HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_030180665.1)

Select a Genome:
BAKTA Annotations for GCA_030180665.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
34 2036402 1854 7 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3842 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 3842 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAMGTF010000010.1 GCA030180665_00520 gene open 21988-24156
3502 JAMGTF010000010.1 GCA030180665_00521 gene open 24158-24661
3503 JAMGTF010000010.1 GCA030180665_00522 gene open 24674-25882
3504 JAMGTF010000010.1 GCA030180665_00523 gene open 25886-26434
3505 JAMGTF010000010.1 GCA030180665_00524 gene open 26459-28984 dhaL
3506 JAMGTF010000010.1 GCA030180665_00525 gene open 29048-29977
3507 JAMGTF010000010.1 GCA030180665_00526 gene open 29992-31266
3508 JAMGTF010000010.1 GCA030180665_00527 gene open 31276-32313 mnmA
3509 JAMGTF010000010.1 GCA030180665_00528 gene open 32310-34331 ligA
3510 JAMGTF010000010.1 GCA030180665_00529 gene open 34389-37058 secA
3511 JAMGTF010000010.1 GCA030180665_00530 gene open 37079-37819
3512 JAMGTF010000010.1 GCA030180665_00531 gene open 37891-38709
3513 JAMGTF010000010.1 GCA030180665_00532 gene open 38712-39710 rfaD
3514 JAMGTF010000010.1 GCA030180665_00533 gene open 39720-40541
3515 JAMGTF010000010.1 GCA030180665_00534 gene open 40551-41894
3516 JAMGTF010000010.1 GCA030180665_00535 gene open 41957-43174
3517 JAMGTF010000010.1 GCA030180665_00536 gene open 43420-45495
3518 JAMGTF010000010.1 GCA030180665_00537 gene open 45623-46246
3519 JAMGTF010000010.1 GCA030180665_00538 gene open 46363-46950
3520 JAMGTF010000010.1 GCA030180665_00539 gene open 46975-47454
3521 JAMGTF010000010.1 GCA030180665_00540 gene open 47467-49227
3522 JAMGTF010000010.1 GCA030180665_00541 gene open 49245-51053 glmS
3523 JAMGTF010000010.1 GCA030180665_00542 gene open 51158-52048 thrB
3524 JAMGTF010000010.1 GCA030180665_00543 gene open 52036-53493 thrC
3525 JAMGTF010000010.1 GCA030180665_00544 gene open 53595-54713
3526 JAMGTF010000010.1 GCA030180665_00545 gene open 54710-56047
3527 JAMGTF010000010.1 GCA030180665_00546 gene open 56044-57012
3528 JAMGTF010000010.1 GCA030180665_00547 gene open 57139-58056
3529 JAMGTF010000010.1 GCA030180665_00548 gene open 58172-59182
3530 JAMGTF010000010.1 GCA030180665_00549 gene open 59214-60011
3531 JAMGTF010000010.1 GCA030180665_00550 gene open 60049-61194
3532 JAMGTF010000010.1 GCA030180665_00551 gene open 61414-62337
3533 JAMGTF010000010.1 GCA030180665_00552 gene open 62509-63261
3534 JAMGTF010000010.1 GCA030180665_00553 gene open 63248-64003
3535 JAMGTF010000010.1 GCA030180665_00554 gene open 64004-64498
3536 JAMGTF010000010.1 GCA030180665_00555 gene open 64538-65194
3537 JAMGTF010000010.1 GCA030180665_00556 gene open 65202-66431
3538 JAMGTF010000010.1 GCA030180665_00557 gene open 66446-67786 dnaB
3539 JAMGTF010000010.1 GCA030180665_00558 gene open 67802-68251 rplI
3540 JAMGTF010000010.1 GCA030180665_00559 gene open 68273-69097
3541 JAMGTF010000010.1 GCA030180665_00560 gene open 69094-70500 dnaX
3542 JAMGTF010000010.1 GCA030180665_00561 gene open 70504-71892 ntrC
3543 JAMGTF010000010.1 GCA030180665_00562 gene open 71909-72670 tonB
3544 JAMGTF010000010.1 GCA030180665_00563 gene open 72685-73119
3545 JAMGTF010000010.1 GCA030180665_00564 gene open 73135-73746
3546 JAMGTF010000010.1 GCA030180665_00565 gene open 73760-74128
3547 JAMGTF010000010.1 GCA030180665_00566 gene open 74146-76893 ybgF
3548 JAMGTF010000011.1 GCA030180665_00568 CDS open 182-751 _na     189_aa dTTP/UTP pyrophosphatase
3549 JAMGTF010000011.1 GCA030180665_00569 CDS open 748-1269 _na     173_aa Metal-dependent hydrolase
3550 JAMGTF010000011.1 GCA030180665_00570 CDS open 1313-2125 _na     270_aa Transketolase%2C thiamine diphosphate binding domain protein
3551 JAMGTF010000011.1 GCA030180665_00571 CDS open 2146-3075 _na     309_aa Transketolase%2C pyridine binding domain protein
3552 JAMGTF010000011.1 GCA030180665_00572 CDS open 3195-4040 _na     281_aa ftsX FtsX extracellular domain-containing protein
3553 JAMGTF010000011.1 GCA030180665_00573 CDS open 4037-5140 _na     367_aa Peptidase M23
3554 JAMGTF010000011.1 GCA030180665_00574 CDS open 5162-5962 _na     266_aa NAD kinase
3555 JAMGTF010000011.1 GCA030180665_00575 CDS open 5956-7623 _na     555_aa recN DNA repair protein RecN
3556 JAMGTF010000011.1 GCA030180665_00576 CDS open 7620-8333 _na     237_aa Core-binding (CB) domain-containing protein
3557 JAMGTF010000011.1 GCA030180665_00577 CDS open 8334-9224 _na     296_aa era GTPase Era
3558 JAMGTF010000011.1 GCA030180665_00578 CDS open 9301-10125 _na     274_aa Iron-sulfur cluster carrier protein
3559 JAMGTF010000011.1 GCA030180665_00579 CDS open 10163-10939 _na     258_aa 3-hydroxybutyryl-CoA dehydratase
3560 JAMGTF010000011.1 GCA030180665_00580 CDS open 10974-11807 _na     277_aa 3-hydroxybutyryl-CoA dehydrogenase
3561 JAMGTF010000011.1 GCA030180665_00581 CDS open 11830-12747 _na     305_aa Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase
3562 JAMGTF010000011.1 GCA030180665_00582 CDS open 12885-13601 _na     238_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
3563 JAMGTF010000011.1 GCA030180665_00583 CDS open 13598-14827 _na     409_aa tetrahydrofolate synthase
3564 JAMGTF010000011.1 GCA030180665_00584 CDS open 14814-15449 _na     211_aa hypothetical protein
3565 JAMGTF010000011.1 GCA030180665_00585 CDS open 15466-17379 _na     637_aa hprK HPr(Ser) kinase/phosphatase
3566 JAMGTF010000011.1 GCA030180665_00586 CDS open 17696-18568 _na     290_aa EamA-like transporter family protein
3567 JAMGTF010000011.1 GCA030180665_00587 CDS open 18699-20183 _na     494_aa PTS system%2C glucose-specific IIBC component
3568 JAMGTF010000011.1 GCA030180665_00588 CDS open 20306-21388 _na     360_aa Alanine racemase
3569 JAMGTF010000011.1 GCA030180665_00589 CDS open 21385-22128 _na     247_aa Membrane protein
3570 JAMGTF010000011.1 GCA030180665_00590 CDS open 22094-22810 _na     238_aa ABC transporter substrate-binding protein
3571 JAMGTF010000011.1 GCA030180665_00591 CDS open 22981-23430 _na     149_aa DNA starvation/stationary phase protection protein
3572 JAMGTF010000011.1 GCA030180665_00595 CDS open 23926-24777 _na     283_aa rapZ RNase adapter RapZ
3573 JAMGTF010000011.1 GCA030180665_00596 CDS open 24764-26536 _na     590_aa uvrC excinuclease ABC subunit UvrC
3574 JAMGTF010000011.1 GCA030180665_00597 CDS open 26541-28058 _na     505_aa Stage II sporulation protein E
3575 JAMGTF010000011.1 GCA030180665_00598 CDS open 28077-28985 _na     302_aa PF07136 family protein
3576 JAMGTF010000011.1 GCA030180665_00599 CDS open 29016-29426 _na     136_aa Transcriptional regulator%2C Rrf2 family
3577 JAMGTF010000011.1 GCA030180665_00600 CDS open 29494-30021 _na     175_aa Lipoprotein
3578 JAMGTF010000011.1 GCA030180665_00601 CDS open 30195-31112 _na     305_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
3579 JAMGTF010000011.1 GCA030180665_00602 CDS open 31102-32058 _na     318_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
3580 JAMGTF010000011.1 GCA030180665_00603 CDS open 32063-33034 _na     323_aa pfkA 6-phosphofructokinase
3581 JAMGTF010000011.1 GCA030180665_00604 CDS open 33053-33355 _na     100_aa DUF496 domain-containing protein
3582 JAMGTF010000011.1 GCA030180665_00605 CDS open 33357-33950 _na     197_aa recR recombination mediator RecR
3583 JAMGTF010000011.1 GCA030180665_00606 CDS open 34110-35036 _na     308_aa Oligopeptide ABC transporter%2C oligopeptide-binding protein
3584 JAMGTF010000011.1 GCA030180665_00607 CDS open 35058-35888 _na     276_aa ABC transporter
3585 JAMGTF010000011.1 GCA030180665_00608 CDS open 35896-36672 _na     258_aa ABC transporter ATP-binding protein
3586 JAMGTF010000011.1 GCA030180665_00609 CDS open 36790-37632 _na     280_aa WYL domain protein
3587 JAMGTF010000011.1 GCA030180665_00568 gene open 182-751
3588 JAMGTF010000011.1 GCA030180665_00569 gene open 748-1269
3589 JAMGTF010000011.1 GCA030180665_00570 gene open 1313-2125
3590 JAMGTF010000011.1 GCA030180665_00571 gene open 2146-3075
3591 JAMGTF010000011.1 GCA030180665_00572 gene open 3195-4040 ftsX
3592 JAMGTF010000011.1 GCA030180665_00573 gene open 4037-5140
3593 JAMGTF010000011.1 GCA030180665_00574 gene open 5162-5962
3594 JAMGTF010000011.1 GCA030180665_00575 gene open 5956-7623 recN
3595 JAMGTF010000011.1 GCA030180665_00576 gene open 7620-8333
3596 JAMGTF010000011.1 GCA030180665_00577 gene open 8334-9224 era
3597 JAMGTF010000011.1 GCA030180665_00578 gene open 9301-10125
3598 JAMGTF010000011.1 GCA030180665_00579 gene open 10163-10939
3599 JAMGTF010000011.1 GCA030180665_00580 gene open 10974-11807
3600 JAMGTF010000011.1 GCA030180665_00581 gene open 11830-12747
3601 JAMGTF010000011.1 GCA030180665_00582 gene open 12885-13601
3602 JAMGTF010000011.1 GCA030180665_00583 gene open 13598-14827
3603 JAMGTF010000011.1 GCA030180665_00584 gene open 14814-15449
3604 JAMGTF010000011.1 GCA030180665_00585 gene open 15466-17379 hprK
3605 JAMGTF010000011.1 GCA030180665_00586 gene open 17696-18568
3606 JAMGTF010000011.1 GCA030180665_00587 gene open 18699-20183
3607 JAMGTF010000011.1 GCA030180665_00588 gene open 20306-21388
3608 JAMGTF010000011.1 GCA030180665_00589 gene open 21385-22128
3609 JAMGTF010000011.1 GCA030180665_00590 gene open 22094-22810
3610 JAMGTF010000011.1 GCA030180665_00591 gene open 22981-23430
3611 JAMGTF010000011.1 GCA030180665_00595 gene open 23926-24777 rapZ
3612 JAMGTF010000011.1 GCA030180665_00596 gene open 24764-26536 uvrC
3613 JAMGTF010000011.1 GCA030180665_00597 gene open 26541-28058
3614 JAMGTF010000011.1 GCA030180665_00598 gene open 28077-28985
3615 JAMGTF010000011.1 GCA030180665_00599 gene open 29016-29426
3616 JAMGTF010000011.1 GCA030180665_00600 gene open 29494-30021
3617 JAMGTF010000011.1 GCA030180665_00601 gene open 30195-31112 accD
3618 JAMGTF010000011.1 GCA030180665_00602 gene open 31102-32058
3619 JAMGTF010000011.1 GCA030180665_00603 gene open 32063-33034 pfkA
3620 JAMGTF010000011.1 GCA030180665_00604 gene open 33053-33355
3621 JAMGTF010000011.1 GCA030180665_00605 gene open 33357-33950 recR
3622 JAMGTF010000011.1 GCA030180665_00606 gene open 34110-35036
3623 JAMGTF010000011.1 GCA030180665_00607 gene open 35058-35888
3624 JAMGTF010000011.1 GCA030180665_00608 gene open 35896-36672
3625 JAMGTF010000011.1 GCA030180665_00609 gene open 36790-37632
3626 JAMGTF010000011.1 GCA030180665_00567 gene open 35-110 trnN
3627 JAMGTF010000011.1 GCA030180665_00592 gene open 23529-23605 trnM
3628 JAMGTF010000011.1 GCA030180665_00593 gene open 23610-23686 trnA
3629 JAMGTF010000011.1 GCA030180665_00594 gene open 23698-23773 trnG
3630 JAMGTF010000011.1 GCA030180665_00567 tRNA open 35-110 trnN tRNA-Asn(gtt)
3631 JAMGTF010000011.1 GCA030180665_00592 tRNA open 23529-23605 trnM tRNA-Met(cat)
3632 JAMGTF010000011.1 GCA030180665_00593 tRNA open 23610-23686 trnA tRNA-Ala(tgc)
3633 JAMGTF010000011.1 GCA030180665_00594 tRNA open 23698-23773 trnG tRNA-Gly(tcc)
3634 JAMGTF010000012.1 GCA030180665_00610 CDS open 239-1492 _na     417_aa Serine hydroxymethyltransferase
3635 JAMGTF010000012.1 GCA030180665_00611 CDS open 1849-2664 _na     271_aa PI-PLC Y-box domain-containing protein
3636 JAMGTF010000012.1 GCA030180665_00612 CDS open 3103-6540 _na     1145_aa GDSL-like protein
3637 JAMGTF010000012.1 GCA030180665_00613 CDS open 6635-7177 _na     180_aa GNAT family acetyltransferase
3638 JAMGTF010000012.1 GCA030180665_00614 CDS open 7325-7960 _na     211_aa PF04237 family protein
3639 JAMGTF010000012.1 GCA030180665_00615 CDS open 8165-9097 _na     310_aa Signal recognition particle
3640 JAMGTF010000012.1 GCA030180665_00616 CDS open 9094-9912 _na     272_aa CAAX protease
3641 JAMGTF010000012.1 GCA030180665_00617 CDS open 10277-11065 _na     262_aa Guanylate cyclase domain-containing protein
3642 JAMGTF010000012.1 GCA030180665_00618 CDS open 11062-11790 _na     242_aa DUF3307 domain-containing protein
3643 JAMGTF010000012.1 GCA030180665_00619 CDS open 11928-12356 _na     142_aa PH domain-containing protein
3644 JAMGTF010000012.1 GCA030180665_00620 CDS open 12362-12775 _na     137_aa hypothetical protein
3645 JAMGTF010000012.1 GCA030180665_00621 CDS open 12849-14207 _na     452_aa ATP-binding protein
3646 JAMGTF010000012.1 GCA030180665_00622 CDS open 14331-14891 _na     186_aa DUF4367 domain-containing protein
3647 JAMGTF010000012.1 GCA030180665_00623 CDS open 14936-15388 _na     150_aa Lipoprotein
3648 JAMGTF010000012.1 GCA030180665_00624 CDS open 15452-16426 _na     324_aa araC AraC family transcriptional regulator
3649 JAMGTF010000012.1 GCA030180665_00625 CDS open 16675-18447 _na     590_aa ABC transporter ATP-binding protein
3650 JAMGTF010000012.1 GCA030180665_00626 CDS open 18440-20164 _na     574_aa ABC transporter ATP-binding protein
3651 JAMGTF010000012.1 GCA030180665_00627 CDS open 20223-20807 _na     194_aa Trep-Strep domain-containing protein
3652 JAMGTF010000012.1 GCA030180665_00628 CDS open 20807-21493 _na     228_aa ABC transporter permease
3653 JAMGTF010000012.1 GCA030180665_00629 CDS open 21487-22860 _na     457_aa ABC transporter ATP-binding protein
3654 JAMGTF010000012.1 GCA030180665_00630 CDS open 22917-23180 _na     87_aa O-methyltransferase domain-containing protein
3655 JAMGTF010000012.1 GCA030180665_00631 CDS open 23302-25296 _na     664_aa Hemin receptor
3656 JAMGTF010000012.1 GCA030180665_00632 CDS open 25543-28596 _na     1017_aa Acriflavin resistance protein
3657 JAMGTF010000012.1 GCA030180665_00633 CDS open 28593-29702 _na     369_aa Efflux RND transporter periplasmic adaptor subunit
3658 JAMGTF010000012.1 GCA030180665_00634 CDS open 29712-30986 _na     424_aa tolC TolC family protein
3659 JAMGTF010000012.1 GCA030180665_00635 CDS open 31125-32843 _na     572_aa ABC transporter
3660 JAMGTF010000012.1 GCA030180665_00636 CDS open 32836-34575 _na     579_aa ABC transporter ATP-binding protein
3661 JAMGTF010000012.1 GCA030180665_00637 CDS open 34780-35352 _na     190_aa TetR/AcrR family transcriptional regulator
3662 JAMGTF010000012.1 GCA030180665_00638 CDS open 35422-36441 _na     339_aa hypothetical protein
3663 JAMGTF010000012.1 GCA030180665_00610 gene open 239-1492
3664 JAMGTF010000012.1 GCA030180665_00611 gene open 1849-2664
3665 JAMGTF010000012.1 GCA030180665_00612 gene open 3103-6540
3666 JAMGTF010000012.1 GCA030180665_00613 gene open 6635-7177
3667 JAMGTF010000012.1 GCA030180665_00614 gene open 7325-7960
3668 JAMGTF010000012.1 GCA030180665_00615 gene open 8165-9097
3669 JAMGTF010000012.1 GCA030180665_00616 gene open 9094-9912
3670 JAMGTF010000012.1 GCA030180665_00617 gene open 10277-11065
3671 JAMGTF010000012.1 GCA030180665_00618 gene open 11062-11790
3672 JAMGTF010000012.1 GCA030180665_00619 gene open 11928-12356
3673 JAMGTF010000012.1 GCA030180665_00620 gene open 12362-12775
3674 JAMGTF010000012.1 GCA030180665_00621 gene open 12849-14207
3675 JAMGTF010000012.1 GCA030180665_00622 gene open 14331-14891
3676 JAMGTF010000012.1 GCA030180665_00623 gene open 14936-15388
3677 JAMGTF010000012.1 GCA030180665_00624 gene open 15452-16426 araC
3678 JAMGTF010000012.1 GCA030180665_00625 gene open 16675-18447
3679 JAMGTF010000012.1 GCA030180665_00626 gene open 18440-20164
3680 JAMGTF010000012.1 GCA030180665_00627 gene open 20223-20807
3681 JAMGTF010000012.1 GCA030180665_00628 gene open 20807-21493
3682 JAMGTF010000012.1 GCA030180665_00629 gene open 21487-22860
3683 JAMGTF010000012.1 GCA030180665_00630 gene open 22917-23180
3684 JAMGTF010000012.1 GCA030180665_00631 gene open 23302-25296
3685 JAMGTF010000012.1 GCA030180665_00632 gene open 25543-28596
3686 JAMGTF010000012.1 GCA030180665_00633 gene open 28593-29702
3687 JAMGTF010000012.1 GCA030180665_00634 gene open 29712-30986 tolC
3688 JAMGTF010000012.1 GCA030180665_00635 gene open 31125-32843
3689 JAMGTF010000012.1 GCA030180665_00636 gene open 32836-34575
3690 JAMGTF010000012.1 GCA030180665_00637 gene open 34780-35352
3691 JAMGTF010000012.1 GCA030180665_00638 gene open 35422-36441
3692 JAMGTF010000013.1 GCA030180665_00639 gene open 4-120 rrf
3693 JAMGTF010000013.1 GCA030180665_00639 rRNA open 4-120 rrf 5S ribosomal RNA
3694 JAMGTF010000013.1 GCA030180665_00641 CDS open 600-878 _na     92_aa hypothetical protein
3695 JAMGTF010000013.1 GCA030180665_00642 CDS open 973-1365 _na     130_aa Holin
3696 JAMGTF010000013.1 GCA030180665_00643 CDS open 1380-1787 _na     135_aa hypothetical protein
3697 JAMGTF010000013.1 GCA030180665_00644 CDS open 1801-2172 _na     123_aa M15 family metallopeptidase
3698 JAMGTF010000013.1 GCA030180665_00645 CDS open 2165-2818 _na     217_aa DUF4376 domain-containing protein
3699 JAMGTF010000013.1 GCA030180665_00646 CDS open 2829-6014 _na     1061_aa hypothetical protein
3700 JAMGTF010000013.1 GCA030180665_00647 CDS open 6016-10293 _na     1425_aa Phage tail tape measure protein
3701 JAMGTF010000013.1 GCA030180665_00648 CDS open 10554-10976 _na     140_aa hypothetical protein
3702 JAMGTF010000013.1 GCA030180665_00649 CDS open 10988-11914 _na     308_aa phage tail tube protein
3703 JAMGTF010000013.1 GCA030180665_00650 CDS open 11916-12659 _na     247_aa DUF6838 domain-containing protein
3704 JAMGTF010000013.1 GCA030180665_00651 CDS open 12650-13186 _na     178_aa HK97 gp10 family phage protein
3705 JAMGTF010000013.1 GCA030180665_00652 CDS open 13186-13530 _na     114_aa Phage head-tail adaptor
3706 JAMGTF010000013.1 GCA030180665_00653 CDS open 13532-13912 _na     126_aa hypothetical protein
3707 JAMGTF010000013.1 GCA030180665_00654 CDS open 13921-15111 _na     396_aa Phage coat protein
3708 JAMGTF010000013.1 GCA030180665_00655 CDS open 15130-15720 _na     196_aa Phage minor structural protein GP20
3709 JAMGTF010000013.1 GCA030180665_00656 CDS open 15831-15965 _na     44_aa hypothetical protein
3710 JAMGTF010000013.1 GCA030180665_00657 CDS open 16010-16708 _na     232_aa Transcriptional regulator
3711 JAMGTF010000013.1 GCA030180665_00658 CDS open 16768-17784 _na     338_aa Rha family transcriptional regulator
3712 JAMGTF010000013.1 GCA030180665_00659 CDS open 17907-18083 _na     58_aa copG CopG family transcriptional regulator
3713 JAMGTF010000013.1 GCA030180665_00660 CDS open 18207-19010 _na     267_aa Lipoprotein
3714 JAMGTF010000013.1 GCA030180665_00661 CDS open 19126-19470 _na     114_aa yjcQ YjcQ protein
3715 JAMGTF010000013.1 GCA030180665_00662 CDS open 19454-19612 _na     52_aa hypothetical protein
3716 JAMGTF010000013.1 GCA030180665_00663 CDS open 19669-19845 _na     58_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
3717 JAMGTF010000013.1 GCA030180665_00664 CDS open 19842-21416 _na     524_aa Phage protein F-like protein
3718 JAMGTF010000013.1 GCA030180665_00665 CDS open 21403-22746 _na     447_aa Phage portal protein%2C SPP1 Gp6-like protein
3719 JAMGTF010000013.1 GCA030180665_00666 CDS open 22810-23925 _na     371_aa Phage terminase large subunit
3720 JAMGTF010000013.1 GCA030180665_00667 CDS open 23969-24190 _na     73_aa terminase
3721 JAMGTF010000013.1 GCA030180665_00668 CDS open 24202-24711 _na     169_aa Terminase small subunit
3722 JAMGTF010000013.1 GCA030180665_00669 CDS open 24877-25737 _na     286_aa hypothetical protein
3723 JAMGTF010000013.1 GCA030180665_00670 CDS open 25882-26424 _na     180_aa hypothetical protein
3724 JAMGTF010000013.1 GCA030180665_00671 CDS open 26440-27354 _na     304_aa Kiwa anti-phage protein KwaB-like domain-containing protein
3725 JAMGTF010000013.1 GCA030180665_00672 CDS open 27563-28072 _na     169_aa RNA polymerase sigma-70 region 4 domain-containing protein
3726 JAMGTF010000013.1 GCA030180665_00673 CDS open 28083-28667 _na     194_aa dUTPase
3727 JAMGTF010000013.1 GCA030180665_00674 CDS open 28654-28869 _na     71_aa hypothetical protein
3728 JAMGTF010000013.1 GCA030180665_00641 gene open 600-878
3729 JAMGTF010000013.1 GCA030180665_00642 gene open 973-1365
3730 JAMGTF010000013.1 GCA030180665_00643 gene open 1380-1787
3731 JAMGTF010000013.1 GCA030180665_00644 gene open 1801-2172
3732 JAMGTF010000013.1 GCA030180665_00645 gene open 2165-2818
3733 JAMGTF010000013.1 GCA030180665_00646 gene open 2829-6014
3734 JAMGTF010000013.1 GCA030180665_00647 gene open 6016-10293
3735 JAMGTF010000013.1 GCA030180665_00648 gene open 10554-10976
3736 JAMGTF010000013.1 GCA030180665_00649 gene open 10988-11914
3737 JAMGTF010000013.1 GCA030180665_00650 gene open 11916-12659
3738 JAMGTF010000013.1 GCA030180665_00651 gene open 12650-13186
3739 JAMGTF010000013.1 GCA030180665_00652 gene open 13186-13530
3740 JAMGTF010000013.1 GCA030180665_00653 gene open 13532-13912
3741 JAMGTF010000013.1 GCA030180665_00654 gene open 13921-15111
3742 JAMGTF010000013.1 GCA030180665_00655 gene open 15130-15720
3743 JAMGTF010000013.1 GCA030180665_00656 gene open 15831-15965
3744 JAMGTF010000013.1 GCA030180665_00657 gene open 16010-16708
3745 JAMGTF010000013.1 GCA030180665_00658 gene open 16768-17784
3746 JAMGTF010000013.1 GCA030180665_00659 gene open 17907-18083 copG
3747 JAMGTF010000013.1 GCA030180665_00660 gene open 18207-19010
3748 JAMGTF010000013.1 GCA030180665_00661 gene open 19126-19470 yjcQ
3749 JAMGTF010000013.1 GCA030180665_00662 gene open 19454-19612
3750 JAMGTF010000013.1 GCA030180665_00663 gene open 19669-19845
3751 JAMGTF010000013.1 GCA030180665_00664 gene open 19842-21416
3752 JAMGTF010000013.1 GCA030180665_00665 gene open 21403-22746
3753 JAMGTF010000013.1 GCA030180665_00666 gene open 22810-23925
3754 JAMGTF010000013.1 GCA030180665_00667 gene open 23969-24190
3755 JAMGTF010000013.1 GCA030180665_00668 gene open 24202-24711
3756 JAMGTF010000013.1 GCA030180665_00669 gene open 24877-25737
3757 JAMGTF010000013.1 GCA030180665_00670 gene open 25882-26424
3758 JAMGTF010000013.1 GCA030180665_00671 gene open 26440-27354
3759 JAMGTF010000013.1 GCA030180665_00672 gene open 27563-28072
3760 JAMGTF010000013.1 GCA030180665_00673 gene open 28083-28667
3761 JAMGTF010000013.1 GCA030180665_00674 gene open 28654-28869
3762 JAMGTF010000013.1 GCA030180665_00640 gene open 139-214 trnT
3763 JAMGTF010000013.1 GCA030180665_00640 tRNA open 139-214 trnT tRNA-Thr(cgt)
3764 JAMGTF010000014.1 GCA030180665_00675 CDS open 322-1449 _na     375_aa N-terminal phage integrase SAM-like domain-containing protein
3765 JAMGTF010000014.1 GCA030180665_00676 CDS open 1584-2291 _na     235_aa MAE_28990/MAE_18760 family HEPN-like nuclease
3766 JAMGTF010000014.1 GCA030180665_00677 CDS open 2288-3316 _na     342_aa DUF262 domain-containing protein
3767 JAMGTF010000014.1 GCA030180665_00678 CDS open 3288-4376 _na     362_aa DNA cytosine methyltransferase
3768 JAMGTF010000014.1 GCA030180665_00679 CDS open 4399-4806 _na     135_aa irrE IrrE N-terminal-like domain-containing protein
3769 JAMGTF010000014.1 GCA030180665_00680 CDS open 4815-5225 _na     136_aa Transcriptional regulator
3770 JAMGTF010000014.1 GCA030180665_00681 CDS open 5396-5608 _na     70_aa Repressor
3771 JAMGTF010000014.1 GCA030180665_00682 CDS open 5931-6398 _na     155_aa hypothetical protein
3772 JAMGTF010000014.1 GCA030180665_00683 CDS open 6469-6711 _na     80_aa DNA-binding protein
3773 JAMGTF010000014.1 GCA030180665_00684 CDS open 6829-7062 _na     77_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
3774 JAMGTF010000014.1 GCA030180665_00685 CDS open 7209-7514 _na     101_aa recB recombinase RecB
3775 JAMGTF010000014.1 GCA030180665_00686 CDS open 7507-8724 _na     405_aa DEAD/DEAH box helicase
3776 JAMGTF010000014.1 GCA030180665_00687 CDS open 8721-9224 _na     167_aa hypothetical protein
3777 JAMGTF010000014.1 GCA030180665_00688 CDS open 9217-10239 _na     340_aa yqaJ YqaJ viral recombinase family protein
3778 JAMGTF010000014.1 GCA030180665_00689 CDS open 10253-10579 _na     108_aa HTH domain-containing protein
3779 JAMGTF010000014.1 GCA030180665_00690 CDS open 10595-11482 _na     295_aa AAA family ATPase
3780 JAMGTF010000014.1 GCA030180665_00691 CDS open 11486-11899 _na     137_aa hypothetical protein
3781 JAMGTF010000014.1 GCA030180665_00692 CDS open 11960-13789 _na     609_aa putative DNA-directed DNA polymerase II
3782 JAMGTF010000014.1 GCA030180665_00693 CDS open 13765-15675 _na     636_aa phage/plasmid primase%2C P4 family
3783 JAMGTF010000014.1 GCA030180665_00675 gene open 322-1449
3784 JAMGTF010000014.1 GCA030180665_00676 gene open 1584-2291
3785 JAMGTF010000014.1 GCA030180665_00677 gene open 2288-3316
3786 JAMGTF010000014.1 GCA030180665_00678 gene open 3288-4376
3787 JAMGTF010000014.1 GCA030180665_00679 gene open 4399-4806 irrE
3788 JAMGTF010000014.1 GCA030180665_00680 gene open 4815-5225
3789 JAMGTF010000014.1 GCA030180665_00681 gene open 5396-5608
3790 JAMGTF010000014.1 GCA030180665_00682 gene open 5931-6398
3791 JAMGTF010000014.1 GCA030180665_00683 gene open 6469-6711
3792 JAMGTF010000014.1 GCA030180665_00684 gene open 6829-7062
3793 JAMGTF010000014.1 GCA030180665_00685 gene open 7209-7514 recB
3794 JAMGTF010000014.1 GCA030180665_00686 gene open 7507-8724
3795 JAMGTF010000014.1 GCA030180665_00687 gene open 8721-9224
3796 JAMGTF010000014.1 GCA030180665_00688 gene open 9217-10239 yqaJ
3797 JAMGTF010000014.1 GCA030180665_00689 gene open 10253-10579
3798 JAMGTF010000014.1 GCA030180665_00690 gene open 10595-11482
3799 JAMGTF010000014.1 GCA030180665_00691 gene open 11486-11899
3800 JAMGTF010000014.1 GCA030180665_00692 gene open 11960-13789
3801 JAMGTF010000014.1 GCA030180665_00693 gene open 13765-15675
3802 JAMGTF010000015.1 GCA030180665_00708 gene open 10168-10284 rrf
3803 JAMGTF010000015.1 GCA030180665_00708 rRNA open 10168-10284 rrf 5S ribosomal RNA
3804 JAMGTF010000015.1 GCA030180665_00694 CDS open 157-606 _na     149_aa yebR Free methionine-(R)-sulfoxide reductase YebR
3805 JAMGTF010000015.1 GCA030180665_00695 CDS open 653-1234 _na     193_aa hypothetical protein
3806 JAMGTF010000015.1 GCA030180665_00696 CDS open 1289-2548 _na     419_aa gspD General secretion pathway protein GspD
3807 JAMGTF010000015.1 GCA030180665_00697 CDS open 2517-3110 _na     197_aa pilN Fimbrial assembly protein PilN
3808 JAMGTF010000015.1 GCA030180665_00698 CDS open 3088-4227 _na     379_aa Fimbrial assembly protein
3809 JAMGTF010000015.1 GCA030180665_00699 CDS open 4224-4700 _na     158_aa Competence protein ComGF
3810 JAMGTF010000015.1 GCA030180665_00700 CDS open 4714-5280 _na     188_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3811 JAMGTF010000015.1 GCA030180665_00701 CDS open 5261-5653 _na     130_aa Type II secretion system protein
3812 JAMGTF010000015.1 GCA030180665_00702 CDS open 5650-6093 _na     147_aa Prepilin peptidase
3813 JAMGTF010000015.1 GCA030180665_00703 CDS open 6078-6551 _na     157_aa Prepilin-type cleavage/methylation N-terminal domain protein
3814 JAMGTF010000015.1 GCA030180665_00704 CDS open 6561-7736 _na     391_aa gspF Type II secretion system protein GspF domain-containing protein
3815 JAMGTF010000015.1 GCA030180665_00705 CDS open 7733-9208 _na     491_aa Bacterial type II secretion system protein E domain-containing protein
3816 JAMGTF010000015.1 GCA030180665_00706 CDS open 9208-9366 _na     52_aa hypothetical protein
3817 JAMGTF010000015.1 GCA030180665_00707 CDS open 9363-9983 _na     206_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3818 JAMGTF010000015.1 GCA030180665_00694 gene open 157-606 yebR
3819 JAMGTF010000015.1 GCA030180665_00695 gene open 653-1234
3820 JAMGTF010000015.1 GCA030180665_00696 gene open 1289-2548 gspD
3821 JAMGTF010000015.1 GCA030180665_00697 gene open 2517-3110 pilN
3822 JAMGTF010000015.1 GCA030180665_00698 gene open 3088-4227
3823 JAMGTF010000015.1 GCA030180665_00699 gene open 4224-4700
3824 JAMGTF010000015.1 GCA030180665_00700 gene open 4714-5280
3825 JAMGTF010000015.1 GCA030180665_00701 gene open 5261-5653
3826 JAMGTF010000015.1 GCA030180665_00702 gene open 5650-6093
3827 JAMGTF010000015.1 GCA030180665_00703 gene open 6078-6551
3828 JAMGTF010000015.1 GCA030180665_00704 gene open 6561-7736 gspF
3829 JAMGTF010000015.1 GCA030180665_00705 gene open 7733-9208
3830 JAMGTF010000015.1 GCA030180665_00706 gene open 9208-9366
3831 JAMGTF010000015.1 GCA030180665_00707 gene open 9363-9983
3832 JAMGTF010000016.1 GCA030180665_00709 gene open 25-1532 rrs
3833 JAMGTF010000016.1 GCA030180665_00709 rRNA open 25-1532 rrs 16S ribosomal RNA
3834 JAMGTF010000017.1 repeat_region open 437-1458 CRISPR array with 16 repeats of length 30%2C consensus sequence ATTTCAAAACATCCTATGTTTCTTGTTAAT and spacer length 35
3835 JAMGTF010000018.1 GCA030180665_00710 CDS open 95-1372 _na     425_aa ISL3 family transposase
3836 JAMGTF010000018.1 GCA030180665_00710 gene open 95-1372
3837 JAMGTF010000019.1 GCA030180665_00711 gene open 1-1254 rrl
3838 JAMGTF010000019.1 GCA030180665_00711 rRNA open 1-1254 rrl 23S ribosomal RNA
3839 JAMGTF010000023.1 GCA030180665_00966 gene open 141-217 trnI
3840 JAMGTF010000023.1 GCA030180665_00967 gene open 223-299 trnA
3841 JAMGTF010000023.1 GCA030180665_00966 tRNA open 141-217 trnI tRNA-Ile(gat)
3842 JAMGTF010000023.1 GCA030180665_00967 tRNA open 223-299 trnA tRNA-Ala(tgc)