HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176795.1)

Select a Genome:
BAKTA Annotations for GCA_030176795.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
33 2295525 2079 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4274 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4274 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JASNVH010000006.1 GCA030176795_01674 gene open 55956-56702 tsaB
2002 JASNVH010000006.1 GCA030176795_01675 gene open 56705-57175
2003 JASNVH010000006.1 GCA030176795_01676 gene open 57311-57880 tsaE
2004 JASNVH010000006.1 GCA030176795_01677 gene open 57877-58989 alr
2005 JASNVH010000006.1 GCA030176795_01678 gene open 59089-60960 glmS
2006 JASNVH010000006.1 GCA030176795_01679 gene open 61052-61891
2007 JASNVH010000006.1 GCA030176795_01680 gene open 61910-62218
2008 JASNVH010000006.1 GCA030176795_01681 gene open 62218-63885
2009 JASNVH010000006.1 GCA030176795_01682 gene open 63882-64196
2010 JASNVH010000006.1 GCA030176795_01683 gene open 64355-65698 glmM
2011 JASNVH010000006.1 GCA030176795_01684 gene open 65802-67181
2012 JASNVH010000006.1 GCA030176795_01685 gene open 67509-67841
2013 JASNVH010000006.1 GCA030176795_01686 gene open 67822-68286
2014 JASNVH010000006.1 GCA030176795_01687 gene open 68290-68742
2015 JASNVH010000006.1 GCA030176795_01688 gene open 68811-69191
2016 JASNVH010000006.1 GCA030176795_01689 gene open 69462-70001 rpsI
2017 JASNVH010000006.1 GCA030176795_01690 gene open 70001-70444 rplM
2018 JASNVH010000006.1 GCA030176795_01691 gene open 70768-71055
2019 JASNVH010000006.1 GCA030176795_01692 gene open 71147-71464
2020 JASNVH010000006.1 GCA030176795_01693 gene open 71612-72811
2021 JASNVH010000006.1 GCA030176795_01694 gene open 72808-76905
2022 JASNVH010000006.1 GCA030176795_01695 gene open 77056-78450 eccD
2023 JASNVH010000006.1 GCA030176795_01696 gene open 78450-79994
2024 JASNVH010000006.1 GCA030176795_01697 gene open 80115-81683 eccB
2025 JASNVH010000006.1 GCA030176795_01698 gene open 81749-82633 truA
2026 JASNVH010000006.1 GCA030176795_01699 gene open 82623-83408
2027 JASNVH010000006.1 GCA030176795_01700 gene open 83575-84537
2028 JASNVH010000006.1 GCA030176795_01701 gene open 84670-85461
2029 JASNVH010000006.1 GCA030176795_01702 gene open 85458-86330
2030 JASNVH010000006.1 GCA030176795_01703 gene open 86327-87193
2031 JASNVH010000006.1 GCA030176795_01704 gene open 87275-87478
2032 JASNVH010000006.1 GCA030176795_01705 gene open 87645-88142 rplQ
2033 JASNVH010000006.1 GCA030176795_01706 gene open 88257-89264
2034 JASNVH010000006.1 GCA030176795_01707 gene open 89346-89951 rpsD
2035 JASNVH010000006.1 GCA030176795_01708 gene open 89973-90374 rpsK
2036 JASNVH010000006.1 GCA030176795_01709 gene open 90378-90746 rpsM
2037 JASNVH010000006.1 GCA030176795_01710 gene open 90933-91151 infA
2038 JASNVH010000006.1 GCA030176795_01711 gene open 91419-92156
2039 JASNVH010000006.1 GCA030176795_01712 gene open 92225-92770
2040 JASNVH010000006.1 GCA030176795_01713 gene open 92770-94095 secY
2041 JASNVH010000006.1 GCA030176795_01714 gene open 94438-94887 rplO
2042 JASNVH010000006.1 GCA030176795_01715 gene open 94895-95080 rpmD
2043 JASNVH010000006.1 GCA030176795_01716 gene open 95084-95698 rpsE
2044 JASNVH010000006.1 GCA030176795_01717 gene open 95739-96134 rplR
2045 JASNVH010000006.1 GCA030176795_01718 gene open 96138-96674 rplF
2046 JASNVH010000006.1 GCA030176795_01719 gene open 96692-97087 rpsH
2047 JASNVH010000006.1 GCA030176795_01720 gene open 97451-97960 doxX
2048 JASNVH010000006.1 GCA030176795_01721 gene open 98118-98315
2049 JASNVH010000006.1 GCA030176795_01722 gene open 98387-98941 rplE
2050 JASNVH010000006.1 GCA030176795_01723 gene open 98945-99259 rplX
2051 JASNVH010000006.1 GCA030176795_01724 gene open 99260-99631 rplN
2052 JASNVH010000006.1 GCA030176795_01725 gene open 100065-101087
2053 JASNVH010000006.1 GCA030176795_01726 gene open 101084-102178
2054 JASNVH010000006.1 GCA030176795_01727 gene open 102292-103092
2055 JASNVH010000006.1 GCA030176795_01728 gene open 103100-104077
2056 JASNVH010000006.1 GCA030176795_01729 gene open 104281-104589 rpsQ
2057 JASNVH010000006.1 GCA030176795_01730 gene open 104592-104822 rpmC
2058 JASNVH010000006.1 GCA030176795_01731 gene open 104822-105238 rplP
2059 JASNVH010000006.1 GCA030176795_01732 gene open 105242-105979 rpsC
2060 JASNVH010000006.1 GCA030176795_01733 gene open 105980-106342 rplV
2061 JASNVH010000006.1 GCA030176795_01734 gene open 106346-106621 rpsS
2062 JASNVH010000006.1 GCA030176795_01735 gene open 106638-107474 rplB
2063 JASNVH010000006.1 GCA030176795_01736 gene open 107499-107801 rplW
2064 JASNVH010000006.1 GCA030176795_01737 gene open 107803-108462 rplD
2065 JASNVH010000006.1 GCA030176795_01738 gene open 108465-109115 rplC
2066 JASNVH010000006.1 GCA030176795_01739 gene open 109170-109475 rpsJ
2067 JASNVH010000006.1 GCA030176795_01740 gene open 110236-110712
2068 JASNVH010000006.1 GCA030176795_01741 gene open 110715-111053
2069 JASNVH010000006.1 GCA030176795_01742 gene open 111077-111265
2070 JASNVH010000006.1 GCA030176795_01743 gene open 111265-112656
2071 JASNVH010000006.1 GCA030176795_01744 gene open 112649-113206
2072 JASNVH010000006.1 GCA030176795_01745 gene open 113203-113766 amaP
2073 JASNVH010000006.1 GCA030176795_01746 gene open 113972-114262
2074 JASNVH010000006.1 GCA030176795_01747 gene open 114493-114753
2075 JASNVH010000006.1 GCA030176795_01748 gene open 115216-116406 tuf
2076 JASNVH010000006.1 GCA030176795_01749 gene open 116888-119020 fusA
2077 JASNVH010000006.1 GCA030176795_01750 gene open 119319-119786 rpsG
2078 JASNVH010000006.1 GCA030176795_01751 gene open 119793-120161 rpsL
2079 JASNVH010000006.1 GCA030176795_01752 gene open 120616-121419
2080 JASNVH010000006.1 GCA030176795_01753 gene open 121421-122833 ccmA
2081 JASNVH010000006.1 GCA030176795_01754 gene open 122894-123517
2082 JASNVH010000006.1 GCA030176795_01755 gene open 123864-127859
2083 JASNVH010000006.1 GCA030176795_01756 gene open 127942-131418
2084 JASNVH010000006.1 GCA030176795_01757 gene open 131710-132780
2085 JASNVH010000006.1 GCA030176795_01758 gene open 132887-133426
2086 JASNVH010000006.1 GCA030176795_01759 gene open 133733-134119 rplL
2087 JASNVH010000006.1 GCA030176795_01760 gene open 134270-134791 rplJ
2088 JASNVH010000006.1 GCA030176795_01761 gene open 135079-136632
2089 JASNVH010000006.1 GCA030176795_01762 gene open 136707-137171
2090 JASNVH010000006.1 GCA030176795_01763 gene open 137401-138111 rplA
2091 JASNVH010000006.1 GCA030176795_01764 gene open 138258-138707 rplK
2092 JASNVH010000006.1 GCA030176795_01765 gene open 138917-139849 nusG
2093 JASNVH010000006.1 GCA030176795_01766 gene open 139971-140303 secE
2094 JASNVH010000006.1 GCA030176795_01770 gene open 140975-141985
2095 JASNVH010000006.1 GCA030176795_01771 gene open 142119-143123
2096 JASNVH010000006.1 GCA030176795_01767 gene open 140359-140434 trnW
2097 JASNVH010000006.1 GCA030176795_01768 gene open 140554-140625 trnM
2098 JASNVH010000006.1 GCA030176795_01769 gene open 140669-140741 trnT
2099 JASNVH010000006.1 GCA030176795_01767 tRNA open 140359-140434 trnW tRNA-Trp(cca)
2100 JASNVH010000006.1 GCA030176795_01768 tRNA open 140554-140625 trnM tRNA-Met(cat)
2101 JASNVH010000006.1 GCA030176795_01769 tRNA open 140669-140741 trnT tRNA-Thr(ggt)
2102 JASNVH010000007.1 GCA030176795_01772 CDS open 451-1716 _na     421_aa AB hydrolase-1 domain-containing protein
2103 JASNVH010000007.1 GCA030176795_01773 CDS open 1783-2793 _na     336_aa Deacetylase sirtuin-type domain-containing protein
2104 JASNVH010000007.1 GCA030176795_01774 CDS open 2836-3141 _na     101_aa Aminotransferase
2105 JASNVH010000007.1 GCA030176795_01775 CDS open 3172-4152 _na     326_aa bioB biotin synthase BioB
2106 JASNVH010000007.1 GCA030176795_01776 CDS open 4351-5052 _na     233_aa DUF4442 domain-containing protein
2107 JASNVH010000007.1 GCA030176795_01777 CDS open 5089-6429 _na     446_aa Peptidase M20 dimerisation domain-containing protein
2108 JASNVH010000007.1 GCA030176795_01778 CDS open 6437-7483 _na     348_aa ABC transporter permease
2109 JASNVH010000007.1 GCA030176795_01779 CDS open 7486-8577 _na     363_aa Fe/B12 periplasmic-binding domain-containing protein
2110 JASNVH010000007.1 GCA030176795_01780 CDS open 8579-9262 _na     227_aa Heme oxygenase
2111 JASNVH010000007.1 GCA030176795_01782 CDS open 9959-10864 _na     301_aa FHA domain-containing protein
2112 JASNVH010000007.1 GCA030176795_01783 CDS open 10894-11361 _na     155_aa FHA domain-containing protein
2113 JASNVH010000007.1 GCA030176795_01784 CDS open 11362-12948 _na     528_aa PPM-type phosphatase domain-containing protein
2114 JASNVH010000007.1 GCA030176795_01785 CDS open 12949-14457 _na     502_aa ftsW Cell division protein FtsW
2115 JASNVH010000007.1 GCA030176795_01786 CDS open 14454-15881 _na     475_aa Penicillin-binding protein 2
2116 JASNVH010000007.1 GCA030176795_01787 CDS open 15885-17714 _na     609_aa non-specific serine/threonine protein kinase
2117 JASNVH010000007.1 GCA030176795_01788 CDS open 17717-19780 _na     687_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2118 JASNVH010000007.1 GCA030176795_01789 CDS open 19896-20168 _na     90_aa crgA cell division protein CrgA
2119 JASNVH010000007.1 GCA030176795_01790 CDS open 20355-20738 _na     127_aa Secreted protein
2120 JASNVH010000007.1 GCA030176795_01791 CDS open 20808-21332 _na     174_aa RNA polymerase
2121 JASNVH010000007.1 GCA030176795_01792 CDS open 21332-22513 _na     393_aa DUF5667 domain-containing protein
2122 JASNVH010000007.1 GCA030176795_01793 CDS open 22569-22679 _na     36_aa hypothetical protein
2123 JASNVH010000007.1 GCA030176795_01794 CDS open 23214-23744 _na     176_aa Peptidyl-prolyl cis-trans isomerase
2124 JASNVH010000007.1 GCA030176795_01795 CDS open 23917-25011 _na     364_aa Trehalose-binding protein
2125 JASNVH010000007.1 GCA030176795_01796 CDS open 25094-27391 _na     765_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
2126 JASNVH010000007.1 GCA030176795_01797 CDS open 27519-28496 _na     325_aa Methylenetetrahydrofolate reductase
2127 JASNVH010000007.1 GCA030176795_01798 CDS open 28459-28767 _na     102_aa hypothetical protein
2128 JASNVH010000007.1 GCA030176795_01799 CDS open 28829-29794 _na     321_aa hypothetical protein
2129 JASNVH010000007.1 GCA030176795_01800 CDS open 29992-30285 _na     97_aa hypothetical protein
2130 JASNVH010000007.1 GCA030176795_01801 CDS open 30295-31437 _na     380_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
2131 JASNVH010000007.1 GCA030176795_01802 CDS open 31455-32681 _na     408_aa DUF4143 domain-containing protein
2132 JASNVH010000007.1 GCA030176795_01803 CDS open 33685-34437 _na     250_aa IS3 family transposase
2133 JASNVH010000007.1 GCA030176795_01804 CDS open 34513-34779 _na     88_aa Cardiolipin synthase N-terminal domain-containing protein
2134 JASNVH010000007.1 GCA030176795_01805 CDS open 34811-35602 _na     263_aa Secreted protein
2135 JASNVH010000007.1 GCA030176795_01806 CDS open 35825-35920 _na     31_aa hypothetical protein
2136 JASNVH010000007.1 GCA030176795_01807 CDS open 36158-37177 _na     339_aa tnp IS256 family transposase
2137 JASNVH010000007.1 GCA030176795_01808 CDS open 37391-37696 _na     101_aa GtrA-like protein domain-containing protein
2138 JASNVH010000007.1 GCA030176795_01809 CDS open 37697-38053 _na     118_aa hypothetical protein
2139 JASNVH010000007.1 GCA030176795_01810 CDS open 38106-38792 _na     228_aa DUF305 domain-containing protein
2140 JASNVH010000007.1 GCA030176795_01811 CDS open 38841-40970 _na     709_aa zntA Copper-exporting ATPase
2141 JASNVH010000007.1 GCA030176795_01812 CDS open 41022-41348 _na     108_aa copZ HMA domain-containing protein
2142 JASNVH010000007.1 GCA030176795_01813 CDS open 41463-42335 _na     290_aa ATP-binding protein
2143 JASNVH010000007.1 GCA030176795_01814 CDS open 42275-42589 _na     104_aa hypothetical protein
2144 JASNVH010000007.1 GCA030176795_01815 CDS open 42586-43308 _na     240_aa ompR Two-component system response regulator
2145 JASNVH010000007.1 GCA030176795_01816 CDS open 43712-44287 _na     191_aa Secreted protein
2146 JASNVH010000007.1 GCA030176795_01817 CDS open 44359-45840 _na     493_aa sufI Multicopper oxidase
2147 JASNVH010000007.1 GCA030176795_01818 CDS open 46054-46452 _na     132_aa hypothetical protein
2148 JASNVH010000007.1 GCA030176795_01819 CDS open 46878-47237 _na     119_aa arsR HTH arsR-type domain-containing protein
2149 JASNVH010000007.1 GCA030176795_01820 CDS open 47238-47834 _na     198_aa cadD Cadmium resistance transporter
2150 JASNVH010000007.1 GCA030176795_01821 CDS open 48283-48426 _na     47_aa hypothetical protein
2151 JASNVH010000007.1 GCA030176795_01824 CDS open 49225-49575 _na     116_aa DUF3566 domain-containing protein
2152 JASNVH010000007.1 GCA030176795_01825 CDS open 49580-52180 _na     866_aa gyrA DNA gyrase subunit A
2153 JASNVH010000007.1 GCA030176795_01826 CDS open 52240-53130 _na     296_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
2154 JASNVH010000007.1 GCA030176795_01827 CDS open 53221-55248 _na     675_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2155 JASNVH010000007.1 GCA030176795_01828 CDS open 55382-56059 _na     225_aa dciA Dna[CI] antecedent%2C DciA
2156 JASNVH010000007.1 GCA030176795_01829 CDS open 56056-57390 _na     444_aa recF DNA replication/repair protein RecF
2157 JASNVH010000007.1 GCA030176795_01830 CDS open 57390-58577 _na     395_aa dnaN DNA polymerase III subunit beta
2158 JASNVH010000007.1 GCA030176795_01831 CDS open 59284-61032 _na     582_aa dnaA chromosomal replication initiator protein DnaA
2159 JASNVH010000007.1 GCA030176795_01832 CDS open 61894-62037 _na     47_aa rpmH 50S ribosomal protein L34
2160 JASNVH010000007.1 GCA030176795_01833 CDS open 62125-62463 _na     112_aa rnpA ribonuclease P protein component
2161 JASNVH010000007.1 GCA030176795_01834 CDS open 62460-62765 _na     101_aa yidD membrane protein insertion efficiency factor YidD
2162 JASNVH010000007.1 GCA030176795_01835 CDS open 62785-63792 _na     335_aa yidC membrane protein insertase YidC
2163 JASNVH010000007.1 GCA030176795_01836 CDS open 63792-64394 _na     200_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2164 JASNVH010000007.1 GCA030176795_01837 CDS open 64405-65343 _na     312_aa AAA domain-containing protein
2165 JASNVH010000007.1 GCA030176795_01838 CDS open 65360-66586 _na     408_aa ParB/Sulfiredoxin domain-containing protein
2166 JASNVH010000007.1 GCA030176795_01839 CDS open 66807-67991 _na     394_aa MurNAc-LAA domain-containing protein
2167 JASNVH010000007.1 GCA030176795_01840 CDS open 68141-68464 _na     107_aa trxA thioredoxin
2168 JASNVH010000007.1 GCA030176795_01841 CDS open 68650-69579 _na     309_aa trxB thioredoxin-disulfide reductase
2169 JASNVH010000007.1 GCA030176795_01842 CDS open 69707-70270 _na     187_aa Sigma-70 family RNA polymerase sigma factor
2170 JASNVH010000007.1 GCA030176795_01843 CDS open 70409-74092 _na     1227_aa mviN Integral membrane protein MviN
2171 JASNVH010000007.1 GCA030176795_01844 CDS open 74108-76459 _na     783_aa Secreted protein
2172 JASNVH010000007.1 GCA030176795_01845 CDS open 76456-77286 _na     276_aa Nudix hydrolase domain-containing protein
2173 JASNVH010000007.1 GCA030176795_01846 CDS open 77315-78775 _na     486_aa CCA tRNA nucleotidyltransferase
2174 JASNVH010000007.1 GCA030176795_01847 CDS open 78833-79084 _na     83_aa azlC AzlC protein
2175 JASNVH010000007.1 GCA030176795_01848 CDS open 79117-79452 _na     111_aa hypothetical protein
2176 JASNVH010000007.1 GCA030176795_01849 CDS open 79498-79869 _na     123_aa Rieske domain-containing protein
2177 JASNVH010000007.1 GCA030176795_01850 CDS open 79978-80448 _na     156_aa SdpI/YhfL protein family
2178 JASNVH010000007.1 GCA030176795_01851 CDS open 80542-81822 _na     426_aa Dicarboxylate/amino acid:cation symporter
2179 JASNVH010000007.1 GCA030176795_01852 CDS open 81954-82784 _na     276_aa trpA tryptophan synthase subunit alpha
2180 JASNVH010000007.1 GCA030176795_01853 CDS open 82756-84054 _na     432_aa trpB tryptophan synthase subunit beta
2181 JASNVH010000007.1 GCA030176795_01854 CDS open 84063-85562 _na     499_aa trpF bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF
2182 JASNVH010000007.1 GCA030176795_01855 CDS open 85552-86682 _na     376_aa Anthranilate phosphoribosyltransferase
2183 JASNVH010000007.1 GCA030176795_01856 CDS open 86682-87335 _na     217_aa anthranilate synthase component II
2184 JASNVH010000007.1 GCA030176795_01857 CDS open 87335-88942 _na     535_aa anthranilate synthase component 1
2185 JASNVH010000007.1 GCA030176795_01858 CDS open 89052-90257 _na     401_aa hutI imidazolonepropionase
2186 JASNVH010000007.1 GCA030176795_01859 CDS open 90468-92054 _na     528_aa hutH histidine ammonia-lyase
2187 JASNVH010000007.1 GCA030176795_01860 CDS open 92277-93299 _na     340_aa hutG formimidoylglutamase
2188 JASNVH010000007.1 GCA030176795_01861 CDS open 93357-94724 _na     455_aa Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
2189 JASNVH010000007.1 GCA030176795_01862 CDS open 94769-96214 _na     481_aa Amino acid carrier protein
2190 JASNVH010000007.1 GCA030176795_01863 CDS open 96314-97240 _na     308_aa ABC transporter domain-containing protein
2191 JASNVH010000007.1 GCA030176795_01864 CDS open 97237-98904 _na     555_aa ABC-2 type transporter domain-containing protein
2192 JASNVH010000007.1 GCA030176795_01865 CDS open 99157-101982 _na     941_aa Choice-of-anchor M domain-containing protein
2193 JASNVH010000007.1 GCA030176795_01866 CDS open 102144-104828 _na     894_aa Surface-anchored protein
2194 JASNVH010000007.1 GCA030176795_01867 CDS open 104835-106751 _na     638_aa Cell surface protein
2195 JASNVH010000007.1 GCA030176795_01868 CDS open 106783-108378 _na     531_aa anchored repeat ABC transporter%2C substrate-binding protein
2196 JASNVH010000007.1 GCA030176795_01869 CDS open 108394-109305 _na     303_aa Peptidase
2197 JASNVH010000007.1 GCA030176795_01870 CDS open 109308-110042 _na     244_aa anchored repeat-type ABC transporter ATP-binding subunit
2198 JASNVH010000007.1 GCA030176795_01871 CDS open 110035-110925 _na     296_aa anchored repeat-type ABC transporter permease subunit
2199 JASNVH010000007.1 GCA030176795_01872 CDS open 111031-112500 _na     489_aa Surface-anchored protein
2200 JASNVH010000007.1 GCA030176795_01873 CDS open 112803-114026 _na     407_aa Fido domain-containing protein
2201 JASNVH010000007.1 GCA030176795_01874 CDS open 114063-114542 _na     159_aa MoaB/Mog domain-containing protein
2202 JASNVH010000007.1 GCA030176795_01875 CDS open 114772-116097 _na     441_aa Major facilitator superfamily (MFS) profile domain-containing protein
2203 JASNVH010000007.1 GCA030176795_01876 CDS open 116134-119868 _na     1244_aa nitrate reductase subunit alpha
2204 JASNVH010000007.1 GCA030176795_01877 CDS open 119868-121460 _na     530_aa narH nitrate reductase subunit beta
2205 JASNVH010000007.1 GCA030176795_01878 CDS open 121490-122323 _na     277_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
2206 JASNVH010000007.1 GCA030176795_01879 CDS open 122348-123127 _na     259_aa narI respiratory nitrate reductase subunit gamma
2207 JASNVH010000007.1 GCA030176795_01880 CDS open 123453-123710 _na     85_aa Major facilitator superfamily (MFS) profile domain-containing protein
2208 JASNVH010000007.1 GCA030176795_01881 CDS open 123911-124108 _na     65_aa Transposase
2209 JASNVH010000007.1 GCA030176795_01882 CDS open 124679-125101 _na     140_aa hypothetical protein
2210 JASNVH010000007.1 GCA030176795_01883 CDS open 125747-126223 _na     158_aa DDE-type integrase/transposase/recombinase
2211 JASNVH010000007.1 GCA030176795_01884 CDS open 126401-126553 _na     50_aa Transposase
2212 JASNVH010000007.1 GCA030176795_01885 CDS open 126630-127019 _na     129_aa fluC Fluoride-specific ion channel FluC
2213 JASNVH010000007.1 GCA030176795_01886 CDS open 127016-127462 _na     148_aa Fluoride-specific ion channel
2214 JASNVH010000007.1 GCA030176795_01887 CDS open 127532-128188 _na     218_aa Methylated-DNA--[protein]-cysteine S-methyltransferase
2215 JASNVH010000007.1 GCA030176795_01888 CDS open 128185-128463 _na     92_aa hypothetical protein
2216 JASNVH010000007.1 GCA030176795_01889 CDS open 128728-129750 _na     340_aa Peptidase S1 domain-containing protein
2217 JASNVH010000007.1 GCA030176795_01890 CDS open 129750-132749 _na     999_aa Fibronectin type-III domain-containing protein
2218 JASNVH010000007.1 GCA030176795_01891 CDS open 133270-134409 _na     379_aa Histidine kinase
2219 JASNVH010000007.1 GCA030176795_01892 CDS open 134409-135083 _na     224_aa Response regulator transcription factor
2220 JASNVH010000007.1 GCA030176795_01893 CDS open 135204-135950 _na     248_aa ABC transporter permease
2221 JASNVH010000007.1 GCA030176795_01894 CDS open 135954-136700 _na     248_aa ABC transporter permease
2222 JASNVH010000007.1 GCA030176795_01895 CDS open 136690-137586 _na     298_aa ATP-binding cassette domain-containing protein
2223 JASNVH010000007.1 GCA030176795_01896 CDS open 137600-137833 _na     77_aa hypothetical protein
2224 JASNVH010000007.1 GCA030176795_01897 CDS open 137850-137966 _na     38_aa hypothetical protein
2225 JASNVH010000007.1 GCA030176795_01898 CDS open 138242-138487 _na     81_aa hypothetical protein
2226 JASNVH010000007.1 GCA030176795_01772 gene open 451-1716
2227 JASNVH010000007.1 GCA030176795_01773 gene open 1783-2793
2228 JASNVH010000007.1 GCA030176795_01774 gene open 2836-3141
2229 JASNVH010000007.1 GCA030176795_01775 gene open 3172-4152 bioB
2230 JASNVH010000007.1 GCA030176795_01776 gene open 4351-5052
2231 JASNVH010000007.1 GCA030176795_01777 gene open 5089-6429
2232 JASNVH010000007.1 GCA030176795_01778 gene open 6437-7483
2233 JASNVH010000007.1 GCA030176795_01779 gene open 7486-8577
2234 JASNVH010000007.1 GCA030176795_01780 gene open 8579-9262
2235 JASNVH010000007.1 GCA030176795_01782 gene open 9959-10864
2236 JASNVH010000007.1 GCA030176795_01783 gene open 10894-11361
2237 JASNVH010000007.1 GCA030176795_01784 gene open 11362-12948
2238 JASNVH010000007.1 GCA030176795_01785 gene open 12949-14457 ftsW
2239 JASNVH010000007.1 GCA030176795_01786 gene open 14454-15881
2240 JASNVH010000007.1 GCA030176795_01787 gene open 15885-17714
2241 JASNVH010000007.1 GCA030176795_01788 gene open 17717-19780 pknB
2242 JASNVH010000007.1 GCA030176795_01789 gene open 19896-20168 crgA
2243 JASNVH010000007.1 GCA030176795_01790 gene open 20355-20738
2244 JASNVH010000007.1 GCA030176795_01791 gene open 20808-21332
2245 JASNVH010000007.1 GCA030176795_01792 gene open 21332-22513
2246 JASNVH010000007.1 GCA030176795_01793 gene open 22569-22679
2247 JASNVH010000007.1 GCA030176795_01794 gene open 23214-23744
2248 JASNVH010000007.1 GCA030176795_01795 gene open 23917-25011
2249 JASNVH010000007.1 GCA030176795_01796 gene open 25094-27391 metE
2250 JASNVH010000007.1 GCA030176795_01797 gene open 27519-28496
2251 JASNVH010000007.1 GCA030176795_01798 gene open 28459-28767
2252 JASNVH010000007.1 GCA030176795_01799 gene open 28829-29794
2253 JASNVH010000007.1 GCA030176795_01800 gene open 29992-30285
2254 JASNVH010000007.1 GCA030176795_01801 gene open 30295-31437
2255 JASNVH010000007.1 GCA030176795_01802 gene open 31455-32681
2256 JASNVH010000007.1 GCA030176795_01803 gene open 33685-34437
2257 JASNVH010000007.1 GCA030176795_01804 gene open 34513-34779
2258 JASNVH010000007.1 GCA030176795_01805 gene open 34811-35602
2259 JASNVH010000007.1 GCA030176795_01806 gene open 35825-35920
2260 JASNVH010000007.1 GCA030176795_01807 gene open 36158-37177 tnp
2261 JASNVH010000007.1 GCA030176795_01808 gene open 37391-37696
2262 JASNVH010000007.1 GCA030176795_01809 gene open 37697-38053
2263 JASNVH010000007.1 GCA030176795_01810 gene open 38106-38792
2264 JASNVH010000007.1 GCA030176795_01811 gene open 38841-40970 zntA
2265 JASNVH010000007.1 GCA030176795_01812 gene open 41022-41348 copZ
2266 JASNVH010000007.1 GCA030176795_01813 gene open 41463-42335
2267 JASNVH010000007.1 GCA030176795_01814 gene open 42275-42589
2268 JASNVH010000007.1 GCA030176795_01815 gene open 42586-43308 ompR
2269 JASNVH010000007.1 GCA030176795_01816 gene open 43712-44287
2270 JASNVH010000007.1 GCA030176795_01817 gene open 44359-45840 sufI
2271 JASNVH010000007.1 GCA030176795_01818 gene open 46054-46452
2272 JASNVH010000007.1 GCA030176795_01819 gene open 46878-47237 arsR
2273 JASNVH010000007.1 GCA030176795_01820 gene open 47238-47834 cadD
2274 JASNVH010000007.1 GCA030176795_01821 gene open 48283-48426
2275 JASNVH010000007.1 GCA030176795_01824 gene open 49225-49575
2276 JASNVH010000007.1 GCA030176795_01825 gene open 49580-52180 gyrA
2277 JASNVH010000007.1 GCA030176795_01826 gene open 52240-53130 pdxS
2278 JASNVH010000007.1 GCA030176795_01827 gene open 53221-55248 gyrB
2279 JASNVH010000007.1 GCA030176795_01828 gene open 55382-56059 dciA
2280 JASNVH010000007.1 GCA030176795_01829 gene open 56056-57390 recF
2281 JASNVH010000007.1 GCA030176795_01830 gene open 57390-58577 dnaN
2282 JASNVH010000007.1 GCA030176795_01831 gene open 59284-61032 dnaA
2283 JASNVH010000007.1 GCA030176795_01832 gene open 61894-62037 rpmH
2284 JASNVH010000007.1 GCA030176795_01833 gene open 62125-62463 rnpA
2285 JASNVH010000007.1 GCA030176795_01834 gene open 62460-62765 yidD
2286 JASNVH010000007.1 GCA030176795_01835 gene open 62785-63792 yidC
2287 JASNVH010000007.1 GCA030176795_01836 gene open 63792-64394 rsmG
2288 JASNVH010000007.1 GCA030176795_01837 gene open 64405-65343
2289 JASNVH010000007.1 GCA030176795_01838 gene open 65360-66586
2290 JASNVH010000007.1 GCA030176795_01839 gene open 66807-67991
2291 JASNVH010000007.1 GCA030176795_01840 gene open 68141-68464 trxA
2292 JASNVH010000007.1 GCA030176795_01841 gene open 68650-69579 trxB
2293 JASNVH010000007.1 GCA030176795_01842 gene open 69707-70270
2294 JASNVH010000007.1 GCA030176795_01843 gene open 70409-74092 mviN
2295 JASNVH010000007.1 GCA030176795_01844 gene open 74108-76459
2296 JASNVH010000007.1 GCA030176795_01845 gene open 76456-77286
2297 JASNVH010000007.1 GCA030176795_01846 gene open 77315-78775
2298 JASNVH010000007.1 GCA030176795_01847 gene open 78833-79084 azlC
2299 JASNVH010000007.1 GCA030176795_01848 gene open 79117-79452
2300 JASNVH010000007.1 GCA030176795_01849 gene open 79498-79869
2301 JASNVH010000007.1 GCA030176795_01850 gene open 79978-80448
2302 JASNVH010000007.1 GCA030176795_01851 gene open 80542-81822
2303 JASNVH010000007.1 GCA030176795_01852 gene open 81954-82784 trpA
2304 JASNVH010000007.1 GCA030176795_01853 gene open 82756-84054 trpB
2305 JASNVH010000007.1 GCA030176795_01854 gene open 84063-85562 trpF
2306 JASNVH010000007.1 GCA030176795_01855 gene open 85552-86682
2307 JASNVH010000007.1 GCA030176795_01856 gene open 86682-87335
2308 JASNVH010000007.1 GCA030176795_01857 gene open 87335-88942
2309 JASNVH010000007.1 GCA030176795_01858 gene open 89052-90257 hutI
2310 JASNVH010000007.1 GCA030176795_01859 gene open 90468-92054 hutH
2311 JASNVH010000007.1 GCA030176795_01860 gene open 92277-93299 hutG
2312 JASNVH010000007.1 GCA030176795_01861 gene open 93357-94724
2313 JASNVH010000007.1 GCA030176795_01862 gene open 94769-96214
2314 JASNVH010000007.1 GCA030176795_01863 gene open 96314-97240
2315 JASNVH010000007.1 GCA030176795_01864 gene open 97237-98904
2316 JASNVH010000007.1 GCA030176795_01865 gene open 99157-101982
2317 JASNVH010000007.1 GCA030176795_01866 gene open 102144-104828
2318 JASNVH010000007.1 GCA030176795_01867 gene open 104835-106751
2319 JASNVH010000007.1 GCA030176795_01868 gene open 106783-108378
2320 JASNVH010000007.1 GCA030176795_01869 gene open 108394-109305
2321 JASNVH010000007.1 GCA030176795_01870 gene open 109308-110042
2322 JASNVH010000007.1 GCA030176795_01871 gene open 110035-110925
2323 JASNVH010000007.1 GCA030176795_01872 gene open 111031-112500
2324 JASNVH010000007.1 GCA030176795_01873 gene open 112803-114026
2325 JASNVH010000007.1 GCA030176795_01874 gene open 114063-114542
2326 JASNVH010000007.1 GCA030176795_01875 gene open 114772-116097
2327 JASNVH010000007.1 GCA030176795_01876 gene open 116134-119868
2328 JASNVH010000007.1 GCA030176795_01877 gene open 119868-121460 narH
2329 JASNVH010000007.1 GCA030176795_01878 gene open 121490-122323 narJ
2330 JASNVH010000007.1 GCA030176795_01879 gene open 122348-123127 narI
2331 JASNVH010000007.1 GCA030176795_01880 gene open 123453-123710
2332 JASNVH010000007.1 GCA030176795_01881 gene open 123911-124108
2333 JASNVH010000007.1 GCA030176795_01882 gene open 124679-125101
2334 JASNVH010000007.1 GCA030176795_01883 gene open 125747-126223
2335 JASNVH010000007.1 GCA030176795_01884 gene open 126401-126553
2336 JASNVH010000007.1 GCA030176795_01885 gene open 126630-127019 fluC
2337 JASNVH010000007.1 GCA030176795_01886 gene open 127016-127462
2338 JASNVH010000007.1 GCA030176795_01887 gene open 127532-128188
2339 JASNVH010000007.1 GCA030176795_01888 gene open 128185-128463
2340 JASNVH010000007.1 GCA030176795_01889 gene open 128728-129750
2341 JASNVH010000007.1 GCA030176795_01890 gene open 129750-132749
2342 JASNVH010000007.1 GCA030176795_01891 gene open 133270-134409
2343 JASNVH010000007.1 GCA030176795_01892 gene open 134409-135083
2344 JASNVH010000007.1 GCA030176795_01893 gene open 135204-135950
2345 JASNVH010000007.1 GCA030176795_01894 gene open 135954-136700
2346 JASNVH010000007.1 GCA030176795_01895 gene open 136690-137586
2347 JASNVH010000007.1 GCA030176795_01896 gene open 137600-137833
2348 JASNVH010000007.1 GCA030176795_01897 gene open 137850-137966
2349 JASNVH010000007.1 GCA030176795_01898 gene open 138242-138487
2350 JASNVH010000007.1 GCA030176795_01781 gene open 9569-9653 trnL
2351 JASNVH010000007.1 GCA030176795_01822 gene open 48986-49058 trnA
2352 JASNVH010000007.1 GCA030176795_01823 gene open 49072-49145 trnI
2353 JASNVH010000007.1 GCA030176795_01781 tRNA open 9569-9653 trnL tRNA-Leu(cag)
2354 JASNVH010000007.1 GCA030176795_01822 tRNA open 48986-49058 trnA tRNA-Ala(tgc)
2355 JASNVH010000007.1 GCA030176795_01823 tRNA open 49072-49145 trnI tRNA-Ile(gat)
2356 JASNVH010000008.1 repeat_region open 100392-102198 CRISPR array with 30 repeats of length 28%2C consensus sequence GGCTCATCCCCGCATGCGCGGGGAAAAC and spacer length 33
2357 JASNVH010000008.1 GCA030176795_01899 CDS open 259-1575 _na     438_aa DUF2254 domain-containing protein
2358 JASNVH010000008.1 GCA030176795_01900 CDS open 1754-2245 _na     163_aa Helix-turn-helix transcriptional regulator
2359 JASNVH010000008.1 GCA030176795_01901 CDS open 2644-3282 _na     212_aa DUF3800 domain-containing protein
2360 JASNVH010000008.1 GCA030176795_01902 CDS open 3282-4106 _na     274_aa ImmA/IrrE family metallo-endopeptidase
2361 JASNVH010000008.1 GCA030176795_01903 CDS open 4103-4444 _na     113_aa Helix-turn-helix transcriptional regulator
2362 JASNVH010000008.1 GCA030176795_01904 CDS open 4690-7545 _na     951_aa site-specific DNA-methyltransferase (adenine-specific)
2363 JASNVH010000008.1 GCA030176795_01905 CDS open 7580-10159 _na     859_aa AAA family ATPase
2364 JASNVH010000008.1 GCA030176795_01906 CDS open 10146-11237 _na     363_aa Restriction endonuclease
2365 JASNVH010000008.1 GCA030176795_01907 CDS open 11293-12042 _na     249_aa Abi family protein
2366 JASNVH010000008.1 GCA030176795_01908 CDS open 12278-12898 _na     206_aa DUF4230 domain-containing protein
2367 JASNVH010000008.1 GCA030176795_01909 CDS open 13067-13957 _na     296_aa GIY-YIG nuclease family protein
2368 JASNVH010000008.1 GCA030176795_01910 CDS open 14076-14303 _na     75_aa hypothetical protein
2369 JASNVH010000008.1 GCA030176795_01911 CDS open 14383-14937 _na     184_aa PIN domain-containing protein
2370 JASNVH010000008.1 GCA030176795_01912 CDS open 14934-15383 _na     149_aa Helix-turn-helix domain-containing protein
2371 JASNVH010000008.1 GCA030176795_01913 CDS open 15492-16433 _na     313_aa BRCT domain-containing protein
2372 JASNVH010000008.1 GCA030176795_01914 CDS open 16637-18043 _na     468_aa ATP-binding protein
2373 JASNVH010000008.1 GCA030176795_01915 CDS open 18182-20020 _na     612_aa selB selenocysteine-specific translation elongation factor
2374 JASNVH010000008.1 GCA030176795_01916 CDS open 20021-21391 _na     456_aa selA L-seryl-tRNA(Sec) selenium transferase
2375 JASNVH010000008.1 GCA030176795_01918 CDS open 21640-22683 _na     347_aa selD selenide%2C water dikinase SelD
2376 JASNVH010000008.1 GCA030176795_01919 CDS open 22739-23857 _na     372_aa Nitrite reductase
2377 JASNVH010000008.1 GCA030176795_01920 CDS open 23854-24987 _na     377_aa 4Fe-4S ferredoxin-type domain-containing protein
2378 JASNVH010000008.1 GCA030176795_01921 CDS open 24994-27648 _na     884_aa Formate dehydrogenase%2C alpha subunit
2379 JASNVH010000008.1 GCA030176795_01922 CDS open 27757-28443 _na     228_aa 4Fe-4S Mo/W bis-MGD-type domain-containing protein
2380 JASNVH010000008.1 GCA030176795_01923 CDS open 28629-30155 _na     508_aa Dicarboxylate/amino acid:cation symporter
2381 JASNVH010000008.1 GCA030176795_01924 CDS open 30865-31641 _na     258_aa Hemerythrin-like domain-containing protein
2382 JASNVH010000008.1 GCA030176795_01925 CDS open 31753-32439 _na     228_aa YhhN-like protein
2383 JASNVH010000008.1 GCA030176795_01926 CDS open 32467-33093 _na     208_aa Methyltransferase domain-containing protein
2384 JASNVH010000008.1 GCA030176795_01927 CDS open 33196-33654 _na     152_aa cynS cyanase
2385 JASNVH010000008.1 GCA030176795_01928 CDS open 33699-34457 _na     252_aa ABC transporter domain-containing protein
2386 JASNVH010000008.1 GCA030176795_01929 CDS open 34454-35419 _na     321_aa Enterobactin ABC transporter permease
2387 JASNVH010000008.1 GCA030176795_01930 CDS open 35409-36323 _na     304_aa Iron ABC transporter permease
2388 JASNVH010000008.1 GCA030176795_01931 CDS open 36360-37361 _na     333_aa Fe/B12 periplasmic-binding domain-containing protein
2389 JASNVH010000008.1 GCA030176795_01933 CDS open 37866-39449 _na     527_aa Divalent anion:Na+ symporter (DASS) family transporter
2390 JASNVH010000008.1 GCA030176795_01934 CDS open 39516-40880 _na     454_aa mgtE magnesium transporter
2391 JASNVH010000008.1 GCA030176795_01935 CDS open 41027-41767 _na     246_aa DUF2470 domain-containing protein
2392 JASNVH010000008.1 GCA030176795_01936 CDS open 41797-43185 _na     462_aa Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein
2393 JASNVH010000008.1 GCA030176795_01938 CDS open 43450-44484 _na     344_aa hisC histidinol-phosphate transaminase
2394 JASNVH010000008.1 GCA030176795_01939 CDS open 44484-44903 _na     139_aa Phage holin family protein
2395 JASNVH010000008.1 GCA030176795_01940 CDS open 45090-45311 _na     73_aa Cell wall anchor protein
2396 JASNVH010000008.1 GCA030176795_01942 CDS open 45593-46633 _na     346_aa Enoyl reductase (ER) domain-containing protein
2397 JASNVH010000008.1 GCA030176795_01943 CDS open 46630-47865 _na     411_aa Aminotransferase class V domain-containing protein
2398 JASNVH010000008.1 GCA030176795_01944 CDS open 48022-48939 _na     305_aa ABC-2 type transporter transmembrane domain-containing protein
2399 JASNVH010000008.1 GCA030176795_01945 CDS open 48985-49770 _na     261_aa ABC transporter domain-containing protein
2400 JASNVH010000008.1 GCA030176795_01946 CDS open 49831-50775 _na     314_aa Glycosyltransferase 2-like domain-containing protein
2401 JASNVH010000008.1 GCA030176795_01947 CDS open 50850-51377 _na     175_aa Suppressor of fused-like domain-containing protein
2402 JASNVH010000008.1 GCA030176795_01948 CDS open 51413-51880 _na     155_aa GtrA/DPMS transmembrane domain-containing protein
2403 JASNVH010000008.1 GCA030176795_01949 CDS open 51964-52851 _na     295_aa DUF2877 domain-containing protein
2404 JASNVH010000008.1 GCA030176795_01950 CDS open 52897-53145 _na     82_aa hypothetical protein
2405 JASNVH010000008.1 GCA030176795_01951 CDS open 53154-54569 _na     471_aa FAD-binding PCMH-type domain-containing protein
2406 JASNVH010000008.1 GCA030176795_01952 CDS open 54636-55397 _na     253_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
2407 JASNVH010000008.1 GCA030176795_01953 CDS open 55428-57341 _na     637_aa Galactan 5-O-arabinofuranosyltransferase
2408 JASNVH010000008.1 GCA030176795_01954 CDS open 57432-60767 _na     1111_aa Arabinosyltransferase C
2409 JASNVH010000008.1 GCA030176795_01955 CDS open 60771-62795 _na     674_aa Galactan 5-O-arabinofuranosyltransferase
2410 JASNVH010000008.1 GCA030176795_01956 CDS open 62820-63752 _na     310_aa NAD-dependent epimerase/dehydratase domain-containing protein
2411 JASNVH010000008.1 GCA030176795_01957 CDS open 63813-64238 _na     141_aa DUF2304 domain-containing protein
2412 JASNVH010000008.1 GCA030176795_01958 CDS open 64239-64931 _na     230_aa Glycosyltransferase 2-like domain-containing protein
2413 JASNVH010000008.1 GCA030176795_01959 CDS open 64948-66288 _na     446_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2414 JASNVH010000008.1 GCA030176795_01960 CDS open 66301-67194 _na     297_aa Glycosyltransferase 2-like domain-containing protein
2415 JASNVH010000008.1 GCA030176795_01961 CDS open 67194-68099 _na     301_aa Alpha/beta hydrolase fold domain-containing protein
2416 JASNVH010000008.1 GCA030176795_01962 CDS open 68217-68831 _na     204_aa Maltokinase N-terminal cap domain-containing protein
2417 JASNVH010000008.1 GCA030176795_01963 CDS open 68877-70862 _na     661_aa Peptidase M13
2418 JASNVH010000008.1 GCA030176795_01964 CDS open 70891-71592 _na     233_aa DUF3515 domain-containing protein
2419 JASNVH010000008.1 GCA030176795_01965 CDS open 71595-72449 _na     284_aa prsW PrsW family intramembrane metalloprotease
2420 JASNVH010000008.1 GCA030176795_01966 CDS open 72450-74048 _na     532_aa Aldehyde dehydrogenase domain-containing protein
2421 JASNVH010000008.1 GCA030176795_01967 CDS open 74131-74892 _na     253_aa Peptidase S1 domain-containing protein
2422 JASNVH010000008.1 GCA030176795_01968 CDS open 75053-75994 _na     313_aa Peptidase S1 domain-containing protein
2423 JASNVH010000008.1 GCA030176795_01969 CDS open 76122-76295 _na     57_aa hypothetical protein
2424 JASNVH010000008.1 GCA030176795_01970 CDS open 76434-78593 _na     719_aa High-affinity choline transporter
2425 JASNVH010000008.1 GCA030176795_01971 CDS open 78812-80614 _na     600_aa betA choline dehydrogenase
2426 JASNVH010000008.1 GCA030176795_01972 CDS open 80631-82229 _na     532_aa PepSY domain-containing protein
2427 JASNVH010000008.1 GCA030176795_01973 CDS open 82423-83406 _na     327_aa Aldose 1-epimerase
2428 JASNVH010000008.1 GCA030176795_01974 CDS open 83575-85230 _na     551_aa Solute:sodium symporter (SSS) family transporter
2429 JASNVH010000008.1 GCA030176795_01975 CDS open 85249-85551 _na     100_aa Cell wall anchor protein
2430 JASNVH010000008.1 GCA030176795_01976 CDS open 85566-86792 _na     408_aa galT galactose-1-phosphate uridylyltransferase
2431 JASNVH010000008.1 GCA030176795_01977 CDS open 86785-88086 _na     433_aa galK galactokinase
2432 JASNVH010000008.1 GCA030176795_01978 CDS open 88238-88642 _na     134_aa panD aspartate 1-decarboxylase
2433 JASNVH010000008.1 GCA030176795_01979 CDS open 88644-90104 _na     486_aa Divalent anion:Na+ symporter (DASS) family transporter
2434 JASNVH010000008.1 GCA030176795_01980 CDS open 90121-91446 _na     441_aa dcuA C4-dicarboxylate transporter DcuA
2435 JASNVH010000008.1 GCA030176795_01981 CDS open 91693-91875 _na     60_aa hypothetical protein
2436 JASNVH010000008.1 GCA030176795_01982 CDS open 91964-93601 _na     545_aa HNH nuclease domain-containing protein
2437 JASNVH010000008.1 GCA030176795_01983 CDS open 93820-94620 _na     266_aa MOSC domain-containing protein
2438 JASNVH010000008.1 GCA030176795_01984 CDS open 94747-96111 _na     454_aa Major facilitator superfamily (MFS) profile domain-containing protein
2439 JASNVH010000008.1 GCA030176795_01985 CDS open 96313-97143 _na     276_aa VOC domain-containing protein
2440 JASNVH010000008.1 GCA030176795_01986 CDS open 97143-97463 _na     106_aa RNA-binding S4 domain-containing protein
2441 JASNVH010000008.1 GCA030176795_01987 CDS open 97497-98216 _na     239_aa SDR family oxidoreductase
2442 JASNVH010000008.1 GCA030176795_01988 CDS open 98252-99310 _na     352_aa Ammonia monooxygenase
2443 JASNVH010000008.1 GCA030176795_01989 CDS open 99924-100271 _na     115_aa HTH cro/C1-type domain-containing protein
2444 JASNVH010000008.1 GCA030176795_01990 CDS open 102505-105348 _na     947_aa CRISPR-associated helicase Cas3
2445 JASNVH010000008.1 GCA030176795_01991 CDS open 105394-107106 _na     570_aa casA type I-E CRISPR-associated protein Cse1/CasA
2446 JASNVH010000008.1 GCA030176795_01992 CDS open 107099-107716 _na     205_aa casB type I-E CRISPR-associated protein Cse2/CasB
2447 JASNVH010000008.1 GCA030176795_01993 CDS open 107743-108873 _na     376_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2448 JASNVH010000008.1 GCA030176795_01994 CDS open 108875-109597 _na     240_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2449 JASNVH010000008.1 GCA030176795_01995 CDS open 109594-110241 _na     215_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2450 JASNVH010000008.1 GCA030176795_01996 CDS open 110247-111191 _na     314_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
2451 JASNVH010000008.1 GCA030176795_01997 CDS open 111188-111532 _na     114_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
2452 JASNVH010000008.1 GCA030176795_01998 CDS open 111605-113341 _na     578_aa DUF885 domain-containing protein
2453 JASNVH010000008.1 GCA030176795_01999 CDS open 113533-114780 _na     415_aa HTH marR-type domain-containing protein
2454 JASNVH010000008.1 GCA030176795_02000 CDS open 114864-115382 _na     172_aa Gamma carbonic anhydrase family protein
2455 JASNVH010000008.1 GCA030176795_02001 CDS open 115422-116042 _na     206_aa Haloacid dehalogenase
2456 JASNVH010000008.1 GCA030176795_02002 CDS open 116089-116622 _na     177_aa Cell-surface hemin receptor
2457 JASNVH010000008.1 GCA030176795_02003 CDS open 116710-116928 _na     72_aa hypothetical protein
2458 JASNVH010000008.1 GCA030176795_02004 CDS open 116870-118828 _na     652_aa Htaa domain-containing protein
2459 JASNVH010000008.1 GCA030176795_02005 CDS open 118937-120040 _na     367_aa Fe/B12 periplasmic-binding domain-containing protein
2460 JASNVH010000008.1 GCA030176795_02006 CDS open 120021-121151 _na     376_aa ABC transporter permease
2461 JASNVH010000008.1 GCA030176795_02007 CDS open 121151-121966 _na     271_aa heme ABC transporter ATP-binding protein
2462 JASNVH010000008.1 GCA030176795_02008 CDS open 122164-123390 _na     408_aa Htaa domain-containing protein
2463 JASNVH010000008.1 GCA030176795_02009 CDS open 123610-125100 _na     496_aa Fibronectin type-III domain-containing protein
2464 JASNVH010000008.1 GCA030176795_02010 CDS open 125361-127628 _na     755_aa htaA HtaA domain-containing protein
2465 JASNVH010000008.1 GCA030176795_02011 CDS open 127825-128829 _na     334_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
2466 JASNVH010000008.1 GCA030176795_02012 CDS open 128833-129291 _na     152_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2467 JASNVH010000008.1 GCA030176795_01899 gene open 259-1575
2468 JASNVH010000008.1 GCA030176795_01900 gene open 1754-2245
2469 JASNVH010000008.1 GCA030176795_01901 gene open 2644-3282
2470 JASNVH010000008.1 GCA030176795_01902 gene open 3282-4106
2471 JASNVH010000008.1 GCA030176795_01903 gene open 4103-4444
2472 JASNVH010000008.1 GCA030176795_01904 gene open 4690-7545
2473 JASNVH010000008.1 GCA030176795_01905 gene open 7580-10159
2474 JASNVH010000008.1 GCA030176795_01906 gene open 10146-11237
2475 JASNVH010000008.1 GCA030176795_01907 gene open 11293-12042
2476 JASNVH010000008.1 GCA030176795_01908 gene open 12278-12898
2477 JASNVH010000008.1 GCA030176795_01909 gene open 13067-13957
2478 JASNVH010000008.1 GCA030176795_01910 gene open 14076-14303
2479 JASNVH010000008.1 GCA030176795_01911 gene open 14383-14937
2480 JASNVH010000008.1 GCA030176795_01912 gene open 14934-15383
2481 JASNVH010000008.1 GCA030176795_01913 gene open 15492-16433
2482 JASNVH010000008.1 GCA030176795_01914 gene open 16637-18043
2483 JASNVH010000008.1 GCA030176795_01915 gene open 18182-20020 selB
2484 JASNVH010000008.1 GCA030176795_01916 gene open 20021-21391 selA
2485 JASNVH010000008.1 GCA030176795_01918 gene open 21640-22683 selD
2486 JASNVH010000008.1 GCA030176795_01919 gene open 22739-23857
2487 JASNVH010000008.1 GCA030176795_01920 gene open 23854-24987
2488 JASNVH010000008.1 GCA030176795_01921 gene open 24994-27648
2489 JASNVH010000008.1 GCA030176795_01922 gene open 27757-28443
2490 JASNVH010000008.1 GCA030176795_01923 gene open 28629-30155
2491 JASNVH010000008.1 GCA030176795_01924 gene open 30865-31641
2492 JASNVH010000008.1 GCA030176795_01925 gene open 31753-32439
2493 JASNVH010000008.1 GCA030176795_01926 gene open 32467-33093
2494 JASNVH010000008.1 GCA030176795_01927 gene open 33196-33654 cynS
2495 JASNVH010000008.1 GCA030176795_01928 gene open 33699-34457
2496 JASNVH010000008.1 GCA030176795_01929 gene open 34454-35419
2497 JASNVH010000008.1 GCA030176795_01930 gene open 35409-36323
2498 JASNVH010000008.1 GCA030176795_01931 gene open 36360-37361
2499 JASNVH010000008.1 GCA030176795_01933 gene open 37866-39449
2500 JASNVH010000008.1 GCA030176795_01934 gene open 39516-40880 mgtE