     454_aa rfbD dTDP-4-dehydrorhamnose reductase
3206 JASNUR010000015.1 GCA030176595_00370 CDS open 45997-46863 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
3207 JASNUR010000015.1 GCA030176595_00371 CDS open 46915-47856 _na     313_aa Thioredoxin domain-containing protein
3208 JASNUR010000015.1 GCA030176595_00372 CDS open 47874-48734 _na     286_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
3209 JASNUR010000015.1 GCA030176595_00373 CDS open 48847-49464 _na     205_aa Metallo-beta-lactamase domain-containing protein
3210 JASNUR010000015.1 GCA030176595_00374 CDS open 49470-50663 _na     397_aa S-(hydroxymethyl)mycothiol dehydrogenase
3211 JASNUR010000015.1 GCA030176595_00375 CDS open 50886-52529 _na     547_aa AMP-dependent synthetase/ligase domain-containing protein
3212 JASNUR010000015.1 GCA030176595_00376 CDS open 53004-53231 _na     75_aa hypothetical protein
3213 JASNUR010000015.1 GCA030176595_00377 CDS open 53178-53489 _na     103_aa hypothetical protein
3214 JASNUR010000015.1 GCA030176595_00378 CDS open 53830-54051 _na     73_aa hypothetical protein
3215 JASNUR010000015.1 GCA030176595_00379 CDS open 54494-54691 _na     65_aa hypothetical protein
3216 JASNUR010000015.1 GCA030176595_00380 CDS open 54751-54855 _na     34_aa hypothetical protein
3217 JASNUR010000015.1 GCA030176595_00381 CDS open 54852-56465 _na     537_aa TIGR04141 family sporadically distributed protein
3218 JASNUR010000015.1 GCA030176595_00382 CDS open 56468-59653 _na     1061_aa Type I restriction enzyme endonuclease subunit
3219 JASNUR010000015.1 GCA030176595_00383 CDS open 59646-60857 _na     403_aa restriction endonuclease subunit S
3220 JASNUR010000015.1 GCA030176595_00384 CDS open 60854-62461 _na     535_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
3221 JASNUR010000015.1 GCA030176595_00385 CDS open 62542-64494 _na     650_aa Hypothetical DNA-binding protein
3222 JASNUR010000015.1 GCA030176595_00386 CDS open 64929-66227 _na     432_aa Fic family protein
3223 JASNUR010000015.1 GCA030176595_00387 CDS open 66318-66686 _na     122_aa superoxide dismutase family protein
3224 JASNUR010000015.1 GCA030176595_00336 gene open 251-352
3225 JASNUR010000015.1 GCA030176595_00337 gene open 604-795
3226 JASNUR010000015.1 GCA030176595_00338 gene open 1149-1997 proC
3227 JASNUR010000015.1 GCA030176595_00339 gene open 2121-3569
3228 JASNUR010000015.1 GCA030176595_00340 gene open 3581-4510
3229 JASNUR010000015.1 GCA030176595_00341 gene open 4544-5446
3230 JASNUR010000015.1 GCA030176595_00342 gene open 5478-6176 regX3
3231 JASNUR010000015.1 GCA030176595_00343 gene open 6287-7696 senX3
3232 JASNUR010000015.1 GCA030176595_00344 gene open 7702-8490
3233 JASNUR010000015.1 GCA030176595_00345 gene open 8572-9891 mshA
3234 JASNUR010000015.1 GCA030176595_00346 gene open 10134-11852
3235 JASNUR010000015.1 GCA030176595_00347 gene open 12326-14134
3236 JASNUR010000015.1 GCA030176595_00348 gene open 14391-16274
3237 JASNUR010000015.1 GCA030176595_00349 gene open 16516-25812
3238 JASNUR010000015.1 GCA030176595_00350 gene open 26031-26996
3239 JASNUR010000015.1 GCA030176595_00351 gene open 27011-27454
3240 JASNUR010000015.1 GCA030176595_00352 gene open 27636-28877
3241 JASNUR010000015.1 GCA030176595_00353 gene open 28975-29478
3242 JASNUR010000015.1 GCA030176595_00354 gene open 29512-30696
3243 JASNUR010000015.1 GCA030176595_00355 gene open 30723-31214
3244 JASNUR010000015.1 GCA030176595_00356 gene open 31244-32134
3245 JASNUR010000015.1 GCA030176595_00357 gene open 32166-33029
3246 JASNUR010000015.1 GCA030176595_00358 gene open 33076-33465
3247 JASNUR010000015.1 GCA030176595_00359 gene open 33579-34016
3248 JASNUR010000015.1 GCA030176595_00360 gene open 34111-35499
3249 JASNUR010000015.1 GCA030176595_00361 gene open 35620-35988
3250 JASNUR010000015.1 GCA030176595_00362 gene open 36127-36876
3251 JASNUR010000015.1 GCA030176595_00363 gene open 36876-38885
3252 JASNUR010000015.1 GCA030176595_00364 gene open 38952-39707
3253 JASNUR010000015.1 GCA030176595_00365 gene open 40062-41489 lpdA
3254 JASNUR010000015.1 GCA030176595_00366 gene open 41683-41790
3255 JASNUR010000015.1 GCA030176595_00367 gene open 42266-43390
3256 JASNUR010000015.1 GCA030176595_00368 gene open 43624-44610 rfbB
3257 JASNUR010000015.1 GCA030176595_00369 gene open 44626-45990 rfbD
3258 JASNUR010000015.1 GCA030176595_00370 gene open 45997-46863 rfbA
3259 JASNUR010000015.1 GCA030176595_00371 gene open 46915-47856
3260 JASNUR010000015.1 GCA030176595_00372 gene open 47874-48734
3261 JASNUR010000015.1 GCA030176595_00373 gene open 48847-49464
3262 JASNUR010000015.1 GCA030176595_00374 gene open 49470-50663
3263 JASNUR010000015.1 GCA030176595_00375 gene open 50886-52529
3264 JASNUR010000015.1 GCA030176595_00376 gene open 53004-53231
3265 JASNUR010000015.1 GCA030176595_00377 gene open 53178-53489
3266 JASNUR010000015.1 GCA030176595_00378 gene open 53830-54051
3267 JASNUR010000015.1 GCA030176595_00379 gene open 54494-54691
3268 JASNUR010000015.1 GCA030176595_00380 gene open 54751-54855
3269 JASNUR010000015.1 GCA030176595_00381 gene open 54852-56465
3270 JASNUR010000015.1 GCA030176595_00382 gene open 56468-59653
3271 JASNUR010000015.1 GCA030176595_00383 gene open 59646-60857
3272 JASNUR010000015.1 GCA030176595_00384 gene open 60854-62461 hsdM
3273 JASNUR010000015.1 GCA030176595_00385 gene open 62542-64494
3274 JASNUR010000015.1 GCA030176595_00386 gene open 64929-66227
3275 JASNUR010000015.1 GCA030176595_00387 gene open 66318-66686
3276 JASNUR010000016.1 repeat_region open 49-1003 CRISPR array with 14 repeats of length 29%2C consensus sequence GGAATTACCTCCGCATACGCGGAGAAGAG and spacer length 41
3277 JASNUR010000016.1 GCA030176595_00388 CDS open 1015-1326 _na     103_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
3278 JASNUR010000016.1 GCA030176595_00389 CDS open 1327-2262 _na     311_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3279 JASNUR010000016.1 GCA030176595_00390 CDS open 2264-4939 _na     891_aa HD Cas3-type domain-containing protein
3280 JASNUR010000016.1 GCA030176595_00391 CDS open 4936-5622 _na     228_aa Type I-E CRISPR-associated protein Cas6/Cse3/CasE
3281 JASNUR010000016.1 GCA030176595_00392 CDS open 5879-7495 _na     538_aa Type I-E CRISPR-associated protein Cse1/CasA
3282 JASNUR010000016.1 GCA030176595_00393 CDS open 7492-8133 _na     213_aa Type I-E CRISPR-associated protein Cse2/CasB
3283 JASNUR010000016.1 GCA030176595_00394 CDS open 8154-9239 _na     361_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3284 JASNUR010000016.1 GCA030176595_00395 CDS open 9232-9945 _na     237_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3285 JASNUR010000016.1 GCA030176595_00396 CDS open 10025-11464 _na     479_aa DNA polymerase IV
3286 JASNUR010000016.1 GCA030176595_00397 CDS open 11461-12417 _na     318_aa L-asparaginase
3287 JASNUR010000016.1 GCA030176595_00398 CDS open 12525-13148 _na     207_aa Secreted protein
3288 JASNUR010000016.1 GCA030176595_00399 CDS open 13251-14924 _na     557_aa L-lactate permease
3289 JASNUR010000016.1 GCA030176595_00400 CDS open 15297-16478 _na     393_aa Oxidoreductase
3290 JASNUR010000016.1 GCA030176595_00401 CDS open 16597-17124 _na     175_aa lspA signal peptidase II
3291 JASNUR010000016.1 GCA030176595_00402 CDS open 17114-18049 _na     311_aa Pseudouridine synthase
3292 JASNUR010000016.1 GCA030176595_00403 CDS open 18090-18809 _na     239_aa Secreted protein
3293 JASNUR010000016.1 GCA030176595_00404 CDS open 18820-19011 _na     63_aa Lipoprotein
3294 JASNUR010000016.1 GCA030176595_00405 CDS open 19035-22613 _na     1192_aa dnaE DNA polymerase III subunit alpha
3295 JASNUR010000016.1 GCA030176595_00406 CDS open 22701-24002 _na     433_aa ilvA threonine ammonia-lyase IlvA
3296 JASNUR010000016.1 GCA030176595_00407 CDS open 24016-24663 _na     215_aa yigZ YigZ family protein
3297 JASNUR010000016.1 GCA030176595_00408 CDS open 24670-24906 _na     78_aa Secreted protein
3298 JASNUR010000016.1 GCA030176595_00409 CDS open 24915-25313 _na     132_aa RNA-binding S4 domain-containing protein
3299 JASNUR010000016.1 GCA030176595_00410 CDS open 25370-26053 _na     227_aa hypothetical protein
3300 JASNUR010000016.1 GCA030176595_00411 CDS open 26207-29128 _na     973_aa D-lactate dehydrogenase (cytochrome)
3301 JASNUR010000016.1 GCA030176595_00412 CDS open 29183-29956 _na     257_aa Glucosamine-6-phosphate deaminase
3302 JASNUR010000016.1 GCA030176595_00413 CDS open 29996-31180 _na     394_aa Amidohydrolase-related domain-containing protein
3303 JASNUR010000016.1 GCA030176595_00414 CDS open 31334-32275 _na     313_aa N-acetylneuraminate lyase
3304 JASNUR010000016.1 GCA030176595_00415 CDS open 32278-33282 _na     334_aa Glucokinase
3305 JASNUR010000016.1 GCA030176595_00416 CDS open 33435-34166 _na     243_aa N-acylglucosamine-6-phosphate 2-epimerase
3306 JASNUR010000016.1 GCA030176595_00417 CDS open 34213-34914 _na     233_aa HTH gntR-type domain-containing protein
3307 JASNUR010000016.1 GCA030176595_00418 CDS open 35285-36928 _na     547_aa Solute-binding protein family 5 domain-containing protein
3308 JASNUR010000016.1 GCA030176595_00419 CDS open 36940-37905 _na     321_aa ABC transmembrane type-1 domain-containing protein
3309 JASNUR010000016.1 GCA030176595_00420 CDS open 37905-39956 _na     683_aa ABC transporter domain-containing protein
3310 JASNUR010000016.1 GCA030176595_00421 CDS open 39962-40795 _na     277_aa ABC transporter domain-containing protein
3311 JASNUR010000016.1 GCA030176595_00422 CDS open 40894-41583 _na     229_aa Peptidase S1 domain-containing protein
3312 JASNUR010000016.1 GCA030176595_00423 CDS open 41620-43365 _na     581_aa BCCT family transporter
3313 JASNUR010000016.1 GCA030176595_00424 CDS open 43465-44841 _na     458_aa BRCT domain-containing protein
3314 JASNUR010000016.1 GCA030176595_00425 CDS open 44925-45704 _na     259_aa HTH tetR-type domain-containing protein
3315 JASNUR010000016.1 GCA030176595_00426 CDS open 45804-46511 _na     235_aa DUF4878 domain-containing protein
3316 JASNUR010000016.1 GCA030176595_00427 CDS open 46515-47051 _na     178_aa DUF2567 domain-containing protein
3317 JASNUR010000016.1 GCA030176595_00428 CDS open 47074-48399 _na     441_aa Histidinol dehydrogenase
3318 JASNUR010000016.1 GCA030176595_00429 CDS open 48403-49497 _na     364_aa histidinol-phosphate transaminase
3319 JASNUR010000016.1 GCA030176595_00430 CDS open 49494-50099 _na     201_aa hisB imidazoleglycerol-phosphate dehydratase HisB
3320 JASNUR010000016.1 GCA030176595_00431 CDS open 50099-50266 _na     55_aa Major facilitator superfamily (MFS) profile domain-containing protein
3321 JASNUR010000016.1 GCA030176595_00432 CDS open 50323-51705 _na     460_aa Major facilitator superfamily (MFS) profile domain-containing protein
3322 JASNUR010000016.1 GCA030176595_00433 CDS open 51721-52353 _na     210_aa hisH imidazole glycerol phosphate synthase subunit HisH
3323 JASNUR010000016.1 GCA030176595_00434 CDS open 52395-53156 _na     253_aa priA bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA
3324 JASNUR010000016.1 GCA030176595_00435 CDS open 53169-53990 _na     273_aa Inositol-phosphate phosphatase
3325 JASNUR010000016.1 GCA030176595_00436 CDS open 54082-54861 _na     259_aa hisF Imidazole glycerol phosphate synthase subunit HisF
3326 JASNUR010000016.1 GCA030176595_00437 CDS open 54858-55223 _na     121_aa hisI phosphoribosyl-AMP cyclohydrolase
3327 JASNUR010000016.1 GCA030176595_00438 CDS open 55228-55899 _na     223_aa TIGR02234 family membrane protein
3328 JASNUR010000016.1 GCA030176595_00439 CDS open 56059-56937 _na     292_aa indole-3-glycerol-phosphate synthase
3329 JASNUR010000016.1 GCA030176595_00440 CDS open 57052-57951 _na     299_aa lgt prolipoprotein diacylglyceryl transferase
3330 JASNUR010000016.1 GCA030176595_00441 CDS open 57982-59412 _na     476_aa pyk pyruvate kinase
3331 JASNUR010000016.1 GCA030176595_00442 CDS open 59453-60694 _na     413_aa Amidohydrolase
3332 JASNUR010000016.1 GCA030176595_00388 gene open 1015-1326 cas2e
3333 JASNUR010000016.1 GCA030176595_00389 gene open 1327-2262 cas1e
3334 JASNUR010000016.1 GCA030176595_00390 gene open 2264-4939
3335 JASNUR010000016.1 GCA030176595_00391 gene open 4936-5622
3336 JASNUR010000016.1 GCA030176595_00392 gene open 5879-7495
3337 JASNUR010000016.1 GCA030176595_00393 gene open 7492-8133
3338 JASNUR010000016.1 GCA030176595_00394 gene open 8154-9239 cas7e
3339 JASNUR010000016.1 GCA030176595_00395 gene open 9232-9945 cas5e
3340 JASNUR010000016.1 GCA030176595_00396 gene open 10025-11464
3341 JASNUR010000016.1 GCA030176595_00397 gene open 11461-12417
3342 JASNUR010000016.1 GCA030176595_00398 gene open 12525-13148
3343 JASNUR010000016.1 GCA030176595_00399 gene open 13251-14924
3344 JASNUR010000016.1 GCA030176595_00400 gene open 15297-16478
3345 JASNUR010000016.1 GCA030176595_00401 gene open 16597-17124 lspA
3346 JASNUR010000016.1 GCA030176595_00402 gene open 17114-18049
3347 JASNUR010000016.1 GCA030176595_00403 gene open 18090-18809
3348 JASNUR010000016.1 GCA030176595_00404 gene open 18820-19011
3349 JASNUR010000016.1 GCA030176595_00405 gene open 19035-22613 dnaE
3350 JASNUR010000016.1 GCA030176595_00406 gene open 22701-24002 ilvA
3351 JASNUR010000016.1 GCA030176595_00407 gene open 24016-24663 yigZ
3352 JASNUR010000016.1 GCA030176595_00408 gene open 24670-24906
3353 JASNUR010000016.1 GCA030176595_00409 gene open 24915-25313
3354 JASNUR010000016.1 GCA030176595_00410 gene open 25370-26053
3355 JASNUR010000016.1 GCA030176595_00411 gene open 26207-29128
3356 JASNUR010000016.1 GCA030176595_00412 gene open 29183-29956
3357 JASNUR010000016.1 GCA030176595_00413 gene open 29996-31180
3358 JASNUR010000016.1 GCA030176595_00414 gene open 31334-32275
3359 JASNUR010000016.1 GCA030176595_00415 gene open 32278-33282
3360 JASNUR010000016.1 GCA030176595_00416 gene open 33435-34166
3361 JASNUR010000016.1 GCA030176595_00417 gene open 34213-34914
3362 JASNUR010000016.1 GCA030176595_00418 gene open 35285-36928
3363 JASNUR010000016.1 GCA030176595_00419 gene open 36940-37905
3364 JASNUR010000016.1 GCA030176595_00420 gene open 37905-39956
3365 JASNUR010000016.1 GCA030176595_00421 gene open 39962-40795
3366 JASNUR010000016.1 GCA030176595_00422 gene open 40894-41583
3367 JASNUR010000016.1 GCA030176595_00423 gene open 41620-43365
3368 JASNUR010000016.1 GCA030176595_00424 gene open 43465-44841
3369 JASNUR010000016.1 GCA030176595_00425 gene open 44925-45704
3370 JASNUR010000016.1 GCA030176595_00426 gene open 45804-46511
3371 JASNUR010000016.1 GCA030176595_00427 gene open 46515-47051
3372 JASNUR010000016.1 GCA030176595_00428 gene open 47074-48399
3373 JASNUR010000016.1 GCA030176595_00429 gene open 48403-49497
3374 JASNUR010000016.1 GCA030176595_00430 gene open 49494-50099 hisB
3375 JASNUR010000016.1 GCA030176595_00431 gene open 50099-50266
3376 JASNUR010000016.1 GCA030176595_00432 gene open 50323-51705
3377 JASNUR010000016.1 GCA030176595_00433 gene open 51721-52353 hisH
3378 JASNUR010000016.1 GCA030176595_00434 gene open 52395-53156 priA
3379 JASNUR010000016.1 GCA030176595_00435 gene open 53169-53990
3380 JASNUR010000016.1 GCA030176595_00436 gene open 54082-54861 hisF
3381 JASNUR010000016.1 GCA030176595_00437 gene open 54858-55223 hisI
3382 JASNUR010000016.1 GCA030176595_00438 gene open 55228-55899
3383 JASNUR010000016.1 GCA030176595_00439 gene open 56059-56937
3384 JASNUR010000016.1 GCA030176595_00440 gene open 57052-57951 lgt
3385 JASNUR010000016.1 GCA030176595_00441 gene open 57982-59412 pyk
3386 JASNUR010000016.1 GCA030176595_00442 gene open 59453-60694
3387 JASNUR010000017.1 GCA030176595_00443 CDS open 70-951 _na     293_aa hypothetical protein
3388 JASNUR010000017.1 GCA030176595_00444 CDS open 1487-2794 _na     435_aa dcuA C4-dicarboxylate transporter DcuA
3389 JASNUR010000017.1 GCA030176595_00445 CDS open 2811-4271 _na     486_aa Divalent anion:Na+ symporter (DASS) family transporter
3390 JASNUR010000017.1 GCA030176595_00446 CDS open 4273-4677 _na     134_aa panD aspartate 1-decarboxylase
3391 JASNUR010000017.1 GCA030176595_00447 CDS open 4829-6130 _na     433_aa galK galactokinase
3392 JASNUR010000017.1 GCA030176595_00448 CDS open 6123-7331 _na     402_aa galT galactose-1-phosphate uridylyltransferase
3393 JASNUR010000017.1 GCA030176595_00449 CDS open 7346-7660 _na     104_aa Cell wall anchor protein
3394 JASNUR010000017.1 GCA030176595_00450 CDS open 7679-9334 _na     551_aa Solute:sodium symporter (SSS) family transporter
3395 JASNUR010000017.1 GCA030176595_00451 CDS open 9503-10432 _na     309_aa aldose epimerase
3396 JASNUR010000017.1 GCA030176595_00452 CDS open 10660-12249 _na     529_aa PepSY domain-containing protein
3397 JASNUR010000017.1 GCA030176595_00453 CDS open 12266-14068 _na     600_aa betA choline dehydrogenase
3398 JASNUR010000017.1 GCA030176595_00454 CDS open 14287-16446 _na     719_aa High-affinity choline transporter
3399 JASNUR010000017.1 GCA030176595_00455 CDS open 16583-16756 _na     57_aa hypothetical protein
3400 JASNUR010000017.1 GCA030176595_00456 CDS open 16884-17774 _na     296_aa Peptidase S1 domain-containing protein
3401 JASNUR010000017.1 GCA030176595_00457 CDS open 17832-18593 _na     253_aa Peptidase S1 domain-containing protein
3402 JASNUR010000017.1 GCA030176595_00458 CDS open 18600-20273 _na     557_aa Aldehyde dehydrogenase domain-containing protein
3403 JASNUR010000017.1 GCA030176595_00459 CDS open 20274-21128 _na     284_aa prsW Protease PrsW
3404 JASNUR010000017.1 GCA030176595_00460 CDS open 21131-21832 _na     233_aa DUF3515 domain-containing protein
3405 JASNUR010000017.1 GCA030176595_00461 CDS open 21861-23846 _na     661_aa Peptidase M13
3406 JASNUR010000017.1 GCA030176595_00462 CDS open 23892-24506 _na     204_aa Maltokinase N-terminal cap domain-containing protein
3407 JASNUR010000017.1 GCA030176595_00463 CDS open 24650-25555 _na     301_aa Alpha/beta hydrolase fold domain-containing protein
3408 JASNUR010000017.1 GCA030176595_00464 CDS open 25555-26448 _na     297_aa Glycosyltransferase 2-like domain-containing protein
3409 JASNUR010000017.1 GCA030176595_00465 CDS open 26461-27801 _na     446_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3410 JASNUR010000017.1 GCA030176595_00466 CDS open 27818-28510 _na     230_aa Glycosyltransferase 2-like domain-containing protein
3411 JASNUR010000017.1 GCA030176595_00467 CDS open 28511-28918 _na     135_aa DUF2304 domain-containing protein
3412 JASNUR010000017.1 GCA030176595_00468 CDS open 28979-29911 _na     310_aa NAD-dependent epimerase/dehydratase domain-containing protein
3413 JASNUR010000017.1 GCA030176595_00469 CDS open 29936-31960 _na     674_aa Galactan 5-O-arabinofuranosyltransferase
3414 JASNUR010000017.1 GCA030176595_00470 CDS open 31964-35299 _na     1111_aa Arabinosyltransferase C
3415 JASNUR010000017.1 GCA030176595_00471 CDS open 35374-37287 _na     637_aa Galactan 5-O-arabinofuranosyltransferase
3416 JASNUR010000017.1 GCA030176595_00472 CDS open 37318-38079 _na     253_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
3417 JASNUR010000017.1 GCA030176595_00473 CDS open 38147-39562 _na     471_aa FAD-binding PCMH-type domain-containing protein
3418 JASNUR010000017.1 GCA030176595_00474 CDS open 39571-39819 _na     82_aa hypothetical protein
3419 JASNUR010000017.1 GCA030176595_00475 CDS open 39886-40743 _na     285_aa DUF2877 domain-containing protein
3420 JASNUR010000017.1 GCA030176595_00476 CDS open 40827-41294 _na     155_aa GtrA/DPMS transmembrane domain-containing protein
3421 JASNUR010000017.1 GCA030176595_00477 CDS open 41331-41867 _na     178_aa Suppressor of fused-like domain-containing protein
3422 JASNUR010000017.1 GCA030176595_00478 CDS open 41944-42888 _na     314_aa Glycosyltransferase 2-like domain-containing protein
3423 JASNUR010000017.1 GCA030176595_00479 CDS open 42933-43718 _na     261_aa ABC transporter domain-containing protein
3424 JASNUR010000017.1 GCA030176595_00480 CDS open 43764-44681 _na     305_aa ABC-2 type transporter transmembrane domain-containing protein
3425 JASNUR010000017.1 GCA030176595_00481 CDS open 44838-46073 _na     411_aa Aminotransferase class V domain-containing protein
3426 JASNUR010000017.1 GCA030176595_00482 CDS open 46070-47110 _na     346_aa Enoyl reductase (ER) domain-containing protein
3427 JASNUR010000017.1 GCA030176595_00484 CDS open 47392-47613 _na     73_aa Cell wall anchor protein
3428 JASNUR010000017.1 GCA030176595_00485 CDS open 47800-48219 _na     139_aa Phage holin family protein
3429 JASNUR010000017.1 GCA030176595_00486 CDS open 48219-49253 _na     344_aa hisC histidinol-phosphate transaminase
3430 JASNUR010000017.1 GCA030176595_00488 CDS open 49518-50906 _na     462_aa Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein
3431 JASNUR010000017.1 GCA030176595_00489 CDS open 50936-51676 _na     246_aa DUF2470 domain-containing protein
3432 JASNUR010000017.1 GCA030176595_00490 CDS open 51823-53187 _na     454_aa mgtE magnesium transporter
3433 JASNUR010000017.1 GCA030176595_00491 CDS open 53254-54837 _na     527_aa Divalent anion:Na+ symporter (DASS) family transporter
3434 JASNUR010000017.1 GCA030176595_00443 gene open 70-951
3435 JASNUR010000017.1 GCA030176595_00444 gene open 1487-2794 dcuA
3436 JASNUR010000017.1 GCA030176595_00445 gene open 2811-4271
3437 JASNUR010000017.1 GCA030176595_00446 gene open 4273-4677 panD
3438 JASNUR010000017.1 GCA030176595_00447 gene open 4829-6130 galK
3439 JASNUR010000017.1 GCA030176595_00448 gene open 6123-7331 galT
3440 JASNUR010000017.1 GCA030176595_00449 gene open 7346-7660
3441 JASNUR010000017.1 GCA030176595_00450 gene open 7679-9334
3442 JASNUR010000017.1 GCA030176595_00451 gene open 9503-10432
3443 JASNUR010000017.1 GCA030176595_00452 gene open 10660-12249
3444 JASNUR010000017.1 GCA030176595_00453 gene open 12266-14068 betA
3445 JASNUR010000017.1 GCA030176595_00454 gene open 14287-16446
3446 JASNUR010000017.1 GCA030176595_00455 gene open 16583-16756
3447 JASNUR010000017.1 GCA030176595_00456 gene open 16884-17774
3448 JASNUR010000017.1 GCA030176595_00457 gene open 17832-18593
3449 JASNUR010000017.1 GCA030176595_00458 gene open 18600-20273
3450 JASNUR010000017.1 GCA030176595_00459 gene open 20274-21128 prsW
3451 JASNUR010000017.1 GCA030176595_00460 gene open 21131-21832
3452 JASNUR010000017.1 GCA030176595_00461 gene open 21861-23846
3453 JASNUR010000017.1 GCA030176595_00462 gene open 23892-24506
3454 JASNUR010000017.1 GCA030176595_00463 gene open 24650-25555
3455 JASNUR010000017.1 GCA030176595_00464 gene open 25555-26448
3456 JASNUR010000017.1 GCA030176595_00465 gene open 26461-27801
3457 JASNUR010000017.1 GCA030176595_00466 gene open 27818-28510
3458 JASNUR010000017.1 GCA030176595_00467 gene open 28511-28918
3459 JASNUR010000017.1 GCA030176595_00468 gene open 28979-29911
3460 JASNUR010000017.1 GCA030176595_00469 gene open 29936-31960
3461 JASNUR010000017.1 GCA030176595_00470 gene open 31964-35299
3462 JASNUR010000017.1 GCA030176595_00471 gene open 35374-37287
3463 JASNUR010000017.1 GCA030176595_00472 gene open 37318-38079
3464 JASNUR010000017.1 GCA030176595_00473 gene open 38147-39562
3465 JASNUR010000017.1 GCA030176595_00474 gene open 39571-39819
3466 JASNUR010000017.1 GCA030176595_00475 gene open 39886-40743
3467 JASNUR010000017.1 GCA030176595_00476 gene open 40827-41294
3468 JASNUR010000017.1 GCA030176595_00477 gene open 41331-41867
3469 JASNUR010000017.1 GCA030176595_00478 gene open 41944-42888
3470 JASNUR010000017.1 GCA030176595_00479 gene open 42933-43718
3471 JASNUR010000017.1 GCA030176595_00480 gene open 43764-44681
3472 JASNUR010000017.1 GCA030176595_00481 gene open 44838-46073
3473 JASNUR010000017.1 GCA030176595_00482 gene open 46070-47110
3474 JASNUR010000017.1 GCA030176595_00484 gene open 47392-47613
3475 JASNUR010000017.1 GCA030176595_00485 gene open 47800-48219
3476 JASNUR010000017.1 GCA030176595_00486 gene open 48219-49253 hisC
3477 JASNUR010000017.1 GCA030176595_00488 gene open 49518-50906
3478 JASNUR010000017.1 GCA030176595_00489 gene open 50936-51676
3479 JASNUR010000017.1 GCA030176595_00490 gene open 51823-53187 mgtE
3480 JASNUR010000017.1 GCA030176595_00491 gene open 53254-54837
3481 JASNUR010000017.1 GCA030176595_00483 gene open 47138-47225 trnS
3482 JASNUR010000017.1 GCA030176595_00487 gene open 49334-49422 trnS
3483 JASNUR010000017.1 GCA030176595_00492 gene open 54995-55067 trnR
3484 JASNUR010000017.1 GCA030176595_00483 tRNA open 47138-47225 trnS tRNA-Ser(tga)
3485 JASNUR010000017.1 GCA030176595_00487 tRNA open 49334-49422 trnS tRNA-Ser(gct)
3486 JASNUR010000017.1 GCA030176595_00492 tRNA open 54995-55067 trnR tRNA-Arg(acg)
3487 JASNUR010000018.1 GCA030176595_00493 CDS open 128-1027 _na     299_aa Oxidoreductase
3488 JASNUR010000018.1 GCA030176595_00496 CDS open 1847-2140 _na     97_aa N-acetyltransferase domain-containing protein
3489 JASNUR010000018.1 GCA030176595_00497 CDS open 2406-2972 _na     188_aa epsC serine O-acetyltransferase EpsC
3490 JASNUR010000018.1 GCA030176595_00498 CDS open 2993-3928 _na     311_aa cysK cysteine synthase A
3491 JASNUR010000018.1 GCA030176595_00499 CDS open 4248-5090 _na     280_aa ramA acetate metabolism transcriptional regulator RamA
3492 JASNUR010000018.1 GCA030176595_00500 CDS open 5121-6383 _na     420_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
3493 JASNUR010000018.1 GCA030176595_00501 CDS open 6510-7328 _na     272_aa ABC transporter domain-containing protein
3494 JASNUR010000018.1 GCA030176595_00502 CDS open 7331-9946 _na     871_aa ABC3 transporter permease protein domain-containing protein
3495 JASNUR010000018.1 GCA030176595_00503 CDS open 9948-10469 _na     173_aa mauE Methylamine utilisation protein MauE domain-containing protein
3496 JASNUR010000018.1 GCA030176595_00504 CDS open 10535-11254 _na     239_aa Thioredoxin-like fold domain-containing protein
3497 JASNUR010000018.1 GCA030176595_00506 CDS open 11808-11993 _na     61_aa Secreted protein
3498 JASNUR010000018.1 GCA030176595_00507 CDS open 12073-13263 _na     396_aa Cytochrome P450
3499 JASNUR010000018.1 GCA030176595_00508 CDS open 13360-13902 _na     180_aa DUF4149 domain-containing protein
3500 JASNUR010000018.1 GCA030176595_00509 CDS open 13954-14796 _na     280_aa dedA DedA family protein