HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176795.1)

Select a Genome:
BAKTA Annotations for GCA_030176795.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
33 2295525 2079 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4274 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4274 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JASNVH010000001.1 GCA030176795_00784 gene open 174669-174763 Bacteria_small_SRP
2 JASNVH010000001.1 GCA030176795_00784 ncRNA open 174669-174763 Bacterial small signal recognition particle RNA
3 JASNVH010000001.1 repeat_region open 70400-71341 CRISPR array with 15 repeats of length 36%2C consensus sequence GAAGTATATCAGGGGTAATGAGAACTGAACCCCAGC and spacer length 28
4 JASNVH010000001.1 GCA030176795_00638 CDS open 395-1411 _na     338_aa Geranylgeranyl pyrophosphate synthase
5 JASNVH010000001.1 GCA030176795_00639 CDS open 1522-2955 _na     477_aa FAD-binding domain-containing protein
6 JASNVH010000001.1 GCA030176795_00640 CDS open 3072-3383 _na     103_aa hypothetical protein
7 JASNVH010000001.1 GCA030176795_00641 CDS open 3577-4377 _na     266_aa demethylmenaquinone methyltransferase
8 JASNVH010000001.1 GCA030176795_00642 CDS open 4387-5613 _na     408_aa Glycosyltransferase family 1 protein
9 JASNVH010000001.1 GCA030176795_00643 CDS open 5656-6228 _na     190_aa DUF3592 domain-containing protein
10 JASNVH010000001.1 GCA030176795_00644 CDS open 6241-8019 _na     592_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
11 JASNVH010000001.1 GCA030176795_00645 CDS open 8157-8951 _na     264_aa hypothetical protein
12 JASNVH010000001.1 GCA030176795_00646 CDS open 8988-11735 _na     915_aa UvrABC system protein A
13 JASNVH010000001.1 GCA030176795_00647 CDS open 11677-12831 _na     384_aa o-succinylbenzoate synthase
14 JASNVH010000001.1 GCA030176795_00648 CDS open 12859-13878 _na     339_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
15 JASNVH010000001.1 GCA030176795_00649 CDS open 13985-15178 _na     397_aa menE o-succinylbenzoate--CoA ligase
16 JASNVH010000001.1 GCA030176795_00650 CDS open 15274-16356 _na     360_aa Aldo/keto reductase
17 JASNVH010000001.1 GCA030176795_00651 CDS open 16521-17411 _na     296_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
18 JASNVH010000001.1 GCA030176795_00652 CDS open 17567-18496 _na     309_aa AEC family transporter
19 JASNVH010000001.1 GCA030176795_00653 CDS open 18512-18982 _na     156_aa DUF4229 domain-containing protein
20 JASNVH010000001.1 GCA030176795_00654 CDS open 19019-19429 _na     136_aa Secreted protein
21 JASNVH010000001.1 GCA030176795_00655 CDS open 19638-20630 _na     330_aa ccsB c-type cytochrome biogenesis protein CcsB
22 JASNVH010000001.1 GCA030176795_00656 CDS open 20886-22550 _na     554_aa ResB-like domain-containing protein
23 JASNVH010000001.1 GCA030176795_00657 CDS open 22626-23582 _na     318_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
24 JASNVH010000001.1 GCA030176795_00658 CDS open 23625-24275 _na     216_aa Thioredoxin domain-containing protein
25 JASNVH010000001.1 GCA030176795_00659 CDS open 24339-25055 _na     238_aa Phosphoglycerate mutase
26 JASNVH010000001.1 GCA030176795_00660 CDS open 25281-26699 _na     472_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
27 JASNVH010000001.1 GCA030176795_00661 CDS open 26776-28323 _na     515_aa protoporphyrinogen oxidase
28 JASNVH010000001.1 GCA030176795_00662 CDS open 28417-29367 _na     316_aa hemE uroporphyrinogen decarboxylase
29 JASNVH010000001.1 GCA030176795_00663 CDS open 29601-30485 _na     294_aa hypothetical protein
30 JASNVH010000001.1 GCA030176795_00664 CDS open 30490-31479 _na     329_aa hemB porphobilinogen synthase
31 JASNVH010000001.1 GCA030176795_00665 CDS open 31654-33390 _na     578_aa Tetrapyrrole methylase domain-containing protein
32 JASNVH010000001.1 GCA030176795_00666 CDS open 33672-34565 _na     297_aa hemC hydroxymethylbilane synthase
33 JASNVH010000001.1 GCA030176795_00667 CDS open 34637-36103 _na     488_aa glutamyl-tRNA reductase
34 JASNVH010000001.1 GCA030176795_00668 CDS open 36363-36746 _na     127_aa Glutaredoxin domain-containing protein
35 JASNVH010000001.1 GCA030176795_00669 CDS open 37077-38153 _na     358_aa HAD hydrolase%2C family IB
36 JASNVH010000001.1 GCA030176795_00670 CDS open 38372-40003 _na     543_aa HNH nuclease domain-containing protein
37 JASNVH010000001.1 GCA030176795_00671 CDS open 40159-40260 _na     33_aa 30S ribosomal protein bS22
38 JASNVH010000001.1 GCA030176795_00672 CDS open 40512-40703 _na     63_aa Helix-turn-helix domain-containing protein
39 JASNVH010000001.1 GCA030176795_00673 CDS open 41057-41905 _na     282_aa proC pyrroline-5-carboxylate reductase
40 JASNVH010000001.1 GCA030176795_00674 CDS open 42029-43471 _na     480_aa hypothetical protein
41 JASNVH010000001.1 GCA030176795_00675 CDS open 43483-44412 _na     309_aa Ppx/GppA phosphatase N-terminal domain-containing protein
42 JASNVH010000001.1 GCA030176795_00676 CDS open 44446-45348 _na     300_aa DUF3109 domain-containing protein
43 JASNVH010000001.1 GCA030176795_00677 CDS open 45361-46059 _na     232_aa regX3 Sensory transduction protein RegX3
44 JASNVH010000001.1 GCA030176795_00678 CDS open 46170-47603 _na     477_aa senX3 Sensor-like histidine kinase SenX3
45 JASNVH010000001.1 GCA030176795_00679 CDS open 47608-48396 _na     262_aa phosphoglyceromutase
46 JASNVH010000001.1 GCA030176795_00680 CDS open 48478-49797 _na     439_aa mshA D-inositol-3-phosphate glycosyltransferase
47 JASNVH010000001.1 GCA030176795_00681 CDS open 50055-51773 _na     572_aa long-chain-fatty-acid--CoA ligase
48 JASNVH010000001.1 GCA030176795_00682 CDS open 52285-54069 _na     594_aa long-chain-fatty-acid--CoA ligase
49 JASNVH010000001.1 GCA030176795_00683 CDS open 54326-56110 _na     594_aa long-chain-fatty-acid--CoA ligase
50 JASNVH010000001.1 GCA030176795_00684 CDS open 56360-65650 _na     3096_aa Ketosynthase family 3 (KS3) domain-containing protein
51 JASNVH010000001.1 GCA030176795_00685 CDS open 65820-69119 _na     1099_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
52 JASNVH010000001.1 GCA030176795_00686 CDS open 69122-70036 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
53 JASNVH010000001.1 GCA030176795_00687 CDS open 70044-70349 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
54 JASNVH010000001.1 GCA030176795_00688 CDS open 71571-72536 _na     321_aa Polysaccharide deacetylase family protein
55 JASNVH010000001.1 GCA030176795_00689 CDS open 72551-72994 _na     147_aa Bacterial Pleckstrin-like y domain-containing protein
56 JASNVH010000001.1 GCA030176795_00690 CDS open 73175-74416 _na     413_aa Esterase
57 JASNVH010000001.1 GCA030176795_00691 CDS open 74514-75017 _na     167_aa Bacterial spore germination immunoglobulin-like domain-containing protein
58 JASNVH010000001.1 GCA030176795_00692 CDS open 75051-76313 _na     420_aa UDP-N-acetylmuramate dehydrogenase
59 JASNVH010000001.1 GCA030176795_00693 CDS open 76340-76831 _na     163_aa DUF2505 domain-containing protein
60 JASNVH010000001.1 GCA030176795_00694 CDS open 76861-77751 _na     296_aa DUF2993 domain-containing protein
61 JASNVH010000001.1 GCA030176795_00695 CDS open 77783-78670 _na     295_aa Deoxyribose-phosphate aldolase
62 JASNVH010000001.1 GCA030176795_00696 CDS open 78717-79106 _na     129_aa DUF2516 domain-containing protein
63 JASNVH010000001.1 GCA030176795_00697 CDS open 79220-79657 _na     145_aa Transposase
64 JASNVH010000001.1 GCA030176795_00698 CDS open 79738-81126 _na     462_aa DUF445 domain-containing protein
65 JASNVH010000001.1 GCA030176795_00699 CDS open 81247-81615 _na     122_aa DUF2628 domain-containing protein
66 JASNVH010000001.1 GCA030176795_00700 CDS open 81754-82503 _na     249_aa succinate dehydrogenase
67 JASNVH010000001.1 GCA030176795_00701 CDS open 82503-84512 _na     669_aa Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
68 JASNVH010000001.1 GCA030176795_00702 CDS open 84579-85334 _na     251_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
69 JASNVH010000001.1 GCA030176795_00703 CDS open 85688-87115 _na     475_aa lpdA dihydrolipoyl dehydrogenase
70 JASNVH010000001.1 GCA030176795_00704 CDS open 87309-87416 _na     35_aa hypothetical protein
71 JASNVH010000001.1 GCA030176795_00705 CDS open 87924-89048 _na     374_aa Esterase
72 JASNVH010000001.1 GCA030176795_00706 CDS open 89282-90268 _na     328_aa rfbB dTDP-glucose 4%2C6-dehydratase
73 JASNVH010000001.1 GCA030176795_00707 CDS open 90284-91648 _na     454_aa rfbD dTDP-4-dehydrorhamnose reductase
74 JASNVH010000001.1 GCA030176795_00708 CDS open 91655-92521 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
75 JASNVH010000001.1 GCA030176795_00709 CDS open 92573-93514 _na     313_aa Thioredoxin domain-containing protein
76 JASNVH010000001.1 GCA030176795_00710 CDS open 93532-94392 _na     286_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
77 JASNVH010000001.1 GCA030176795_00711 CDS open 94464-95081 _na     205_aa Metallo-beta-lactamase domain-containing protein
78 JASNVH010000001.1 GCA030176795_00712 CDS open 95087-96238 _na     383_aa S-(hydroxymethyl)mycothiol dehydrogenase
79 JASNVH010000001.1 GCA030176795_00713 CDS open 96503-98146 _na     547_aa AMP-dependent synthetase/ligase domain-containing protein
80 JASNVH010000001.1 GCA030176795_00714 CDS open 98556-100271 _na     571_aa ATP-binding protein
81 JASNVH010000001.1 GCA030176795_00715 CDS open 100368-100763 _na     131_aa hypothetical protein
82 JASNVH010000001.1 GCA030176795_00716 CDS open 101624-103237 _na     537_aa TIGR04141 family sporadically distributed protein
83 JASNVH010000001.1 GCA030176795_00717 CDS open 103240-106425 _na     1061_aa Type I restriction enzyme endonuclease subunit
84 JASNVH010000001.1 GCA030176795_00718 CDS open 106442-107656 _na     404_aa Restriction endonuclease subunit S
85 JASNVH010000001.1 GCA030176795_00719 CDS open 107653-109260 _na     535_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
86 JASNVH010000001.1 GCA030176795_00720 CDS open 109341-111293 _na     650_aa Hypothetical DNA-binding protein
87 JASNVH010000001.1 GCA030176795_00721 CDS open 111728-113026 _na     432_aa Fic family protein
88 JASNVH010000001.1 GCA030176795_00722 CDS open 113106-113387 _na     93_aa hypothetical protein
89 JASNVH010000001.1 GCA030176795_00724 CDS open 113892-115130 _na     412_aa DNA polymerase III subunit delta'
90 JASNVH010000001.1 GCA030176795_00725 CDS open 115321-116847 _na     508_aa Adenylate cyclase
91 JASNVH010000001.1 GCA030176795_00726 CDS open 116948-118297 _na     449_aa DUF418 domain-containing protein
92 JASNVH010000001.1 GCA030176795_00727 CDS open 118301-121300 _na     999_aa topA type I DNA topoisomerase
93 JASNVH010000001.1 GCA030176795_00728 CDS open 121527-121730 _na     67_aa Cold-shock protein A
94 JASNVH010000001.1 GCA030176795_00729 CDS open 121917-124301 _na     794_aa DEAD/DEAH box helicase
95 JASNVH010000001.1 GCA030176795_00730 CDS open 124335-124709 _na     124_aa Helicase/secretion neighborhood TadE-like protein
96 JASNVH010000001.1 GCA030176795_00731 CDS open 124706-125086 _na     126_aa tadE TadE family protein
97 JASNVH010000001.1 GCA030176795_00732 CDS open 125037-125345 _na     102_aa DUF4244 domain-containing protein
98 JASNVH010000001.1 GCA030176795_00733 CDS open 125396-125980 _na     194_aa gspF Type II secretion system protein GspF domain-containing protein
99 JASNVH010000001.1 GCA030176795_00734 CDS open 125965-126777 _na     270_aa gspF Type II secretion system protein GspF domain-containing protein
100 JASNVH010000001.1 GCA030176795_00735 CDS open 126774-128003 _na     409_aa Helicase/secretion neighborhood ATPase
101 JASNVH010000001.1 GCA030176795_00736 CDS open 128101-129315 _na     404_aa ssd septum site-determining protein Ssd
102 JASNVH010000001.1 GCA030176795_00737 CDS open 129586-130569 _na     327_aa HAD family hydrolase
103 JASNVH010000001.1 GCA030176795_00738 CDS open 130566-131069 _na     167_aa Phage holin family protein
104 JASNVH010000001.1 GCA030176795_00739 CDS open 131130-132095 _na     321_aa AB hydrolase-1 domain-containing protein
105 JASNVH010000001.1 GCA030176795_00740 CDS open 132134-133330 _na     398_aa marP MarP family serine protease
106 JASNVH010000001.1 GCA030176795_00741 CDS open 133366-134115 _na     249_aa Nudix hydrolase domain-containing protein
107 JASNVH010000001.1 GCA030176795_00742 CDS open 134115-134798 _na     227_aa Thioredoxin domain-containing protein
108 JASNVH010000001.1 GCA030176795_00743 CDS open 135157-135840 _na     227_aa Transcriptional regulator%2C Crp family protein
109 JASNVH010000001.1 GCA030176795_00744 CDS open 136067-136894 _na     275_aa Metallo-beta-lactamase domain-containing protein
110 JASNVH010000001.1 GCA030176795_00745 CDS open 136972-137442 _na     156_aa Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein
111 JASNVH010000001.1 GCA030176795_00746 CDS open 137444-137599 _na     51_aa DUF4177 domain-containing protein
112 JASNVH010000001.1 GCA030176795_00747 CDS open 137675-138028 _na     117_aa whiB Transcriptional regulator WhiB
113 JASNVH010000001.1 GCA030176795_00748 CDS open 138200-140590 _na     796_aa peptidoglycan glycosyltransferase
114 JASNVH010000001.1 GCA030176795_00749 CDS open 140587-141078 _na     163_aa GatB/YqeY domain-containing protein
115 JASNVH010000001.1 GCA030176795_00750 CDS open 141203-142105 _na     300_aa Calcineurin-like phosphoesterase domain-containing protein
116 JASNVH010000001.1 GCA030176795_00752 CDS open 142627-143988 _na     453_aa Collagen-like protein
117 JASNVH010000001.1 GCA030176795_00753 CDS open 144213-144503 _na     96_aa Peptidase M23
118 JASNVH010000001.1 GCA030176795_00754 CDS open 144591-146123 _na     510_aa X-X-X-Leu-X-X-Gly heptad repeats protein
119 JASNVH010000001.1 GCA030176795_00755 CDS open 146343-147890 _na     515_aa Catalase core domain-containing protein
120 JASNVH010000001.1 GCA030176795_00756 CDS open 148042-148590 _na     182_aa RNA polymerase sigma factor
121 JASNVH010000001.1 GCA030176795_00757 CDS open 148679-149986 _na     435_aa ykvI Membrane protein YkvI
122 JASNVH010000001.1 GCA030176795_00758 CDS open 150096-151133 _na     345_aa aspartate-semialdehyde dehydrogenase
123 JASNVH010000001.1 GCA030176795_00759 CDS open 151178-152443 _na     421_aa aspartate kinase
124 JASNVH010000001.1 GCA030176795_00760 CDS open 152778-154601 _na     607_aa leuA 2-isopropylmalate synthase
125 JASNVH010000001.1 GCA030176795_00761 CDS open 154718-156148 _na     476_aa DNA polymerase III subunit epsilon
126 JASNVH010000001.1 GCA030176795_00762 CDS open 156179-157615 _na     478_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
127 JASNVH010000001.1 GCA030176795_00763 CDS open 157631-158467 _na     278_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
128 JASNVH010000001.1 GCA030176795_00764 CDS open 158517-159434 _na     305_aa FAD-binding FR-type domain-containing protein
129 JASNVH010000001.1 GCA030176795_00765 CDS open 159491-160150 _na     219_aa recR recombination mediator RecR
130 JASNVH010000001.1 GCA030176795_00766 CDS open 160151-160489 _na     112_aa YbaB/EbfC family nucleoid-associated protein
131 JASNVH010000001.1 GCA030176795_00767 CDS open 160616-163345 _na     909_aa DNA polymerase III subunit gamma and tau
132 JASNVH010000001.1 GCA030176795_00768 CDS open 163424-164002 _na     192_aa Suppressor of fused-like domain-containing protein
133 JASNVH010000001.1 GCA030176795_00769 CDS open 163983-165251 _na     422_aa Aminotransferase class I/classII domain-containing protein
134 JASNVH010000001.1 GCA030176795_00770 CDS open 165403-166233 _na     276_aa ABC transporter domain-containing protein
135 JASNVH010000001.1 GCA030176795_00771 CDS open 166226-167155 _na     309_aa ABC transporter permease
136 JASNVH010000001.1 GCA030176795_00772 CDS open 167165-168355 _na     396_aa SsuA/THI5-like domain-containing protein
137 JASNVH010000001.1 GCA030176795_00773 CDS open 169263-169457 _na     64_aa DUF6968 domain-containing protein
138 JASNVH010000001.1 GCA030176795_00774 CDS open 169512-170018 _na     168_aa Transposase IS116/IS110/IS902 C-terminal domain-containing protein
139 JASNVH010000001.1 GCA030176795_00775 CDS open 170035-170406 _na     123_aa Transposase IS110-like N-terminal domain-containing protein
140 JASNVH010000001.1 GCA030176795_00776 CDS open 170530-170670 _na     46_aa hypothetical protein
141 JASNVH010000001.1 GCA030176795_00777 CDS open 170910-171395 _na     161_aa Rrf2 family transcriptional regulator
142 JASNVH010000001.1 GCA030176795_00778 CDS open 171415-172623 _na     402_aa nitric oxide dioxygenase
143 JASNVH010000001.1 GCA030176795_00779 CDS open 172755-173045 _na     96_aa hypothetical protein
144 JASNVH010000001.1 GCA030176795_00780 CDS open 173112-173495 _na     127_aa Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein
145 JASNVH010000001.1 GCA030176795_00781 CDS open 173476-173637 _na     53_aa hypothetical protein
146 JASNVH010000001.1 GCA030176795_00782 CDS open 173744-174559 _na     271_aa hypothetical protein
147 JASNVH010000001.1 GCA030176795_00783 CDS open 174653-174829 _na     58_aa hypothetical protein
148 JASNVH010000001.1 GCA030176795_00785 CDS open 174896-176269 _na     457_aa YibE/F family protein
149 JASNVH010000001.1 GCA030176795_00786 CDS open 176640-177587 _na     315_aa FAD-binding FR-type domain-containing protein
150 JASNVH010000001.1 GCA030176795_00787 CDS open 177650-178810 _na     386_aa Glycosyl transferase family 1 domain-containing protein
151 JASNVH010000001.1 GCA030176795_00788 CDS open 178878-179138 _na     86_aa hypothetical protein
152 JASNVH010000001.1 GCA030176795_00789 CDS open 179817-180590 _na     257_aa Methyltransferase type 11 domain-containing protein
153 JASNVH010000001.1 GCA030176795_00790 CDS open 180596-181054 _na     152_aa Phage holin family protein
154 JASNVH010000001.1 GCA030176795_00791 CDS open 181238-181585 _na     115_aa hypothetical protein
155 JASNVH010000001.1 GCA030176795_00792 CDS open 181825-183657 _na     610_aa phosphoenolpyruvate carboxykinase (GTP)
156 JASNVH010000001.1 GCA030176795_00793 CDS open 183923-184720 _na     265_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
157 JASNVH010000001.1 GCA030176795_00794 CDS open 184861-185520 _na     219_aa NYN domain-containing protein
158 JASNVH010000001.1 GCA030176795_00795 CDS open 185529-187886 _na     785_aa Membrane transport protein MMPL domain-containing protein
159 JASNVH010000001.1 GCA030176795_00796 CDS open 187899-188936 _na     345_aa TIGR00374 family protein
160 JASNVH010000001.1 GCA030176795_00797 CDS open 188942-189340 _na     132_aa Major facilitator superfamily (MFS) profile domain-containing protein
161 JASNVH010000001.1 GCA030176795_00798 CDS open 189254-190222 _na     322_aa rarD EamA family transporter RarD
162 JASNVH010000001.1 GCA030176795_00799 CDS open 190750-191016 _na     88_aa hypothetical protein
163 JASNVH010000001.1 GCA030176795_00800 CDS open 191009-192553 _na     514_aa Propionyl-CoA carboxylase beta chain 5
164 JASNVH010000001.1 GCA030176795_00801 CDS open 192554-197566 _na     1670_aa pks13 polyketide synthase Pks13
165 JASNVH010000001.1 GCA030176795_00802 CDS open 197567-199411 _na     614_aa FadD32-like long-chain-fatty-acid--AMP ligase
166 JASNVH010000001.1 GCA030176795_00803 CDS open 199684-200595 _na     303_aa Cutinase
167 JASNVH010000001.1 GCA030176795_00804 CDS open 200660-201286 _na     208_aa DUF732 domain-containing protein
168 JASNVH010000001.1 GCA030176795_00805 CDS open 201286-203283 _na     665_aa Trehalose O-mycolyltransferase
169 JASNVH010000001.1 GCA030176795_00806 CDS open 203627-204649 _na     340_aa Acyl-CoA:diacylglycerol acyltransferase
170 JASNVH010000001.1 GCA030176795_00807 CDS open 204856-205839 _na     327_aa decaprenyl-phosphate phosphoribosyltransferase
171 JASNVH010000001.1 GCA030176795_00808 CDS open 205840-206370 _na     176_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
172 JASNVH010000001.1 GCA030176795_00809 CDS open 206360-208294 _na     644_aa Glycosyltransferase
173 JASNVH010000001.1 GCA030176795_00810 CDS open 208389-209579 _na     396_aa glf UDP-galactopyranose mutase
174 JASNVH010000001.1 GCA030176795_00811 CDS open 209872-212022 _na     716_aa Peptidoglycan recognition protein family domain-containing protein
175 JASNVH010000001.1 GCA030176795_00812 CDS open 212019-213584 _na     521_aa glpK glycerol kinase GlpK
176 JASNVH010000001.1 GCA030176795_00813 CDS open 213592-214425 _na     277_aa Cof-like hydrolase
177 JASNVH010000001.1 GCA030176795_00814 CDS open 214443-215321 _na     292_aa Phospholipid/glycerol acyltransferase domain-containing protein
178 JASNVH010000001.1 GCA030176795_00815 CDS open 215318-216631 _na     437_aa serS serine--tRNA ligase
179 JASNVH010000001.1 GCA030176795_00816 CDS open 216649-217635 _na     328_aa Septum formation-related domain-containing protein
180 JASNVH010000001.1 GCA030176795_00817 CDS open 217644-218042 _na     132_aa Metallopeptidase family protein
181 JASNVH010000001.1 GCA030176795_00818 CDS open 218089-218742 _na     217_aa Phosphoglycerate mutase
182 JASNVH010000001.1 GCA030176795_00819 CDS open 218745-219668 _na     307_aa pheA prephenate dehydratase
183 JASNVH010000001.1 GCA030176795_00820 CDS open 219693-220817 _na     374_aa amidase
184 JASNVH010000001.1 GCA030176795_00821 CDS open 220878-222737 _na     619_aa Cell envelope-related transcriptional attenuator domain-containing protein
185 JASNVH010000001.1 GCA030176795_00822 CDS open 222785-223888 _na     367_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
186 JASNVH010000001.1 GCA030176795_00823 CDS open 223992-224912 _na     306_aa DUF5926 domain-containing protein
187 JASNVH010000001.1 GCA030176795_00824 CDS open 224923-225651 _na     242_aa GP-PDE domain-containing protein
188 JASNVH010000001.1 GCA030176795_00825 CDS open 225697-226359 _na     220_aa msrA Peptide methionine sulfoxide reductase MsrA
189 JASNVH010000001.1 GCA030176795_00826 CDS open 226562-227164 _na     200_aa Superoxide dismutase
190 JASNVH010000001.1 GCA030176795_00827 CDS open 227306-227707 _na     133_aa Major facilitator superfamily (MFS) profile domain-containing protein
191 JASNVH010000001.1 GCA030176795_00828 CDS open 228764-229021 _na     85_aa Integrase core domain-containing protein
192 JASNVH010000001.1 GCA030176795_00829 CDS open 229286-229891 _na     201_aa DUF3800 domain-containing protein
193 JASNVH010000001.1 GCA030176795_00830 CDS open 230013-230759 _na     248_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
194 JASNVH010000001.1 GCA030176795_00831 CDS open 230771-231097 _na     108_aa hicB HicB family protein
195 JASNVH010000001.1 GCA030176795_00832 CDS open 231103-231342 _na     79_aa hicA Toxin HicA
196 JASNVH010000001.1 GCA030176795_00833 CDS open 231788-231898 _na     36_aa hypothetical protein
197 JASNVH010000001.1 GCA030176795_00834 CDS open 231898-231996 _na     32_aa hypothetical protein
198 JASNVH010000001.1 GCA030176795_00835 CDS open 232267-232692 _na     141_aa hypothetical protein
199 JASNVH010000001.1 GCA030176795_00836 CDS open 232693-233136 _na     147_aa Integrase catalytic domain-containing protein
200 JASNVH010000001.1 GCA030176795_00837 CDS open 233136-233273 _na     45_aa Transposase
201 JASNVH010000001.1 GCA030176795_00838 CDS open 233549-233758 _na     69_aa hypothetical protein
202 JASNVH010000001.1 GCA030176795_00839 CDS open 233683-233910 _na     75_aa hypothetical protein
203 JASNVH010000001.1 GCA030176795_00840 CDS open 233911-234864 _na     317_aa hypothetical protein
204 JASNVH010000001.1 GCA030176795_00841 CDS open 235302-235490 _na     62_aa Tranposase
205 JASNVH010000001.1 GCA030176795_00842 CDS open 235527-236051 _na     174_aa IS3 family transposase
206 JASNVH010000001.1 GCA030176795_00843 CDS open 236094-236192 _na     32_aa hypothetical protein
207 JASNVH010000001.1 GCA030176795_00844 CDS open 236411-237619 _na     402_aa Major facilitator superfamily (MFS) profile domain-containing protein
208 JASNVH010000001.1 GCA030176795_00845 CDS open 237616-239202 _na     528_aa yprB YprB ribonuclease H-like domain-containing protein
209 JASNVH010000001.1 GCA030176795_00846 CDS open 239289-239924 _na     211_aa DUF6474 domain-containing protein
210 JASNVH010000001.1 GCA030176795_00847 CDS open 239934-240572 _na     212_aa Response regulatory domain-containing protein
211 JASNVH010000001.1 GCA030176795_00848 CDS open 240626-241948 _na     440_aa Histidine kinase domain-containing protein
212 JASNVH010000001.1 GCA030176795_00849 CDS open 242058-243320 _na     420_aa yidC Membrane protein insertase YidC
213 JASNVH010000001.1 GCA030176795_00850 CDS open 243317-243943 _na     208_aa HTH tetR-type domain-containing protein
214 JASNVH010000001.1 GCA030176795_00851 CDS open 244132-244389 _na     85_aa GlsB/YeaQ/YmgE family stress response membrane protein
215 JASNVH010000001.1 GCA030176795_00852 CDS open 244393-245289 _na     298_aa uspA UspA domain-containing protein
216 JASNVH010000001.1 GCA030176795_00853 CDS open 245669-246673 _na     334_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
217 JASNVH010000001.1 GCA030176795_00854 CDS open 246684-248381 _na     565_aa Amine oxidase domain-containing protein
218 JASNVH010000001.1 GCA030176795_00855 CDS open 248378-249316 _na     312_aa Squalene/phytoene synthase family protein
219 JASNVH010000001.1 GCA030176795_00638 gene open 395-1411
220 JASNVH010000001.1 GCA030176795_00639 gene open 1522-2955
221 JASNVH010000001.1 GCA030176795_00640 gene open 3072-3383
222 JASNVH010000001.1 GCA030176795_00641 gene open 3577-4377
223 JASNVH010000001.1 GCA030176795_00642 gene open 4387-5613
224 JASNVH010000001.1 GCA030176795_00643 gene open 5656-6228
225 JASNVH010000001.1 GCA030176795_00644 gene open 6241-8019 menD
226 JASNVH010000001.1 GCA030176795_00645 gene open 8157-8951
227 JASNVH010000001.1 GCA030176795_00646 gene open 8988-11735
228 JASNVH010000001.1 GCA030176795_00647 gene open 11677-12831
229 JASNVH010000001.1 GCA030176795_00648 gene open 12859-13878
230 JASNVH010000001.1 GCA030176795_00649 gene open 13985-15178 menE
231 JASNVH010000001.1 GCA030176795_00650 gene open 15274-16356
232 JASNVH010000001.1 GCA030176795_00651 gene open 16521-17411
233 JASNVH010000001.1 GCA030176795_00652 gene open 17567-18496
234 JASNVH010000001.1 GCA030176795_00653 gene open 18512-18982
235 JASNVH010000001.1 GCA030176795_00654 gene open 19019-19429
236 JASNVH010000001.1 GCA030176795_00655 gene open 19638-20630 ccsB
237 JASNVH010000001.1 GCA030176795_00656 gene open 20886-22550
238 JASNVH010000001.1 GCA030176795_00657 gene open 22626-23582
239 JASNVH010000001.1 GCA030176795_00658 gene open 23625-24275
240 JASNVH010000001.1 GCA030176795_00659 gene open 24339-25055
241 JASNVH010000001.1 GCA030176795_00660 gene open 25281-26699 hemL
242 JASNVH010000001.1 GCA030176795_00661 gene open 26776-28323
243 JASNVH010000001.1 GCA030176795_00662 gene open 28417-29367 hemE
244 JASNVH010000001.1 GCA030176795_00663 gene open 29601-30485
245 JASNVH010000001.1 GCA030176795_00664 gene open 30490-31479 hemB
246 JASNVH010000001.1 GCA030176795_00665 gene open 31654-33390
247 JASNVH010000001.1 GCA030176795_00666 gene open 33672-34565 hemC
248 JASNVH010000001.1 GCA030176795_00667 gene open 34637-36103
249 JASNVH010000001.1 GCA030176795_00668 gene open 36363-36746
250 JASNVH010000001.1 GCA030176795_00669 gene open 37077-38153
251 JASNVH010000001.1 GCA030176795_00670 gene open 38372-40003
252 JASNVH010000001.1 GCA030176795_00671 gene open 40159-40260
253 JASNVH010000001.1 GCA030176795_00672 gene open 40512-40703
254 JASNVH010000001.1 GCA030176795_00673 gene open 41057-41905 proC
255 JASNVH010000001.1 GCA030176795_00674 gene open 42029-43471
256 JASNVH010000001.1 GCA030176795_00675 gene open 43483-44412
257 JASNVH010000001.1 GCA030176795_00676 gene open 44446-45348
258 JASNVH010000001.1 GCA030176795_00677 gene open 45361-46059 regX3
259 JASNVH010000001.1 GCA030176795_00678 gene open 46170-47603 senX3
260 JASNVH010000001.1 GCA030176795_00679 gene open 47608-48396
261 JASNVH010000001.1 GCA030176795_00680 gene open 48478-49797 mshA
262 JASNVH010000001.1 GCA030176795_00681 gene open 50055-51773
263 JASNVH010000001.1 GCA030176795_00682 gene open 52285-54069
264 JASNVH010000001.1 GCA030176795_00683 gene open 54326-56110
265 JASNVH010000001.1 GCA030176795_00684 gene open 56360-65650
266 JASNVH010000001.1 GCA030176795_00685 gene open 65820-69119 cas9
267 JASNVH010000001.1 GCA030176795_00686 gene open 69122-70036 cas1
268 JASNVH010000001.1 GCA030176795_00687 gene open 70044-70349 cas2
269 JASNVH010000001.1 GCA030176795_00688 gene open 71571-72536
270 JASNVH010000001.1 GCA030176795_00689 gene open 72551-72994
271 JASNVH010000001.1 GCA030176795_00690 gene open 73175-74416
272 JASNVH010000001.1 GCA030176795_00691 gene open 74514-75017
273 JASNVH010000001.1 GCA030176795_00692 gene open 75051-76313
274 JASNVH010000001.1 GCA030176795_00693 gene open 76340-76831
275 JASNVH010000001.1 GCA030176795_00694 gene open 76861-77751
276 JASNVH010000001.1 GCA030176795_00695 gene open 77783-78670
277 JASNVH010000001.1 GCA030176795_00696 gene open 78717-79106
278 JASNVH010000001.1 GCA030176795_00697 gene open 79220-79657
279 JASNVH010000001.1 GCA030176795_00698 gene open 79738-81126
280 JASNVH010000001.1 GCA030176795_00699 gene open 81247-81615
281 JASNVH010000001.1 GCA030176795_00700 gene open 81754-82503
282 JASNVH010000001.1 GCA030176795_00701 gene open 82503-84512
283 JASNVH010000001.1 GCA030176795_00702 gene open 84579-85334
284 JASNVH010000001.1 GCA030176795_00703 gene open 85688-87115 lpdA
285 JASNVH010000001.1 GCA030176795_00704 gene open 87309-87416
286 JASNVH010000001.1 GCA030176795_00705 gene open 87924-89048
287 JASNVH010000001.1 GCA030176795_00706 gene open 89282-90268 rfbB
288 JASNVH010000001.1 GCA030176795_00707 gene open 90284-91648 rfbD
289 JASNVH010000001.1 GCA030176795_00708 gene open 91655-92521 rfbA
290 JASNVH010000001.1 GCA030176795_00709 gene open 92573-93514
291 JASNVH010000001.1 GCA030176795_00710 gene open 93532-94392
292 JASNVH010000001.1 GCA030176795_00711 gene open 94464-95081
293 JASNVH010000001.1 GCA030176795_00712 gene open 95087-96238
294 JASNVH010000001.1 GCA030176795_00713 gene open 96503-98146
295 JASNVH010000001.1 GCA030176795_00714 gene open 98556-100271
296 JASNVH010000001.1 GCA030176795_00715 gene open 100368-100763
297 JASNVH010000001.1 GCA030176795_00716 gene open 101624-103237
298 JASNVH010000001.1 GCA030176795_00717 gene open 103240-106425
299 JASNVH010000001.1 GCA030176795_00718 gene open 106442-107656
300 JASNVH010000001.1 GCA030176795_00719 gene open 107653-109260 hsdM
301 JASNVH010000001.1 GCA030176795_00720 gene open 109341-111293
302 JASNVH010000001.1 GCA030176795_00721 gene open 111728-113026
303 JASNVH010000001.1 GCA030176795_00722 gene open 113106-113387
304 JASNVH010000001.1 GCA030176795_00724 gene open 113892-115130
305 JASNVH010000001.1 GCA030176795_00725 gene open 115321-116847
306 JASNVH010000001.1 GCA030176795_00726 gene open 116948-118297
307 JASNVH010000001.1 GCA030176795_00727 gene open 118301-121300 topA
308 JASNVH010000001.1 GCA030176795_00728 gene open 121527-121730
309 JASNVH010000001.1 GCA030176795_00729 gene open 121917-124301
310 JASNVH010000001.1 GCA030176795_00730 gene open 124335-124709
311 JASNVH010000001.1 GCA030176795_00731 gene open 124706-125086 tadE
312 JASNVH010000001.1 GCA030176795_00732 gene open 125037-125345
313 JASNVH010000001.1 GCA030176795_00733 gene open 125396-125980 gspF
314 JASNVH010000001.1 GCA030176795_00734 gene open 125965-126777 gspF
315 JASNVH010000001.1 GCA030176795_00735 gene open 126774-128003
316 JASNVH010000001.1 GCA030176795_00736 gene open 128101-129315 ssd
317 JASNVH010000001.1 GCA030176795_00737 gene open 129586-130569
318 JASNVH010000001.1 GCA030176795_00738 gene open 130566-131069
319 JASNVH010000001.1 GCA030176795_00739 gene open 131130-132095
320 JASNVH010000001.1 GCA030176795_00740 gene open 132134-133330 marP
321 JASNVH010000001.1 GCA030176795_00741 gene open 133366-134115
322 JASNVH010000001.1 GCA030176795_00742 gene open 134115-134798
323 JASNVH010000001.1 GCA030176795_00743 gene open 135157-135840
324 JASNVH010000001.1 GCA030176795_00744 gene open 136067-136894
325 JASNVH010000001.1 GCA030176795_00745 gene open 136972-137442
326 JASNVH010000001.1 GCA030176795_00746 gene open 137444-137599
327 JASNVH010000001.1 GCA030176795_00747 gene open 137675-138028 whiB
328 JASNVH010000001.1 GCA030176795_00748 gene open 138200-140590
329 JASNVH010000001.1 GCA030176795_00749 gene open 140587-141078
330 JASNVH010000001.1 GCA030176795_00750 gene open 141203-142105
331 JASNVH010000001.1 GCA030176795_00752 gene open 142627-143988
332 JASNVH010000001.1 GCA030176795_00753 gene open 144213-144503
333 JASNVH010000001.1 GCA030176795_00754 gene open 144591-146123
334 JASNVH010000001.1 GCA030176795_00755 gene open 146343-147890
335 JASNVH010000001.1 GCA030176795_00756 gene open 148042-148590
336 JASNVH010000001.1 GCA030176795_00757 gene open 148679-149986 ykvI
337 JASNVH010000001.1 GCA030176795_00758 gene open 150096-151133
338 JASNVH010000001.1 GCA030176795_00759 gene open 151178-152443
339 JASNVH010000001.1 GCA030176795_00760 gene open 152778-154601 leuA
340 JASNVH010000001.1 GCA030176795_00761 gene open 154718-156148
341 JASNVH010000001.1 GCA030176795_00762 gene open 156179-157615 murT
342 JASNVH010000001.1 GCA030176795_00763 gene open 157631-158467 gatD
343 JASNVH010000001.1 GCA030176795_00764 gene open 158517-159434
344 JASNVH010000001.1 GCA030176795_00765 gene open 159491-160150 recR
345 JASNVH010000001.1 GCA030176795_00766 gene open 160151-160489
346 JASNVH010000001.1 GCA030176795_00767 gene open 160616-163345
347 JASNVH010000001.1 GCA030176795_00768 gene open 163424-164002
348 JASNVH010000001.1 GCA030176795_00769 gene open 163983-165251
349 JASNVH010000001.1 GCA030176795_00770 gene open 165403-166233
350 JASNVH010000001.1 GCA030176795_00771 gene open 166226-167155
351 JASNVH010000001.1 GCA030176795_00772 gene open 167165-168355
352 JASNVH010000001.1 GCA030176795_00773 gene open 169263-169457
353 JASNVH010000001.1 GCA030176795_00774 gene open 169512-170018
354 JASNVH010000001.1 GCA030176795_00775 gene open 170035-170406
355 JASNVH010000001.1 GCA030176795_00776 gene open 170530-170670
356 JASNVH010000001.1 GCA030176795_00777 gene open 170910-171395
357 JASNVH010000001.1 GCA030176795_00778 gene open 171415-172623
358 JASNVH010000001.1 GCA030176795_00779 gene open 172755-173045
359 JASNVH010000001.1 GCA030176795_00780 gene open 173112-173495
360 JASNVH010000001.1 GCA030176795_00781 gene open 173476-173637
361 JASNVH010000001.1 GCA030176795_00782 gene open 173744-174559
362 JASNVH010000001.1 GCA030176795_00783 gene open 174653-174829
363 JASNVH010000001.1 GCA030176795_00785 gene open 174896-176269
364 JASNVH010000001.1 GCA030176795_00786 gene open 176640-177587
365 JASNVH010000001.1 GCA030176795_00787 gene open 177650-178810
366 JASNVH010000001.1 GCA030176795_00788 gene open 178878-179138
367 JASNVH010000001.1 GCA030176795_00789 gene open 179817-180590
368 JASNVH010000001.1 GCA030176795_00790 gene open 180596-181054
369 JASNVH010000001.1 GCA030176795_00791 gene open 181238-181585
370 JASNVH010000001.1 GCA030176795_00792 gene open 181825-183657
371 JASNVH010000001.1 GCA030176795_00793 gene open 183923-184720 trmB
372 JASNVH010000001.1 GCA030176795_00794 gene open 184861-185520
373 JASNVH010000001.1 GCA030176795_00795 gene open 185529-187886
374 JASNVH010000001.1 GCA030176795_00796 gene open 187899-188936
375 JASNVH010000001.1 GCA030176795_00797 gene open 188942-189340
376 JASNVH010000001.1 GCA030176795_00798 gene open 189254-190222 rarD
377 JASNVH010000001.1 GCA030176795_00799 gene open 190750-191016
378 JASNVH010000001.1 GCA030176795_00800 gene open 191009-192553
379 JASNVH010000001.1 GCA030176795_00801 gene open 192554-197566 pks13
380 JASNVH010000001.1 GCA030176795_00802 gene open 197567-199411
381 JASNVH010000001.1 GCA030176795_00803 gene open 199684-200595
382 JASNVH010000001.1 GCA030176795_00804 gene open 200660-201286
383 JASNVH010000001.1 GCA030176795_00805 gene open 201286-203283
384 JASNVH010000001.1 GCA030176795_00806 gene open 203627-204649
385 JASNVH010000001.1 GCA030176795_00807 gene open 204856-205839
386 JASNVH010000001.1 GCA030176795_00808 gene open 205840-206370
387 JASNVH010000001.1 GCA030176795_00809 gene open 206360-208294
388 JASNVH010000001.1 GCA030176795_00810 gene open 208389-209579 glf
389 JASNVH010000001.1 GCA030176795_00811 gene open 209872-212022
390 JASNVH010000001.1 GCA030176795_00812 gene open 212019-213584 glpK
391 JASNVH010000001.1 GCA030176795_00813 gene open 213592-214425
392 JASNVH010000001.1 GCA030176795_00814 gene open 214443-215321
393 JASNVH010000001.1 GCA030176795_00815 gene open 215318-216631 serS
394 JASNVH010000001.1 GCA030176795_00816 gene open 216649-217635
395 JASNVH010000001.1 GCA030176795_00817 gene open 217644-218042
396 JASNVH010000001.1 GCA030176795_00818 gene open 218089-218742
397 JASNVH010000001.1 GCA030176795_00819 gene open 218745-219668 pheA
398 JASNVH010000001.1 GCA030176795_00820 gene open 219693-220817
399 JASNVH010000001.1 GCA030176795_00821 gene open 220878-222737
400 JASNVH010000001.1 GCA030176795_00822 gene open 222785-223888
401 JASNVH010000001.1 GCA030176795_00823 gene open 223992-224912
402 JASNVH010000001.1 GCA030176795_00824 gene open 224923-225651
403 JASNVH010000001.1 GCA030176795_00825 gene open 225697-226359 msrA
404 JASNVH010000001.1 GCA030176795_00826 gene open 226562-227164
405 JASNVH010000001.1 GCA030176795_00827 gene open 227306-227707
406 JASNVH010000001.1 GCA030176795_00828 gene open 228764-229021
407 JASNVH010000001.1 GCA030176795_00829 gene open 229286-229891
408 JASNVH010000001.1 GCA030176795_00830 gene open 230013-230759
409 JASNVH010000001.1 GCA030176795_00831 gene open 230771-231097 hicB
410 JASNVH010000001.1 GCA030176795_00832 gene open 231103-231342 hicA
411 JASNVH010000001.1 GCA030176795_00833 gene open 231788-231898
412 JASNVH010000001.1 GCA030176795_00834 gene open 231898-231996
413 JASNVH010000001.1 GCA030176795_00835 gene open 232267-232692
414 JASNVH010000001.1 GCA030176795_00836 gene open 232693-233136
415 JASNVH010000001.1 GCA030176795_00837 gene open 233136-233273
416 JASNVH010000001.1 GCA030176795_00838 gene open 233549-233758
417 JASNVH010000001.1 GCA030176795_00839 gene open 233683-233910
418 JASNVH010000001.1 GCA030176795_00840 gene open 233911-234864
419 JASNVH010000001.1 GCA030176795_00841 gene open 235302-235490
420 JASNVH010000001.1 GCA030176795_00842 gene open 235527-236051
421 JASNVH010000001.1 GCA030176795_00843 gene open 236094-236192
422 JASNVH010000001.1 GCA030176795_00844 gene open 236411-237619
423 JASNVH010000001.1 GCA030176795_00845 gene open 237616-239202 yprB
424 JASNVH010000001.1 GCA030176795_00846 gene open 239289-239924
425 JASNVH010000001.1 GCA030176795_00847 gene open 239934-240572
426 JASNVH010000001.1 GCA030176795_00848 gene open 240626-241948
427 JASNVH010000001.1 GCA030176795_00849 gene open 242058-243320 yidC
428 JASNVH010000001.1 GCA030176795_00850 gene open 243317-243943
429 JASNVH010000001.1 GCA030176795_00851 gene open 244132-244389
430 JASNVH010000001.1 GCA030176795_00852 gene open 244393-245289 uspA
431 JASNVH010000001.1 GCA030176795_00853 gene open 245669-246673
432 JASNVH010000001.1 GCA030176795_00854 gene open 246684-248381
433 JASNVH010000001.1 GCA030176795_00855 gene open 248378-249316
434 JASNVH010000001.1 GCA030176795_00637 gene open 176-257 trnY
435 JASNVH010000001.1 GCA030176795_00723 gene open 113675-113750 trnT
436 JASNVH010000001.1 GCA030176795_00751 gene open 142228-142301 trnP
437 JASNVH010000001.1 GCA030176795_00637 tRNA open 176-257 trnY tRNA-Tyr(gta)
438 JASNVH010000001.1 GCA030176795_00723 tRNA open 113675-113750 trnT tRNA-Thr(cgt)
439 JASNVH010000001.1 GCA030176795_00751 tRNA open 142228-142301 trnP tRNA-Pro(tgg)
440 JASNVH010000002.1 regulatory_region open 86906-87029 atpB RNA
441 JASNVH010000002.1 GCA030176795_00937 CDS open 158-307 _na     49_aa hypothetical protein
442 JASNVH010000002.1 GCA030176795_00938 CDS open 608-889 _na     93_aa hypothetical protein
443 JASNVH010000002.1 GCA030176795_00939 CDS open 1019-1270 _na     83_aa Transposase
444 JASNVH010000002.1 GCA030176795_00940 CDS open 1321-1935 _na     204_aa Integrase catalytic domain-containing protein
445 JASNVH010000002.1 GCA030176795_00941 CDS open 1980-2225 _na     81_aa Transposase
446 JASNVH010000002.1 GCA030176795_00942 CDS open 2322-2441 _na     39_aa hypothetical protein
447 JASNVH010000002.1 GCA030176795_00943 CDS open 2474-2887 _na     137_aa DUF6508 domain-containing protein
448 JASNVH010000002.1 GCA030176795_00944 CDS open 2884-3123 _na     79_aa Phage portal protein
449 JASNVH010000002.1 GCA030176795_00945 CDS open 3279-3425 _na     48_aa Transposase
450 JASNVH010000002.1 GCA030176795_00946 CDS open 3465-3572 _na     35_aa Transposase
451 JASNVH010000002.1 GCA030176795_00947 CDS open 3871-4107 _na     78_aa DDE-type integrase/transposase/recombinase
452 JASNVH010000002.1 GCA030176795_00948 CDS open 4266-4643 _na     125_aa hypothetical protein
453 JASNVH010000002.1 GCA030176795_00949 CDS open 5075-5356 _na     93_aa hypothetical protein
454 JASNVH010000002.1 GCA030176795_00950 CDS open 5349-5603 _na     84_aa hypothetical protein
455 JASNVH010000002.1 GCA030176795_00952 CDS open 5789-6709 _na     306_aa DUF368 domain-containing protein
456 JASNVH010000002.1 GCA030176795_00953 CDS open 6706-7203 _na     165_aa coaD pantetheine-phosphate adenylyltransferase
457 JASNVH010000002.1 GCA030176795_00954 CDS open 7302-7883 _na     193_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
458 JASNVH010000002.1 GCA030176795_00955 CDS open 7931-10171 _na     746_aa recG putative DNA 3'-5' helicase RecG
459 JASNVH010000002.1 GCA030176795_00956 CDS open 10173-11894 _na     573_aa dhaL DhaL domain-containing protein
460 JASNVH010000002.1 GCA030176795_00957 CDS open 11914-12642 _na     242_aa uracil-DNA glycosylase
461 JASNVH010000002.1 GCA030176795_00958 CDS open 12639-13661 _na     340_aa thiamine-phosphate kinase
462 JASNVH010000002.1 GCA030176795_00959 CDS open 13703-14884 _na     393_aa DUF3515 domain-containing protein
463 JASNVH010000002.1 GCA030176795_00960 CDS open 14961-16031 _na     356_aa D-alanine--D-alanine ligase
464 JASNVH010000002.1 GCA030176795_00961 CDS open 16071-17063 _na     330_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
465 JASNVH010000002.1 GCA030176795_00962 CDS open 17118-18149 _na     343_aa Bifunctional NUDIX hydrolase/histidine phosphatase family protein
466 JASNVH010000002.1 GCA030176795_00963 CDS open 18146-18736 _na     196_aa 3-isopropylmalate dehydratase small subunit
467 JASNVH010000002.1 GCA030176795_00964 CDS open 18768-20180 _na     470_aa 3-isopropylmalate dehydratase large subunit
468 JASNVH010000002.1 GCA030176795_00965 CDS open 20231-20932 _na     233_aa HTH iclR-type domain-containing protein
469 JASNVH010000002.1 GCA030176795_00966 CDS open 20966-22525 _na     519_aa Photolyase/cryptochrome alpha/beta domain-containing protein
470 JASNVH010000002.1 GCA030176795_00967 CDS open 22606-23979 _na     457_aa Aldehyde dehydrogenase domain-containing protein
471 JASNVH010000002.1 GCA030176795_00968 CDS open 24210-25451 _na     413_aa putative acetyl-CoA acetyltransferase
472 JASNVH010000002.1 GCA030176795_00969 CDS open 25467-26384 _na     305_aa eamA EamA domain-containing protein
473 JASNVH010000002.1 GCA030176795_00970 CDS open 26396-27235 _na     279_aa SGNH hydrolase-type esterase domain-containing protein
474 JASNVH010000002.1 GCA030176795_00971 CDS open 27429-27722 _na     97_aa Cardiolipin synthase N-terminal domain-containing protein
475 JASNVH010000002.1 GCA030176795_00974 CDS open 28234-29733 _na     499_aa gltX glutamate--tRNA ligase
476 JASNVH010000002.1 GCA030176795_00975 CDS open 29783-30880 _na     365_aa isochorismate synthase
477 JASNVH010000002.1 GCA030176795_00976 CDS open 30951-31745 _na     264_aa Fumarylacetoacetase-like C-terminal domain-containing protein
478 JASNVH010000002.1 GCA030176795_00977 CDS open 31779-32429 _na     216_aa Exonuclease domain-containing protein
479 JASNVH010000002.1 GCA030176795_00978 CDS open 32446-34311 _na     621_aa Cyclic nucleotide-binding domain-containing protein
480 JASNVH010000002.1 GCA030176795_00979 CDS open 34387-36159 _na     590_aa Cell wall-binding repeat 2 family protein
481 JASNVH010000002.1 GCA030176795_00980 CDS open 36170-37189 _na     339_aa 3-isopropylmalate dehydrogenase
482 JASNVH010000002.1 GCA030176795_00981 CDS open 37284-38126 _na     280_aa hypothetical protein
483 JASNVH010000002.1 GCA030176795_00982 CDS open 38271-38984 _na     237_aa 6-carboxyhexanoate--CoA ligase
484 JASNVH010000002.1 GCA030176795_00983 CDS open 38981-40234 _na     417_aa 8-amino-7-oxononanoate synthase
485 JASNVH010000002.1 GCA030176795_00984 CDS open 40340-41920 _na     526_aa serA phosphoglycerate dehydrogenase
486 JASNVH010000002.1 GCA030176795_00985 CDS open 42051-43001 _na     316_aa PBP domain-containing protein
487 JASNVH010000002.1 GCA030176795_00986 CDS open 42988-44001 _na     337_aa ilvC ketol-acid reductoisomerase
488 JASNVH010000002.1 GCA030176795_00987 CDS open 44107-44622 _na     171_aa ilvN acetolactate synthase small subunit
489 JASNVH010000002.1 GCA030176795_00988 CDS open 44625-46496 _na     623_aa acetolactate synthase large subunit
490 JASNVH010000002.1 GCA030176795_00989 CDS open 46812-48044 _na     410_aa mscS Mechanosensitive ion channel MscS domain-containing protein
491 JASNVH010000002.1 GCA030176795_00990 CDS open 48068-48727 _na     219_aa Low molecular weight protein antigen 6 PH domain-containing protein
492 JASNVH010000002.1 GCA030176795_00991 CDS open 48794-50635 _na     613_aa ilvD dihydroxy-acid dehydratase
493 JASNVH010000002.1 GCA030176795_00992 CDS open 50583-51926 _na     447_aa Polyprenol-phosphate-mannose-dependent alpha-(1-2)-phosphatidylinositol mannoside mannosyltransferase
494 JASNVH010000002.1 GCA030176795_00993 CDS open 51923-53116 _na     397_aa doxX DoxX family protein
495 JASNVH010000002.1 GCA030176795_00994 CDS open 53183-53950 _na     255_aa GmrSD restriction endonucleases C-terminal domain-containing protein
496 JASNVH010000002.1 GCA030176795_00995 CDS open 54063-55157 _na     364_aa GST C-terminal domain-containing protein
497 JASNVH010000002.1 GCA030176795_00996 CDS open 55187-56599 _na     470_aa ykvI Membrane protein YkvI
498 JASNVH010000002.1 GCA030176795_00997 CDS open 56693-58240 _na     515_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
499 JASNVH010000002.1 GCA030176795_00998 CDS open 58260-59291 _na     343_aa ATP-dependent 6-phosphofructokinase
500 JASNVH010000002.1 GCA030176795_00999 CDS open 59408-60838 _na     476_aa Major facilitator superfamily (MFS) profile domain-containing protein