HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_030180725.1)

Select a Genome:
BAKTA Annotations for GCA_030180725.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
277 2075585 1975 8 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4082 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4082 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAMGTI010000098.1 GCA030180725_02023 gene open 432-1223 minD
3502 JAMGTI010000098.1 GCA030180725_02024 gene open 1225-1866 minC
3503 JAMGTI010000098.1 GCA030180725_02025 gene open 2000-2296
3504 JAMGTI010000098.1 GCA030180725_02026 gene open 2319-3071
3505 JAMGTI010000098.1 GCA030180725_02027 gene open 3083-5269
3506 JAMGTI010000098.1 GCA030180725_02028 gene open 5270-5659
3507 JAMGTI010000098.1 GCA030180725_02029 gene open 5662-6120
3508 JAMGTI010000099.1 GCA030180725_02030 CDS open 61-2265 _na     734_aa nrdD anaerobic ribonucleoside-triphosphate reductase
3509 JAMGTI010000099.1 GCA030180725_02031 CDS open 2281-2790 _na     169_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3510 JAMGTI010000099.1 GCA030180725_02032 CDS open 2919-4256 _na     445_aa Multidrug-efflux transporter
3511 JAMGTI010000099.1 GCA030180725_02033 CDS open 4265-6049 _na     594_aa hflX GTPase HflX
3512 JAMGTI010000099.1 GCA030180725_02030 gene open 61-2265 nrdD
3513 JAMGTI010000099.1 GCA030180725_02031 gene open 2281-2790 nrdG
3514 JAMGTI010000099.1 GCA030180725_02032 gene open 2919-4256
3515 JAMGTI010000099.1 GCA030180725_02033 gene open 4265-6049 hflX
3516 JAMGTI010000100.1 GCA030180725_00116 CDS open 72-1061 _na     329_aa cobD threonine-phosphate decarboxylase CobD
3517 JAMGTI010000100.1 GCA030180725_00117 CDS open 1077-2414 _na     445_aa cobyrinate a%2Cc-diamide synthase
3518 JAMGTI010000100.1 GCA030180725_00118 CDS open 2434-2751 _na     105_aa HTH deoR-type domain-containing protein
3519 JAMGTI010000100.1 GCA030180725_00119 CDS open 2763-3407 _na     214_aa cobH Cobalamin biosynthesis precorrin-8X methylmutase CobH/CbiC domain-containing protein
3520 JAMGTI010000100.1 GCA030180725_00120 CDS open 3591-4715 _na     374_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
3521 JAMGTI010000100.1 GCA030180725_00121 CDS open 4708-5352 _na     214_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating) subunit CbiE
3522 JAMGTI010000100.1 GCA030180725_00122 CDS open 5339-5905 _na     188_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating) subunit CbiT
3523 JAMGTI010000100.1 GCA030180725_00116 gene open 72-1061 cobD
3524 JAMGTI010000100.1 GCA030180725_00117 gene open 1077-2414
3525 JAMGTI010000100.1 GCA030180725_00118 gene open 2434-2751
3526 JAMGTI010000100.1 GCA030180725_00119 gene open 2763-3407 cobH
3527 JAMGTI010000100.1 GCA030180725_00120 gene open 3591-4715 cbiD
3528 JAMGTI010000100.1 GCA030180725_00121 gene open 4708-5352 cbiE
3529 JAMGTI010000100.1 GCA030180725_00122 gene open 5339-5905 cbiT
3530 JAMGTI010000101.1 GCA030180725_00123 CDS open 95-1510 _na     471_aa Aspartate ammonia-lyase
3531 JAMGTI010000101.1 GCA030180725_00124 CDS open 1503-2120 _na     205_aa cutC PF03932 family protein CutC
3532 JAMGTI010000101.1 GCA030180725_00125 CDS open 2142-2702 _na     186_aa DNA polymerase III subunit epsilon
3533 JAMGTI010000101.1 GCA030180725_00126 CDS open 2828-3553 _na     241_aa pflA pyruvate formate-lyase-activating protein
3534 JAMGTI010000101.1 GCA030180725_00127 CDS open 3580-5811 _na     743_aa pflB formate C-acetyltransferase
3535 JAMGTI010000101.1 GCA030180725_00123 gene open 95-1510
3536 JAMGTI010000101.1 GCA030180725_00124 gene open 1503-2120 cutC
3537 JAMGTI010000101.1 GCA030180725_00125 gene open 2142-2702
3538 JAMGTI010000101.1 GCA030180725_00126 gene open 2828-3553 pflA
3539 JAMGTI010000101.1 GCA030180725_00127 gene open 3580-5811 pflB
3540 JAMGTI010000102.1 GCA030180725_00128 CDS open 486-1406 _na     306_aa WYL domain protein
3541 JAMGTI010000102.1 GCA030180725_00129 CDS open 1673-2089 _na     138_aa PF08002 family protein
3542 JAMGTI010000102.1 GCA030180725_00130 CDS open 2315-2947 _na     210_aa TetR/AcrR family transcriptional regulator
3543 JAMGTI010000102.1 GCA030180725_00131 CDS open 2977-4323 _na     448_aa mepA Multidrug export protein MepA
3544 JAMGTI010000102.1 GCA030180725_00132 CDS open 4430-5179 _na     249_aa Methyltransferase
3545 JAMGTI010000102.1 GCA030180725_00133 CDS open 5207-5653 _na     148_aa DUF4143 domain-containing protein
3546 JAMGTI010000102.1 GCA030180725_00128 gene open 486-1406
3547 JAMGTI010000102.1 GCA030180725_00129 gene open 1673-2089
3548 JAMGTI010000102.1 GCA030180725_00130 gene open 2315-2947
3549 JAMGTI010000102.1 GCA030180725_00131 gene open 2977-4323 mepA
3550 JAMGTI010000102.1 GCA030180725_00132 gene open 4430-5179
3551 JAMGTI010000102.1 GCA030180725_00133 gene open 5207-5653
3552 JAMGTI010000103.1 GCA030180725_00134 CDS open 73-726 _na     217_aa ompA OmpA family protein
3553 JAMGTI010000103.1 GCA030180725_00135 CDS open 805-1413 _na     202_aa Lipoprotein
3554 JAMGTI010000103.1 GCA030180725_00136 CDS open 1498-5349 _na     1283_aa YadA-like family protein
3555 JAMGTI010000103.1 GCA030180725_00134 gene open 73-726 ompA
3556 JAMGTI010000103.1 GCA030180725_00135 gene open 805-1413
3557 JAMGTI010000103.1 GCA030180725_00136 gene open 1498-5349
3558 JAMGTI010000104.1 GCA030180725_00137 CDS open 38-736 _na     232_aa opine metallophore biosynthesis dehydrogenase
3559 JAMGTI010000104.1 GCA030180725_00138 CDS open 733-1515 _na     260_aa Methyltransferase domain protein
3560 JAMGTI010000104.1 GCA030180725_00139 CDS open 1546-2949 _na     467_aa Multidrug-efflux transporter
3561 JAMGTI010000104.1 GCA030180725_00140 CDS open 3048-4661 _na     537_aa PTS sugar transporter subunit IIABC
3562 JAMGTI010000104.1 GCA030180725_00141 CDS open 4746-5255 _na     169_aa DMT family transporter
3563 JAMGTI010000104.1 GCA030180725_00137 gene open 38-736
3564 JAMGTI010000104.1 GCA030180725_00138 gene open 733-1515
3565 JAMGTI010000104.1 GCA030180725_00139 gene open 1546-2949
3566 JAMGTI010000104.1 GCA030180725_00140 gene open 3048-4661
3567 JAMGTI010000104.1 GCA030180725_00141 gene open 4746-5255
3568 JAMGTI010000105.1 regulatory_region open 109-224 FMN riboswitch aptamer (RFN element)
3569 JAMGTI010000105.1 GCA030180725_00142 CDS open 309-770 _na     153_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
3570 JAMGTI010000105.1 GCA030180725_00143 CDS open 775-1854 _na     359_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
3571 JAMGTI010000105.1 GCA030180725_00144 CDS open 1864-2511 _na     215_aa ribE riboflavin synthase
3572 JAMGTI010000105.1 GCA030180725_00145 CDS open 2522-3733 _na     403_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
3573 JAMGTI010000105.1 GCA030180725_00146 CDS open 3774-5261 _na     495_aa UPF0371 protein A2J07_07565
3574 JAMGTI010000105.1 GCA030180725_00142 gene open 309-770 ribE
3575 JAMGTI010000105.1 GCA030180725_00143 gene open 775-1854 ribD
3576 JAMGTI010000105.1 GCA030180725_00144 gene open 1864-2511 ribE
3577 JAMGTI010000105.1 GCA030180725_00145 gene open 2522-3733
3578 JAMGTI010000105.1 GCA030180725_00146 gene open 3774-5261
3579 JAMGTI010000106.1 GCA030180725_00147 CDS open 196-1497 _na     433_aa Histidine transporter
3580 JAMGTI010000106.1 GCA030180725_00148 CDS open 1650-3680 _na     676_aa urocanate hydratase
3581 JAMGTI010000106.1 GCA030180725_00149 CDS open 3682-5214 _na     510_aa hutH histidine ammonia-lyase
3582 JAMGTI010000106.1 GCA030180725_00147 gene open 196-1497
3583 JAMGTI010000106.1 GCA030180725_00148 gene open 1650-3680
3584 JAMGTI010000106.1 GCA030180725_00149 gene open 3682-5214 hutH
3585 JAMGTI010000107.1 GCA030180725_00150 CDS open 92-1408 _na     438_aa Porin
3586 JAMGTI010000107.1 GCA030180725_00151 CDS open 1482-3284 _na     600_aa lepA translation elongation factor 4
3587 JAMGTI010000107.1 GCA030180725_00152 CDS open 3475-3651 _na     58_aa Metallothionein
3588 JAMGTI010000107.1 GCA030180725_00153 CDS open 3742-4089 _na     115_aa DNA-deoxyinosine glycosylase
3589 JAMGTI010000107.1 GCA030180725_00154 CDS open 4212-4715 _na     167_aa GNAT family acetyltransferase
3590 JAMGTI010000107.1 GCA030180725_00150 gene open 92-1408
3591 JAMGTI010000107.1 GCA030180725_00151 gene open 1482-3284 lepA
3592 JAMGTI010000107.1 GCA030180725_00152 gene open 3475-3651
3593 JAMGTI010000107.1 GCA030180725_00153 gene open 3742-4089
3594 JAMGTI010000107.1 GCA030180725_00154 gene open 4212-4715
3595 JAMGTI010000108.1 GCA030180725_00155 CDS open 59-574 _na     171_aa Flavodoxin
3596 JAMGTI010000108.1 GCA030180725_00156 CDS open 571-951 _na     126_aa HTH merR-type domain-containing protein
3597 JAMGTI010000108.1 GCA030180725_00157 CDS open 969-2723 _na     584_aa 1-deoxy-D-xylulose-5-phosphate synthase
3598 JAMGTI010000108.1 GCA030180725_00158 CDS open 2749-3594 _na     281_aa Oxidoreductase%2C aldo/keto reductase family protein
3599 JAMGTI010000108.1 GCA030180725_00159 CDS open 3621-4220 _na     199_aa Flavodoxin
3600 JAMGTI010000108.1 GCA030180725_00160 CDS open 4312-4896 _na     194_aa Isochorismatase family protein
3601 JAMGTI010000108.1 GCA030180725_00155 gene open 59-574
3602 JAMGTI010000108.1 GCA030180725_00156 gene open 571-951
3603 JAMGTI010000108.1 GCA030180725_00157 gene open 969-2723
3604 JAMGTI010000108.1 GCA030180725_00158 gene open 2749-3594
3605 JAMGTI010000108.1 GCA030180725_00159 gene open 3621-4220
3606 JAMGTI010000108.1 GCA030180725_00160 gene open 4312-4896
3607 JAMGTI010000109.1 GCA030180725_00161 CDS open 233-1765 _na     510_aa Amidohydrolase
3608 JAMGTI010000109.1 GCA030180725_00162 CDS open 1795-3423 _na     542_aa aepA Exoenzyme regulatory protein aepA
3609 JAMGTI010000109.1 GCA030180725_00163 CDS open 3420-4844 _na     474_aa nhaC Na+/H+ antiporter NhaC
3610 JAMGTI010000109.1 GCA030180725_00161 gene open 233-1765
3611 JAMGTI010000109.1 GCA030180725_00162 gene open 1795-3423 aepA
3612 JAMGTI010000109.1 GCA030180725_00163 gene open 3420-4844 nhaC
3613 JAMGTI010000110.1 GCA030180725_00195 CDS open 137-733 _na     198_aa tetR Transcriptional regulator%2C TetR family
3614 JAMGTI010000110.1 GCA030180725_00196 CDS open 761-3241 _na     826_aa Phosphoenolpyruvate synthase
3615 JAMGTI010000110.1 GCA030180725_00197 CDS open 3243-4637 _na     464_aa mepA Multidrug export protein MepA
3616 JAMGTI010000110.1 GCA030180725_00195 gene open 137-733 tetR
3617 JAMGTI010000110.1 GCA030180725_00196 gene open 761-3241
3618 JAMGTI010000110.1 GCA030180725_00197 gene open 3243-4637 mepA
3619 JAMGTI010000111.1 GCA030180725_00198 CDS open 125-682 _na     185_aa Tetratricopeptide repeat protein
3620 JAMGTI010000111.1 GCA030180725_00199 CDS open 705-1250 _na     181_aa J domain-containing protein
3621 JAMGTI010000111.1 GCA030180725_00200 CDS open 1289-2647 _na     452_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
3622 JAMGTI010000111.1 GCA030180725_00201 CDS open 2637-3587 _na     316_aa ribose-phosphate diphosphokinase
3623 JAMGTI010000111.1 GCA030180725_00202 CDS open 3590-4198 _na     202_aa L-threonylcarbamoyladenylate synthase
3624 JAMGTI010000111.1 GCA030180725_00203 CDS open 4207-4641 _na     144_aa DUF327 domain-containing protein
3625 JAMGTI010000111.1 GCA030180725_00198 gene open 125-682
3626 JAMGTI010000111.1 GCA030180725_00199 gene open 705-1250
3627 JAMGTI010000111.1 GCA030180725_00200 gene open 1289-2647 glmU
3628 JAMGTI010000111.1 GCA030180725_00201 gene open 2637-3587
3629 JAMGTI010000111.1 GCA030180725_00202 gene open 3590-4198
3630 JAMGTI010000111.1 GCA030180725_00203 gene open 4207-4641
3631 JAMGTI010000112.1 GCA030180725_00204 CDS open 9-791 _na     260_aa Peptide ABC transporter substrate-binding protein
3632 JAMGTI010000112.1 GCA030180725_00205 CDS open 804-1529 _na     241_aa Peptide ABC transporter ATP-binding protein
3633 JAMGTI010000112.1 GCA030180725_00206 CDS open 1529-2323 _na     264_aa Peptide ABC transporter permease
3634 JAMGTI010000112.1 GCA030180725_00207 CDS open 2320-3201 _na     293_aa Peptide ABC transporter permease
3635 JAMGTI010000112.1 GCA030180725_00208 CDS open 3254-4792 _na     512_aa Peptide-binding protein
3636 JAMGTI010000112.1 GCA030180725_00204 gene open 9-791
3637 JAMGTI010000112.1 GCA030180725_00205 gene open 804-1529
3638 JAMGTI010000112.1 GCA030180725_00206 gene open 1529-2323
3639 JAMGTI010000112.1 GCA030180725_00207 gene open 2320-3201
3640 JAMGTI010000112.1 GCA030180725_00208 gene open 3254-4792
3641 JAMGTI010000113.1 GCA030180725_00209 CDS open 130-2208 _na     692_aa DNA primase
3642 JAMGTI010000113.1 GCA030180725_00210 CDS open 2222-2443 _na     73_aa hypothetical protein
3643 JAMGTI010000113.1 GCA030180725_00211 CDS open 2462-3046 _na     194_aa Single-stranded DNA-binding protein
3644 JAMGTI010000113.1 GCA030180725_00212 CDS open 3068-3721 _na     217_aa ATP-binding protein
3645 JAMGTI010000113.1 GCA030180725_00213 CDS open 3733-4245 _na     170_aa Siphovirus Gp157
3646 JAMGTI010000113.1 GCA030180725_00214 CDS open 4255-4581 _na     108_aa hypothetical protein
3647 JAMGTI010000113.1 GCA030180725_00209 gene open 130-2208
3648 JAMGTI010000113.1 GCA030180725_00210 gene open 2222-2443
3649 JAMGTI010000113.1 GCA030180725_00211 gene open 2462-3046
3650 JAMGTI010000113.1 GCA030180725_00212 gene open 3068-3721
3651 JAMGTI010000113.1 GCA030180725_00213 gene open 3733-4245
3652 JAMGTI010000113.1 GCA030180725_00214 gene open 4255-4581
3653 JAMGTI010000114.1 GCA030180725_00215 CDS open 98-802 _na     234_aa DNA-binding response regulator
3654 JAMGTI010000114.1 GCA030180725_00216 CDS open 799-2472 _na     557_aa Histidine kinase/HSP90-like ATPase domain-containing protein
3655 JAMGTI010000114.1 GCA030180725_00217 CDS open 2482-3162 _na     226_aa eamA EamA domain-containing protein
3656 JAMGTI010000114.1 GCA030180725_00218 CDS open 3236-3862 _na     208_aa Outer membrane protein beta-barrel domain-containing protein
3657 JAMGTI010000114.1 GCA030180725_00215 gene open 98-802
3658 JAMGTI010000114.1 GCA030180725_00216 gene open 799-2472
3659 JAMGTI010000114.1 GCA030180725_00217 gene open 2482-3162 eamA
3660 JAMGTI010000114.1 GCA030180725_00218 gene open 3236-3862
3661 JAMGTI010000115.1 GCA030180725_00219 CDS open 104-877 _na     257_aa pxpA 5-oxoprolinase subunit A
3662 JAMGTI010000115.1 GCA030180725_00220 CDS open 893-2080 _na     395_aa mntH Transporter%2C branched chain amino acid:cation symporter (LIVCS) family protein
3663 JAMGTI010000115.1 GCA030180725_00221 CDS open 2094-2843 _na     249_aa pxpB 5-oxoprolinase subunit PxpB
3664 JAMGTI010000115.1 GCA030180725_00222 CDS open 2836-3858 _na     340_aa Biotin-dependent carboxyltransferase family protein
3665 JAMGTI010000115.1 GCA030180725_00219 gene open 104-877 pxpA
3666 JAMGTI010000115.1 GCA030180725_00220 gene open 893-2080 mntH
3667 JAMGTI010000115.1 GCA030180725_00221 gene open 2094-2843 pxpB
3668 JAMGTI010000115.1 GCA030180725_00222 gene open 2836-3858
3669 JAMGTI010000116.1 GCA030180725_00223 CDS open 268-1932 _na     554_aa PF08011 family protein
3670 JAMGTI010000116.1 GCA030180725_00224 CDS open 2051-2662 _na     203_aa AAA-ATPase domain protein
3671 JAMGTI010000116.1 GCA030180725_00225 CDS open 2659-3684 _na     341_aa AAA-ATPase-like domain-containing protein
3672 JAMGTI010000116.1 GCA030180725_00223 gene open 268-1932
3673 JAMGTI010000116.1 GCA030180725_00224 gene open 2051-2662
3674 JAMGTI010000116.1 GCA030180725_00225 gene open 2659-3684
3675 JAMGTI010000117.1 GCA030180725_00226 CDS open 105-1100 _na     331_aa S-adenosyl-L-homocysteine hydrolase%2C NAD binding-like domain protein
3676 JAMGTI010000117.1 GCA030180725_00227 CDS open 1128-2309 _na     393_aa gltS sodium/glutamate symporter
3677 JAMGTI010000117.1 GCA030180725_00226 gene open 105-1100
3678 JAMGTI010000117.1 GCA030180725_00227 gene open 1128-2309 gltS
3679 JAMGTI010000118.1 GCA030180725_00228 CDS open 190-849 _na     219_aa DUF4276 domain-containing protein
3680 JAMGTI010000118.1 GCA030180725_00229 CDS open 846-1058 _na     70_aa Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein
3681 JAMGTI010000118.1 GCA030180725_00230 CDS open 1089-1685 _na     198_aa AAA domain protein
3682 JAMGTI010000118.1 GCA030180725_00231 CDS open 1784-3292 _na     502_aa ABC transporter substrate-binding protein
3683 JAMGTI010000118.1 GCA030180725_00232 CDS open 3310-3807 _na     165_aa Core-binding (CB) domain-containing protein
3684 JAMGTI010000118.1 GCA030180725_00228 gene open 190-849
3685 JAMGTI010000118.1 GCA030180725_00229 gene open 846-1058
3686 JAMGTI010000118.1 GCA030180725_00230 gene open 1089-1685
3687 JAMGTI010000118.1 GCA030180725_00231 gene open 1784-3292
3688 JAMGTI010000118.1 GCA030180725_00232 gene open 3310-3807
3689 JAMGTI010000119.1 GCA030180725_00233 CDS open 37-1074 _na     345_aa ISL3 family transposase
3690 JAMGTI010000119.1 GCA030180725_00234 CDS open 2157-3695 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
3691 JAMGTI010000119.1 GCA030180725_00233 gene open 37-1074
3692 JAMGTI010000119.1 GCA030180725_00234 gene open 2157-3695 guaA
3693 JAMGTI010000120.1 GCA030180725_00277 CDS open 87-1223 _na     378_aa Haloacid dehalogenase-like hydrolase
3694 JAMGTI010000120.1 GCA030180725_00278 CDS open 1256-2164 _na     302_aa murQ N-acetylmuramic acid 6-phosphate etherase
3695 JAMGTI010000120.1 GCA030180725_00279 CDS open 2157-3569 _na     470_aa PTS glucose transporter subunit IIB
3696 JAMGTI010000120.1 GCA030180725_00277 gene open 87-1223
3697 JAMGTI010000120.1 GCA030180725_00278 gene open 1256-2164 murQ
3698 JAMGTI010000120.1 GCA030180725_00279 gene open 2157-3569
3699 JAMGTI010000121.1 GCA030180725_00280 CDS open 153-1121 _na     322_aa Thiamine ABC transporter substrate-binding protein
3700 JAMGTI010000121.1 GCA030180725_00281 CDS open 1308-3020 _na     570_aa argS arginine--tRNA ligase
3701 JAMGTI010000121.1 GCA030180725_00280 gene open 153-1121
3702 JAMGTI010000121.1 GCA030180725_00281 gene open 1308-3020 argS
3703 JAMGTI010000121.1 GCA030180725_00282 gene open 3383-3459 trnR
3704 JAMGTI010000121.1 GCA030180725_00282 tRNA open 3383-3459 trnR tRNA-Arg(tcg)
3705 JAMGTI010000122.1 GCA030180725_00283 CDS open 34-333 _na     99_aa hypothetical protein
3706 JAMGTI010000122.1 GCA030180725_00284 CDS open 778-948 _na     56_aa AbrB/MazE/SpoVT family DNA-binding domain-containing protein
3707 JAMGTI010000122.1 GCA030180725_00285 CDS open 969-1445 _na     158_aa Toxin secretion/phage lysis holin
3708 JAMGTI010000122.1 GCA030180725_00286 CDS open 1461-1913 _na     150_aa DUF1353 domain-containing protein
3709 JAMGTI010000122.1 GCA030180725_00287 CDS open 1900-2283 _na     127_aa Holin
3710 JAMGTI010000122.1 GCA030180725_00288 CDS open 2314-2775 _na     153_aa Serine-type D-Ala-D-Ala carboxypeptidase
3711 JAMGTI010000122.1 GCA030180725_00289 CDS open 2803-3471 _na     222_aa DUF4376 domain-containing protein
3712 JAMGTI010000122.1 GCA030180725_00283 gene open 34-333
3713 JAMGTI010000122.1 GCA030180725_00284 gene open 778-948
3714 JAMGTI010000122.1 GCA030180725_00285 gene open 969-1445
3715 JAMGTI010000122.1 GCA030180725_00286 gene open 1461-1913
3716 JAMGTI010000122.1 GCA030180725_00287 gene open 1900-2283
3717 JAMGTI010000122.1 GCA030180725_00288 gene open 2314-2775
3718 JAMGTI010000122.1 GCA030180725_00289 gene open 2803-3471
3719 JAMGTI010000123.1 GCA030180725_00290 CDS open 78-1427 _na     449_aa gntP GntP family permease
3720 JAMGTI010000123.1 GCA030180725_00291 CDS open 1445-2755 _na     436_aa dsdA D-serine ammonia-lyase
3721 JAMGTI010000123.1 GCA030180725_00292 CDS open 2959-3474 _na     171_aa Flavodoxin
3722 JAMGTI010000123.1 GCA030180725_00290 gene open 78-1427 gntP
3723 JAMGTI010000123.1 GCA030180725_00291 gene open 1445-2755 dsdA
3724 JAMGTI010000123.1 GCA030180725_00292 gene open 2959-3474
3725 JAMGTI010000124.1 GCA030180725_00293 CDS open 509-1045 _na     178_aa O-acetyl-ADP-ribose deacetylase
3726 JAMGTI010000124.1 GCA030180725_00294 CDS open 1598-2113 _na     171_aa ParB/Sulfiredoxin domain-containing protein
3727 JAMGTI010000124.1 GCA030180725_00295 CDS open 2100-3374 _na     424_aa Phosphoadenosine phosphosulphate reductase domain-containing protein
3728 JAMGTI010000124.1 GCA030180725_00293 gene open 509-1045
3729 JAMGTI010000124.1 GCA030180725_00294 gene open 1598-2113
3730 JAMGTI010000124.1 GCA030180725_00295 gene open 2100-3374
3731 JAMGTI010000125.1 GCA030180725_00296 CDS open 191-904 _na     237_aa Transposase
3732 JAMGTI010000125.1 GCA030180725_00297 CDS open 944-1366 _na     140_aa Transposase IS116/IS110/IS902 C-terminal domain-containing protein
3733 JAMGTI010000125.1 GCA030180725_00298 CDS open 1533-3338 _na     601_aa hypothetical protein
3734 JAMGTI010000125.1 GCA030180725_00296 gene open 191-904
3735 JAMGTI010000125.1 GCA030180725_00297 gene open 944-1366
3736 JAMGTI010000125.1 GCA030180725_00298 gene open 1533-3338
3737 JAMGTI010000126.1 GCA030180725_00299 CDS open 259-483 _na     74_aa YadA-like C-terminal domain protein
3738 JAMGTI010000126.1 GCA030180725_00300 CDS open 735-2450 _na     571_aa Hemolysin secretion/activation protein%2C ShlB/FhaC/HecB family
3739 JAMGTI010000126.1 GCA030180725_00299 gene open 259-483
3740 JAMGTI010000126.1 GCA030180725_00300 gene open 735-2450
3741 JAMGTI010000127.1 GCA030180725_00301 CDS open 8-1216 _na     402_aa dpaL diaminopropionate ammonia-lyase
3742 JAMGTI010000127.1 GCA030180725_00302 CDS open 1231-2415 _na     394_aa ygeY YgeY family selenium metabolism-linked hydrolase
3743 JAMGTI010000127.1 GCA030180725_00301 gene open 8-1216 dpaL
3744 JAMGTI010000127.1 GCA030180725_00302 gene open 1231-2415 ygeY
3745 JAMGTI010000128.1 GCA030180725_00303 CDS open 6-1304 _na     432_aa ATP-binding protein
3746 JAMGTI010000128.1 GCA030180725_00304 CDS open 1405-1962 _na     185_aa GNAT family acetyltransferase
3747 JAMGTI010000128.1 GCA030180725_00305 CDS open 1959-2696 _na     245_aa Glutamine amidotransferase
3748 JAMGTI010000128.1 GCA030180725_00306 CDS open 2762-3316 _na     184_aa Cupin domain-containing protein
3749 JAMGTI010000128.1 GCA030180725_00303 gene open 6-1304
3750 JAMGTI010000128.1 GCA030180725_00304 gene open 1405-1962
3751 JAMGTI010000128.1 GCA030180725_00305 gene open 1959-2696
3752 JAMGTI010000128.1 GCA030180725_00306 gene open 2762-3316
3753 JAMGTI010000129.1 GCA030180725_00307 CDS open 1574-2947 _na     457_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
3754 JAMGTI010000129.1 GCA030180725_00308 CDS open 2961-3359 _na     132_aa hypothetical protein
3755 JAMGTI010000129.1 GCA030180725_00307 gene open 1574-2947 mnmE
3756 JAMGTI010000129.1 GCA030180725_00308 gene open 2961-3359
3757 JAMGTI010000130.1 GCA030180725_00335 CDS open 238-1116 _na     292_aa ATPase AAA-type core domain-containing protein
3758 JAMGTI010000130.1 GCA030180725_00336 CDS open 1120-2076 _na     318_aa RloB-like protein
3759 JAMGTI010000130.1 GCA030180725_00337 CDS open 2183-3076 _na     297_aa DUF6602 domain-containing protein
3760 JAMGTI010000130.1 GCA030180725_00335 gene open 238-1116
3761 JAMGTI010000130.1 GCA030180725_00336 gene open 1120-2076
3762 JAMGTI010000130.1 GCA030180725_00337 gene open 2183-3076
3763 JAMGTI010000131.1 GCA030180725_00338 CDS open 65-1549 _na     494_aa HTH cro/C1-type domain-containing protein
3764 JAMGTI010000131.1 GCA030180725_00339 CDS open 1611-3170 _na     519_aa Coenzyme A transferase
3765 JAMGTI010000131.1 GCA030180725_00338 gene open 65-1549
3766 JAMGTI010000131.1 GCA030180725_00339 gene open 1611-3170
3767 JAMGTI010000132.1 GCA030180725_00340 CDS open 123-938 _na     271_aa hypothetical protein
3768 JAMGTI010000132.1 GCA030180725_00341 CDS open 964-1728 _na     254_aa Lipopolysaccharide biosynthesis protein
3769 JAMGTI010000132.1 GCA030180725_00342 CDS open 1704-2462 _na     252_aa Polysaccharide deacetylase
3770 JAMGTI010000132.1 GCA030180725_00343 CDS open 2479-3177 _na     232_aa hypothetical protein
3771 JAMGTI010000132.1 GCA030180725_00340 gene open 123-938
3772 JAMGTI010000132.1 GCA030180725_00341 gene open 964-1728
3773 JAMGTI010000132.1 GCA030180725_00342 gene open 1704-2462
3774 JAMGTI010000132.1 GCA030180725_00343 gene open 2479-3177
3775 JAMGTI010000133.1 GCA030180725_00344 CDS open 64-288 _na     74_aa hypothetical protein
3776 JAMGTI010000133.1 GCA030180725_00345 CDS open 412-1611 _na     399_aa Spermidine/putrescine ABC transporter substrate-binding protein
3777 JAMGTI010000133.1 GCA030180725_00346 CDS open 1608-2300 _na     230_aa CobW/HypB/UreG nucleotide-binding domain-containing protein
3778 JAMGTI010000133.1 GCA030180725_00347 CDS open 2301-3125 _na     274_aa ABC transporter%2C ATP-binding protein
3779 JAMGTI010000133.1 GCA030180725_00344 gene open 64-288
3780 JAMGTI010000133.1 GCA030180725_00345 gene open 412-1611
3781 JAMGTI010000133.1 GCA030180725_00346 gene open 1608-2300
3782 JAMGTI010000133.1 GCA030180725_00347 gene open 2301-3125
3783 JAMGTI010000134.1 GCA030180725_00348 CDS open 42-425 _na     127_aa hypothetical protein
3784 JAMGTI010000134.1 GCA030180725_00350 CDS open 752-1450 _na     232_aa DNA alkylation repair protein
3785 JAMGTI010000134.1 GCA030180725_00351 CDS open 1447-2310 _na     287_aa phzF Phenazine biosynthesis protein PhzF
3786 JAMGTI010000134.1 GCA030180725_00352 CDS open 2324-2968 _na     214_aa Peptidase S24-like protein
3787 JAMGTI010000134.1 GCA030180725_00348 gene open 42-425
3788 JAMGTI010000134.1 GCA030180725_00350 gene open 752-1450
3789 JAMGTI010000134.1 GCA030180725_00351 gene open 1447-2310 phzF
3790 JAMGTI010000134.1 GCA030180725_00352 gene open 2324-2968
3791 JAMGTI010000134.1 GCA030180725_00349 gene open 584-660 trnR
3792 JAMGTI010000134.1 GCA030180725_00349 tRNA open 584-660 trnR tRNA-Arg(acg)
3793 JAMGTI010000135.1 GCA030180725_00353 CDS open 343-918 _na     191_aa DUF4375 domain-containing protein
3794 JAMGTI010000135.1 GCA030180725_00354 CDS open 948-1388 _na     146_aa PF10020 family protein
3795 JAMGTI010000135.1 GCA030180725_00355 CDS open 1425-2042 _na     205_aa hypothetical protein
3796 JAMGTI010000135.1 GCA030180725_00356 CDS open 2063-2188 _na     41_aa hypothetical protein
3797 JAMGTI010000135.1 GCA030180725_00357 CDS open 2397-2849 _na     150_aa SMI1/KNR4 family protein
3798 JAMGTI010000135.1 GCA030180725_00353 gene open 343-918
3799 JAMGTI010000135.1 GCA030180725_00354 gene open 948-1388
3800 JAMGTI010000135.1 GCA030180725_00355 gene open 1425-2042
3801 JAMGTI010000135.1 GCA030180725_00356 gene open 2063-2188
3802 JAMGTI010000135.1 GCA030180725_00357 gene open 2397-2849
3803 JAMGTI010000136.1 regulatory_region open 27-202 Cobalamin riboswitch aptamer
3804 JAMGTI010000136.1 GCA030180725_00358 CDS open 329-2872 _na     847_aa Autotransporter outer membrane beta-barrel domain-containing protein
3805 JAMGTI010000136.1 GCA030180725_00358 gene open 329-2872
3806 JAMGTI010000137.1 GCA030180725_00359 CDS open 361-837 _na     158_aa Competence protein ComGF
3807 JAMGTI010000137.1 GCA030180725_00360 CDS open 851-1417 _na     188_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3808 JAMGTI010000137.1 GCA030180725_00361 CDS open 1398-1790 _na     130_aa Type II secretion system protein
3809 JAMGTI010000137.1 GCA030180725_00362 CDS open 1787-2230 _na     147_aa Prepilin peptidase
3810 JAMGTI010000137.1 GCA030180725_00363 CDS open 2215-2688 _na     157_aa Prepilin-type cleavage/methylation N-terminal domain protein
3811 JAMGTI010000137.1 GCA030180725_00359 gene open 361-837
3812 JAMGTI010000137.1 GCA030180725_00360 gene open 851-1417
3813 JAMGTI010000137.1 GCA030180725_00361 gene open 1398-1790
3814 JAMGTI010000137.1 GCA030180725_00362 gene open 1787-2230
3815 JAMGTI010000137.1 GCA030180725_00363 gene open 2215-2688
3816 JAMGTI010000138.1 GCA030180725_00364 CDS open 442-1122 _na     226_aa CRISPR-associated RAMP protein
3817 JAMGTI010000138.1 GCA030180725_00365 CDS open 1217-2749 _na     510_aa hypothetical protein
3818 JAMGTI010000138.1 GCA030180725_00364 gene open 442-1122
3819 JAMGTI010000138.1 GCA030180725_00365 gene open 1217-2749
3820 JAMGTI010000139.1 GCA030180725_00366 CDS open 341-2158 _na     605_aa htpG molecular chaperone HtpG
3821 JAMGTI010000139.1 GCA030180725_00367 CDS open 2293-2517 _na     74_aa relB type II toxin-antitoxin system RelB family antitoxin
3822 JAMGTI010000139.1 GCA030180725_00368 CDS open 2518-2787 _na     89_aa relE Addiction module toxin RelE
3823 JAMGTI010000139.1 GCA030180725_00366 gene open 341-2158 htpG
3824 JAMGTI010000139.1 GCA030180725_00367 gene open 2293-2517 relB
3825 JAMGTI010000139.1 GCA030180725_00368 gene open 2518-2787 relE
3826 JAMGTI010000140.1 GCA030180725_00404 CDS open 47-304 _na     85_aa hypothetical protein
3827 JAMGTI010000140.1 GCA030180725_00405 CDS open 318-782 _na     154_aa Toxin secretion/phage lysis holin
3828 JAMGTI010000140.1 GCA030180725_00406 CDS open 795-1244 _na     149_aa PF07087 family protein
3829 JAMGTI010000140.1 GCA030180725_00407 CDS open 1253-1537 _na     94_aa Phage holin%2C LL-H family
3830 JAMGTI010000140.1 GCA030180725_00408 CDS open 1551-2015 _na     154_aa M15 family metallopeptidase
3831 JAMGTI010000140.1 GCA030180725_00409 CDS open 2025-2687 _na     220_aa DUF4376 domain-containing protein
3832 JAMGTI010000140.1 GCA030180725_00404 gene open 47-304
3833 JAMGTI010000140.1 GCA030180725_00405 gene open 318-782
3834 JAMGTI010000140.1 GCA030180725_00406 gene open 795-1244
3835 JAMGTI010000140.1 GCA030180725_00407 gene open 1253-1537
3836 JAMGTI010000140.1 GCA030180725_00408 gene open 1551-2015
3837 JAMGTI010000140.1 GCA030180725_00409 gene open 2025-2687
3838 JAMGTI010000141.1 GCA030180725_00410 CDS open 136-549 _na     137_aa hypothetical protein
3839 JAMGTI010000141.1 GCA030180725_00411 CDS open 555-983 _na     142_aa PH domain-containing protein
3840 JAMGTI010000141.1 GCA030180725_00412 CDS open 1121-1330 _na     69_aa DUF3307 domain-containing protein
3841 JAMGTI010000141.1 GCA030180725_00413 CDS open 1327-1848 _na     173_aa PF11750 family protein
3842 JAMGTI010000141.1 GCA030180725_00414 CDS open 1845-2633 _na     262_aa Guanylate cyclase domain-containing protein
3843 JAMGTI010000141.1 GCA030180725_00410 gene open 136-549
3844 JAMGTI010000141.1 GCA030180725_00411 gene open 555-983
3845 JAMGTI010000141.1 GCA030180725_00412 gene open 1121-1330
3846 JAMGTI010000141.1 GCA030180725_00413 gene open 1327-1848
3847 JAMGTI010000141.1 GCA030180725_00414 gene open 1845-2633
3848 JAMGTI010000142.1 GCA030180725_00415 CDS open 32-412 _na     126_aa DUF454 domain-containing protein
3849 JAMGTI010000142.1 GCA030180725_00416 CDS open 441-1049 _na     202_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
3850 JAMGTI010000142.1 GCA030180725_00417 CDS open 1052-1438 _na     128_aa exbD Biopolymer transporter ExbD
3851 JAMGTI010000142.1 GCA030180725_00418 CDS open 1451-2188 _na     245_aa tonB Energy transducer TonB
3852 JAMGTI010000142.1 GCA030180725_00419 CDS open 2219-2677 _na     152_aa DUF2147 domain-containing protein
3853 JAMGTI010000142.1 GCA030180725_00415 gene open 32-412
3854 JAMGTI010000142.1 GCA030180725_00416 gene open 441-1049
3855 JAMGTI010000142.1 GCA030180725_00417 gene open 1052-1438 exbD
3856 JAMGTI010000142.1 GCA030180725_00418 gene open 1451-2188 tonB
3857 JAMGTI010000142.1 GCA030180725_00419 gene open 2219-2677
3858 JAMGTI010000143.1 GCA030180725_00420 CDS open 9-776 _na     255_aa cobM precorrin-4 C(11)-methyltransferase
3859 JAMGTI010000143.1 GCA030180725_00421 CDS open 755-1477 _na     240_aa cobI precorrin-2 C(20)-methyltransferase
3860 JAMGTI010000143.1 GCA030180725_00422 CDS open 1495-2493 _na     332_aa Cell filamentation protein Fic
3861 JAMGTI010000143.1 GCA030180725_00420 gene open 9-776 cobM
3862 JAMGTI010000143.1 GCA030180725_00421 gene open 755-1477 cobI
3863 JAMGTI010000143.1 GCA030180725_00422 gene open 1495-2493
3864 JAMGTI010000144.1 GCA030180725_00423 CDS open 96-404 _na     102_aa hypothetical protein
3865 JAMGTI010000144.1 GCA030180725_00424 CDS open 401-1366 _na     321_aa Glycosyltransferase%2C group 2 family protein
3866 JAMGTI010000144.1 GCA030180725_00425 CDS open 1430-2569 _na     379_aa Glycosyltransferase
3867 JAMGTI010000144.1 GCA030180725_00423 gene open 96-404
3868 JAMGTI010000144.1 GCA030180725_00424 gene open 401-1366
3869 JAMGTI010000144.1 GCA030180725_00425 gene open 1430-2569
3870 JAMGTI010000145.1 GCA030180725_00426 CDS open 37-249 _na     70_aa DUF739 domain-containing protein
3871 JAMGTI010000145.1 GCA030180725_00427 CDS open 287-478 _na     63_aa hypothetical protein
3872 JAMGTI010000145.1 GCA030180725_00428 CDS open 455-847 _na     130_aa DUF2513 domain-containing protein
3873 JAMGTI010000145.1 GCA030180725_00429 CDS open 934-1200 _na     88_aa hypothetical protein
3874 JAMGTI010000145.1 GCA030180725_00430 CDS open 1197-1394 _na     65_aa DNA binding domain%2C excisionase family
3875 JAMGTI010000145.1 GCA030180725_00431 CDS open 1500-1766 _na     88_aa hypothetical protein
3876 JAMGTI010000145.1 GCA030180725_00432 CDS open 1744-1908 _na     54_aa TMhelix containing protein
3877 JAMGTI010000145.1 GCA030180725_00433 CDS open 1916-2608 _na     230_aa hypothetical protein
3878 JAMGTI010000145.1 GCA030180725_00426 gene open 37-249
3879 JAMGTI010000145.1 GCA030180725_00427 gene open 287-478
3880 JAMGTI010000145.1 GCA030180725_00428 gene open 455-847
3881 JAMGTI010000145.1 GCA030180725_00429 gene open 934-1200
3882 JAMGTI010000145.1 GCA030180725_00430 gene open 1197-1394
3883 JAMGTI010000145.1 GCA030180725_00431 gene open 1500-1766
3884 JAMGTI010000145.1 GCA030180725_00432 gene open 1744-1908
3885 JAMGTI010000145.1 GCA030180725_00433 gene open 1916-2608
3886 JAMGTI010000146.1 GCA030180725_00434 CDS open 36-851 _na     271_aa PI-PLC Y-box domain-containing protein
3887 JAMGTI010000146.1 GCA030180725_00435 CDS open 1208-2461 _na     417_aa Serine hydroxymethyltransferase
3888 JAMGTI010000146.1 GCA030180725_00434 gene open 36-851
3889 JAMGTI010000146.1 GCA030180725_00435 gene open 1208-2461
3890 JAMGTI010000147.1 GCA030180725_00436 CDS open 137-754 _na     205_aa L-lysine permease
3891 JAMGTI010000147.1 GCA030180725_00437 CDS open 989-1774 _na     261_aa murI glutamate racemase
3892 JAMGTI010000147.1 GCA030180725_00438 CDS open 1787-2407 _na     206_aa MBL fold hydrolase
3893 JAMGTI010000147.1 GCA030180725_00436 gene open 137-754
3894 JAMGTI010000147.1 GCA030180725_00437 gene open 989-1774 murI
3895 JAMGTI010000147.1 GCA030180725_00438 gene open 1787-2407
3896 JAMGTI010000148.1 GCA030180725_00439 CDS open 75-464 _na     129_aa hypothetical protein
3897 JAMGTI010000148.1 GCA030180725_00440 CDS open 442-1035 _na     197_aa pilN Fimbrial assembly protein PilN
3898 JAMGTI010000148.1 GCA030180725_00441 CDS open 1004-2263 _na     419_aa gspD General secretion pathway protein GspD
3899 JAMGTI010000148.1 GCA030180725_00439 gene open 75-464
3900 JAMGTI010000148.1 GCA030180725_00440 gene open 442-1035 pilN
3901 JAMGTI010000148.1 GCA030180725_00441 gene open 1004-2263 gspD
3902 JAMGTI010000149.1 GCA030180725_00442 CDS open 193-450 _na     85_aa hypothetical protein
3903 JAMGTI010000149.1 GCA030180725_00443 CDS open 460-936 _na     158_aa hypothetical protein
3904 JAMGTI010000149.1 GCA030180725_00444 CDS open 941-1312 _na     123_aa Peptidase M15
3905 JAMGTI010000149.1 GCA030180725_00445 CDS open 1394-2080 _na     228_aa DUF4376 domain-containing protein
3906 JAMGTI010000149.1 GCA030180725_00442 gene open 193-450
3907 JAMGTI010000149.1 GCA030180725_00443 gene open 460-936
3908 JAMGTI010000149.1 GCA030180725_00444 gene open 941-1312
3909 JAMGTI010000149.1 GCA030180725_00445 gene open 1394-2080
3910 JAMGTI010000151.1 GCA030180725_00479 CDS open 151-2001 _na     616_aa DEAD/DEAH box helicase
3911 JAMGTI010000151.1 GCA030180725_00479 gene open 151-2001
3912 JAMGTI010000152.1 GCA030180725_00480 CDS open 234-1259 _na     341_aa site-specific integrase
3913 JAMGTI010000152.1 GCA030180725_00481 CDS open 1386-2012 _na     208_aa Abi family protein
3914 JAMGTI010000152.1 GCA030180725_00480 gene open 234-1259
3915 JAMGTI010000152.1 GCA030180725_00481 gene open 1386-2012
3916 JAMGTI010000153.1 GCA030180725_00482 CDS open 694-2034 _na     446_aa nox H2O-forming NADH oxidase
3917 JAMGTI010000153.1 GCA030180725_00482 gene open 694-2034 nox
3918 JAMGTI010000154.1 GCA030180725_00483 CDS open 49-489 _na     146_aa hypothetical protein
3919 JAMGTI010000154.1 GCA030180725_00484 CDS open 492-692 _na     66_aa hypothetical protein
3920 JAMGTI010000154.1 GCA030180725_00485 CDS open 860-2035 _na     391_aa Multidrug transporter
3921 JAMGTI010000154.1 GCA030180725_00483 gene open 49-489
3922 JAMGTI010000154.1 GCA030180725_00484 gene open 492-692
3923 JAMGTI010000154.1 GCA030180725_00485 gene open 860-2035
3924 JAMGTI010000155.1 GCA030180725_00486 CDS open 950-1918 _na     322_aa Site-specific recombinase%2C phage integrase family
3925 JAMGTI010000155.1 GCA030180725_00486 gene open 950-1918
3926 JAMGTI010000156.1 GCA030180725_00487 CDS open 139-681 _na     180_aa RNA polymerase sigma-70 region 4 domain-containing protein
3927 JAMGTI010000156.1 GCA030180725_00488 CDS open 692-1027 _na     111_aa dUTPase
3928 JAMGTI010000156.1 GCA030180725_00489 CDS open 1032-1787 _na     251_aa Putative lactococcus phage M3 protein
3929 JAMGTI010000156.1 GCA030180725_00490 CDS open 1771-1968 _na     65_aa YARHG domain-containing protein
3930 JAMGTI010000156.1 GCA030180725_00487 gene open 139-681
3931 JAMGTI010000156.1 GCA030180725_00488 gene open 692-1027
3932 JAMGTI010000156.1 GCA030180725_00489 gene open 1032-1787
3933 JAMGTI010000156.1 GCA030180725_00490 gene open 1771-1968
3934 JAMGTI010000157.1 GCA030180725_00491 CDS open 54-749 _na     231_aa Methyltransferase
3935 JAMGTI010000157.1 GCA030180725_00492 CDS open 822-1685 _na     287_aa Membrane protein
3936 JAMGTI010000157.1 GCA030180725_00493 CDS open 1688-1789 _na     33_aa hypothetical protein
3937 JAMGTI010000157.1 GCA030180725_00491 gene open 54-749
3938 JAMGTI010000157.1 GCA030180725_00492 gene open 822-1685
3939 JAMGTI010000157.1 GCA030180725_00493 gene open 1688-1789
3940 JAMGTI010000158.1 GCA030180725_00494 CDS open 270-1811 _na     513_aa abgT AbgT transporter family
3941 JAMGTI010000158.1 GCA030180725_00494 gene open 270-1811 abgT
3942 JAMGTI010000159.1 GCA030180725_00495 CDS open 29-601 _na     190_aa 4Fe-4S ferredoxin-type domain-containing protein
3943 JAMGTI010000159.1 GCA030180725_00496 CDS open 608-1732 _na     374_aa tRNA ligase
3944 JAMGTI010000159.1 GCA030180725_00495 gene open 29-601
3945 JAMGTI010000159.1 GCA030180725_00496 gene open 608-1732
3946 JAMGTI010000160.1 GCA030180725_00525 CDS open 69-530 _na     153_aa IAA acetyltransferase
3947 JAMGTI010000160.1 GCA030180725_00526 CDS open 586-1128 _na     180_aa ClbS/DfsB family four-helix bundle protein
3948 JAMGTI010000160.1 GCA030180725_00525 gene open 69-530
3949 JAMGTI010000160.1 GCA030180725_00526 gene open 586-1128
3950 JAMGTI010000161.1 repeat_region open 1071-1575 CRISPR array with 8 repeats of length 30%2C consensus sequence ATTTACATTCTACTTTAGTAATACTCTAAT and spacer length 36
3951 JAMGTI010000162.1 GCA030180725_00527 CDS open 311-1330 _na     339_aa C4-dicarboxylate ABC transporter
3952 JAMGTI010000162.1 GCA030180725_00527 gene open 311-1330
3953 JAMGTI010000163.1 GCA030180725_00528 CDS open 171-1469 _na     432_aa M18 family aminopeptidase
3954 JAMGTI010000163.1 GCA030180725_00528 gene open 171-1469
3955 JAMGTI010000164.1 GCA030180725_00529 CDS open 44-1477 _na     477_aa Amino acid carrier protein
3956 JAMGTI010000164.1 GCA030180725_00529 gene open 44-1477
3957 JAMGTI010000165.1 GCA030180725_00530 CDS open 324-803 _na     159_aa helix-turn-helix transcriptional regulator
3958 JAMGTI010000165.1 GCA030180725_00531 CDS open 954-1148 _na     64_aa Cro/C1-type HTH DNA-binding domain protein
3959 JAMGTI010000165.1 GCA030180725_00532 CDS open 1157-1336 _na     59_aa hypothetical protein
3960 JAMGTI010000165.1 GCA030180725_00530 gene open 324-803
3961 JAMGTI010000165.1 GCA030180725_00531 gene open 954-1148
3962 JAMGTI010000165.1 GCA030180725_00532 gene open 1157-1336
3963 JAMGTI010000166.1 GCA030180725_00533 CDS open 45-404 _na     119_aa YokE-like PH domain-containing protein
3964 JAMGTI010000166.1 GCA030180725_00534 CDS open 631-1014 _na     127_aa Putative superoxide reductase
3965 JAMGTI010000166.1 GCA030180725_00535 CDS open 1035-1460 _na     141_aa Ferric uptake regulator family protein
3966 JAMGTI010000166.1 GCA030180725_00533 gene open 45-404
3967 JAMGTI010000166.1 GCA030180725_00534 gene open 631-1014
3968 JAMGTI010000166.1 GCA030180725_00535 gene open 1035-1460
3969 JAMGTI010000167.1 GCA030180725_00536 CDS open 22-849 _na     275_aa Bacterial type II secretion system protein E domain-containing protein
3970 JAMGTI010000167.1 GCA030180725_00536 gene open 22-849
3971 JAMGTI010000168.1 GCA030180725_00537 CDS open 111-1355 _na     414_aa gltS sodium/glutamate symporter
3972 JAMGTI010000168.1 GCA030180725_00537 gene open 111-1355 gltS
3973 JAMGTI010000169.1 GCA030180725_00538 CDS open 451-936 _na     161_aa FR47-like protein
3974 JAMGTI010000169.1 GCA030180725_00538 gene open 451-936
3975 JAMGTI010000171.1 GCA030180725_00568 CDS open 334-456 _na     40_aa hypothetical protein
3976 JAMGTI010000171.1 GCA030180725_00569 CDS open 453-728 _na     91_aa hypothetical protein
3977 JAMGTI010000171.1 GCA030180725_00570 CDS open 733-843 _na     36_aa hypothetical protein
3978 JAMGTI010000171.1 GCA030180725_00571 CDS open 931-1164 _na     77_aa Transcriptional regulator
3979 JAMGTI010000171.1 GCA030180725_00568 gene open 334-456
3980 JAMGTI010000171.1 GCA030180725_00569 gene open 453-728
3981 JAMGTI010000171.1 GCA030180725_00570 gene open 733-843
3982 JAMGTI010000171.1 GCA030180725_00571 gene open 931-1164
3983 JAMGTI010000172.1 GCA030180725_00572 CDS open 61-1152 _na     363_aa Major outer membrane protein
3984 JAMGTI010000172.1 GCA030180725_00572 gene open 61-1152
3985 JAMGTI010000173.1 GCA030180725_00573 CDS open 40-561 _na     173_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
3986 JAMGTI010000173.1 GCA030180725_00574 CDS open 558-716 _na     52_aa hypothetical protein
3987 JAMGTI010000173.1 GCA030180725_00573 gene open 40-561
3988 JAMGTI010000173.1 GCA030180725_00574 gene open 558-716
3989 JAMGTI010000174.1 GCA030180725_00575 CDS open 161-610 _na     149_aa yebR Free methionine-(R)-sulfoxide reductase YebR
3990 JAMGTI010000174.1 GCA030180725_00576 CDS open 657-1142 _na     161_aa hypothetical protein
3991 JAMGTI010000174.1 GCA030180725_00575 gene open 161-610 yebR
3992 JAMGTI010000174.1 GCA030180725_00576 gene open 657-1142
3993 JAMGTI010000175.1 GCA030180725_00577 CDS open 80-1204 _na     374_aa tetR Transcriptional regulator%2C TetR family
3994 JAMGTI010000175.1 GCA030180725_00577 gene open 80-1204 tetR
3995 JAMGTI010000176.1 GCA030180725_00578 CDS open 71-325 _na     84_aa Addiction module antitoxin%2C RelB/DinJ family
3996 JAMGTI010000176.1 GCA030180725_00579 CDS open 325-588 _na     87_aa Txe/YoeB family addiction module toxin
3997 JAMGTI010000176.1 GCA030180725_00578 gene open 71-325
3998 JAMGTI010000176.1 GCA030180725_00579 gene open 325-588
3999 JAMGTI010000177.1 GCA030180725_00580 CDS open 9-419 _na     136_aa Transcriptional regulator
4000 JAMGTI010000177.1 GCA030180725_00581 CDS open 428-835 _na     135_aa ImmA/IrrE family metallo-endopeptidase