HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_030180765.1)

Select a Genome:
BAKTA Annotations for GCA_030180765.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
84 2432335 2438 9 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5024 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 5024 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JAMGTK010000002.1 GCA030180765_01007 CDS open 125518-125868 _na     116_aa Anti-sigma factor antagonist
502 JAMGTK010000002.1 GCA030180765_01008 CDS open 125893-127458 _na     521_aa rny ribonuclease Y
503 JAMGTK010000002.1 GCA030180765_01009 CDS open 127568-128791 _na     407_aa L-serine ammonia-lyase
504 JAMGTK010000002.1 GCA030180765_01010 CDS open 128796-129701 _na     301_aa Membrane protein
505 JAMGTK010000002.1 GCA030180765_01011 CDS open 129723-130616 _na     297_aa DUF535 domain-containing protein
506 JAMGTK010000002.1 GCA030180765_01012 CDS open 130584-131024 _na     146_aa Membrane protein
507 JAMGTK010000002.1 GCA030180765_01013 CDS open 131036-131797 _na     253_aa Threonine/serine exporter-like N-terminal domain-containing protein
508 JAMGTK010000002.1 GCA030180765_01014 CDS open 131790-132122 _na     110_aa arsR ArsR family transcriptional regulator
509 JAMGTK010000002.1 GCA030180765_01015 CDS open 132238-133893 _na     551_aa Dynamin family protein
510 JAMGTK010000002.1 GCA030180765_01016 CDS open 133875-135302 _na     475_aa dGTP triphosphohydrolase
511 JAMGTK010000002.1 GCA030180765_01017 CDS open 135306-135893 _na     195_aa Redoxin
512 JAMGTK010000002.1 GCA030180765_01018 CDS open 135961-136584 _na     207_aa lysE Lysine transporter LysE
513 JAMGTK010000002.1 GCA030180765_01019 CDS open 136609-137661 _na     350_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
514 JAMGTK010000002.1 GCA030180765_01020 CDS open 137679-138077 _na     132_aa mscL large-conductance mechanosensitive channel protein MscL
515 JAMGTK010000002.1 GCA030180765_01021 CDS open 138384-139403 _na     339_aa Histidine kinase
516 JAMGTK010000002.1 GCA030180765_01022 CDS open 139664-139768 _na     34_aa hypothetical protein
517 JAMGTK010000002.1 GCA030180765_01023 CDS open 139776-142145 _na     789_aa TonB-dependent receptor plug domain protein
518 JAMGTK010000002.1 GCA030180765_01024 CDS open 142160-146251 _na     1363_aa Outer membrane autotransporter barrel domain protein
519 JAMGTK010000002.1 GCA030180765_01025 CDS open 146414-147211 _na     265_aa hydroxymethylpyrimidine kinase
520 JAMGTK010000002.1 GCA030180765_01026 CDS open 147208-147846 _na     212_aa Thiamine-phosphate synthase
521 JAMGTK010000002.1 GCA030180765_01027 CDS open 147830-148378 _na     182_aa thiF sulfur carrier protein ThiS adenylyltransferase ThiF
522 JAMGTK010000002.1 GCA030180765_01028 CDS open 148375-149481 _na     368_aa thiH 2-iminoacetate synthase ThiH
523 JAMGTK010000002.1 GCA030180765_01029 CDS open 149478-150257 _na     259_aa Thiazole synthase
524 JAMGTK010000002.1 GCA030180765_01030 CDS open 150283-150495 _na     70_aa thiS sulfur carrier protein ThiS
525 JAMGTK010000002.1 GCA030180765_01031 CDS open 150665-151129 _na     154_aa PF04463 family protein
526 JAMGTK010000002.1 GCA030180765_01032 CDS open 151302-154820 _na     1172_aa smc chromosome segregation protein SMC
527 JAMGTK010000002.1 GCA030180765_01033 CDS open 154839-155846 _na     335_aa lpxK tetraacyldisaccharide 4'-kinase
528 JAMGTK010000002.1 GCA030180765_01034 CDS open 155843-156403 _na     186_aa HEAT repeat domain-containing protein
529 JAMGTK010000002.1 GCA030180765_01035 CDS open 156412-157023 _na     203_aa Ribonuclease H
530 JAMGTK010000002.1 GCA030180765_01036 CDS open 157036-157713 _na     225_aa TIGR02206 family protein
531 JAMGTK010000002.1 GCA030180765_01037 CDS open 157804-158883 _na     359_aa prfA peptide chain release factor 1
532 JAMGTK010000002.1 GCA030180765_01038 CDS open 158885-159991 _na     368_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
533 JAMGTK010000002.1 GCA030180765_01039 CDS open 159988-160536 _na     182_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
534 JAMGTK010000002.1 GCA030180765_01040 CDS open 160567-161085 _na     172_aa Peptidyl-prolyl cis-trans isomerase
535 JAMGTK010000002.1 GCA030180765_01041 CDS open 161063-161287 _na     74_aa xseB exodeoxyribonuclease VII small subunit
536 JAMGTK010000002.1 GCA030180765_01042 CDS open 161274-162146 _na     290_aa Geranyl transferase
537 JAMGTK010000002.1 GCA030180765_01043 CDS open 162146-163177 _na     343_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
538 JAMGTK010000002.1 GCA030180765_01044 CDS open 163188-165176 _na     662_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
539 JAMGTK010000002.1 GCA030180765_01045 CDS open 165173-166129 _na     318_aa NADH oxidase
540 JAMGTK010000002.1 GCA030180765_01046 CDS open 166116-166811 _na     231_aa Pseudouridine synthase
541 JAMGTK010000002.1 GCA030180765_01047 CDS open 166822-167037 _na     71_aa Lipoprotein
542 JAMGTK010000002.1 GCA030180765_01048 CDS open 167045-168073 _na     342_aa Protein-arginine rhamnosyltransferase
543 JAMGTK010000002.1 GCA030180765_01049 CDS open 168087-168650 _na     187_aa efp elongation factor P
544 JAMGTK010000002.1 GCA030180765_01050 CDS open 168865-169722 _na     285_aa eamA EamA domain-containing protein
545 JAMGTK010000002.1 GCA030180765_01051 CDS open 169771-170709 _na     312_aa UDP-glucose 4-epimerase
546 JAMGTK010000002.1 GCA030180765_01052 CDS open 170706-171074 _na     122_aa Nuclear transport factor 2 family protein
547 JAMGTK010000002.1 GCA030180765_01053 CDS open 171142-171453 _na     103_aa ylxM YlxM family DNA-binding protein
548 JAMGTK010000002.1 GCA030180765_01054 CDS open 171464-172813 _na     449_aa ffh signal recognition particle protein
549 JAMGTK010000002.1 GCA030180765_01055 CDS open 172853-173116 _na     87_aa rpsP 30S ribosomal protein S16
550 JAMGTK010000002.1 GCA030180765_01056 CDS open 173152-174102 _na     316_aa ctlX citrulline utilization hydrolase CtlX
551 JAMGTK010000002.1 GCA030180765_01057 CDS open 174236-174808 _na     190_aa Nitroreductase
552 JAMGTK010000002.1 GCA030180765_01058 CDS open 174964-175467 _na     167_aa Flavodoxin
553 JAMGTK010000002.1 GCA030180765_01059 CDS open 175656-177083 _na     475_aa tnpB RNA-guided endonuclease TnpB family protein
554 JAMGTK010000002.1 GCA030180765_01060 CDS open 177094-177495 _na     133_aa tnpA IS200/IS605 family transposase
555 JAMGTK010000002.1 GCA030180765_00893 gene open 273-1094
556 JAMGTK010000002.1 GCA030180765_00894 gene open 1248-2375
557 JAMGTK010000002.1 GCA030180765_00895 gene open 2674-4491 htpG
558 JAMGTK010000002.1 GCA030180765_00896 gene open 4626-4850 relB
559 JAMGTK010000002.1 GCA030180765_00897 gene open 4851-5120 relE
560 JAMGTK010000002.1 GCA030180765_00898 gene open 5383-6681
561 JAMGTK010000002.1 GCA030180765_00899 gene open 6986-8020
562 JAMGTK010000002.1 GCA030180765_00900 gene open 8053-9054
563 JAMGTK010000002.1 GCA030180765_00901 gene open 9072-9533
564 JAMGTK010000002.1 GCA030180765_00902 gene open 9530-10816
565 JAMGTK010000002.1 GCA030180765_00903 gene open 10833-11618
566 JAMGTK010000002.1 GCA030180765_00904 gene open 11682-12563
567 JAMGTK010000002.1 GCA030180765_00905 gene open 12765-14408
568 JAMGTK010000002.1 GCA030180765_00906 gene open 14415-15488
569 JAMGTK010000002.1 GCA030180765_00907 gene open 15472-16878
570 JAMGTK010000002.1 GCA030180765_00908 gene open 16881-17579
571 JAMGTK010000002.1 GCA030180765_00909 gene open 17596-18354
572 JAMGTK010000002.1 GCA030180765_00910 gene open 18330-19094
573 JAMGTK010000002.1 GCA030180765_00911 gene open 19120-20304
574 JAMGTK010000002.1 GCA030180765_00912 gene open 20430-21392
575 JAMGTK010000002.1 GCA030180765_00913 gene open 21389-22354
576 JAMGTK010000002.1 GCA030180765_00914 gene open 22418-23557
577 JAMGTK010000002.1 GCA030180765_00915 gene open 23773-24708
578 JAMGTK010000002.1 GCA030180765_00916 gene open 24726-25658
579 JAMGTK010000002.1 GCA030180765_00917 gene open 25659-26363
580 JAMGTK010000002.1 GCA030180765_00918 gene open 26418-27311 rfbA
581 JAMGTK010000002.1 GCA030180765_00919 gene open 27290-27865 rfbC
582 JAMGTK010000002.1 GCA030180765_00920 gene open 27862-28701 rfbD
583 JAMGTK010000002.1 GCA030180765_00921 gene open 28698-29798 rfbB
584 JAMGTK010000002.1 GCA030180765_00922 gene open 29816-30184
585 JAMGTK010000002.1 GCA030180765_00923 gene open 30195-30380
586 JAMGTK010000002.1 GCA030180765_00924 gene open 30385-30747
587 JAMGTK010000002.1 GCA030180765_00925 gene open 30900-31145
588 JAMGTK010000002.1 GCA030180765_00926 gene open 31256-31549
589 JAMGTK010000002.1 GCA030180765_00927 gene open 31570-32244
590 JAMGTK010000002.1 GCA030180765_00928 gene open 32241-32558
591 JAMGTK010000002.1 GCA030180765_00929 gene open 32708-33436
592 JAMGTK010000002.1 GCA030180765_00930 gene open 33722-34234 infC
593 JAMGTK010000002.1 GCA030180765_00931 gene open 34285-34491 rpmI
594 JAMGTK010000002.1 GCA030180765_00932 gene open 34509-34859 rplT
595 JAMGTK010000002.1 GCA030180765_00933 gene open 34931-35614 gntR
596 JAMGTK010000002.1 GCA030180765_00934 gene open 35823-36533 gntR
597 JAMGTK010000002.1 GCA030180765_00935 gene open 36885-38465
598 JAMGTK010000002.1 GCA030180765_00936 gene open 38564-38689
599 JAMGTK010000002.1 GCA030180765_00937 gene open 38783-40210
600 JAMGTK010000002.1 GCA030180765_00938 gene open 40300-41436
601 JAMGTK010000002.1 GCA030180765_00939 gene open 41449-42225
602 JAMGTK010000002.1 GCA030180765_00940 gene open 42237-43226
603 JAMGTK010000002.1 GCA030180765_00941 gene open 43379-44767 nhaC
604 JAMGTK010000002.1 GCA030180765_00942 gene open 44785-45537
605 JAMGTK010000002.1 GCA030180765_00943 gene open 45540-46316
606 JAMGTK010000002.1 GCA030180765_00944 gene open 46316-47128
607 JAMGTK010000002.1 GCA030180765_00945 gene open 47118-48083
608 JAMGTK010000002.1 GCA030180765_00946 gene open 48100-49641
609 JAMGTK010000002.1 GCA030180765_00947 gene open 49735-50181 dtd
610 JAMGTK010000002.1 GCA030180765_00948 gene open 50371-51879
611 JAMGTK010000002.1 GCA030180765_00949 gene open 51889-52803
612 JAMGTK010000002.1 GCA030180765_00950 gene open 52778-53179 nusG
613 JAMGTK010000002.1 GCA030180765_00951 gene open 53183-54316
614 JAMGTK010000002.1 GCA030180765_00952 gene open 54300-55457
615 JAMGTK010000002.1 GCA030180765_00953 gene open 55441-56103 fliJ
616 JAMGTK010000002.1 GCA030180765_00954 gene open 56125-57432
617 JAMGTK010000002.1 GCA030180765_00955 gene open 57479-58375 ftcD
618 JAMGTK010000002.1 GCA030180765_00956 gene open 58386-59612 hutI
619 JAMGTK010000002.1 GCA030180765_00957 gene open 59622-60263
620 JAMGTK010000002.1 GCA030180765_00958 gene open 60302-60748
621 JAMGTK010000002.1 GCA030180765_00959 gene open 60916-61782
622 JAMGTK010000002.1 GCA030180765_00960 gene open 61787-62833 mreB
623 JAMGTK010000002.1 GCA030180765_00961 gene open 62850-64478
624 JAMGTK010000002.1 GCA030180765_00962 gene open 64462-65001 scpB
625 JAMGTK010000002.1 GCA030180765_00963 gene open 64973-65692
626 JAMGTK010000002.1 GCA030180765_00964 gene open 65706-65999 gatC
627 JAMGTK010000002.1 GCA030180765_00965 gene open 66014-67471 gatA
628 JAMGTK010000002.1 GCA030180765_00966 gene open 67487-68929 gatB
629 JAMGTK010000002.1 GCA030180765_00967 gene open 69180-70718
630 JAMGTK010000002.1 GCA030180765_00968 gene open 70771-71652
631 JAMGTK010000002.1 GCA030180765_00969 gene open 71649-72443
632 JAMGTK010000002.1 GCA030180765_00970 gene open 72443-73168
633 JAMGTK010000002.1 GCA030180765_00971 gene open 73181-73963
634 JAMGTK010000002.1 GCA030180765_00972 gene open 74292-75941 lktB
635 JAMGTK010000002.1 GCA030180765_00973 gene open 75957-85646 lktA
636 JAMGTK010000002.1 GCA030180765_00974 gene open 85643-86080 lktC
637 JAMGTK010000002.1 GCA030180765_00976 gene open 86872-87795
638 JAMGTK010000002.1 GCA030180765_00977 gene open 88038-88751
639 JAMGTK010000002.1 GCA030180765_00978 gene open 88883-90175
640 JAMGTK010000002.1 GCA030180765_00979 gene open 90477-92390
641 JAMGTK010000002.1 GCA030180765_00980 gene open 92406-93608
642 JAMGTK010000002.1 GCA030180765_00981 gene open 94245-97982 cobN
643 JAMGTK010000002.1 GCA030180765_00982 gene open 98012-98686
644 JAMGTK010000002.1 GCA030180765_00983 gene open 98634-100013
645 JAMGTK010000002.1 GCA030180765_00984 gene open 100078-100962
646 JAMGTK010000002.1 GCA030180765_00985 gene open 100983-102011
647 JAMGTK010000002.1 GCA030180765_00986 gene open 102008-102778
648 JAMGTK010000002.1 GCA030180765_00987 gene open 102812-103924
649 JAMGTK010000002.1 GCA030180765_00988 gene open 103911-104939
650 JAMGTK010000002.1 GCA030180765_00989 gene open 104936-105496
651 JAMGTK010000002.1 GCA030180765_00990 gene open 105493-105963
652 JAMGTK010000002.1 GCA030180765_00991 gene open 105974-107791
653 JAMGTK010000002.1 GCA030180765_00992 gene open 107794-108849
654 JAMGTK010000002.1 GCA030180765_00993 gene open 109125-110348
655 JAMGTK010000002.1 GCA030180765_00994 gene open 110341-112029
656 JAMGTK010000002.1 GCA030180765_00995 gene open 112244-113914 hcp
657 JAMGTK010000002.1 GCA030180765_00996 gene open 114012-115004
658 JAMGTK010000002.1 GCA030180765_00997 gene open 115243-116055
659 JAMGTK010000002.1 GCA030180765_00998 gene open 116036-116821
660 JAMGTK010000002.1 GCA030180765_00999 gene open 116841-118409
661 JAMGTK010000002.1 GCA030180765_01000 gene open 118458-119282 nikC
662 JAMGTK010000002.1 GCA030180765_01001 gene open 119283-120218 nikB
663 JAMGTK010000002.1 GCA030180765_01002 gene open 120847-122469
664 JAMGTK010000002.1 GCA030180765_01003 gene open 122487-123773 obgE
665 JAMGTK010000002.1 GCA030180765_01004 gene open 123783-124691 miaA
666 JAMGTK010000002.1 GCA030180765_01005 gene open 124727-125113
667 JAMGTK010000002.1 GCA030180765_01006 gene open 125118-125513
668 JAMGTK010000002.1 GCA030180765_01007 gene open 125518-125868
669 JAMGTK010000002.1 GCA030180765_01008 gene open 125893-127458 rny
670 JAMGTK010000002.1 GCA030180765_01009 gene open 127568-128791
671 JAMGTK010000002.1 GCA030180765_01010 gene open 128796-129701
672 JAMGTK010000002.1 GCA030180765_01011 gene open 129723-130616
673 JAMGTK010000002.1 GCA030180765_01012 gene open 130584-131024
674 JAMGTK010000002.1 GCA030180765_01013 gene open 131036-131797
675 JAMGTK010000002.1 GCA030180765_01014 gene open 131790-132122 arsR
676 JAMGTK010000002.1 GCA030180765_01015 gene open 132238-133893
677 JAMGTK010000002.1 GCA030180765_01016 gene open 133875-135302
678 JAMGTK010000002.1 GCA030180765_01017 gene open 135306-135893
679 JAMGTK010000002.1 GCA030180765_01018 gene open 135961-136584 lysE
680 JAMGTK010000002.1 GCA030180765_01019 gene open 136609-137661 mnmA
681 JAMGTK010000002.1 GCA030180765_01020 gene open 137679-138077 mscL
682 JAMGTK010000002.1 GCA030180765_01021 gene open 138384-139403
683 JAMGTK010000002.1 GCA030180765_01022 gene open 139664-139768
684 JAMGTK010000002.1 GCA030180765_01023 gene open 139776-142145
685 JAMGTK010000002.1 GCA030180765_01024 gene open 142160-146251
686 JAMGTK010000002.1 GCA030180765_01025 gene open 146414-147211
687 JAMGTK010000002.1 GCA030180765_01026 gene open 147208-147846
688 JAMGTK010000002.1 GCA030180765_01027 gene open 147830-148378 thiF
689 JAMGTK010000002.1 GCA030180765_01028 gene open 148375-149481 thiH
690 JAMGTK010000002.1 GCA030180765_01029 gene open 149478-150257
691 JAMGTK010000002.1 GCA030180765_01030 gene open 150283-150495 thiS
692 JAMGTK010000002.1 GCA030180765_01031 gene open 150665-151129
693 JAMGTK010000002.1 GCA030180765_01032 gene open 151302-154820 smc
694 JAMGTK010000002.1 GCA030180765_01033 gene open 154839-155846 lpxK
695 JAMGTK010000002.1 GCA030180765_01034 gene open 155843-156403
696 JAMGTK010000002.1 GCA030180765_01035 gene open 156412-157023
697 JAMGTK010000002.1 GCA030180765_01036 gene open 157036-157713
698 JAMGTK010000002.1 GCA030180765_01037 gene open 157804-158883 prfA
699 JAMGTK010000002.1 GCA030180765_01038 gene open 158885-159991 prmC
700 JAMGTK010000002.1 GCA030180765_01039 gene open 159988-160536 rsmD
701 JAMGTK010000002.1 GCA030180765_01040 gene open 160567-161085
702 JAMGTK010000002.1 GCA030180765_01041 gene open 161063-161287 xseB
703 JAMGTK010000002.1 GCA030180765_01042 gene open 161274-162146
704 JAMGTK010000002.1 GCA030180765_01043 gene open 162146-163177 queA
705 JAMGTK010000002.1 GCA030180765_01044 gene open 163188-165176
706 JAMGTK010000002.1 GCA030180765_01045 gene open 165173-166129
707 JAMGTK010000002.1 GCA030180765_01046 gene open 166116-166811
708 JAMGTK010000002.1 GCA030180765_01047 gene open 166822-167037
709 JAMGTK010000002.1 GCA030180765_01048 gene open 167045-168073
710 JAMGTK010000002.1 GCA030180765_01049 gene open 168087-168650 efp
711 JAMGTK010000002.1 GCA030180765_01050 gene open 168865-169722 eamA
712 JAMGTK010000002.1 GCA030180765_01051 gene open 169771-170709
713 JAMGTK010000002.1 GCA030180765_01052 gene open 170706-171074
714 JAMGTK010000002.1 GCA030180765_01053 gene open 171142-171453 ylxM
715 JAMGTK010000002.1 GCA030180765_01054 gene open 171464-172813 ffh
716 JAMGTK010000002.1 GCA030180765_01055 gene open 172853-173116 rpsP
717 JAMGTK010000002.1 GCA030180765_01056 gene open 173152-174102 ctlX
718 JAMGTK010000002.1 GCA030180765_01057 gene open 174236-174808
719 JAMGTK010000002.1 GCA030180765_01058 gene open 174964-175467
720 JAMGTK010000002.1 GCA030180765_01059 gene open 175656-177083 tnpB
721 JAMGTK010000002.1 GCA030180765_01060 gene open 177094-177495 tnpA
722 JAMGTK010000002.1 GCA030180765_00975 gene open 86381-86456 trnT
723 JAMGTK010000002.1 GCA030180765_00975 tRNA open 86381-86456 trnT tRNA-Thr(ggt)
724 JAMGTK010000003.1 regulatory_region open 129784-129959 Cobalamin riboswitch aptamer
725 JAMGTK010000003.1 regulatory_region open 143344-143431 SAM riboswitch aptamer (S box leader)
726 JAMGTK010000003.1 repeat_region open 164269-164509 CRISPR array with 4 repeats of length 32%2C consensus sequence ATTTACATTCTACTTTAGTAATACTCTAATTA and spacer length 34
727 JAMGTK010000003.1 GCA030180765_01378 CDS open 686-2101 _na     471_aa Aspartate ammonia-lyase
728 JAMGTK010000003.1 GCA030180765_01379 CDS open 2094-2711 _na     205_aa cutC PF03932 family protein CutC
729 JAMGTK010000003.1 GCA030180765_01380 CDS open 2733-3293 _na     186_aa DNA polymerase III subunit epsilon
730 JAMGTK010000003.1 GCA030180765_01381 CDS open 3419-4144 _na     241_aa pflA pyruvate formate-lyase-activating protein
731 JAMGTK010000003.1 GCA030180765_01382 CDS open 4171-6402 _na     743_aa pflB formate C-acetyltransferase
732 JAMGTK010000003.1 GCA030180765_01383 CDS open 6611-7735 _na     374_aa tRNA ligase
733 JAMGTK010000003.1 GCA030180765_01384 CDS open 7742-8314 _na     190_aa 4Fe-4S ferredoxin-type domain-containing protein
734 JAMGTK010000003.1 GCA030180765_01385 CDS open 8754-10295 _na     513_aa abgT AbgT transporter family
735 JAMGTK010000003.1 GCA030180765_01386 CDS open 10480-10758 _na     92_aa N-acetyltransferase
736 JAMGTK010000003.1 GCA030180765_01387 CDS open 10850-11038 _na     62_aa DUF1653 domain-containing protein
737 JAMGTK010000003.1 GCA030180765_01388 CDS open 11205-11969 _na     254_aa PHP domain protein
738 JAMGTK010000003.1 GCA030180765_01389 CDS open 11984-12850 _na     288_aa Transporter
739 JAMGTK010000003.1 GCA030180765_01390 CDS open 12860-13543 _na     227_aa FCD domain protein
740 JAMGTK010000003.1 GCA030180765_01391 CDS open 13735-15060 _na     441_aa Transporter
741 JAMGTK010000003.1 GCA030180765_01392 CDS open 15302-16702 _na     466_aa tyrosine phenol-lyase
742 JAMGTK010000003.1 GCA030180765_01393 CDS open 17037-18755 _na     572_aa ABC transporter ATP-binding protein
743 JAMGTK010000003.1 GCA030180765_01394 CDS open 18748-20493 _na     581_aa ABC transporter ATP-binding protein
744 JAMGTK010000003.1 GCA030180765_01395 CDS open 20607-21596 _na     329_aa Transcriptional regulator
745 JAMGTK010000003.1 GCA030180765_01396 CDS open 21738-22340 _na     200_aa coaE dephospho-CoA kinase
746 JAMGTK010000003.1 GCA030180765_01397 CDS open 22312-24480 _na     722_aa Peptidase%2C U32 family
747 JAMGTK010000003.1 GCA030180765_01398 CDS open 24482-24985 _na     167_aa Phosphatidylglycerophosphatase A
748 JAMGTK010000003.1 GCA030180765_01399 CDS open 24998-26206 _na     402_aa CinA-like protein
749 JAMGTK010000003.1 GCA030180765_01400 CDS open 26210-26758 _na     182_aa Cupin domain protein
750 JAMGTK010000003.1 GCA030180765_01401 CDS open 26783-29308 _na     841_aa dhaL DhaL domain-containing protein
751 JAMGTK010000003.1 GCA030180765_01402 CDS open 29372-30301 _na     309_aa CBS domain protein
752 JAMGTK010000003.1 GCA030180765_01403 CDS open 30316-31590 _na     424_aa Citrate transporter-like domain-containing protein
753 JAMGTK010000003.1 GCA030180765_01404 CDS open 31600-32637 _na     345_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
754 JAMGTK010000003.1 GCA030180765_01405 CDS open 32634-34655 _na     673_aa ligA NAD-dependent DNA ligase LigA
755 JAMGTK010000003.1 GCA030180765_01406 CDS open 34713-37382 _na     889_aa secA preprotein translocase subunit SecA
756 JAMGTK010000003.1 GCA030180765_01407 CDS open 37403-38143 _na     246_aa Lipoprotein
757 JAMGTK010000003.1 GCA030180765_01408 CDS open 38215-39033 _na     272_aa PHP domain protein
758 JAMGTK010000003.1 GCA030180765_01409 CDS open 39036-40034 _na     332_aa rfaD ADP-glyceromanno-heptose 6-epimerase
759 JAMGTK010000003.1 GCA030180765_01410 CDS open 40044-40865 _na     273_aa undecaprenyl-diphosphate phosphatase
760 JAMGTK010000003.1 GCA030180765_01411 CDS open 40875-42218 _na     447_aa MATE efflux family protein
761 JAMGTK010000003.1 GCA030180765_01412 CDS open 42281-43498 _na     405_aa Aminotransferase
762 JAMGTK010000003.1 GCA030180765_01413 CDS open 43744-45819 _na     691_aa Cadmium-exporting ATPase
763 JAMGTK010000003.1 GCA030180765_01414 CDS open 45947-46570 _na     207_aa Hemolysin D
764 JAMGTK010000003.1 GCA030180765_01415 CDS open 46687-47274 _na     195_aa Cytidylate kinase
765 JAMGTK010000003.1 GCA030180765_01416 CDS open 47299-47778 _na     159_aa hypothetical protein
766 JAMGTK010000003.1 GCA030180765_01417 CDS open 47791-49551 _na     586_aa Metallopeptidase family M24
767 JAMGTK010000003.1 GCA030180765_01418 CDS open 49569-51377 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
768 JAMGTK010000003.1 GCA030180765_01419 CDS open 51482-52372 _na     296_aa thrB homoserine kinase
769 JAMGTK010000003.1 GCA030180765_01420 CDS open 52360-53817 _na     485_aa thrC threonine synthase
770 JAMGTK010000003.1 GCA030180765_01421 CDS open 53919-55037 _na     372_aa Homoserine dehydrogenase
771 JAMGTK010000003.1 GCA030180765_01422 CDS open 55034-56371 _na     445_aa aspartate kinase
772 JAMGTK010000003.1 GCA030180765_01423 CDS open 56368-57336 _na     322_aa aspartate-semialdehyde dehydrogenase
773 JAMGTK010000003.1 GCA030180765_01424 CDS open 57463-58380 _na     305_aa PF03537 domain protein
774 JAMGTK010000003.1 GCA030180765_01425 CDS open 58496-59506 _na     336_aa Electron transfer flavoprotein subunit alpha/FixB family protein
775 JAMGTK010000003.1 GCA030180765_01426 CDS open 59538-60335 _na     265_aa Electron transfer flavoprotein subunit beta
776 JAMGTK010000003.1 GCA030180765_01427 CDS open 60373-61518 _na     381_aa Butyryl-CoA dehydrogenase
777 JAMGTK010000003.1 GCA030180765_01428 CDS open 61738-62661 _na     307_aa AEC family transporter
778 JAMGTK010000003.1 GCA030180765_01429 CDS open 62833-63585 _na     250_aa Ribosomal protein L11 methyltransferase-like protein
779 JAMGTK010000003.1 GCA030180765_01430 CDS open 63572-64327 _na     251_aa Threonine/serine exporter-like N-terminal domain-containing protein
780 JAMGTK010000003.1 GCA030180765_01431 CDS open 64328-64822 _na     164_aa PF12821 family protein
781 JAMGTK010000003.1 GCA030180765_01432 CDS open 64862-65518 _na     218_aa L%2CD-transpeptidase catalytic domain protein
782 JAMGTK010000003.1 GCA030180765_01433 CDS open 65526-66755 _na     409_aa Peptidase%2C U32 family
783 JAMGTK010000003.1 GCA030180765_01434 CDS open 66770-68110 _na     446_aa dnaB replicative DNA helicase
784 JAMGTK010000003.1 GCA030180765_01435 CDS open 68126-68575 _na     149_aa rplI 50S ribosomal protein L9
785 JAMGTK010000003.1 GCA030180765_01436 CDS open 68597-69421 _na     274_aa Membrane protein
786 JAMGTK010000003.1 GCA030180765_01437 CDS open 69418-70824 _na     468_aa dnaX DNA polymerase III subunit gamma/tau
787 JAMGTK010000003.1 GCA030180765_01438 CDS open 70828-72216 _na     462_aa ntrC DNA-binding transcriptional regulator NtrC
788 JAMGTK010000003.1 GCA030180765_01439 CDS open 72233-72994 _na     253_aa tonB Biopolymer transporter TonB
789 JAMGTK010000003.1 GCA030180765_01440 CDS open 73009-73443 _na     144_aa Transport energizing protein%2C ExbD/TolR family
790 JAMGTK010000003.1 GCA030180765_01441 CDS open 73458-74069 _na     203_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
791 JAMGTK010000003.1 GCA030180765_01442 CDS open 74083-74451 _na     122_aa Lipoprotein
792 JAMGTK010000003.1 GCA030180765_01443 CDS open 74469-77216 _na     915_aa ybgF tol-pal system protein YbgF
793 JAMGTK010000003.1 GCA030180765_01444 CDS open 77425-78084 _na     219_aa Suppressor of fused domain protein
794 JAMGTK010000003.1 GCA030180765_01445 CDS open 78296-79303 _na     335_aa Cysteine synthase
795 JAMGTK010000003.1 GCA030180765_01446 CDS open 79513-79977 _na     154_aa YbaK/proline--tRNA ligase associated domain protein
796 JAMGTK010000003.1 GCA030180765_01447 CDS open 80024-80674 _na     216_aa lemA LemA family protein
797 JAMGTK010000003.1 GCA030180765_01448 CDS open 80995-81432 _na     145_aa Membrane protein%2C PF10097 family
798 JAMGTK010000003.1 GCA030180765_01449 CDS open 81401-81607 _na     68_aa Lipoprotein
799 JAMGTK010000003.1 GCA030180765_01450 CDS open 81825-84758 _na     977_aa TonB-dependent receptor
800 JAMGTK010000003.1 GCA030180765_01451 CDS open 84901-85092 _na     63_aa hypothetical protein
801 JAMGTK010000003.1 GCA030180765_01452 CDS open 85716-86687 _na     323_aa oppF Oligopeptide ABC transporter%2C ATP-binding protein OppF
802 JAMGTK010000003.1 GCA030180765_01453 CDS open 86677-87684 _na     335_aa nikD Nickel import system ATP-binding protein NikD
803 JAMGTK010000003.1 GCA030180765_01454 CDS open 87705-88571 _na     288_aa nikC nickel transporter permease
804 JAMGTK010000003.1 GCA030180765_01455 CDS open 88586-89512 _na     308_aa nikB nickel ABC transporter permease
805 JAMGTK010000003.1 GCA030180765_01456 CDS open 89598-91130 _na     510_aa Diguanylate phosphodiesterase
806 JAMGTK010000003.1 GCA030180765_01457 CDS open 91237-92319 _na     360_aa YibE/F-like protein
807 JAMGTK010000003.1 GCA030180765_01458 CDS open 92379-92642 _na     87_aa rpsO 30S ribosomal protein S15
808 JAMGTK010000003.1 GCA030180765_01459 CDS open 92732-94921 _na     729_aa ftsH ATP-dependent zinc metalloprotease FtsH
809 JAMGTK010000003.1 GCA030180765_01460 CDS open 94918-96255 _na     445_aa tRNA(Ile)-lysidine synthase
810 JAMGTK010000003.1 GCA030180765_01461 CDS open 96272-97216 _na     314_aa Endolytic murein transglycosylase
811 JAMGTK010000003.1 GCA030180765_01462 CDS open 97234-98820 _na     528_aa RNA helicase
812 JAMGTK010000003.1 GCA030180765_01463 CDS open 98886-99347 _na     153_aa ywqK Toxin-antitoxin system YwqK family antitoxin
813 JAMGTK010000003.1 GCA030180765_01464 CDS open 99515-100948 _na     477_aa leucyl aminopeptidase
814 JAMGTK010000003.1 GCA030180765_01465 CDS open 101048-102193 _na     381_aa Acetyltransferase
815 JAMGTK010000003.1 GCA030180765_01466 CDS open 102168-102743 _na     191_aa NAD(P)H nitroreductase
816 JAMGTK010000003.1 GCA030180765_01467 CDS open 102951-103211 _na     86_aa rpsT 30S ribosomal protein S20
817 JAMGTK010000003.1 GCA030180765_01468 CDS open 103346-104305 _na     319_aa Electron transporter
818 JAMGTK010000003.1 GCA030180765_01469 CDS open 104319-105044 _na     241_aa Electron transfer flavoprotein
819 JAMGTK010000003.1 GCA030180765_01470 CDS open 105213-106694 _na     493_aa lysS lysine--tRNA ligase
820 JAMGTK010000003.1 GCA030180765_01471 CDS open 106721-107944 _na     407_aa Tetratricopeptide repeat protein
821 JAMGTK010000003.1 GCA030180765_01472 CDS open 107947-108327 _na     126_aa DUF1934 domain-containing protein
822 JAMGTK010000003.1 GCA030180765_01473 CDS open 108327-108656 _na     109_aa DUF1292 domain-containing protein
823 JAMGTK010000003.1 GCA030180765_01474 CDS open 108695-109162 _na     155_aa Ribosomal RNA large subunit methyltransferase H
824 JAMGTK010000003.1 GCA030180765_01475 CDS open 109193-110986 _na     597_aa mutL DNA mismatch repair endonuclease MutL
825 JAMGTK010000003.1 GCA030180765_01476 CDS open 111135-112949 _na     604_aa Tetratricopeptide repeat protein
826 JAMGTK010000003.1 GCA030180765_01477 CDS open 113016-115544 _na     842_aa recJ single-stranded-DNA-specific exonuclease RecJ
827 JAMGTK010000003.1 GCA030180765_01478 CDS open 115800-117089 _na     429_aa Sodium:proton antiporter
828 JAMGTK010000003.1 GCA030180765_01479 CDS open 117083-117967 _na     294_aa lgt prolipoprotein diacylglyceryl transferase
829 JAMGTK010000003.1 GCA030180765_01480 CDS open 118015-119718 _na     567_aa NADH:ubiquinone oxidoreductase
830 JAMGTK010000003.1 GCA030180765_01481 CDS open 119735-121519 _na     594_aa hymB Protein HymB
831 JAMGTK010000003.1 GCA030180765_01482 CDS open 121532-122014 _na     160_aa nuoE NADH-quinone oxidoreductase subunit NuoE
832 JAMGTK010000003.1 GCA030180765_01483 CDS open 122185-123840 _na     551_aa Histidine kinase
833 JAMGTK010000003.1 GCA030180765_01484 CDS open 123827-124603 _na     258_aa DNA-binding response regulator
834 JAMGTK010000003.1 GCA030180765_01485 CDS open 124617-125507 _na     296_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
835 JAMGTK010000003.1 GCA030180765_01486 CDS open 125570-126244 _na     224_aa Redoxin domain-containing protein
836 JAMGTK010000003.1 GCA030180765_01487 CDS open 126284-126937 _na     217_aa ccdA Putative cytochrome C-type biogenesis protein CcdA
837 JAMGTK010000003.1 GCA030180765_01488 CDS open 127114-129657 _na     847_aa Autotransporter outer membrane beta-barrel domain-containing protein
838 JAMGTK010000003.1 GCA030180765_01489 CDS open 130076-130804 _na     242_aa phosphoserine phosphatase
839 JAMGTK010000003.1 GCA030180765_01490 CDS open 130944-131768 _na     274_aa Endonuclease/exonuclease/phosphatase family protein
840 JAMGTK010000003.1 GCA030180765_01491 CDS open 131768-132421 _na     217_aa thiamine diphosphokinase
841 JAMGTK010000003.1 GCA030180765_01492 CDS open 132609-133370 _na     253_aa Nickel transporter
842 JAMGTK010000003.1 GCA030180765_01493 CDS open 133367-133807 _na     146_aa DUF1007 domain-containing protein
843 JAMGTK010000003.1 GCA030180765_01494 CDS open 134070-134453 _na     127_aa Dihydrolipoamide acyltransferase
844 JAMGTK010000003.1 GCA030180765_01495 CDS open 134500-135789 _na     429_aa Uracil permease
845 JAMGTK010000003.1 GCA030180765_01496 CDS open 135804-137579 _na     591_aa pepF oligoendopeptidase F
846 JAMGTK010000003.1 GCA030180765_01497 CDS open 137588-139282 _na     564_aa Signal peptide peptidase SppA%2C 36K type
847 JAMGTK010000003.1 GCA030180765_01498 CDS open 139350-139709 _na     119_aa YbaB/EbfC family nucleoid-associated protein
848 JAMGTK010000003.1 GCA030180765_01499 CDS open 139804-140472 _na     222_aa DUF374 domain-containing protein
849 JAMGTK010000003.1 GCA030180765_01500 CDS open 140465-142405 _na     646_aa metG methionine--tRNA ligase
850 JAMGTK010000003.1 GCA030180765_01501 CDS open 142434-143318 _na     294_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
851 JAMGTK010000003.1 GCA030180765_01502 CDS open 143516-144664 _na     382_aa metK methionine adenosyltransferase
852 JAMGTK010000003.1 GCA030180765_01503 CDS open 144779-145459 _na     226_aa Cupin domain-containing protein
853 JAMGTK010000003.1 GCA030180765_01504 CDS open 145509-146261 _na     250_aa 3-oxoacyl-ACP reductase
854 JAMGTK010000003.1 GCA030180765_01505 CDS open 146283-147806 _na     507_aa Glycine/betaine ABC transporter permease
855 JAMGTK010000003.1 GCA030180765_01506 CDS open 147816-148529 _na     237_aa ABC transporter%2C ATP-binding protein
856 JAMGTK010000003.1 GCA030180765_01507 CDS open 148516-148863 _na     115_aa DNA-binding protein
857 JAMGTK010000003.1 GCA030180765_01508 CDS open 149061-149579 _na     172_aa DNA-binding transcriptional regulator
858 JAMGTK010000003.1 GCA030180765_01509 CDS open 149572-150432 _na     286_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
859 JAMGTK010000003.1 GCA030180765_01510 CDS open 150410-151687 _na     425_aa L-aspartate oxidase
860 JAMGTK010000003.1 GCA030180765_01511 CDS open 151684-152586 _na     300_aa nadA quinolinate synthase NadA
861 JAMGTK010000003.1 GCA030180765_01512 CDS open 152687-153310 _na     207_aa Orotate phosphoribosyltransferase
862 JAMGTK010000003.1 GCA030180765_01513 CDS open 153303-154520 _na     405_aa Dihydroorotase
863 JAMGTK010000003.1 GCA030180765_01514 CDS open 154514-155230 _na     238_aa pyrF orotidine-5'-phosphate decarboxylase
864 JAMGTK010000003.1 GCA030180765_01515 CDS open 155235-156155 _na     306_aa dihydroorotate dehydrogenase
865 JAMGTK010000003.1 GCA030180765_01516 CDS open 156165-156965 _na     266_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
866 JAMGTK010000003.1 GCA030180765_01517 CDS open 156975-157880 _na     301_aa pyrB aspartate carbamoyltransferase
867 JAMGTK010000003.1 GCA030180765_01518 CDS open 158175-159143 _na     322_aa Thiamine ABC transporter substrate-binding protein
868 JAMGTK010000003.1 GCA030180765_01519 CDS open 159330-161042 _na     570_aa argS arginine--tRNA ligase
869 JAMGTK010000003.1 GCA030180765_01521 CDS open 161693-162970 _na     425_aa ISL3 family transposase
870 JAMGTK010000003.1 GCA030180765_01522 CDS open 164698-164961 _na     87_aa hypothetical protein
871 JAMGTK010000003.1 GCA030180765_01523 CDS open 164958-165530 _na     190_aa hypothetical protein
872 JAMGTK010000003.1 GCA030180765_01524 CDS open 165540-165725 _na     61_aa hypothetical protein
873 JAMGTK010000003.1 GCA030180765_01525 CDS open 165712-165891 _na     59_aa Phosphoadenosine phosphosulfate reductase family protein
874 JAMGTK010000003.1 GCA030180765_01526 CDS open 166497-167123 _na     208_aa Peptidase S24-like protein
875 JAMGTK010000003.1 GCA030180765_01378 gene open 686-2101
876 JAMGTK010000003.1 GCA030180765_01379 gene open 2094-2711 cutC
877 JAMGTK010000003.1 GCA030180765_01380 gene open 2733-3293
878 JAMGTK010000003.1 GCA030180765_01381 gene open 3419-4144 pflA
879 JAMGTK010000003.1 GCA030180765_01382 gene open 4171-6402 pflB
880 JAMGTK010000003.1 GCA030180765_01383 gene open 6611-7735
881 JAMGTK010000003.1 GCA030180765_01384 gene open 7742-8314
882 JAMGTK010000003.1 GCA030180765_01385 gene open 8754-10295 abgT
883 JAMGTK010000003.1 GCA030180765_01386 gene open 10480-10758
884 JAMGTK010000003.1 GCA030180765_01387 gene open 10850-11038
885 JAMGTK010000003.1 GCA030180765_01388 gene open 11205-11969
886 JAMGTK010000003.1 GCA030180765_01389 gene open 11984-12850
887 JAMGTK010000003.1 GCA030180765_01390 gene open 12860-13543
888 JAMGTK010000003.1 GCA030180765_01391 gene open 13735-15060
889 JAMGTK010000003.1 GCA030180765_01392 gene open 15302-16702
890 JAMGTK010000003.1 GCA030180765_01393 gene open 17037-18755
891 JAMGTK010000003.1 GCA030180765_01394 gene open 18748-20493
892 JAMGTK010000003.1 GCA030180765_01395 gene open 20607-21596
893 JAMGTK010000003.1 GCA030180765_01396 gene open 21738-22340 coaE
894 JAMGTK010000003.1 GCA030180765_01397 gene open 22312-24480
895 JAMGTK010000003.1 GCA030180765_01398 gene open 24482-24985
896 JAMGTK010000003.1 GCA030180765_01399 gene open 24998-26206
897 JAMGTK010000003.1 GCA030180765_01400 gene open 26210-26758
898 JAMGTK010000003.1 GCA030180765_01401 gene open 26783-29308 dhaL
899 JAMGTK010000003.1 GCA030180765_01402 gene open 29372-30301
900 JAMGTK010000003.1 GCA030180765_01403 gene open 30316-31590
901 JAMGTK010000003.1 GCA030180765_01404 gene open 31600-32637 mnmA
902 JAMGTK010000003.1 GCA030180765_01405 gene open 32634-34655 ligA
903 JAMGTK010000003.1 GCA030180765_01406 gene open 34713-37382 secA
904 JAMGTK010000003.1 GCA030180765_01407 gene open 37403-38143
905 JAMGTK010000003.1 GCA030180765_01408 gene open 38215-39033
906 JAMGTK010000003.1 GCA030180765_01409 gene open 39036-40034 rfaD
907 JAMGTK010000003.1 GCA030180765_01410 gene open 40044-40865
908 JAMGTK010000003.1 GCA030180765_01411 gene open 40875-42218
909 JAMGTK010000003.1 GCA030180765_01412 gene open 42281-43498
910 JAMGTK010000003.1 GCA030180765_01413 gene open 43744-45819
911 JAMGTK010000003.1 GCA030180765_01414 gene open 45947-46570
912 JAMGTK010000003.1 GCA030180765_01415 gene open 46687-47274
913 JAMGTK010000003.1 GCA030180765_01416 gene open 47299-47778
914 JAMGTK010000003.1 GCA030180765_01417 gene open 47791-49551
915 JAMGTK010000003.1 GCA030180765_01418 gene open 49569-51377 glmS
916 JAMGTK010000003.1 GCA030180765_01419 gene open 51482-52372 thrB
917 JAMGTK010000003.1 GCA030180765_01420 gene open 52360-53817 thrC
918 JAMGTK010000003.1 GCA030180765_01421 gene open 53919-55037
919 JAMGTK010000003.1 GCA030180765_01422 gene open 55034-56371
920 JAMGTK010000003.1 GCA030180765_01423 gene open 56368-57336
921 JAMGTK010000003.1 GCA030180765_01424 gene open 57463-58380
922 JAMGTK010000003.1 GCA030180765_01425 gene open 58496-59506
923 JAMGTK010000003.1 GCA030180765_01426 gene open 59538-60335
924 JAMGTK010000003.1 GCA030180765_01427 gene open 60373-61518
925 JAMGTK010000003.1 GCA030180765_01428 gene open 61738-62661
926 JAMGTK010000003.1 GCA030180765_01429 gene open 62833-63585
927 JAMGTK010000003.1 GCA030180765_01430 gene open 63572-64327
928 JAMGTK010000003.1 GCA030180765_01431 gene open 64328-64822
929 JAMGTK010000003.1 GCA030180765_01432 gene open 64862-65518
930 JAMGTK010000003.1 GCA030180765_01433 gene open 65526-66755
931 JAMGTK010000003.1 GCA030180765_01434 gene open 66770-68110 dnaB
932 JAMGTK010000003.1 GCA030180765_01435 gene open 68126-68575 rplI
933 JAMGTK010000003.1 GCA030180765_01436 gene open 68597-69421
934 JAMGTK010000003.1 GCA030180765_01437 gene open 69418-70824 dnaX
935 JAMGTK010000003.1 GCA030180765_01438 gene open 70828-72216 ntrC
936 JAMGTK010000003.1 GCA030180765_01439 gene open 72233-72994 tonB
937 JAMGTK010000003.1 GCA030180765_01440 gene open 73009-73443
938 JAMGTK010000003.1 GCA030180765_01441 gene open 73458-74069
939 JAMGTK010000003.1 GCA030180765_01442 gene open 74083-74451
940 JAMGTK010000003.1 GCA030180765_01443 gene open 74469-77216 ybgF
941 JAMGTK010000003.1 GCA030180765_01444 gene open 77425-78084
942 JAMGTK010000003.1 GCA030180765_01445 gene open 78296-79303
943 JAMGTK010000003.1 GCA030180765_01446 gene open 79513-79977
944 JAMGTK010000003.1 GCA030180765_01447 gene open 80024-80674 lemA
945 JAMGTK010000003.1 GCA030180765_01448 gene open 80995-81432
946 JAMGTK010000003.1 GCA030180765_01449 gene open 81401-81607
947 JAMGTK010000003.1 GCA030180765_01450 gene open 81825-84758
948 JAMGTK010000003.1 GCA030180765_01451 gene open 84901-85092
949 JAMGTK010000003.1 GCA030180765_01452 gene open 85716-86687 oppF
950 JAMGTK010000003.1 GCA030180765_01453 gene open 86677-87684 nikD
951 JAMGTK010000003.1 GCA030180765_01454 gene open 87705-88571 nikC
952 JAMGTK010000003.1 GCA030180765_01455 gene open 88586-89512 nikB
953 JAMGTK010000003.1 GCA030180765_01456 gene open 89598-91130
954 JAMGTK010000003.1 GCA030180765_01457 gene open 91237-92319
955 JAMGTK010000003.1 GCA030180765_01458 gene open 92379-92642 rpsO
956 JAMGTK010000003.1 GCA030180765_01459 gene open 92732-94921 ftsH
957 JAMGTK010000003.1 GCA030180765_01460 gene open 94918-96255
958 JAMGTK010000003.1 GCA030180765_01461 gene open 96272-97216
959 JAMGTK010000003.1 GCA030180765_01462 gene open 97234-98820
960 JAMGTK010000003.1 GCA030180765_01463 gene open 98886-99347 ywqK
961 JAMGTK010000003.1 GCA030180765_01464 gene open 99515-100948
962 JAMGTK010000003.1 GCA030180765_01465 gene open 101048-102193
963 JAMGTK010000003.1 GCA030180765_01466 gene open 102168-102743
964 JAMGTK010000003.1 GCA030180765_01467 gene open 102951-103211 rpsT
965 JAMGTK010000003.1 GCA030180765_01468 gene open 103346-104305
966 JAMGTK010000003.1 GCA030180765_01469 gene open 104319-105044
967 JAMGTK010000003.1 GCA030180765_01470 gene open 105213-106694 lysS
968 JAMGTK010000003.1 GCA030180765_01471 gene open 106721-107944
969 JAMGTK010000003.1 GCA030180765_01472 gene open 107947-108327
970 JAMGTK010000003.1 GCA030180765_01473 gene open 108327-108656
971 JAMGTK010000003.1 GCA030180765_01474 gene open 108695-109162
972 JAMGTK010000003.1 GCA030180765_01475 gene open 109193-110986 mutL
973 JAMGTK010000003.1 GCA030180765_01476 gene open 111135-112949
974 JAMGTK010000003.1 GCA030180765_01477 gene open 113016-115544 recJ
975 JAMGTK010000003.1 GCA030180765_01478 gene open 115800-117089
976 JAMGTK010000003.1 GCA030180765_01479 gene open 117083-117967 lgt
977 JAMGTK010000003.1 GCA030180765_01480 gene open 118015-119718
978 JAMGTK010000003.1 GCA030180765_01481 gene open 119735-121519 hymB
979 JAMGTK010000003.1 GCA030180765_01482 gene open 121532-122014 nuoE
980 JAMGTK010000003.1 GCA030180765_01483 gene open 122185-123840
981 JAMGTK010000003.1 GCA030180765_01484 gene open 123827-124603
982 JAMGTK010000003.1 GCA030180765_01485 gene open 124617-125507 msrB
983 JAMGTK010000003.1 GCA030180765_01486 gene open 125570-126244
984 JAMGTK010000003.1 GCA030180765_01487 gene open 126284-126937 ccdA
985 JAMGTK010000003.1 GCA030180765_01488 gene open 127114-129657
986 JAMGTK010000003.1 GCA030180765_01489 gene open 130076-130804
987 JAMGTK010000003.1 GCA030180765_01490 gene open 130944-131768
988 JAMGTK010000003.1 GCA030180765_01491 gene open 131768-132421
989 JAMGTK010000003.1 GCA030180765_01492 gene open 132609-133370
990 JAMGTK010000003.1 GCA030180765_01493 gene open 133367-133807
991 JAMGTK010000003.1 GCA030180765_01494 gene open 134070-134453
992 JAMGTK010000003.1 GCA030180765_01495 gene open 134500-135789
993 JAMGTK010000003.1 GCA030180765_01496 gene open 135804-137579 pepF
994 JAMGTK010000003.1 GCA030180765_01497 gene open 137588-139282
995 JAMGTK010000003.1 GCA030180765_01498 gene open 139350-139709
996 JAMGTK010000003.1 GCA030180765_01499 gene open 139804-140472
997 JAMGTK010000003.1 GCA030180765_01500 gene open 140465-142405 metG
998 JAMGTK010000003.1 GCA030180765_01501 gene open 142434-143318 galU
999 JAMGTK010000003.1 GCA030180765_01502 gene open 143516-144664 metK
1000 JAMGTK010000003.1 GCA030180765_01503 gene open 144779-145459