HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_030180665.1)

Select a Genome:
BAKTA Annotations for GCA_030180665.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
34 2036402 1854 7 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3842 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3842 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JAMGTF010000002.1 GCA030180665_00951 gene open 258375-259322
1502 JAMGTF010000002.1 GCA030180665_00952 gene open 259436-259744
1503 JAMGTF010000002.1 GCA030180665_00953 gene open 259797-260159
1504 JAMGTF010000002.1 GCA030180665_00954 gene open 260354-260905 ykuD
1505 JAMGTF010000002.1 GCA030180665_00955 gene open 261434-261742
1506 JAMGTF010000002.1 GCA030180665_00956 gene open 261857-262213
1507 JAMGTF010000002.1 GCA030180665_00957 gene open 262366-262842
1508 JAMGTF010000002.1 GCA030180665_00958 gene open 262842-263300 araC
1509 JAMGTF010000002.1 GCA030180665_00959 gene open 263461-263940
1510 JAMGTF010000002.1 GCA030180665_00960 gene open 263958-264749
1511 JAMGTF010000002.1 GCA030180665_00961 gene open 264844-265422
1512 JAMGTF010000002.1 GCA030180665_00962 gene open 265466-265933
1513 JAMGTF010000002.1 GCA030180665_00963 gene open 266089-266979
1514 JAMGTF010000002.1 GCA030180665_00964 gene open 267170-267682
1515 JAMGTF010000002.1 GCA030180665_00965 gene open 267995-268285
1516 JAMGTF010000002.1 GCA030180665_00838 gene open 152752-152828 trnR
1517 JAMGTF010000002.1 GCA030180665_00838 tRNA open 152752-152828 trnR tRNA-Arg(cct)
1518 JAMGTF010000003.1 regulatory_region open 70926-71023 Purine riboswitch aptamer
1519 JAMGTF010000003.1 repeat_region open 104546-105520 CRISPR array with 15 repeats of length 30%2C consensus sequence ATTTAAATTTCAGTCTGCTTCGATTATGAG and spacer length 36
1520 JAMGTF010000003.1 GCA030180665_00968 CDS open 605-1006 _na     133_aa tnpA IS200/IS605 family transposase
1521 JAMGTF010000003.1 GCA030180665_00969 CDS open 1215-1757 _na     180_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1522 JAMGTF010000003.1 GCA030180665_00970 CDS open 1834-2517 _na     227_aa Lipoprotein releasing system%2C ATP-binding protein
1523 JAMGTF010000003.1 GCA030180665_00971 CDS open 2510-3679 _na     389_aa Lipoprotein releasing system%2C transmembrane protein%2C LolC/E family
1524 JAMGTF010000003.1 GCA030180665_00972 CDS open 3682-5457 _na     591_aa recQ DNA helicase RecQ
1525 JAMGTF010000003.1 GCA030180665_00973 CDS open 5476-6381 _na     301_aa dprA DNA protecting protein DprA
1526 JAMGTF010000003.1 GCA030180665_00974 CDS open 6504-7625 _na     373_aa dnaN DNA polymerase III subunit beta
1527 JAMGTF010000003.1 GCA030180665_00975 CDS open 7641-8459 _na     272_aa RNA polymerase sigma factor
1528 JAMGTF010000003.1 GCA030180665_00976 CDS open 8486-9487 _na     333_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
1529 JAMGTF010000003.1 GCA030180665_00977 CDS open 9500-10099 _na     199_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1530 JAMGTF010000003.1 GCA030180665_00978 CDS open 10167-11165 _na     332_aa tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
1531 JAMGTF010000003.1 GCA030180665_00979 CDS open 11169-11735 _na     188_aa sepF Cell division protein SepF
1532 JAMGTF010000003.1 GCA030180665_00980 CDS open 11748-12428 _na     226_aa Pyridoxal phosphate homeostasis protein
1533 JAMGTF010000003.1 GCA030180665_00981 CDS open 12441-13538 _na     365_aa hemW radical SAM family heme chaperone HemW
1534 JAMGTF010000003.1 GCA030180665_00982 CDS open 13522-15216 _na     564_aa Phosphoglucomutase/phosphomannomutase%2C alpha/beta/alpha domain I
1535 JAMGTF010000003.1 GCA030180665_00983 CDS open 15473-16591 _na     372_aa Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein
1536 JAMGTF010000003.1 GCA030180665_00984 CDS open 17128-17847 _na     239_aa traT TraT complement resistance protein
1537 JAMGTF010000003.1 GCA030180665_00985 CDS open 17958-19577 _na     539_aa groL chaperonin GroEL
1538 JAMGTF010000003.1 GCA030180665_00986 CDS open 19600-19863 _na     87_aa Co-chaperonin GroES
1539 JAMGTF010000003.1 GCA030180665_00987 CDS open 20024-20299 _na     91_aa csoR Copper-sensing transcriptional repressor CsoR
1540 JAMGTF010000003.1 GCA030180665_00988 CDS open 20389-20937 _na     182_aa MORN repeat protein
1541 JAMGTF010000003.1 GCA030180665_00989 CDS open 20975-21766 _na     263_aa Methyltransferase
1542 JAMGTF010000003.1 GCA030180665_00990 CDS open 21770-22120 _na     116_aa padR Transcriptional regulator%2C PadR family
1543 JAMGTF010000003.1 GCA030180665_00991 CDS open 22107-23777 _na     556_aa nikD nickel import ATP-binding protein NikD
1544 JAMGTF010000003.1 GCA030180665_00992 CDS open 23762-24583 _na     273_aa ABC transmembrane type-1 domain-containing protein
1545 JAMGTF010000003.1 GCA030180665_00993 CDS open 24580-25536 _na     318_aa Peptide ABC transporter permease
1546 JAMGTF010000003.1 GCA030180665_00994 CDS open 25538-27088 _na     516_aa DNA-binding protein
1547 JAMGTF010000003.1 GCA030180665_00995 CDS open 27270-28217 _na     315_aa 2-nitropropane dioxygenase
1548 JAMGTF010000003.1 GCA030180665_00996 CDS open 28443-29657 _na     404_aa Metallo-beta-lactamase domain protein
1549 JAMGTF010000003.1 GCA030180665_00997 CDS open 29654-30118 _na     154_aa PF07308 family protein
1550 JAMGTF010000003.1 GCA030180665_00998 CDS open 30146-32104 _na     652_aa [FeFe] hydrogenase%2C group A
1551 JAMGTF010000003.1 GCA030180665_00999 CDS open 32268-32702 _na     144_aa hypothetical protein
1552 JAMGTF010000003.1 GCA030180665_01000 CDS open 32702-34006 _na     434_aa AAA family ATPase
1553 JAMGTF010000003.1 GCA030180665_01001 CDS open 34031-35410 _na     459_aa Xaa-Pro aminopeptidase
1554 JAMGTF010000003.1 GCA030180665_01002 CDS open 35438-37507 _na     689_aa fusA elongation factor G
1555 JAMGTF010000003.1 GCA030180665_01003 CDS open 37847-38446 _na     199_aa Lipoprotein
1556 JAMGTF010000003.1 GCA030180665_01004 CDS open 38531-42868 _na     1445_aa YadA-like family protein
1557 JAMGTF010000003.1 GCA030180665_01005 CDS open 43551-44144 _na     197_aa ABC transporter permease
1558 JAMGTF010000003.1 GCA030180665_01006 CDS open 44176-44721 _na     181_aa DUF4276 domain-containing protein
1559 JAMGTF010000003.1 GCA030180665_01007 CDS open 44703-44837 _na     44_aa hypothetical protein
1560 JAMGTF010000003.1 GCA030180665_01008 CDS open 44834-45334 _na     166_aa AAA family ATPase
1561 JAMGTF010000003.1 GCA030180665_01009 CDS open 45771-47279 _na     502_aa ABC transporter substrate-binding protein
1562 JAMGTF010000003.1 GCA030180665_01010 CDS open 47297-48778 _na     493_aa DUF2974 domain-containing protein
1563 JAMGTF010000003.1 GCA030180665_01011 CDS open 48782-49519 _na     245_aa PAP2 family protein
1564 JAMGTF010000003.1 GCA030180665_01012 CDS open 49522-50016 _na     164_aa ybeY rRNA maturation RNase YbeY
1565 JAMGTF010000003.1 GCA030180665_01013 CDS open 50029-52128 _na     699_aa Phosphohydrolase
1566 JAMGTF010000003.1 GCA030180665_01014 CDS open 52139-54217 _na     692_aa DNA 5'-3' helicase
1567 JAMGTF010000003.1 GCA030180665_01015 CDS open 54455-55924 _na     489_aa PTS system%2C N-acetylglucosamine-specific IIBC component
1568 JAMGTF010000003.1 GCA030180665_01016 CDS open 56044-56484 _na     146_aa Dinitrogenase iron-molybdenum cofactor
1569 JAMGTF010000003.1 GCA030180665_01017 CDS open 56490-56846 _na     118_aa UPF0251 protein EPT53_06750
1570 JAMGTF010000003.1 GCA030180665_01018 CDS open 56920-58086 _na     388_aa Methyltransferase TRM13
1571 JAMGTF010000003.1 GCA030180665_01019 CDS open 58106-59329 _na     407_aa ABC transporter permease
1572 JAMGTF010000003.1 GCA030180665_01020 CDS open 59326-60000 _na     224_aa ABC transporter%2C ATP-binding protein
1573 JAMGTF010000003.1 GCA030180665_01021 CDS open 59975-61051 _na     358_aa Efflux transporter%2C RND family%2C MFP subunit
1574 JAMGTF010000003.1 GCA030180665_01022 CDS open 61048-62322 _na     424_aa tolC TolC family protein
1575 JAMGTF010000003.1 GCA030180665_01023 CDS open 62341-62925 _na     194_aa Phosphoglycerate mutase
1576 JAMGTF010000003.1 GCA030180665_01024 CDS open 62941-63528 _na     195_aa ruvA Holliday junction branch migration protein RuvA
1577 JAMGTF010000003.1 GCA030180665_01025 CDS open 63533-66385 _na     950_aa uvrA excinuclease ABC subunit UvrA
1578 JAMGTF010000003.1 GCA030180665_01026 CDS open 66403-67929 _na     508_aa Stage II sporulation protein B
1579 JAMGTF010000003.1 GCA030180665_01027 CDS open 67916-68659 _na     247_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
1580 JAMGTF010000003.1 GCA030180665_01028 CDS open 68966-69532 _na     188_aa xanthine phosphoribosyltransferase
1581 JAMGTF010000003.1 GCA030180665_01029 CDS open 69549-70856 _na     435_aa Xanthine permease
1582 JAMGTF010000003.1 GCA030180665_01030 CDS open 71228-72844 _na     538_aa potassium/proton antiporter
1583 JAMGTF010000003.1 GCA030180665_01031 CDS open 72867-74207 _na     446_aa Poly(A) polymerase
1584 JAMGTF010000003.1 GCA030180665_01032 CDS open 74209-74604 _na     131_aa 8-oxo-dGTP diphosphatase
1585 JAMGTF010000003.1 GCA030180665_01033 CDS open 74719-75300 _na     193_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1586 JAMGTF010000003.1 GCA030180665_01034 CDS open 75432-77216 _na     594_aa aspS aspartate--tRNA ligase
1587 JAMGTF010000003.1 GCA030180665_01035 CDS open 77220-78461 _na     413_aa hisS histidine--tRNA ligase
1588 JAMGTF010000003.1 GCA030180665_01036 CDS open 78463-79695 _na     410_aa Replication-associated recombination protein A
1589 JAMGTF010000003.1 GCA030180665_01037 CDS open 79798-80022 _na     74_aa secG preprotein translocase subunit SecG
1590 JAMGTF010000003.1 GCA030180665_01038 CDS open 80084-81199 _na     371_aa mutY A/G-specific adenine glycosylase
1591 JAMGTF010000003.1 GCA030180665_01039 CDS open 81285-81884 _na     199_aa Thymidylate synthase
1592 JAMGTF010000003.1 GCA030180665_01040 CDS open 82008-83177 _na     389_aa comE Competence protein ComE
1593 JAMGTF010000003.1 GCA030180665_01041 CDS open 83180-84469 _na     429_aa Melibiose carrier protein
1594 JAMGTF010000003.1 GCA030180665_01042 CDS open 84466-85575 _na     369_aa tRNA(Met) cytidine acetate ligase
1595 JAMGTF010000003.1 GCA030180665_01043 CDS open 85586-86614 _na     342_aa Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
1596 JAMGTF010000003.1 GCA030180665_01044 CDS open 86626-87195 _na     189_aa ruvC crossover junction endodeoxyribonuclease RuvC
1597 JAMGTF010000003.1 GCA030180665_01045 CDS open 87198-87656 _na     152_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
1598 JAMGTF010000003.1 GCA030180665_01046 CDS open 87845-88465 _na     206_aa MBL fold metallo-hydrolase
1599 JAMGTF010000003.1 GCA030180665_01047 CDS open 88489-89415 _na     308_aa Thioredoxin reductase
1600 JAMGTF010000003.1 GCA030180665_01048 CDS open 89449-90756 _na     435_aa phoH PhoH family protein
1601 JAMGTF010000003.1 GCA030180665_01049 CDS open 91316-94600 _na     1094_aa Cell surface protein
1602 JAMGTF010000003.1 GCA030180665_01050 CDS open 94727-95131 _na     134_aa Enoyl-CoA hydratase
1603 JAMGTF010000003.1 GCA030180665_01051 CDS open 95161-96540 _na     459_aa Citrate transporter
1604 JAMGTF010000003.1 GCA030180665_01052 CDS open 96577-98121 _na     514_aa 3-oxoacid CoA-transferase
1605 JAMGTF010000003.1 GCA030180665_01053 CDS open 98340-99464 _na     374_aa tetR Transcriptional regulator%2C TetR family
1606 JAMGTF010000003.1 GCA030180665_01054 CDS open 99738-101150 _na     470_aa PTS glucose transporter subunit IIB
1607 JAMGTF010000003.1 GCA030180665_01055 CDS open 101143-102051 _na     302_aa murQ N-acetylmuramic acid 6-phosphate etherase
1608 JAMGTF010000003.1 GCA030180665_01056 CDS open 102084-103220 _na     378_aa Haloacid dehalogenase-like hydrolase
1609 JAMGTF010000003.1 GCA030180665_01057 CDS open 103708-103893 _na     61_aa hypothetical protein
1610 JAMGTF010000003.1 GCA030180665_01058 CDS open 105835-108234 _na     799_aa HD Cas3-type domain-containing protein
1611 JAMGTF010000003.1 GCA030180665_01059 CDS open 108432-109184 _na     250_aa CRISPR-associated protein Cas5
1612 JAMGTF010000003.1 GCA030180665_01060 CDS open 109171-110043 _na     290_aa cas7i type I-B CRISPR-associated protein Cas7/Cst2/DevR
1613 JAMGTF010000003.1 GCA030180665_01061 CDS open 110047-111747 _na     566_aa CRISPR-associated protein CXXC-CXXC domain-containing protein
1614 JAMGTF010000003.1 GCA030180665_01062 CDS open 111759-112481 _na     240_aa cas6 CRISPR-associated endoribonuclease Cas6
1615 JAMGTF010000003.1 GCA030180665_01063 CDS open 113201-114283 _na     360_aa DUF262 domain-containing protein
1616 JAMGTF010000003.1 GCA030180665_01064 CDS open 114295-115260 _na     321_aa SIR2-like domain-containing protein
1617 JAMGTF010000003.1 GCA030180665_01065 CDS open 115639-115749 _na     36_aa hypothetical protein
1618 JAMGTF010000003.1 GCA030180665_01066 CDS open 116556-117152 _na     198_aa hypothetical protein
1619 JAMGTF010000003.1 GCA030180665_01067 CDS open 117546-117869 _na     107_aa Arm DNA-binding domain-containing protein
1620 JAMGTF010000003.1 GCA030180665_01068 CDS open 118195-119733 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
1621 JAMGTF010000003.1 GCA030180665_01069 CDS open 120165-120635 _na     156_aa ClbS/DfsB family four-helix bundle protein
1622 JAMGTF010000003.1 GCA030180665_01070 CDS open 120759-121202 _na     147_aa IAA acetyltransferase
1623 JAMGTF010000003.1 GCA030180665_01071 CDS open 121800-123152 _na     450_aa creD cell envelope integrity protein CreD
1624 JAMGTF010000003.1 GCA030180665_01072 CDS open 123168-123881 _na     237_aa VWA domain-containing protein
1625 JAMGTF010000003.1 GCA030180665_01073 CDS open 124164-125471 _na     435_aa eno phosphopyruvate hydratase
1626 JAMGTF010000003.1 GCA030180665_01074 CDS open 125505-126923 _na     472_aa pykF pyruvate kinase PykF
1627 JAMGTF010000003.1 GCA030180665_01075 CDS open 127057-127518 _na     153_aa YhcH/YjgK/YiaL family protein
1628 JAMGTF010000003.1 GCA030180665_01076 CDS open 127665-128342 _na     225_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
1629 JAMGTF010000003.1 GCA030180665_01077 CDS open 128353-129225 _na     290_aa N-acetylneuraminate lyase
1630 JAMGTF010000003.1 GCA030180665_01078 CDS open 129222-130124 _na     300_aa N-acetylmannosamine kinase
1631 JAMGTF010000003.1 GCA030180665_01079 CDS open 130128-131981 _na     617_aa dctM TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
1632 JAMGTF010000003.1 GCA030180665_01080 CDS open 131999-132988 _na     329_aa siaP Sialic acid-binding periplasmic protein SiaP
1633 JAMGTF010000003.1 GCA030180665_01081 CDS open 133002-134009 _na     335_aa lacI LacI family transcriptional regulator
1634 JAMGTF010000003.1 GCA030180665_01082 CDS open 134013-135122 _na     369_aa Cyclically-permuted mutarotase family protein
1635 JAMGTF010000003.1 GCA030180665_01083 CDS open 135283-135822 _na     179_aa Outer membrane protein
1636 JAMGTF010000003.1 GCA030180665_01084 CDS open 135842-136981 _na     379_aa D-alanyl-D-alanine carboxypeptidase
1637 JAMGTF010000003.1 GCA030180665_01085 CDS open 137103-137480 _na     125_aa nifU Fe-S cluster assembly scaffold protein NifU
1638 JAMGTF010000003.1 GCA030180665_01086 CDS open 137528-138700 _na     390_aa nifS cysteine desulfurase NifS
1639 JAMGTF010000003.1 GCA030180665_01087 CDS open 138761-139402 _na     213_aa nth endonuclease III
1640 JAMGTF010000003.1 GCA030180665_01088 CDS open 139395-139856 _na     153_aa Acetyltransferase (GNAT) domain protein
1641 JAMGTF010000003.1 GCA030180665_01089 CDS open 139867-141075 _na     402_aa tyrS tyrosine--tRNA ligase
1642 JAMGTF010000003.1 GCA030180665_01090 CDS open 141247-144201 _na     984_aa Autotransporter domain-containing protein
1643 JAMGTF010000003.1 GCA030180665_01091 CDS open 144226-144627 _na     133_aa Esterase
1644 JAMGTF010000003.1 GCA030180665_01092 CDS open 144799-146895 _na     698_aa Ligand-gated channel
1645 JAMGTF010000003.1 GCA030180665_01093 CDS open 146925-147491 _na     188_aa tetR Transcriptional regulator%2C TetR family
1646 JAMGTF010000003.1 GCA030180665_01094 CDS open 147521-148846 _na     441_aa OmpP1/FadL family transporter
1647 JAMGTF010000003.1 GCA030180665_01095 CDS open 149276-151207 _na     643_aa Fructose-1%2C6-bisphosphatase class 3
1648 JAMGTF010000003.1 GCA030180665_01096 CDS open 151218-153752 _na     844_aa ppdK pyruvate%2C phosphate dikinase
1649 JAMGTF010000003.1 GCA030180665_01097 CDS open 153773-154360 _na     195_aa CBS domain-containing protein
1650 JAMGTF010000003.1 GCA030180665_01098 CDS open 154596-156242 _na     548_aa 9-O-acetyl-N-acetylneuraminate esterase
1651 JAMGTF010000003.1 GCA030180665_01099 CDS open 156458-160291 _na     1277_aa Autotransporter domain-containing protein
1652 JAMGTF010000003.1 GCA030180665_01100 CDS open 160319-162529 _na     736_aa TonB-dependent receptor plug domain protein
1653 JAMGTF010000003.1 GCA030180665_01101 CDS open 162733-166035 _na     1100_aa autotransporter outer membrane beta-barrel domain-containing protein
1654 JAMGTF010000003.1 GCA030180665_01102 CDS open 166057-168330 _na     757_aa TonB-dependent receptor
1655 JAMGTF010000003.1 GCA030180665_01103 CDS open 168687-170045 _na     452_aa trkA Trk system potassium transporter TrkA
1656 JAMGTF010000003.1 GCA030180665_01104 CDS open 170058-171545 _na     495_aa kefA Potassium transporter KefA
1657 JAMGTF010000003.1 GCA030180665_01105 CDS open 171742-173397 _na     551_aa PF08011 family protein
1658 JAMGTF010000003.1 GCA030180665_01106 CDS open 173573-173884 _na     103_aa trxA thioredoxin
1659 JAMGTF010000003.1 GCA030180665_01107 CDS open 173945-174796 _na     283_aa folP dihydropteroate synthase
1660 JAMGTF010000003.1 GCA030180665_01108 CDS open 174780-175607 _na     275_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1661 JAMGTF010000003.1 GCA030180665_01109 CDS open 175617-176171 _na     184_aa folE GTP cyclohydrolase I FolE
1662 JAMGTF010000003.1 GCA030180665_01110 CDS open 176181-178244 _na     687_aa Glycine--tRNA ligase beta subunit
1663 JAMGTF010000003.1 GCA030180665_01111 CDS open 178248-179126 _na     292_aa glycine--tRNA ligase subunit alpha
1664 JAMGTF010000003.1 GCA030180665_01112 CDS open 179141-179593 _na     150_aa lspA signal peptidase II
1665 JAMGTF010000003.1 GCA030180665_01113 CDS open 179603-182398 _na     931_aa ileS isoleucine--tRNA ligase
1666 JAMGTF010000003.1 GCA030180665_01114 CDS open 182391-184808 _na     805_aa histidine kinase
1667 JAMGTF010000003.1 GCA030180665_01115 CDS open 184809-186980 _na     723_aa RNA-binding transcriptional accessory protein
1668 JAMGTF010000003.1 GCA030180665_01116 CDS open 187020-187223 _na     67_aa hypothetical protein
1669 JAMGTF010000003.1 GCA030180665_01117 CDS open 187379-187927 _na     182_aa TetR/AcrR family transcriptional regulator
1670 JAMGTF010000003.1 GCA030180665_01118 CDS open 188049-188507 _na     152_aa DUF2147 domain-containing protein
1671 JAMGTF010000003.1 GCA030180665_01119 CDS open 188538-189275 _na     245_aa tonB Energy transducer TonB
1672 JAMGTF010000003.1 GCA030180665_01120 CDS open 189288-189674 _na     128_aa exbD Biopolymer transporter ExbD
1673 JAMGTF010000003.1 GCA030180665_01121 CDS open 189677-190285 _na     202_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
1674 JAMGTF010000003.1 GCA030180665_01122 CDS open 190314-190694 _na     126_aa DUF454 domain-containing protein
1675 JAMGTF010000003.1 GCA030180665_01123 CDS open 190849-191364 _na     171_aa Flavodoxin
1676 JAMGTF010000003.1 GCA030180665_01124 CDS open 191568-192878 _na     436_aa dsdA D-serine ammonia-lyase
1677 JAMGTF010000003.1 GCA030180665_01125 CDS open 192896-194245 _na     449_aa gntP GntP family permease
1678 JAMGTF010000003.1 GCA030180665_01126 CDS open 194625-195179 _na     184_aa Cupin domain-containing protein
1679 JAMGTF010000003.1 GCA030180665_01127 CDS open 195245-195982 _na     245_aa Glutamine amidotransferase
1680 JAMGTF010000003.1 GCA030180665_01128 CDS open 195979-196536 _na     185_aa GNAT family acetyltransferase
1681 JAMGTF010000003.1 GCA030180665_01129 CDS open 196626-197963 _na     445_aa ATP-binding protein
1682 JAMGTF010000003.1 GCA030180665_01130 CDS open 198243-199538 _na     431_aa ATPase
1683 JAMGTF010000003.1 GCA030180665_01136 CDS open 200360-200851 _na     163_aa YokE-like PH domain-containing protein
1684 JAMGTF010000003.1 GCA030180665_01137 CDS open 200865-201923 _na     352_aa glpX class II fructose-bisphosphatase
1685 JAMGTF010000003.1 GCA030180665_01138 CDS open 201920-202228 _na     102_aa Septum formation initiator
1686 JAMGTF010000003.1 GCA030180665_01139 CDS open 202215-202736 _na     173_aa def peptide deformylase
1687 JAMGTF010000003.1 GCA030180665_01140 CDS open 202752-205028 _na     758_aa priA primosomal protein N'
1688 JAMGTF010000003.1 GCA030180665_01141 CDS open 205025-206989 _na     654_aa ftsI Cell division protein FtsI
1689 JAMGTF010000003.1 GCA030180665_01142 CDS open 206986-208170 _na     394_aa Ribonuclease BN
1690 JAMGTF010000003.1 GCA030180665_01143 CDS open 208173-208517 _na     114_aa hypothetical protein
1691 JAMGTF010000003.1 GCA030180665_01144 CDS open 208617-210596 _na     659_aa aroB 3-dehydroquinate synthase
1692 JAMGTF010000003.1 GCA030180665_01145 CDS open 210593-211024 _na     143_aa DsrE/DsrF-like family protein
1693 JAMGTF010000003.1 GCA030180665_01146 CDS open 211043-211999 _na     318_aa hutG formimidoylglutamase
1694 JAMGTF010000003.1 GCA030180665_01147 CDS open 212101-213222 _na     373_aa Pyridoxal phosphate-dependent aminotransferase family protein
1695 JAMGTF010000003.1 GCA030180665_01148 CDS open 213200-213796 _na     198_aa DUF452 domain-containing protein
1696 JAMGTF010000003.1 GCA030180665_01149 CDS open 213786-214448 _na     220_aa Methyltransferase domain-containing protein
1697 JAMGTF010000003.1 GCA030180665_01150 CDS open 214538-215626 _na     362_aa M42 glutamyl aminopeptidase
1698 JAMGTF010000003.1 GCA030180665_01151 CDS open 215577-217094 _na     505_aa Diguanylate phosphodiesterase
1699 JAMGTF010000003.1 GCA030180665_01152 CDS open 217185-217646 _na     153_aa DUF2147 domain-containing protein
1700 JAMGTF010000003.1 GCA030180665_01153 CDS open 217758-220295 _na     845_aa ATPase
1701 JAMGTF010000003.1 GCA030180665_01154 CDS open 220499-221449 _na     316_aa Transporter
1702 JAMGTF010000003.1 GCA030180665_01155 CDS open 221472-222287 _na     271_aa Ferredoxin
1703 JAMGTF010000003.1 GCA030180665_01156 CDS open 222300-223643 _na     447_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
1704 JAMGTF010000003.1 GCA030180665_01157 CDS open 223627-224322 _na     231_aa bioD dethiobiotin synthase
1705 JAMGTF010000003.1 GCA030180665_01158 CDS open 224312-225295 _na     327_aa bioB biotin synthase BioB
1706 JAMGTF010000003.1 GCA030180665_01159 CDS open 225348-226328 _na     326_aa Biotin--[acetyl-CoA-carboxylase] ligase
1707 JAMGTF010000003.1 GCA030180665_01160 CDS open 226406-226996 _na     196_aa Leucine Rich Repeat protein
1708 JAMGTF010000003.1 GCA030180665_01161 CDS open 227013-228161 _na     382_aa (R)-2-hydroxyglutaryl-CoA dehydratase subunit beta
1709 JAMGTF010000003.1 GCA030180665_01162 CDS open 228173-229498 _na     441_aa hgdB R-phenyllactate dehydratase%2C medium subunit
1710 JAMGTF010000003.1 GCA030180665_01163 CDS open 229576-230370 _na     264_aa (R)-2-hydroxyglutaryl-CoA dehydratase activator
1711 JAMGTF010000003.1 GCA030180665_01164 CDS open 230399-231637 _na     412_aa Sodium/glutamate symporter
1712 JAMGTF010000003.1 GCA030180665_01165 CDS open 231660-233417 _na     585_aa Glutaconyl-CoA decarboxylase subunit alpha
1713 JAMGTF010000003.1 GCA030180665_01166 CDS open 233438-234235 _na     265_aa Glutaconate CoA-transferase subunit B
1714 JAMGTF010000003.1 GCA030180665_01167 CDS open 234237-235202 _na     321_aa Glutaconate CoA-transferase subunit A
1715 JAMGTF010000003.1 GCA030180665_01168 CDS open 235259-236401 _na     380_aa Glutaconyl-CoA decarboxylase subunit beta
1716 JAMGTF010000003.1 GCA030180665_01169 CDS open 236418-236837 _na     139_aa Glutaconyl-CoA decarboxylase subunit gamma
1717 JAMGTF010000003.1 GCA030180665_01170 CDS open 236880-237185 _na     101_aa Sodium pump decarboxylase
1718 JAMGTF010000003.1 GCA030180665_01171 CDS open 237200-239185 _na     661_aa Ascorbate-specific PTS system EIIA component
1719 JAMGTF010000003.1 GCA030180665_01172 CDS open 239357-240865 _na     502_aa Peptidase%2C S8/S53 family
1720 JAMGTF010000003.1 GCA030180665_01173 CDS open 240956-242137 _na     393_aa gltS sodium/glutamate symporter
1721 JAMGTF010000003.1 GCA030180665_01174 CDS open 242165-243160 _na     331_aa S-adenosyl-L-homocysteine hydrolase%2C NAD binding-like domain protein
1722 JAMGTF010000003.1 GCA030180665_01175 CDS open 243648-244910 _na     420_aa Glutamate dehydrogenase
1723 JAMGTF010000003.1 GCA030180665_01176 CDS open 245204-245788 _na     194_aa Lipoprotein
1724 JAMGTF010000003.1 GCA030180665_01177 CDS open 245876-251431 _na     1851_aa YadA-like family protein
1725 JAMGTF010000003.1 GCA030180665_01178 CDS open 251815-252405 _na     196_aa Integrase
1726 JAMGTF010000003.1 GCA030180665_01179 CDS open 252917-254437 _na     506_aa nhaC Na+/H+ antiporter NhaC
1727 JAMGTF010000003.1 GCA030180665_01180 CDS open 254525-255328 _na     267_aa Response regulator
1728 JAMGTF010000003.1 GCA030180665_01181 CDS open 255303-256598 _na     431_aa Sensor histidine kinase
1729 JAMGTF010000003.1 GCA030180665_01182 CDS open 256716-257792 _na     358_aa ATP-binding protein
1730 JAMGTF010000003.1 GCA030180665_01183 CDS open 257908-258528 _na     206_aa fic protein adenylyltransferase Fic
1731 JAMGTF010000003.1 GCA030180665_01184 CDS open 258573-259424 _na     283_aa KilA-N domain protein
1732 JAMGTF010000003.1 GCA030180665_01185 CDS open 259439-260353 _na     304_aa DUF5655 domain-containing protein
1733 JAMGTF010000003.1 GCA030180665_01186 CDS open 260445-261257 _na     270_aa cbiK Cobalt chelatase CbiK
1734 JAMGTF010000003.1 GCA030180665_01187 CDS open 261271-262023 _na     250_aa exodeoxyribonuclease III
1735 JAMGTF010000003.1 GCA030180665_01188 CDS open 262037-263239 _na     400_aa hydF [FeFe] hydrogenase H-cluster maturation GTPase HydF
1736 JAMGTF010000003.1 GCA030180665_01189 CDS open 263236-264633 _na     465_aa hydG [FeFe] hydrogenase H-cluster radical SAM maturase HydG
1737 JAMGTF010000003.1 GCA030180665_01190 CDS open 264678-265724 _na     348_aa hydE [FeFe] hydrogenase H-cluster radical SAM maturase HydE
1738 JAMGTF010000003.1 GCA030180665_01191 CDS open 265718-265984 _na     88_aa TM1266 family iron-only hydrogenase system putative regulator
1739 JAMGTF010000003.1 GCA030180665_01192 CDS open 265981-266448 _na     155_aa Methylated-DNA--protein-cysteine methyltransferase
1740 JAMGTF010000003.1 GCA030180665_01193 CDS open 266458-267837 _na     459_aa aminopeptidase
1741 JAMGTF010000003.1 GCA030180665_00968 gene open 605-1006 tnpA
1742 JAMGTF010000003.1 GCA030180665_00969 gene open 1215-1757 hpf
1743 JAMGTF010000003.1 GCA030180665_00970 gene open 1834-2517
1744 JAMGTF010000003.1 GCA030180665_00971 gene open 2510-3679
1745 JAMGTF010000003.1 GCA030180665_00972 gene open 3682-5457 recQ
1746 JAMGTF010000003.1 GCA030180665_00973 gene open 5476-6381 dprA
1747 JAMGTF010000003.1 GCA030180665_00974 gene open 6504-7625 dnaN
1748 JAMGTF010000003.1 GCA030180665_00975 gene open 7641-8459
1749 JAMGTF010000003.1 GCA030180665_00976 gene open 8486-9487
1750 JAMGTF010000003.1 GCA030180665_00977 gene open 9500-10099 plsY
1751 JAMGTF010000003.1 GCA030180665_00978 gene open 10167-11165
1752 JAMGTF010000003.1 GCA030180665_00979 gene open 11169-11735 sepF
1753 JAMGTF010000003.1 GCA030180665_00980 gene open 11748-12428
1754 JAMGTF010000003.1 GCA030180665_00981 gene open 12441-13538 hemW
1755 JAMGTF010000003.1 GCA030180665_00982 gene open 13522-15216
1756 JAMGTF010000003.1 GCA030180665_00983 gene open 15473-16591
1757 JAMGTF010000003.1 GCA030180665_00984 gene open 17128-17847 traT
1758 JAMGTF010000003.1 GCA030180665_00985 gene open 17958-19577 groL
1759 JAMGTF010000003.1 GCA030180665_00986 gene open 19600-19863
1760 JAMGTF010000003.1 GCA030180665_00987 gene open 20024-20299 csoR
1761 JAMGTF010000003.1 GCA030180665_00988 gene open 20389-20937
1762 JAMGTF010000003.1 GCA030180665_00989 gene open 20975-21766
1763 JAMGTF010000003.1 GCA030180665_00990 gene open 21770-22120 padR
1764 JAMGTF010000003.1 GCA030180665_00991 gene open 22107-23777 nikD
1765 JAMGTF010000003.1 GCA030180665_00992 gene open 23762-24583
1766 JAMGTF010000003.1 GCA030180665_00993 gene open 24580-25536
1767 JAMGTF010000003.1 GCA030180665_00994 gene open 25538-27088
1768 JAMGTF010000003.1 GCA030180665_00995 gene open 27270-28217
1769 JAMGTF010000003.1 GCA030180665_00996 gene open 28443-29657
1770 JAMGTF010000003.1 GCA030180665_00997 gene open 29654-30118
1771 JAMGTF010000003.1 GCA030180665_00998 gene open 30146-32104
1772 JAMGTF010000003.1 GCA030180665_00999 gene open 32268-32702
1773 JAMGTF010000003.1 GCA030180665_01000 gene open 32702-34006
1774 JAMGTF010000003.1 GCA030180665_01001 gene open 34031-35410
1775 JAMGTF010000003.1 GCA030180665_01002 gene open 35438-37507 fusA
1776 JAMGTF010000003.1 GCA030180665_01003 gene open 37847-38446
1777 JAMGTF010000003.1 GCA030180665_01004 gene open 38531-42868
1778 JAMGTF010000003.1 GCA030180665_01005 gene open 43551-44144
1779 JAMGTF010000003.1 GCA030180665_01006 gene open 44176-44721
1780 JAMGTF010000003.1 GCA030180665_01007 gene open 44703-44837
1781 JAMGTF010000003.1 GCA030180665_01008 gene open 44834-45334
1782 JAMGTF010000003.1 GCA030180665_01009 gene open 45771-47279
1783 JAMGTF010000003.1 GCA030180665_01010 gene open 47297-48778
1784 JAMGTF010000003.1 GCA030180665_01011 gene open 48782-49519
1785 JAMGTF010000003.1 GCA030180665_01012 gene open 49522-50016 ybeY
1786 JAMGTF010000003.1 GCA030180665_01013 gene open 50029-52128
1787 JAMGTF010000003.1 GCA030180665_01014 gene open 52139-54217
1788 JAMGTF010000003.1 GCA030180665_01015 gene open 54455-55924
1789 JAMGTF010000003.1 GCA030180665_01016 gene open 56044-56484
1790 JAMGTF010000003.1 GCA030180665_01017 gene open 56490-56846
1791 JAMGTF010000003.1 GCA030180665_01018 gene open 56920-58086
1792 JAMGTF010000003.1 GCA030180665_01019 gene open 58106-59329
1793 JAMGTF010000003.1 GCA030180665_01020 gene open 59326-60000
1794 JAMGTF010000003.1 GCA030180665_01021 gene open 59975-61051
1795 JAMGTF010000003.1 GCA030180665_01022 gene open 61048-62322 tolC
1796 JAMGTF010000003.1 GCA030180665_01023 gene open 62341-62925
1797 JAMGTF010000003.1 GCA030180665_01024 gene open 62941-63528 ruvA
1798 JAMGTF010000003.1 GCA030180665_01025 gene open 63533-66385 uvrA
1799 JAMGTF010000003.1 GCA030180665_01026 gene open 66403-67929
1800 JAMGTF010000003.1 GCA030180665_01027 gene open 67916-68659 kdsB
1801 JAMGTF010000003.1 GCA030180665_01028 gene open 68966-69532
1802 JAMGTF010000003.1 GCA030180665_01029 gene open 69549-70856
1803 JAMGTF010000003.1 GCA030180665_01030 gene open 71228-72844
1804 JAMGTF010000003.1 GCA030180665_01031 gene open 72867-74207
1805 JAMGTF010000003.1 GCA030180665_01032 gene open 74209-74604
1806 JAMGTF010000003.1 GCA030180665_01033 gene open 74719-75300 nadD
1807 JAMGTF010000003.1 GCA030180665_01034 gene open 75432-77216 aspS
1808 JAMGTF010000003.1 GCA030180665_01035 gene open 77220-78461 hisS
1809 JAMGTF010000003.1 GCA030180665_01036 gene open 78463-79695
1810 JAMGTF010000003.1 GCA030180665_01037 gene open 79798-80022 secG
1811 JAMGTF010000003.1 GCA030180665_01038 gene open 80084-81199 mutY
1812 JAMGTF010000003.1 GCA030180665_01039 gene open 81285-81884
1813 JAMGTF010000003.1 GCA030180665_01040 gene open 82008-83177 comE
1814 JAMGTF010000003.1 GCA030180665_01041 gene open 83180-84469
1815 JAMGTF010000003.1 GCA030180665_01042 gene open 84466-85575
1816 JAMGTF010000003.1 GCA030180665_01043 gene open 85586-86614
1817 JAMGTF010000003.1 GCA030180665_01044 gene open 86626-87195 ruvC
1818 JAMGTF010000003.1 GCA030180665_01045 gene open 87198-87656
1819 JAMGTF010000003.1 GCA030180665_01046 gene open 87845-88465
1820 JAMGTF010000003.1 GCA030180665_01047 gene open 88489-89415
1821 JAMGTF010000003.1 GCA030180665_01048 gene open 89449-90756 phoH
1822 JAMGTF010000003.1 GCA030180665_01049 gene open 91316-94600
1823 JAMGTF010000003.1 GCA030180665_01050 gene open 94727-95131
1824 JAMGTF010000003.1 GCA030180665_01051 gene open 95161-96540
1825 JAMGTF010000003.1 GCA030180665_01052 gene open 96577-98121
1826 JAMGTF010000003.1 GCA030180665_01053 gene open 98340-99464 tetR
1827 JAMGTF010000003.1 GCA030180665_01054 gene open 99738-101150
1828 JAMGTF010000003.1 GCA030180665_01055 gene open 101143-102051 murQ
1829 JAMGTF010000003.1 GCA030180665_01056 gene open 102084-103220
1830 JAMGTF010000003.1 GCA030180665_01057 gene open 103708-103893
1831 JAMGTF010000003.1 GCA030180665_01058 gene open 105835-108234
1832 JAMGTF010000003.1 GCA030180665_01059 gene open 108432-109184
1833 JAMGTF010000003.1 GCA030180665_01060 gene open 109171-110043 cas7i
1834 JAMGTF010000003.1 GCA030180665_01061 gene open 110047-111747
1835 JAMGTF010000003.1 GCA030180665_01062 gene open 111759-112481 cas6
1836 JAMGTF010000003.1 GCA030180665_01063 gene open 113201-114283
1837 JAMGTF010000003.1 GCA030180665_01064 gene open 114295-115260
1838 JAMGTF010000003.1 GCA030180665_01065 gene open 115639-115749
1839 JAMGTF010000003.1 GCA030180665_01066 gene open 116556-117152
1840 JAMGTF010000003.1 GCA030180665_01067 gene open 117546-117869
1841 JAMGTF010000003.1 GCA030180665_01068 gene open 118195-119733 guaA
1842 JAMGTF010000003.1 GCA030180665_01069 gene open 120165-120635
1843 JAMGTF010000003.1 GCA030180665_01070 gene open 120759-121202
1844 JAMGTF010000003.1 GCA030180665_01071 gene open 121800-123152 creD
1845 JAMGTF010000003.1 GCA030180665_01072 gene open 123168-123881
1846 JAMGTF010000003.1 GCA030180665_01073 gene open 124164-125471 eno
1847 JAMGTF010000003.1 GCA030180665_01074 gene open 125505-126923 pykF
1848 JAMGTF010000003.1 GCA030180665_01075 gene open 127057-127518
1849 JAMGTF010000003.1 GCA030180665_01076 gene open 127665-128342
1850 JAMGTF010000003.1 GCA030180665_01077 gene open 128353-129225
1851 JAMGTF010000003.1 GCA030180665_01078 gene open 129222-130124
1852 JAMGTF010000003.1 GCA030180665_01079 gene open 130128-131981 dctM
1853 JAMGTF010000003.1 GCA030180665_01080 gene open 131999-132988 siaP
1854 JAMGTF010000003.1 GCA030180665_01081 gene open 133002-134009 lacI
1855 JAMGTF010000003.1 GCA030180665_01082 gene open 134013-135122
1856 JAMGTF010000003.1 GCA030180665_01083 gene open 135283-135822
1857 JAMGTF010000003.1 GCA030180665_01084 gene open 135842-136981
1858 JAMGTF010000003.1 GCA030180665_01085 gene open 137103-137480 nifU
1859 JAMGTF010000003.1 GCA030180665_01086 gene open 137528-138700 nifS
1860 JAMGTF010000003.1 GCA030180665_01087 gene open 138761-139402 nth
1861 JAMGTF010000003.1 GCA030180665_01088 gene open 139395-139856
1862 JAMGTF010000003.1 GCA030180665_01089 gene open 139867-141075 tyrS
1863 JAMGTF010000003.1 GCA030180665_01090 gene open 141247-144201
1864 JAMGTF010000003.1 GCA030180665_01091 gene open 144226-144627
1865 JAMGTF010000003.1 GCA030180665_01092 gene open 144799-146895
1866 JAMGTF010000003.1 GCA030180665_01093 gene open 146925-147491 tetR
1867 JAMGTF010000003.1 GCA030180665_01094 gene open 147521-148846
1868 JAMGTF010000003.1 GCA030180665_01095 gene open 149276-151207
1869 JAMGTF010000003.1 GCA030180665_01096 gene open 151218-153752 ppdK
1870 JAMGTF010000003.1 GCA030180665_01097 gene open 153773-154360
1871 JAMGTF010000003.1 GCA030180665_01098 gene open 154596-156242
1872 JAMGTF010000003.1 GCA030180665_01099 gene open 156458-160291
1873 JAMGTF010000003.1 GCA030180665_01100 gene open 160319-162529
1874 JAMGTF010000003.1 GCA030180665_01101 gene open 162733-166035
1875 JAMGTF010000003.1 GCA030180665_01102 gene open 166057-168330
1876 JAMGTF010000003.1 GCA030180665_01103 gene open 168687-170045 trkA
1877 JAMGTF010000003.1 GCA030180665_01104 gene open 170058-171545 kefA
1878 JAMGTF010000003.1 GCA030180665_01105 gene open 171742-173397
1879 JAMGTF010000003.1 GCA030180665_01106 gene open 173573-173884 trxA
1880 JAMGTF010000003.1 GCA030180665_01107 gene open 173945-174796 folP
1881 JAMGTF010000003.1 GCA030180665_01108 gene open 174780-175607 folK
1882 JAMGTF010000003.1 GCA030180665_01109 gene open 175617-176171 folE
1883 JAMGTF010000003.1 GCA030180665_01110 gene open 176181-178244
1884 JAMGTF010000003.1 GCA030180665_01111 gene open 178248-179126
1885 JAMGTF010000003.1 GCA030180665_01112 gene open 179141-179593 lspA
1886 JAMGTF010000003.1 GCA030180665_01113 gene open 179603-182398 ileS
1887 JAMGTF010000003.1 GCA030180665_01114 gene open 182391-184808
1888 JAMGTF010000003.1 GCA030180665_01115 gene open 184809-186980
1889 JAMGTF010000003.1 GCA030180665_01116 gene open 187020-187223
1890 JAMGTF010000003.1 GCA030180665_01117 gene open 187379-187927
1891 JAMGTF010000003.1 GCA030180665_01118 gene open 188049-188507
1892 JAMGTF010000003.1 GCA030180665_01119 gene open 188538-189275 tonB
1893 JAMGTF010000003.1 GCA030180665_01120 gene open 189288-189674 exbD
1894 JAMGTF010000003.1 GCA030180665_01121 gene open 189677-190285
1895 JAMGTF010000003.1 GCA030180665_01122 gene open 190314-190694
1896 JAMGTF010000003.1 GCA030180665_01123 gene open 190849-191364
1897 JAMGTF010000003.1 GCA030180665_01124 gene open 191568-192878 dsdA
1898 JAMGTF010000003.1 GCA030180665_01125 gene open 192896-194245 gntP
1899 JAMGTF010000003.1 GCA030180665_01126 gene open 194625-195179
1900 JAMGTF010000003.1 GCA030180665_01127 gene open 195245-195982
1901 JAMGTF010000003.1 GCA030180665_01128 gene open 195979-196536
1902 JAMGTF010000003.1 GCA030180665_01129 gene open 196626-197963
1903 JAMGTF010000003.1 GCA030180665_01130 gene open 198243-199538
1904 JAMGTF010000003.1 GCA030180665_01136 gene open 200360-200851
1905 JAMGTF010000003.1 GCA030180665_01137 gene open 200865-201923 glpX
1906 JAMGTF010000003.1 GCA030180665_01138 gene open 201920-202228
1907 JAMGTF010000003.1 GCA030180665_01139 gene open 202215-202736 def
1908 JAMGTF010000003.1 GCA030180665_01140 gene open 202752-205028 priA
1909 JAMGTF010000003.1 GCA030180665_01141 gene open 205025-206989 ftsI
1910 JAMGTF010000003.1 GCA030180665_01142 gene open 206986-208170
1911 JAMGTF010000003.1 GCA030180665_01143 gene open 208173-208517
1912 JAMGTF010000003.1 GCA030180665_01144 gene open 208617-210596 aroB
1913 JAMGTF010000003.1 GCA030180665_01145 gene open 210593-211024
1914 JAMGTF010000003.1 GCA030180665_01146 gene open 211043-211999 hutG
1915 JAMGTF010000003.1 GCA030180665_01147 gene open 212101-213222
1916 JAMGTF010000003.1 GCA030180665_01148 gene open 213200-213796
1917 JAMGTF010000003.1 GCA030180665_01149 gene open 213786-214448
1918 JAMGTF010000003.1 GCA030180665_01150 gene open 214538-215626
1919 JAMGTF010000003.1 GCA030180665_01151 gene open 215577-217094
1920 JAMGTF010000003.1 GCA030180665_01152 gene open 217185-217646
1921 JAMGTF010000003.1 GCA030180665_01153 gene open 217758-220295
1922 JAMGTF010000003.1 GCA030180665_01154 gene open 220499-221449
1923 JAMGTF010000003.1 GCA030180665_01155 gene open 221472-222287
1924 JAMGTF010000003.1 GCA030180665_01156 gene open 222300-223643 bioA
1925 JAMGTF010000003.1 GCA030180665_01157 gene open 223627-224322 bioD
1926 JAMGTF010000003.1 GCA030180665_01158 gene open 224312-225295 bioB
1927 JAMGTF010000003.1 GCA030180665_01159 gene open 225348-226328
1928 JAMGTF010000003.1 GCA030180665_01160 gene open 226406-226996
1929 JAMGTF010000003.1 GCA030180665_01161 gene open 227013-228161
1930 JAMGTF010000003.1 GCA030180665_01162 gene open 228173-229498 hgdB
1931 JAMGTF010000003.1 GCA030180665_01163 gene open 229576-230370
1932 JAMGTF010000003.1 GCA030180665_01164 gene open 230399-231637
1933 JAMGTF010000003.1 GCA030180665_01165 gene open 231660-233417
1934 JAMGTF010000003.1 GCA030180665_01166 gene open 233438-234235
1935 JAMGTF010000003.1 GCA030180665_01167 gene open 234237-235202
1936 JAMGTF010000003.1 GCA030180665_01168 gene open 235259-236401
1937 JAMGTF010000003.1 GCA030180665_01169 gene open 236418-236837
1938 JAMGTF010000003.1 GCA030180665_01170 gene open 236880-237185
1939 JAMGTF010000003.1 GCA030180665_01171 gene open 237200-239185
1940 JAMGTF010000003.1 GCA030180665_01172 gene open 239357-240865
1941 JAMGTF010000003.1 GCA030180665_01173 gene open 240956-242137 gltS
1942 JAMGTF010000003.1 GCA030180665_01174 gene open 242165-243160
1943 JAMGTF010000003.1 GCA030180665_01175 gene open 243648-244910
1944 JAMGTF010000003.1 GCA030180665_01176 gene open 245204-245788
1945 JAMGTF010000003.1 GCA030180665_01177 gene open 245876-251431
1946 JAMGTF010000003.1 GCA030180665_01178 gene open 251815-252405
1947 JAMGTF010000003.1 GCA030180665_01179 gene open 252917-254437 nhaC
1948 JAMGTF010000003.1 GCA030180665_01180 gene open 254525-255328
1949 JAMGTF010000003.1 GCA030180665_01181 gene open 255303-256598
1950 JAMGTF010000003.1 GCA030180665_01182 gene open 256716-257792
1951 JAMGTF010000003.1 GCA030180665_01183 gene open 257908-258528 fic
1952 JAMGTF010000003.1 GCA030180665_01184 gene open 258573-259424
1953 JAMGTF010000003.1 GCA030180665_01185 gene open 259439-260353
1954 JAMGTF010000003.1 GCA030180665_01186 gene open 260445-261257 cbiK
1955 JAMGTF010000003.1 GCA030180665_01187 gene open 261271-262023
1956 JAMGTF010000003.1 GCA030180665_01188 gene open 262037-263239 hydF
1957 JAMGTF010000003.1 GCA030180665_01189 gene open 263236-264633 hydG
1958 JAMGTF010000003.1 GCA030180665_01190 gene open 264678-265724 hydE
1959 JAMGTF010000003.1 GCA030180665_01191 gene open 265718-265984
1960 JAMGTF010000003.1 GCA030180665_01192 gene open 265981-266448
1961 JAMGTF010000003.1 GCA030180665_01193 gene open 266458-267837
1962 JAMGTF010000003.1 GCA030180665_01131 gene open 199867-199944 trnD
1963 JAMGTF010000003.1 GCA030180665_01132 gene open 199961-200036 trnV
1964 JAMGTF010000003.1 GCA030180665_01133 gene open 200040-200114 trnE
1965 JAMGTF010000003.1 GCA030180665_01134 gene open 200124-200199 trnK
1966 JAMGTF010000003.1 GCA030180665_01135 gene open 200210-200285 trnG
1967 JAMGTF010000003.1 GCA030180665_01131 tRNA open 199867-199944 trnD tRNA-Asp(gtc)
1968 JAMGTF010000003.1 GCA030180665_01132 tRNA open 199961-200036 trnV tRNA-Val(tac)
1969 JAMGTF010000003.1 GCA030180665_01133 tRNA open 200040-200114 trnE tRNA-Glu(ttc)
1970 JAMGTF010000003.1 GCA030180665_01134 tRNA open 200124-200199 trnK tRNA-Lys(ctt)
1971 JAMGTF010000003.1 GCA030180665_01135 tRNA open 200210-200285 trnG tRNA-Gly(tcc)
1972 JAMGTF010000004.1 GCA030180665_01387 gene open 218304-218403 Bacteria_small_SRP
1973 JAMGTF010000004.1 GCA030180665_01387 ncRNA open 218304-218403 Bacterial small signal recognition particle RNA
1974 JAMGTF010000004.1 regulatory_region open 132282-132350 Glycine riboswitch aptamer
1975 JAMGTF010000004.1 regulatory_region open 132351-132422 Glycine riboswitch aptamer
1976 JAMGTF010000004.1 GCA030180665_01194 CDS open 183-1010 _na     275_aa nagB glucosamine-6-phosphate deaminase
1977 JAMGTF010000004.1 GCA030180665_01195 CDS open 1020-1871 _na     283_aa rpiR Transcriptional regulator%2C RpiR family
1978 JAMGTF010000004.1 GCA030180665_01196 CDS open 1837-2784 _na     315_aa TIGR01212 family radical SAM protein
1979 JAMGTF010000004.1 GCA030180665_01197 CDS open 2879-3865 _na     328_aa asparaginase
1980 JAMGTF010000004.1 GCA030180665_01198 CDS open 3947-6910 _na     987_aa Autotransporter domain-containing protein
1981 JAMGTF010000004.1 GCA030180665_01199 CDS open 7084-7824 _na     246_aa MipA/OmpV family protein
1982 JAMGTF010000004.1 GCA030180665_01200 CDS open 7843-8889 _na     348_aa Peptidase
1983 JAMGTF010000004.1 GCA030180665_01201 CDS open 9006-9737 _na     243_aa CAAX protease
1984 JAMGTF010000004.1 GCA030180665_01202 CDS open 9770-10684 _na     304_aa CAAX protease
1985 JAMGTF010000004.1 GCA030180665_01203 CDS open 10762-11430 _na     222_aa DNA-binding response regulator
1986 JAMGTF010000004.1 GCA030180665_01204 CDS open 11427-12560 _na     377_aa histidine kinase
1987 JAMGTF010000004.1 GCA030180665_01205 CDS open 12800-14611 _na     603_aa typA translational GTPase TypA
1988 JAMGTF010000004.1 GCA030180665_01206 CDS open 14630-15487 _na     285_aa truB tRNA pseudouridine(55) synthase TruB
1989 JAMGTF010000004.1 GCA030180665_01207 CDS open 15494-16681 _na     395_aa cysteine-S-conjugate beta-lyase
1990 JAMGTF010000004.1 GCA030180665_01208 CDS open 16699-19758 _na     1019_aa Acriflavin resistance protein
1991 JAMGTF010000004.1 GCA030180665_01209 CDS open 19771-20874 _na     367_aa RND transporter
1992 JAMGTF010000004.1 GCA030180665_01210 CDS open 20867-22297 _na     476_aa tolC TolC family protein
1993 JAMGTF010000004.1 GCA030180665_01211 CDS open 22392-22925 _na     177_aa ywqK Toxin-antitoxin system YwqK family antitoxin
1994 JAMGTF010000004.1 GCA030180665_01212 CDS open 23375-24772 _na     465_aa Porin
1995 JAMGTF010000004.1 GCA030180665_01213 CDS open 25170-27128 _na     652_aa Ligand-gated channel
1996 JAMGTF010000004.1 GCA030180665_01214 CDS open 27243-29045 _na     600_aa lepA translation elongation factor 4
1997 JAMGTF010000004.1 GCA030180665_01215 CDS open 29672-31417 _na     581_aa ABC transporter ATP-binding protein
1998 JAMGTF010000004.1 GCA030180665_01216 CDS open 31422-33215 _na     597_aa ABC transporter ATP-binding protein
1999 JAMGTF010000004.1 GCA030180665_01217 CDS open 33234-34007 _na     257_aa ABC transporter ATP-binding protein
2000 JAMGTF010000004.1 GCA030180665_01218 CDS open 34004-35035 _na     343_aa Iron ABC transporter permease