HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_030180825.1)

Select a Genome:
BAKTA Annotations for GCA_030180825.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
73 2174870 2035 8 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4208 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4208 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JAMGTO010000002.1 GCA030180825_00897 gene open 156885-158135
1002 JAMGTO010000002.1 GCA030180825_00898 gene open 158132-158572 dut
1003 JAMGTO010000002.1 GCA030180825_00899 gene open 158582-159688 rodA
1004 JAMGTO010000002.1 GCA030180825_00900 gene open 159690-160562
1005 JAMGTO010000002.1 GCA030180825_00901 gene open 160577-161878
1006 JAMGTO010000002.1 GCA030180825_00902 gene open 161967-162860 eamA
1007 JAMGTO010000002.1 GCA030180825_00903 gene open 162926-163351
1008 JAMGTO010000002.1 GCA030180825_00904 gene open 163402-164769 argH
1009 JAMGTO010000002.1 GCA030180825_00905 gene open 164779-165990
1010 JAMGTO010000002.1 GCA030180825_00906 gene open 166004-166729
1011 JAMGTO010000002.1 GCA030180825_00907 gene open 167080-167727 ostA
1012 JAMGTO010000002.1 GCA030180825_00908 gene open 167881-169896 pabB
1013 JAMGTO010000002.1 GCA030180825_00909 gene open 169893-170609
1014 JAMGTO010000002.1 GCA030180825_00910 gene open 170750-171097
1015 JAMGTO010000002.1 GCA030180825_00911 gene open 171304-172260
1016 JAMGTO010000002.1 GCA030180825_00912 gene open 172390-173208
1017 JAMGTO010000002.1 GCA030180825_00913 gene open 173189-174199
1018 JAMGTO010000002.1 GCA030180825_00914 gene open 174196-174885
1019 JAMGTO010000002.1 GCA030180825_00915 gene open 174954-175961
1020 JAMGTO010000002.1 GCA030180825_00916 gene open 175971-176618
1021 JAMGTO010000002.1 GCA030180825_00917 gene open 176605-177396
1022 JAMGTO010000002.1 GCA030180825_00918 gene open 177523-178596 deoR
1023 JAMGTO010000002.1 GCA030180825_00919 gene open 178867-180228
1024 JAMGTO010000002.1 GCA030180825_00920 gene open 180354-181622
1025 JAMGTO010000002.1 GCA030180825_00921 gene open 181677-182453
1026 JAMGTO010000002.1 GCA030180825_00922 gene open 182496-183152
1027 JAMGTO010000002.1 GCA030180825_00923 gene open 183142-184143
1028 JAMGTO010000002.1 GCA030180825_00924 gene open 184383-184841
1029 JAMGTO010000002.1 GCA030180825_00925 gene open 185015-185365 rplS
1030 JAMGTO010000002.1 GCA030180825_00926 gene open 185489-186436 lepB
1031 JAMGTO010000002.1 GCA030180825_00927 gene open 186437-186847 rimI
1032 JAMGTO010000002.1 GCA030180825_00928 gene open 186860-188293 purB
1033 JAMGTO010000002.1 GCA030180825_00929 gene open 188296-188838
1034 JAMGTO010000002.1 GCA030180825_00930 gene open 188835-190193 glmM
1035 JAMGTO010000002.1 GCA030180825_00931 gene open 190223-190939
1036 JAMGTO010000002.1 GCA030180825_00932 gene open 190939-191193
1037 JAMGTO010000002.1 GCA030180825_00933 gene open 191168-191542
1038 JAMGTO010000002.1 GCA030180825_00934 gene open 191546-192352 atpB
1039 JAMGTO010000002.1 GCA030180825_00935 gene open 192380-192655 atpE
1040 JAMGTO010000002.1 GCA030180825_00936 gene open 192693-193199 atpF
1041 JAMGTO010000002.1 GCA030180825_00937 gene open 193196-193729 atpH
1042 JAMGTO010000002.1 GCA030180825_00938 gene open 193748-195253 atpA
1043 JAMGTO010000002.1 GCA030180825_00939 gene open 195265-196113 atpG
1044 JAMGTO010000002.1 GCA030180825_00940 gene open 196136-197533 atpD
1045 JAMGTO010000002.1 GCA030180825_00941 gene open 197536-197811 atpC
1046 JAMGTO010000002.1 GCA030180825_00942 gene open 197976-198401 nfeD
1047 JAMGTO010000002.1 GCA030180825_00943 gene open 198404-199294
1048 JAMGTO010000002.1 GCA030180825_00944 gene open 199310-200281
1049 JAMGTO010000002.1 GCA030180825_00945 gene open 200462-201742
1050 JAMGTO010000002.1 GCA030180825_00946 gene open 201799-202689 eamA
1051 JAMGTO010000002.1 GCA030180825_00947 gene open 202710-204146
1052 JAMGTO010000002.1 GCA030180825_00948 gene open 204273-205460 megL
1053 JAMGTO010000002.1 GCA030180825_00949 gene open 205478-206815
1054 JAMGTO010000002.1 GCA030180825_00950 gene open 206990-210562 nifJ
1055 JAMGTO010000002.1 GCA030180825_00951 gene open 210711-210887
1056 JAMGTO010000002.1 GCA030180825_00952 gene open 211099-211374
1057 JAMGTO010000002.1 GCA030180825_00953 gene open 211368-211607
1058 JAMGTO010000002.1 GCA030180825_00954 gene open 211797-212930
1059 JAMGTO010000002.1 GCA030180825_00955 gene open 213018-213383
1060 JAMGTO010000002.1 GCA030180825_00956 gene open 213405-214838 hydA
1061 JAMGTO010000002.1 GCA030180825_00957 gene open 214870-216243
1062 JAMGTO010000002.1 GCA030180825_00958 gene open 216274-217458 ygeY
1063 JAMGTO010000002.1 GCA030180825_00959 gene open 217473-218681 dpaL
1064 JAMGTO010000002.1 GCA030180825_00960 gene open 218993-220708
1065 JAMGTO010000002.1 GCA030180825_00961 gene open 220802-221107 sepF
1066 JAMGTO010000002.1 GCA030180825_00962 gene open 221123-222067
1067 JAMGTO010000002.1 GCA030180825_00963 gene open 222048-222617 rnmV
1068 JAMGTO010000002.1 GCA030180825_00964 gene open 222620-223588
1069 JAMGTO010000002.1 GCA030180825_00965 gene open 223598-224989 asnS
1070 JAMGTO010000002.1 GCA030180825_00966 gene open 225015-225209
1071 JAMGTO010000002.1 GCA030180825_00967 gene open 225255-226496 rodA
1072 JAMGTO010000002.1 GCA030180825_00968 gene open 226646-227338
1073 JAMGTO010000002.1 GCA030180825_00969 gene open 227289-228284 holA
1074 JAMGTO010000002.1 GCA030180825_00970 gene open 228380-229915
1075 JAMGTO010000002.1 GCA030180825_00971 gene open 229902-231392
1076 JAMGTO010000002.1 GCA030180825_00972 gene open 231421-232338
1077 JAMGTO010000002.1 GCA030180825_00973 gene open 232362-233333 cbiB
1078 JAMGTO010000002.1 GCA030180825_00974 gene open 233375-233566
1079 JAMGTO010000002.1 GCA030180825_00975 gene open 233583-234659 cobD
1080 JAMGTO010000002.1 GCA030180825_00976 gene open 234675-236012
1081 JAMGTO010000002.1 GCA030180825_00977 gene open 236032-236337
1082 JAMGTO010000002.1 GCA030180825_00978 gene open 236349-236993 cobH
1083 JAMGTO010000002.1 GCA030180825_00979 gene open 237177-238301 cbiD
1084 JAMGTO010000002.1 GCA030180825_00980 gene open 238294-238938 cbiE
1085 JAMGTO010000002.1 GCA030180825_00981 gene open 238925-239491 cbiT
1086 JAMGTO010000002.1 GCA030180825_00982 gene open 239908-240906
1087 JAMGTO010000002.1 GCA030180825_00983 gene open 240924-241646 cobI
1088 JAMGTO010000002.1 GCA030180825_00984 gene open 241625-242392 cobM
1089 JAMGTO010000002.1 GCA030180825_00985 gene open 242445-243260
1090 JAMGTO010000002.1 GCA030180825_00986 gene open 243257-244033
1091 JAMGTO010000002.1 GCA030180825_00987 gene open 244117-245136 cbiG
1092 JAMGTO010000002.1 GCA030180825_00988 gene open 245129-245872
1093 JAMGTO010000002.1 GCA030180825_00989 gene open 245894-246655 cobK
1094 JAMGTO010000002.1 GCA030180825_00990 gene open 246685-247620
1095 JAMGTO010000002.1 GCA030180825_00991 gene open 247818-250079
1096 JAMGTO010000002.1 GCA030180825_00992 gene open 250178-252088 abc-f
1097 JAMGTO010000002.1 GCA030180825_00993 gene open 252590-253393
1098 JAMGTO010000002.1 GCA030180825_00994 gene open 253500-254633
1099 JAMGTO010000002.1 GCA030180825_00995 gene open 254644-255771
1100 JAMGTO010000002.1 GCA030180825_00996 gene open 255764-256486
1101 JAMGTO010000002.1 GCA030180825_00997 gene open 256508-256981
1102 JAMGTO010000002.1 GCA030180825_00998 gene open 257069-257983
1103 JAMGTO010000002.1 GCA030180825_00999 gene open 258081-258281
1104 JAMGTO010000002.1 GCA030180825_01000 gene open 258304-259326
1105 JAMGTO010000002.1 GCA030180825_01001 gene open 259346-260134
1106 JAMGTO010000002.1 GCA030180825_01002 gene open 260569-261285 gntR
1107 JAMGTO010000002.1 GCA030180825_01003 gene open 261733-263532 metA
1108 JAMGTO010000002.1 GCA030180825_01004 gene open 263560-264846
1109 JAMGTO010000002.1 GCA030180825_01005 gene open 265027-266628
1110 JAMGTO010000002.1 GCA030180825_01006 gene open 266694-267374
1111 JAMGTO010000002.1 GCA030180825_01007 gene open 267412-268251
1112 JAMGTO010000002.1 GCA030180825_01008 gene open 268441-269277 pstC
1113 JAMGTO010000002.1 GCA030180825_01009 gene open 269274-270113 pstA
1114 JAMGTO010000002.1 GCA030180825_01010 gene open 270126-270878 pstB
1115 JAMGTO010000002.1 GCA030180825_01011 gene open 270929-271612 phoU
1116 JAMGTO010000002.1 GCA030180825_01012 gene open 271761-272129 rpsL
1117 JAMGTO010000002.1 GCA030180825_01013 gene open 272150-272620 rpsG
1118 JAMGTO010000002.1 GCA030180825_01014 gene open 272647-274728 fusA
1119 JAMGTO010000002.1 GCA030180825_01015 gene open 274763-275947
1120 JAMGTO010000002.1 GCA030180825_01016 gene open 276489-277664
1121 JAMGTO010000002.1 GCA030180825_01017 gene open 278130-278915 phoU
1122 JAMGTO010000002.1 GCA030180825_01018 gene open 278905-279372
1123 JAMGTO010000002.1 GCA030180825_00731 gene open 3285-3359 trnQ
1124 JAMGTO010000002.1 GCA030180825_00768 gene open 47299-47375 trnP
1125 JAMGTO010000002.1 GCA030180825_00769 gene open 47381-47456 trnG
1126 JAMGTO010000002.1 GCA030180825_00770 gene open 47465-47540 trnH
1127 JAMGTO010000002.1 GCA030180825_00771 gene open 47547-47622 trnK
1128 JAMGTO010000002.1 GCA030180825_00772 gene open 47630-47713 trnL
1129 JAMGTO010000002.1 GCA030180825_00779 gene open 52001-52088 trnL
1130 JAMGTO010000002.1 GCA030180825_00780 gene open 52097-52173 trnfM
1131 JAMGTO010000002.1 GCA030180825_00781 gene open 52185-52260 trnG
1132 JAMGTO010000002.1 GCA030180825_00782 gene open 52264-52339 trnK
1133 JAMGTO010000002.1 GCA030180825_00783 gene open 52349-52425 trnR
1134 JAMGTO010000002.1 GCA030180825_00784 gene open 52444-52520 trnI
1135 JAMGTO010000002.1 GCA030180825_00785 gene open 52542-52616 trnE
1136 JAMGTO010000002.1 GCA030180825_00786 gene open 52618-52701 trnS
1137 JAMGTO010000002.1 GCA030180825_00787 gene open 52724-52799 trnF
1138 JAMGTO010000002.1 GCA030180825_00788 gene open 52811-52886 trnV
1139 JAMGTO010000002.1 GCA030180825_00789 gene open 52893-52970 trnD
1140 JAMGTO010000002.1 GCA030180825_00837 gene open 97894-97969 trnV
1141 JAMGTO010000002.1 GCA030180825_00838 gene open 97975-98052 trnD
1142 JAMGTO010000002.1 GCA030180825_00839 gene open 98057-98132 trnF
1143 JAMGTO010000002.1 GCA030180825_00840 gene open 98147-98220 trnC
1144 JAMGTO010000002.1 GCA030180825_00843 gene open 99985-100060 trnT
1145 JAMGTO010000002.1 GCA030180825_00844 gene open 100065-100139 trnE
1146 JAMGTO010000002.1 GCA030180825_00845 gene open 100157-100241 trnY
1147 JAMGTO010000002.1 GCA030180825_00855 gene open 111592-111678 trnL
1148 JAMGTO010000002.1 GCA030180825_00861 gene open 116092-116167 trnW
1149 JAMGTO010000002.1 GCA030180825_00731 tRNA open 3285-3359 trnQ tRNA-Gln(ttg)
1150 JAMGTO010000002.1 GCA030180825_00768 tRNA open 47299-47375 trnP tRNA-Pro(tgg)
1151 JAMGTO010000002.1 GCA030180825_00769 tRNA open 47381-47456 trnG tRNA-Gly(tcc)
1152 JAMGTO010000002.1 GCA030180825_00770 tRNA open 47465-47540 trnH tRNA-His(gtg)
1153 JAMGTO010000002.1 GCA030180825_00771 tRNA open 47547-47622 trnK tRNA-Lys(ttt)
1154 JAMGTO010000002.1 GCA030180825_00772 tRNA open 47630-47713 trnL tRNA-Leu(tag)
1155 JAMGTO010000002.1 GCA030180825_00779 tRNA open 52001-52088 trnL tRNA-Leu(taa)
1156 JAMGTO010000002.1 GCA030180825_00780 tRNA open 52097-52173 trnfM tRNA-fMet(cat)
1157 JAMGTO010000002.1 GCA030180825_00781 tRNA open 52185-52260 trnG tRNA-Gly(tcc)
1158 JAMGTO010000002.1 GCA030180825_00782 tRNA open 52264-52339 trnK tRNA-Lys(ttt)
1159 JAMGTO010000002.1 GCA030180825_00783 tRNA open 52349-52425 trnR tRNA-Arg(tct)
1160 JAMGTO010000002.1 GCA030180825_00784 tRNA open 52444-52520 trnI tRNA-Ile2(cat)
1161 JAMGTO010000002.1 GCA030180825_00785 tRNA open 52542-52616 trnE tRNA-Glu(ttc)
1162 JAMGTO010000002.1 GCA030180825_00786 tRNA open 52618-52701 trnS tRNA-Ser(tga)
1163 JAMGTO010000002.1 GCA030180825_00787 tRNA open 52724-52799 trnF tRNA-Phe(gaa)
1164 JAMGTO010000002.1 GCA030180825_00788 tRNA open 52811-52886 trnV tRNA-Val(tac)
1165 JAMGTO010000002.1 GCA030180825_00789 tRNA open 52893-52970 trnD tRNA-Asp(gtc)
1166 JAMGTO010000002.1 GCA030180825_00837 tRNA open 97894-97969 trnV tRNA-Val(tac)
1167 JAMGTO010000002.1 GCA030180825_00838 tRNA open 97975-98052 trnD tRNA-Asp(gtc)
1168 JAMGTO010000002.1 GCA030180825_00839 tRNA open 98057-98132 trnF tRNA-Phe(gaa)
1169 JAMGTO010000002.1 GCA030180825_00840 tRNA open 98147-98220 trnC tRNA-Cys(gca)
1170 JAMGTO010000002.1 GCA030180825_00843 tRNA open 99985-100060 trnT tRNA-Thr(tgt)
1171 JAMGTO010000002.1 GCA030180825_00844 tRNA open 100065-100139 trnE tRNA-Glu(ttc)
1172 JAMGTO010000002.1 GCA030180825_00845 tRNA open 100157-100241 trnY tRNA-Tyr(gta)
1173 JAMGTO010000002.1 GCA030180825_00855 tRNA open 111592-111678 trnL tRNA-Leu(caa)
1174 JAMGTO010000002.1 GCA030180825_00861 tRNA open 116092-116167 trnW tRNA-Trp(cca)
1175 JAMGTO010000003.1 regulatory_region open 73275-73362 SAM riboswitch aptamer (S box leader)
1176 JAMGTO010000003.1 regulatory_region open 86747-86922 Cobalamin riboswitch aptamer
1177 JAMGTO010000003.1 repeat_region open 10058-10957 CRISPR array with 14 repeats of length 30%2C consensus sequence ATTAGAGTATTACTAAAGTAGAATGTAAAT and spacer length 36
1178 JAMGTO010000003.1 repeat_region open 47841-48738 CRISPR array with 14 repeats of length 30%2C consensus sequence ATTAGAGTATTACTAAAGTAGAATGTAAAT and spacer length 36
1179 JAMGTO010000003.1 GCA030180825_01027 CDS open 798-1199 _na     133_aa tnpA IS200/IS605 family transposase
1180 JAMGTO010000003.1 GCA030180825_01028 CDS open 1647-2399 _na     250_aa cas6 CRISPR-associated endoribonuclease Cas6
1181 JAMGTO010000003.1 GCA030180825_01029 CDS open 2389-3819 _na     476_aa cas8a1 type I CRISPR-associated protein Cas8a1/Csx8
1182 JAMGTO010000003.1 GCA030180825_01030 CDS open 3841-4722 _na     293_aa cas7i type I-B CRISPR-associated protein Cas7/Cst2/DevR
1183 JAMGTO010000003.1 GCA030180825_01031 CDS open 4736-5845 _na     369_aa CRISPR-associated protein Cas5
1184 JAMGTO010000003.1 GCA030180825_01032 CDS open 5856-8057 _na     733_aa CRISPR-associated helicase Cas3
1185 JAMGTO010000003.1 GCA030180825_01033 CDS open 8078-8572 _na     164_aa cas4 CRISPR-associated protein Cas4
1186 JAMGTO010000003.1 GCA030180825_01034 CDS open 8583-9575 _na     330_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
1187 JAMGTO010000003.1 GCA030180825_01035 CDS open 9582-9860 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
1188 JAMGTO010000003.1 GCA030180825_01036 CDS open 11509-12105 _na     198_aa lexA LexA family transcriptional regulator
1189 JAMGTO010000003.1 GCA030180825_01037 CDS open 12580-12699 _na     39_aa hypothetical protein
1190 JAMGTO010000003.1 GCA030180825_01038 CDS open 12668-13156 _na     162_aa hypothetical protein
1191 JAMGTO010000003.1 GCA030180825_01039 CDS open 13235-13489 _na     84_aa hypothetical protein
1192 JAMGTO010000003.1 GCA030180825_01040 CDS open 13532-14131 _na     199_aa BRO family protein
1193 JAMGTO010000003.1 GCA030180825_01041 CDS open 14136-14900 _na     254_aa phage integrase N-terminal SAM-like domain-containing protein
1194 JAMGTO010000003.1 GCA030180825_01042 CDS open 14988-15089 _na     33_aa hypothetical protein
1195 JAMGTO010000003.1 GCA030180825_01043 CDS open 15090-15491 _na     133_aa HTH cro/C1-type domain-containing protein
1196 JAMGTO010000003.1 GCA030180825_01044 CDS open 15501-17387 _na     628_aa Mu transposase C-terminal domain-containing protein
1197 JAMGTO010000003.1 GCA030180825_01045 CDS open 17401-18369 _na     322_aa AAA family ATPase
1198 JAMGTO010000003.1 GCA030180825_01046 CDS open 18379-18570 _na     63_aa hypothetical protein
1199 JAMGTO010000003.1 GCA030180825_01047 CDS open 18586-18819 _na     77_aa hypothetical protein
1200 JAMGTO010000003.1 GCA030180825_01048 CDS open 18867-19073 _na     68_aa hypothetical protein
1201 JAMGTO010000003.1 GCA030180825_01049 CDS open 19070-19717 _na     215_aa DUF3164 domain-containing protein
1202 JAMGTO010000003.1 GCA030180825_01050 CDS open 19722-20123 _na     133_aa phage protein GemA/Gp16 family protein
1203 JAMGTO010000003.1 GCA030180825_01051 CDS open 20113-20451 _na     112_aa hypothetical protein
1204 JAMGTO010000003.1 GCA030180825_01052 CDS open 20448-20675 _na     75_aa hypothetical protein
1205 JAMGTO010000003.1 GCA030180825_01053 CDS open 20782-21378 _na     198_aa sigma-70 family RNA polymerase sigma factor
1206 JAMGTO010000003.1 GCA030180825_01054 CDS open 21344-21649 _na     101_aa hypothetical protein
1207 JAMGTO010000003.1 GCA030180825_01055 CDS open 21768-22808 _na     346_aa hypothetical protein
1208 JAMGTO010000003.1 GCA030180825_01056 CDS open 22908-23276 _na     122_aa ASCH domain-containing protein
1209 JAMGTO010000003.1 GCA030180825_01057 CDS open 23290-23526 _na     78_aa helix-turn-helix domain-containing protein
1210 JAMGTO010000003.1 GCA030180825_01058 CDS open 23981-24169 _na     62_aa hypothetical protein
1211 JAMGTO010000003.1 GCA030180825_01059 CDS open 24171-24659 _na     162_aa hypothetical protein
1212 JAMGTO010000003.1 GCA030180825_01060 CDS open 24680-24898 _na     72_aa hypothetical protein
1213 JAMGTO010000003.1 GCA030180825_01061 CDS open 25044-25448 _na     134_aa helix-turn-helix domain-containing protein
1214 JAMGTO010000003.1 GCA030180825_01062 CDS open 25411-26679 _na     422_aa PBSX family phage terminase large subunit
1215 JAMGTO010000003.1 GCA030180825_01063 CDS open 26669-27922 _na     417_aa phage portal protein
1216 JAMGTO010000003.1 GCA030180825_01064 CDS open 27919-28659 _na     246_aa phage minor head protein
1217 JAMGTO010000003.1 GCA030180825_01065 CDS open 28668-30473 _na     601_aa phage major capsid protein
1218 JAMGTO010000003.1 GCA030180825_01066 CDS open 30517-31032 _na     171_aa hypothetical protein
1219 JAMGTO010000003.1 GCA030180825_01067 CDS open 31035-31532 _na     165_aa HK97 gp10 family phage protein
1220 JAMGTO010000003.1 GCA030180825_01068 CDS open 31535-31873 _na     112_aa Head-tail adaptor protein
1221 JAMGTO010000003.1 GCA030180825_01069 CDS open 31863-32366 _na     167_aa LIC_12616 family protein
1222 JAMGTO010000003.1 GCA030180825_01070 CDS open 32380-33423 _na     347_aa hypothetical protein
1223 JAMGTO010000003.1 GCA030180825_01071 CDS open 33423-33815 _na     130_aa Phage protein
1224 JAMGTO010000003.1 GCA030180825_01072 CDS open 33817-34191 _na     124_aa Phage protein
1225 JAMGTO010000003.1 GCA030180825_01073 CDS open 34342-36399 _na     685_aa Phage tail tape measure protein
1226 JAMGTO010000003.1 GCA030180825_01074 CDS open 36401-37000 _na     199_aa phage baseplate protein
1227 JAMGTO010000003.1 GCA030180825_01075 CDS open 37003-37329 _na     108_aa phage baseplate plug protein
1228 JAMGTO010000003.1 GCA030180825_01076 CDS open 37331-38242 _na     303_aa hypothetical protein
1229 JAMGTO010000003.1 GCA030180825_01077 CDS open 38239-38823 _na     194_aa Phage protein Gp138 N-terminal domain-containing protein
1230 JAMGTO010000003.1 GCA030180825_01078 CDS open 38820-39158 _na     112_aa IraD/Gp25-like domain-containing protein
1231 JAMGTO010000003.1 GCA030180825_01079 CDS open 39151-40248 _na     365_aa baseplate J/gp47 family protein
1232 JAMGTO010000003.1 GCA030180825_01080 CDS open 40255-40881 _na     208_aa DUF2313 domain-containing protein
1233 JAMGTO010000003.1 GCA030180825_01081 CDS open 40878-42110 _na     410_aa hypothetical protein
1234 JAMGTO010000003.1 GCA030180825_01082 CDS open 43062-44027 _na     321_aa tyrosine-type recombinase/integrase
1235 JAMGTO010000003.1 GCA030180825_01083 CDS open 44261-44800 _na     179_aa hypothetical protein
1236 JAMGTO010000003.1 GCA030180825_01084 CDS open 44818-45258 _na     146_aa M15 family metallopeptidase
1237 JAMGTO010000003.1 GCA030180825_01085 CDS open 45279-45572 _na     97_aa hypothetical protein
1238 JAMGTO010000003.1 GCA030180825_01086 CDS open 45581-46030 _na     149_aa DUF1353 domain-containing protein
1239 JAMGTO010000003.1 GCA030180825_01087 CDS open 46049-46513 _na     154_aa holin family protein
1240 JAMGTO010000003.1 GCA030180825_01088 CDS open 46602-46778 _na     58_aa copG CopG family transcriptional regulator
1241 JAMGTO010000003.1 GCA030180825_01089 CDS open 46902-47027 _na     41_aa hypothetical protein
1242 JAMGTO010000003.1 GCA030180825_01090 CDS open 47020-47628 _na     202_aa antA/AntB antirepressor family protein
1243 JAMGTO010000003.1 GCA030180825_01091 CDS open 50028-51305 _na     425_aa ISL3 family transposase
1244 JAMGTO010000003.1 GCA030180825_01093 CDS open 51932-53644 _na     570_aa argS arginine--tRNA ligase
1245 JAMGTO010000003.1 GCA030180825_01094 CDS open 53831-54799 _na     322_aa Thiamine ABC transporter substrate-binding protein
1246 JAMGTO010000003.1 GCA030180825_01095 CDS open 55095-56000 _na     301_aa pyrB aspartate carbamoyltransferase
1247 JAMGTO010000003.1 GCA030180825_01096 CDS open 56010-56810 _na     266_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
1248 JAMGTO010000003.1 GCA030180825_01097 CDS open 56820-57740 _na     306_aa dihydroorotate dehydrogenase
1249 JAMGTO010000003.1 GCA030180825_01098 CDS open 57745-58461 _na     238_aa pyrF orotidine-5'-phosphate decarboxylase
1250 JAMGTO010000003.1 GCA030180825_01099 CDS open 58455-59672 _na     405_aa Dihydroorotase
1251 JAMGTO010000003.1 GCA030180825_01100 CDS open 59665-60288 _na     207_aa Orotate phosphoribosyltransferase
1252 JAMGTO010000003.1 GCA030180825_01101 CDS open 60441-60731 _na     96_aa L-aspartate oxidase
1253 JAMGTO010000003.1 GCA030180825_01102 CDS open 60709-61569 _na     286_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
1254 JAMGTO010000003.1 GCA030180825_01103 CDS open 61562-62080 _na     172_aa DNA-binding transcriptional regulator
1255 JAMGTO010000003.1 GCA030180825_01104 CDS open 62159-62908 _na     249_aa iclR IclR family transcriptional regulator
1256 JAMGTO010000003.1 GCA030180825_01105 CDS open 63329-64399 _na     356_aa Hydroxyacid dehydrogenase
1257 JAMGTO010000003.1 GCA030180825_01106 CDS open 64425-65813 _na     462_aa Sodium:glutamate symporter
1258 JAMGTO010000003.1 GCA030180825_01107 CDS open 66055-66345 _na     96_aa hypothetical protein
1259 JAMGTO010000003.1 GCA030180825_01108 CDS open 66377-67687 _na     436_aa 9-O-acetyl-N-acetylneuraminate esterase
1260 JAMGTO010000003.1 GCA030180825_01109 CDS open 67843-68190 _na     115_aa DNA-binding protein
1261 JAMGTO010000003.1 GCA030180825_01110 CDS open 68177-68890 _na     237_aa ABC transporter%2C ATP-binding protein
1262 JAMGTO010000003.1 GCA030180825_01111 CDS open 68900-70423 _na     507_aa Glycine/betaine ABC transporter permease
1263 JAMGTO010000003.1 GCA030180825_01112 CDS open 70445-71197 _na     250_aa 3-oxoacyl-ACP reductase
1264 JAMGTO010000003.1 GCA030180825_01113 CDS open 71247-71927 _na     226_aa Cupin domain-containing protein
1265 JAMGTO010000003.1 GCA030180825_01114 CDS open 72042-73190 _na     382_aa metK methionine adenosyltransferase
1266 JAMGTO010000003.1 GCA030180825_01115 CDS open 73388-74272 _na     294_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
1267 JAMGTO010000003.1 GCA030180825_01116 CDS open 74301-76241 _na     646_aa metG methionine--tRNA ligase
1268 JAMGTO010000003.1 GCA030180825_01117 CDS open 76234-76902 _na     222_aa DUF374 domain-containing protein
1269 JAMGTO010000003.1 GCA030180825_01118 CDS open 76997-77356 _na     119_aa YbaB/EbfC family nucleoid-associated protein
1270 JAMGTO010000003.1 GCA030180825_01119 CDS open 77424-79118 _na     564_aa Signal peptide peptidase SppA%2C 36K type
1271 JAMGTO010000003.1 GCA030180825_01120 CDS open 79127-80902 _na     591_aa pepF oligoendopeptidase F
1272 JAMGTO010000003.1 GCA030180825_01121 CDS open 80917-82206 _na     429_aa Uracil permease
1273 JAMGTO010000003.1 GCA030180825_01122 CDS open 82253-82636 _na     127_aa Dihydrolipoamide acyltransferase
1274 JAMGTO010000003.1 GCA030180825_01123 CDS open 82899-83339 _na     146_aa DUF1007 domain-containing protein
1275 JAMGTO010000003.1 GCA030180825_01124 CDS open 83336-84097 _na     253_aa Nickel transporter
1276 JAMGTO010000003.1 GCA030180825_01125 CDS open 84285-84938 _na     217_aa thiamine diphosphokinase
1277 JAMGTO010000003.1 GCA030180825_01126 CDS open 84938-85762 _na     274_aa Endonuclease/exonuclease/phosphatase family protein
1278 JAMGTO010000003.1 GCA030180825_01127 CDS open 85902-86630 _na     242_aa phosphoserine phosphatase
1279 JAMGTO010000003.1 GCA030180825_01128 CDS open 87049-88263 _na     404_aa hypothetical protein
1280 JAMGTO010000003.1 GCA030180825_01129 CDS open 88323-89591 _na     422_aa autotransporter outer membrane beta-barrel domain-containing protein
1281 JAMGTO010000003.1 GCA030180825_01130 CDS open 89768-90421 _na     217_aa ccdA Putative cytochrome C-type biogenesis protein CcdA
1282 JAMGTO010000003.1 GCA030180825_01131 CDS open 90461-91135 _na     224_aa Redoxin domain-containing protein
1283 JAMGTO010000003.1 GCA030180825_01132 CDS open 91198-92088 _na     296_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
1284 JAMGTO010000003.1 GCA030180825_01133 CDS open 92102-92878 _na     258_aa DNA-binding response regulator
1285 JAMGTO010000003.1 GCA030180825_01134 CDS open 92865-94520 _na     551_aa Histidine kinase
1286 JAMGTO010000003.1 GCA030180825_01135 CDS open 94691-95173 _na     160_aa nuoE NADH-quinone oxidoreductase subunit NuoE
1287 JAMGTO010000003.1 GCA030180825_01136 CDS open 95186-96970 _na     594_aa hymB Protein HymB
1288 JAMGTO010000003.1 GCA030180825_01137 CDS open 96987-98690 _na     567_aa NADH:ubiquinone oxidoreductase
1289 JAMGTO010000003.1 GCA030180825_01138 CDS open 98738-99622 _na     294_aa lgt prolipoprotein diacylglyceryl transferase
1290 JAMGTO010000003.1 GCA030180825_01139 CDS open 99616-100905 _na     429_aa Sodium:proton antiporter
1291 JAMGTO010000003.1 GCA030180825_01140 CDS open 101161-103689 _na     842_aa recJ single-stranded-DNA-specific exonuclease RecJ
1292 JAMGTO010000003.1 GCA030180825_01141 CDS open 103756-105570 _na     604_aa Tetratricopeptide repeat protein
1293 JAMGTO010000003.1 GCA030180825_01142 CDS open 105719-107512 _na     597_aa mutL DNA mismatch repair endonuclease MutL
1294 JAMGTO010000003.1 GCA030180825_01143 CDS open 107543-108010 _na     155_aa Ribosomal RNA large subunit methyltransferase H
1295 JAMGTO010000003.1 GCA030180825_01144 CDS open 108049-108378 _na     109_aa DUF1292 domain-containing protein
1296 JAMGTO010000003.1 GCA030180825_01145 CDS open 108378-108758 _na     126_aa DUF1934 domain-containing protein
1297 JAMGTO010000003.1 GCA030180825_01146 CDS open 108761-109984 _na     407_aa Tetratricopeptide repeat protein
1298 JAMGTO010000003.1 GCA030180825_01147 CDS open 110011-111492 _na     493_aa lysS lysine--tRNA ligase
1299 JAMGTO010000003.1 GCA030180825_01148 CDS open 111661-112386 _na     241_aa Electron transfer flavoprotein
1300 JAMGTO010000003.1 GCA030180825_01149 CDS open 112400-113359 _na     319_aa Electron transporter
1301 JAMGTO010000003.1 GCA030180825_01150 CDS open 113494-113754 _na     86_aa rpsT 30S ribosomal protein S20
1302 JAMGTO010000003.1 GCA030180825_01151 CDS open 113962-114291 _na     109_aa nitroreductase family protein
1303 JAMGTO010000003.1 GCA030180825_01152 CDS open 114512-115657 _na     381_aa Acetyltransferase
1304 JAMGTO010000003.1 GCA030180825_01153 CDS open 115757-117190 _na     477_aa leucyl aminopeptidase
1305 JAMGTO010000003.1 GCA030180825_01154 CDS open 117358-117819 _na     153_aa ywqK Toxin-antitoxin system YwqK family antitoxin
1306 JAMGTO010000003.1 GCA030180825_01155 CDS open 117885-119471 _na     528_aa RNA helicase
1307 JAMGTO010000003.1 GCA030180825_01156 CDS open 119489-120433 _na     314_aa Endolytic murein transglycosylase
1308 JAMGTO010000003.1 GCA030180825_01157 CDS open 120450-121787 _na     445_aa tRNA(Ile)-lysidine synthase
1309 JAMGTO010000003.1 GCA030180825_01158 CDS open 121784-123973 _na     729_aa ftsH ATP-dependent zinc metalloprotease FtsH
1310 JAMGTO010000003.1 GCA030180825_01159 CDS open 124063-124326 _na     87_aa rpsO 30S ribosomal protein S15
1311 JAMGTO010000003.1 GCA030180825_01160 CDS open 124386-125468 _na     360_aa YibE/F-like protein
1312 JAMGTO010000003.1 GCA030180825_01161 CDS open 125575-127107 _na     510_aa Diguanylate phosphodiesterase
1313 JAMGTO010000003.1 GCA030180825_01162 CDS open 127193-128119 _na     308_aa nikB nickel ABC transporter permease
1314 JAMGTO010000003.1 GCA030180825_01163 CDS open 128134-129000 _na     288_aa nikC nickel transporter permease
1315 JAMGTO010000003.1 GCA030180825_01164 CDS open 129021-130028 _na     335_aa nikD Nickel import system ATP-binding protein NikD
1316 JAMGTO010000003.1 GCA030180825_01165 CDS open 130018-130989 _na     323_aa oppF Oligopeptide ABC transporter%2C ATP-binding protein OppF
1317 JAMGTO010000003.1 GCA030180825_01166 CDS open 131691-134882 _na     1063_aa TonB-dependent receptor
1318 JAMGTO010000003.1 GCA030180825_01167 CDS open 135100-135306 _na     68_aa Lipoprotein
1319 JAMGTO010000003.1 GCA030180825_01168 CDS open 135275-135712 _na     145_aa Membrane protein%2C PF10097 family
1320 JAMGTO010000003.1 GCA030180825_01169 CDS open 136033-136683 _na     216_aa lemA LemA family protein
1321 JAMGTO010000003.1 GCA030180825_01170 CDS open 136730-137194 _na     154_aa YbaK/proline--tRNA ligase associated domain protein
1322 JAMGTO010000003.1 GCA030180825_01171 CDS open 137404-138411 _na     335_aa Cysteine synthase
1323 JAMGTO010000003.1 GCA030180825_01172 CDS open 138623-139282 _na     219_aa Suppressor of fused domain protein
1324 JAMGTO010000003.1 GCA030180825_01173 CDS open 139491-142238 _na     915_aa ybgF tol-pal system protein YbgF
1325 JAMGTO010000003.1 GCA030180825_01174 CDS open 142256-142624 _na     122_aa Lipoprotein
1326 JAMGTO010000003.1 GCA030180825_01175 CDS open 142638-143249 _na     203_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
1327 JAMGTO010000003.1 GCA030180825_01176 CDS open 143264-143698 _na     144_aa Transport energizing protein%2C ExbD/TolR family
1328 JAMGTO010000003.1 GCA030180825_01177 CDS open 143713-144474 _na     253_aa tonB Biopolymer transporter TonB
1329 JAMGTO010000003.1 GCA030180825_01178 CDS open 144491-145879 _na     462_aa ntrC DNA-binding transcriptional regulator NtrC
1330 JAMGTO010000003.1 GCA030180825_01179 CDS open 145883-147289 _na     468_aa dnaX DNA polymerase III subunit gamma/tau
1331 JAMGTO010000003.1 GCA030180825_01180 CDS open 147286-148110 _na     274_aa hypothetical protein
1332 JAMGTO010000003.1 GCA030180825_01181 CDS open 148132-148581 _na     149_aa rplI 50S ribosomal protein L9
1333 JAMGTO010000003.1 GCA030180825_01182 CDS open 148597-149937 _na     446_aa dnaB replicative DNA helicase
1334 JAMGTO010000003.1 GCA030180825_01183 CDS open 149952-151181 _na     409_aa Peptidase%2C U32 family
1335 JAMGTO010000003.1 GCA030180825_01184 CDS open 151189-151845 _na     218_aa L%2CD-transpeptidase catalytic domain protein
1336 JAMGTO010000003.1 GCA030180825_01185 CDS open 151885-152379 _na     164_aa PF12821 family protein
1337 JAMGTO010000003.1 GCA030180825_01186 CDS open 152380-153135 _na     251_aa Threonine/serine exporter-like N-terminal domain-containing protein
1338 JAMGTO010000003.1 GCA030180825_01187 CDS open 153122-153874 _na     250_aa Ribosomal protein L11 methyltransferase-like protein
1339 JAMGTO010000003.1 GCA030180825_01188 CDS open 154046-154969 _na     307_aa AEC family transporter
1340 JAMGTO010000003.1 GCA030180825_01189 CDS open 155189-156334 _na     381_aa Butyryl-CoA dehydrogenase
1341 JAMGTO010000003.1 GCA030180825_01190 CDS open 156372-157169 _na     265_aa Electron transfer flavoprotein subunit beta
1342 JAMGTO010000003.1 GCA030180825_01191 CDS open 157201-158211 _na     336_aa Electron transfer flavoprotein subunit alpha/FixB family protein
1343 JAMGTO010000003.1 GCA030180825_01192 CDS open 158327-159244 _na     305_aa PF03537 domain protein
1344 JAMGTO010000003.1 GCA030180825_01193 CDS open 159371-160339 _na     322_aa aspartate-semialdehyde dehydrogenase
1345 JAMGTO010000003.1 GCA030180825_01194 CDS open 160336-161673 _na     445_aa aspartate kinase
1346 JAMGTO010000003.1 GCA030180825_01195 CDS open 161670-162788 _na     372_aa Homoserine dehydrogenase
1347 JAMGTO010000003.1 GCA030180825_01196 CDS open 162890-164347 _na     485_aa thrC threonine synthase
1348 JAMGTO010000003.1 GCA030180825_01197 CDS open 164335-165225 _na     296_aa thrB homoserine kinase
1349 JAMGTO010000003.1 GCA030180825_01198 CDS open 165330-167138 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1350 JAMGTO010000003.1 GCA030180825_01199 CDS open 167156-168916 _na     586_aa Metallopeptidase family M24
1351 JAMGTO010000003.1 GCA030180825_01200 CDS open 168929-169408 _na     159_aa hypothetical protein
1352 JAMGTO010000003.1 GCA030180825_01201 CDS open 169433-170020 _na     195_aa Cytidylate kinase
1353 JAMGTO010000003.1 GCA030180825_01202 CDS open 170137-170760 _na     207_aa Hemolysin D
1354 JAMGTO010000003.1 GCA030180825_01203 CDS open 170888-172963 _na     691_aa Cadmium-exporting ATPase
1355 JAMGTO010000003.1 GCA030180825_01204 CDS open 173209-174426 _na     405_aa Aminotransferase
1356 JAMGTO010000003.1 GCA030180825_01205 CDS open 174489-175832 _na     447_aa MATE efflux family protein
1357 JAMGTO010000003.1 GCA030180825_01206 CDS open 175842-176663 _na     273_aa undecaprenyl-diphosphate phosphatase
1358 JAMGTO010000003.1 GCA030180825_01207 CDS open 176673-177671 _na     332_aa rfaD ADP-glyceromanno-heptose 6-epimerase
1359 JAMGTO010000003.1 GCA030180825_01208 CDS open 177674-178492 _na     272_aa PHP domain protein
1360 JAMGTO010000003.1 GCA030180825_01209 CDS open 178564-179304 _na     246_aa Lipoprotein
1361 JAMGTO010000003.1 GCA030180825_01210 CDS open 179325-181994 _na     889_aa secA preprotein translocase subunit SecA
1362 JAMGTO010000003.1 GCA030180825_01211 CDS open 182052-184073 _na     673_aa ligA NAD-dependent DNA ligase LigA
1363 JAMGTO010000003.1 GCA030180825_01212 CDS open 184070-185107 _na     345_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1364 JAMGTO010000003.1 GCA030180825_01213 CDS open 185117-186391 _na     424_aa Citrate transporter-like domain-containing protein
1365 JAMGTO010000003.1 GCA030180825_01214 CDS open 186406-187335 _na     309_aa CBS domain protein
1366 JAMGTO010000003.1 GCA030180825_01215 CDS open 187399-189924 _na     841_aa dhaL DhaL domain-containing protein
1367 JAMGTO010000003.1 GCA030180825_01216 CDS open 189949-190497 _na     182_aa Cupin domain protein
1368 JAMGTO010000003.1 GCA030180825_01217 CDS open 190501-191709 _na     402_aa CinA-like protein
1369 JAMGTO010000003.1 GCA030180825_01218 CDS open 191722-192225 _na     167_aa Phosphatidylglycerophosphatase A
1370 JAMGTO010000003.1 GCA030180825_01219 CDS open 192227-194395 _na     722_aa Peptidase%2C U32 family
1371 JAMGTO010000003.1 GCA030180825_01220 CDS open 194367-194969 _na     200_aa coaE dephospho-CoA kinase
1372 JAMGTO010000003.1 GCA030180825_01221 CDS open 195111-196100 _na     329_aa Transcriptional regulator
1373 JAMGTO010000003.1 GCA030180825_01222 CDS open 196214-197959 _na     581_aa ABC transporter ATP-binding protein
1374 JAMGTO010000003.1 GCA030180825_01223 CDS open 197952-199670 _na     572_aa ABC transporter ATP-binding protein
1375 JAMGTO010000003.1 GCA030180825_01224 CDS open 200005-201405 _na     466_aa tyrosine phenol-lyase
1376 JAMGTO010000003.1 GCA030180825_01225 CDS open 201647-202972 _na     441_aa Transporter
1377 JAMGTO010000003.1 GCA030180825_01226 CDS open 203164-203847 _na     227_aa FCD domain protein
1378 JAMGTO010000003.1 GCA030180825_01227 CDS open 203857-204723 _na     288_aa Transporter
1379 JAMGTO010000003.1 GCA030180825_01228 CDS open 204738-205502 _na     254_aa PHP domain protein
1380 JAMGTO010000003.1 GCA030180825_01229 CDS open 205669-205857 _na     62_aa DUF1653 domain-containing protein
1381 JAMGTO010000003.1 GCA030180825_01230 CDS open 205949-206227 _na     92_aa N-acetyltransferase
1382 JAMGTO010000003.1 GCA030180825_01231 CDS open 206412-207953 _na     513_aa abgT AbgT transporter family
1383 JAMGTO010000003.1 GCA030180825_01232 CDS open 208393-208965 _na     190_aa 4Fe-4S ferredoxin-type domain-containing protein
1384 JAMGTO010000003.1 GCA030180825_01233 CDS open 208972-210096 _na     374_aa tRNA ligase
1385 JAMGTO010000003.1 GCA030180825_01234 CDS open 210305-212536 _na     743_aa pflB formate C-acetyltransferase
1386 JAMGTO010000003.1 GCA030180825_01235 CDS open 212563-213288 _na     241_aa pflA pyruvate formate-lyase-activating protein
1387 JAMGTO010000003.1 GCA030180825_01236 CDS open 213263-213370 _na     35_aa hypothetical protein
1388 JAMGTO010000003.1 GCA030180825_01237 CDS open 213414-213974 _na     186_aa DNA polymerase III subunit epsilon
1389 JAMGTO010000003.1 GCA030180825_01238 CDS open 213996-214613 _na     205_aa cutC PF03932 family protein CutC
1390 JAMGTO010000003.1 GCA030180825_01239 CDS open 214606-216021 _na     471_aa Aspartate ammonia-lyase
1391 JAMGTO010000003.1 GCA030180825_01027 gene open 798-1199 tnpA
1392 JAMGTO010000003.1 GCA030180825_01028 gene open 1647-2399 cas6
1393 JAMGTO010000003.1 GCA030180825_01029 gene open 2389-3819 cas8a1
1394 JAMGTO010000003.1 GCA030180825_01030 gene open 3841-4722 cas7i
1395 JAMGTO010000003.1 GCA030180825_01031 gene open 4736-5845
1396 JAMGTO010000003.1 GCA030180825_01032 gene open 5856-8057
1397 JAMGTO010000003.1 GCA030180825_01033 gene open 8078-8572 cas4
1398 JAMGTO010000003.1 GCA030180825_01034 gene open 8583-9575 cas1b
1399 JAMGTO010000003.1 GCA030180825_01035 gene open 9582-9860 cas2
1400 JAMGTO010000003.1 GCA030180825_01036 gene open 11509-12105 lexA
1401 JAMGTO010000003.1 GCA030180825_01037 gene open 12580-12699
1402 JAMGTO010000003.1 GCA030180825_01038 gene open 12668-13156
1403 JAMGTO010000003.1 GCA030180825_01039 gene open 13235-13489
1404 JAMGTO010000003.1 GCA030180825_01040 gene open 13532-14131
1405 JAMGTO010000003.1 GCA030180825_01041 gene open 14136-14900
1406 JAMGTO010000003.1 GCA030180825_01042 gene open 14988-15089
1407 JAMGTO010000003.1 GCA030180825_01043 gene open 15090-15491
1408 JAMGTO010000003.1 GCA030180825_01044 gene open 15501-17387
1409 JAMGTO010000003.1 GCA030180825_01045 gene open 17401-18369
1410 JAMGTO010000003.1 GCA030180825_01046 gene open 18379-18570
1411 JAMGTO010000003.1 GCA030180825_01047 gene open 18586-18819
1412 JAMGTO010000003.1 GCA030180825_01048 gene open 18867-19073
1413 JAMGTO010000003.1 GCA030180825_01049 gene open 19070-19717
1414 JAMGTO010000003.1 GCA030180825_01050 gene open 19722-20123
1415 JAMGTO010000003.1 GCA030180825_01051 gene open 20113-20451
1416 JAMGTO010000003.1 GCA030180825_01052 gene open 20448-20675
1417 JAMGTO010000003.1 GCA030180825_01053 gene open 20782-21378
1418 JAMGTO010000003.1 GCA030180825_01054 gene open 21344-21649
1419 JAMGTO010000003.1 GCA030180825_01055 gene open 21768-22808
1420 JAMGTO010000003.1 GCA030180825_01056 gene open 22908-23276
1421 JAMGTO010000003.1 GCA030180825_01057 gene open 23290-23526
1422 JAMGTO010000003.1 GCA030180825_01058 gene open 23981-24169
1423 JAMGTO010000003.1 GCA030180825_01059 gene open 24171-24659
1424 JAMGTO010000003.1 GCA030180825_01060 gene open 24680-24898
1425 JAMGTO010000003.1 GCA030180825_01061 gene open 25044-25448
1426 JAMGTO010000003.1 GCA030180825_01062 gene open 25411-26679
1427 JAMGTO010000003.1 GCA030180825_01063 gene open 26669-27922
1428 JAMGTO010000003.1 GCA030180825_01064 gene open 27919-28659
1429 JAMGTO010000003.1 GCA030180825_01065 gene open 28668-30473
1430 JAMGTO010000003.1 GCA030180825_01066 gene open 30517-31032
1431 JAMGTO010000003.1 GCA030180825_01067 gene open 31035-31532
1432 JAMGTO010000003.1 GCA030180825_01068 gene open 31535-31873
1433 JAMGTO010000003.1 GCA030180825_01069 gene open 31863-32366
1434 JAMGTO010000003.1 GCA030180825_01070 gene open 32380-33423
1435 JAMGTO010000003.1 GCA030180825_01071 gene open 33423-33815
1436 JAMGTO010000003.1 GCA030180825_01072 gene open 33817-34191
1437 JAMGTO010000003.1 GCA030180825_01073 gene open 34342-36399
1438 JAMGTO010000003.1 GCA030180825_01074 gene open 36401-37000
1439 JAMGTO010000003.1 GCA030180825_01075 gene open 37003-37329
1440 JAMGTO010000003.1 GCA030180825_01076 gene open 37331-38242
1441 JAMGTO010000003.1 GCA030180825_01077 gene open 38239-38823
1442 JAMGTO010000003.1 GCA030180825_01078 gene open 38820-39158
1443 JAMGTO010000003.1 GCA030180825_01079 gene open 39151-40248
1444 JAMGTO010000003.1 GCA030180825_01080 gene open 40255-40881
1445 JAMGTO010000003.1 GCA030180825_01081 gene open 40878-42110
1446 JAMGTO010000003.1 GCA030180825_01082 gene open 43062-44027
1447 JAMGTO010000003.1 GCA030180825_01083 gene open 44261-44800
1448 JAMGTO010000003.1 GCA030180825_01084 gene open 44818-45258
1449 JAMGTO010000003.1 GCA030180825_01085 gene open 45279-45572
1450 JAMGTO010000003.1 GCA030180825_01086 gene open 45581-46030
1451 JAMGTO010000003.1 GCA030180825_01087 gene open 46049-46513
1452 JAMGTO010000003.1 GCA030180825_01088 gene open 46602-46778 copG
1453 JAMGTO010000003.1 GCA030180825_01089 gene open 46902-47027
1454 JAMGTO010000003.1 GCA030180825_01090 gene open 47020-47628
1455 JAMGTO010000003.1 GCA030180825_01091 gene open 50028-51305
1456 JAMGTO010000003.1 GCA030180825_01093 gene open 51932-53644 argS
1457 JAMGTO010000003.1 GCA030180825_01094 gene open 53831-54799
1458 JAMGTO010000003.1 GCA030180825_01095 gene open 55095-56000 pyrB
1459 JAMGTO010000003.1 GCA030180825_01096 gene open 56010-56810
1460 JAMGTO010000003.1 GCA030180825_01097 gene open 56820-57740
1461 JAMGTO010000003.1 GCA030180825_01098 gene open 57745-58461 pyrF
1462 JAMGTO010000003.1 GCA030180825_01099 gene open 58455-59672
1463 JAMGTO010000003.1 GCA030180825_01100 gene open 59665-60288
1464 JAMGTO010000003.1 GCA030180825_01101 gene open 60441-60731
1465 JAMGTO010000003.1 GCA030180825_01102 gene open 60709-61569 nadC
1466 JAMGTO010000003.1 GCA030180825_01103 gene open 61562-62080
1467 JAMGTO010000003.1 GCA030180825_01104 gene open 62159-62908 iclR
1468 JAMGTO010000003.1 GCA030180825_01105 gene open 63329-64399
1469 JAMGTO010000003.1 GCA030180825_01106 gene open 64425-65813
1470 JAMGTO010000003.1 GCA030180825_01107 gene open 66055-66345
1471 JAMGTO010000003.1 GCA030180825_01108 gene open 66377-67687
1472 JAMGTO010000003.1 GCA030180825_01109 gene open 67843-68190
1473 JAMGTO010000003.1 GCA030180825_01110 gene open 68177-68890
1474 JAMGTO010000003.1 GCA030180825_01111 gene open 68900-70423
1475 JAMGTO010000003.1 GCA030180825_01112 gene open 70445-71197
1476 JAMGTO010000003.1 GCA030180825_01113 gene open 71247-71927
1477 JAMGTO010000003.1 GCA030180825_01114 gene open 72042-73190 metK
1478 JAMGTO010000003.1 GCA030180825_01115 gene open 73388-74272 galU
1479 JAMGTO010000003.1 GCA030180825_01116 gene open 74301-76241 metG
1480 JAMGTO010000003.1 GCA030180825_01117 gene open 76234-76902
1481 JAMGTO010000003.1 GCA030180825_01118 gene open 76997-77356
1482 JAMGTO010000003.1 GCA030180825_01119 gene open 77424-79118
1483 JAMGTO010000003.1 GCA030180825_01120 gene open 79127-80902 pepF
1484 JAMGTO010000003.1 GCA030180825_01121 gene open 80917-82206
1485 JAMGTO010000003.1 GCA030180825_01122 gene open 82253-82636
1486 JAMGTO010000003.1 GCA030180825_01123 gene open 82899-83339
1487 JAMGTO010000003.1 GCA030180825_01124 gene open 83336-84097
1488 JAMGTO010000003.1 GCA030180825_01125 gene open 84285-84938
1489 JAMGTO010000003.1 GCA030180825_01126 gene open 84938-85762
1490 JAMGTO010000003.1 GCA030180825_01127 gene open 85902-86630
1491 JAMGTO010000003.1 GCA030180825_01128 gene open 87049-88263
1492 JAMGTO010000003.1 GCA030180825_01129 gene open 88323-89591
1493 JAMGTO010000003.1 GCA030180825_01130 gene open 89768-90421 ccdA
1494 JAMGTO010000003.1 GCA030180825_01131 gene open 90461-91135
1495 JAMGTO010000003.1 GCA030180825_01132 gene open 91198-92088 msrB
1496 JAMGTO010000003.1 GCA030180825_01133 gene open 92102-92878
1497 JAMGTO010000003.1 GCA030180825_01134 gene open 92865-94520
1498 JAMGTO010000003.1 GCA030180825_01135 gene open 94691-95173 nuoE
1499 JAMGTO010000003.1 GCA030180825_01136 gene open 95186-96970 hymB
1500 JAMGTO010000003.1 GCA030180825_01137 gene open 96987-98690