BAKTAGenome Explorer: Peptoniphilus harei (GCA_030223965.1)
Select a Genome:
|
BAKTA Annotations for GCA_030223965.1
|
Search & Sort all 3723 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JASOTL010000001.1 | GCA030223965_00594 | gene | open | 585383-585726 | ssrA | ||
| 2 | JASOTL010000001.1 | GCA030223965_00594 | tmRNA | open | 585383-585726 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | JASOTL010000001.1 | rep_origin | open | 500146-500568 | ||||
| 4 | JASOTL010000001.1 | GCA030223965_00143 | gene | open | 90456-90587 | SpR18_sRNA | ||
| 5 | JASOTL010000001.1 | GCA030223965_00149 | gene | open | 96353-96485 | SpR18_sRNA | ||
| 6 | JASOTL010000001.1 | GCA030223965_00211 | gene | open | 162433-162597 | sRNA_0030 | ||
| 7 | JASOTL010000001.1 | GCA030223965_00743 | gene | open | 750311-750495 | 6S | ||
| 8 | JASOTL010000001.1 | GCA030223965_00143 | ncRNA | open | 90456-90587 | Streptococcus sRNA SpR18 | ||
| 9 | JASOTL010000001.1 | GCA030223965_00149 | ncRNA | open | 96353-96485 | Streptococcus sRNA SpR18 | ||
| 10 | JASOTL010000001.1 | GCA030223965_00211 | ncRNA | open | 162433-162597 | Enterococcus sRNA 30 | ||
| 11 | JASOTL010000001.1 | GCA030223965_00743 | ncRNA | open | 750311-750495 | 6S / SsrS RNA | ||
| 12 | JASOTL010000001.1 | regulatory_region | open | 21074-21195 | Ribosomal protein L10 leader | |||
| 13 | JASOTL010000001.1 | regulatory_region | open | 56900-57012 | FMN riboswitch aptamer (RFN element) | |||
| 14 | JASOTL010000001.1 | regulatory_region | open | 71171-71372 | T-box leader | |||
| 15 | JASOTL010000001.1 | regulatory_region | open | 165259-165488 | Cis-regulator of HTH transcription factor | |||
| 16 | JASOTL010000001.1 | regulatory_region | open | 166716-166813 | pemK RNA | |||
| 17 | JASOTL010000001.1 | regulatory_region | open | 435140-435362 | T-box leader | |||
| 18 | JASOTL010000001.1 | regulatory_region | open | 513009-513238 | T-box leader | |||
| 19 | JASOTL010000001.1 | regulatory_region | open | 514636-514860 | T-box leader | |||
| 20 | JASOTL010000001.1 | regulatory_region | open | 643179-643265 | SAM riboswitch aptamer (S box leader) | |||
| 21 | JASOTL010000001.1 | regulatory_region | open | 650834-651003 | Lysine riboswitch aptamer | |||
| 22 | JASOTL010000001.1 | regulatory_region | open | 692562-692807 | T-box leader | |||
| 23 | JASOTL010000001.1 | repeat_region | open | 340376-341017 | CRISPR array with 10 repeats of length 31%2C consensus sequence ATTTCAATCCACGCACTCACGAGGAGTGCGA and spacer length 35 | |||
| 24 | JASOTL010000001.1 | repeat_region | open | 341044-345646 | CRISPR array with 69 repeats of length 32%2C consensus sequence ATTTCAATCCACGCACCCGCGAGGGGTGCGAC and spacer length 35 | |||
| 25 | JASOTL010000001.1 | GCA030223965_00060 | CDS | open | 721-954 | _na 77_aa | hypothetical protein | |
| 26 | JASOTL010000001.1 | GCA030223965_00061 | CDS | open | 1117-1587 | _na 156_aa | Phosphohydrolase | |
| 27 | JASOTL010000001.1 | GCA030223965_00062 | CDS | open | 1584-2285 | _na 233_aa | ABC transporter permease | |
| 28 | JASOTL010000001.1 | GCA030223965_00063 | CDS | open | 2516-4249 | _na 577_aa | pyk | pyruvate kinase |
| 29 | JASOTL010000001.1 | GCA030223965_00064 | CDS | open | 4259-5212 | _na 317_aa | pfkA | ATP-dependent 6-phosphofructokinase |
| 30 | JASOTL010000001.1 | GCA030223965_00065 | CDS | open | 5219-8644 | _na 1141_aa | dnaE | DNA polymerase III subunit alpha |
| 31 | JASOTL010000001.1 | GCA030223965_00066 | CDS | open | 8905-9171 | _na 88_aa | ptsH | Phosphocarrier protein HPr |
| 32 | JASOTL010000001.1 | GCA030223965_00067 | CDS | open | 9173-10108 | _na 311_aa | whiA | DNA-binding protein WhiA |
| 33 | JASOTL010000001.1 | GCA030223965_00068 | CDS | open | 10295-11383 | _na 362_aa | surA | peptidylprolyl isomerase |
| 34 | JASOTL010000001.1 | GCA030223965_00069 | CDS | open | 11436-14915 | _na 1159_aa | mfd | transcription-repair coupling factor |
| 35 | JASOTL010000001.1 | GCA030223965_00070 | CDS | open | 14924-15493 | _na 189_aa | pth | aminoacyl-tRNA hydrolase |
| 36 | JASOTL010000001.1 | GCA030223965_00071 | CDS | open | 15503-16453 | _na 316_aa | prsA | Ribose-phosphate pyrophosphokinase |
| 37 | JASOTL010000001.1 | GCA030223965_00072 | CDS | open | 16467-17846 | _na 459_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 38 | JASOTL010000001.1 | GCA030223965_00073 | CDS | open | 18007-18144 | _na 45_aa | hypothetical protein | |
| 39 | JASOTL010000001.1 | GCA030223965_00074 | CDS | open | 18495-19385 | _na 296_aa | cysK | cysteine synthase A |
| 40 | JASOTL010000001.1 | GCA030223965_00075 | CDS | open | 19378-19929 | _na 183_aa | epsC | serine O-acetyltransferase EpsC |
| 41 | JASOTL010000001.1 | GCA030223965_00076 | CDS | open | 20091-20477 | _na 128_aa | rplL | 50S ribosomal protein L7/L12 |
| 42 | JASOTL010000001.1 | GCA030223965_00077 | CDS | open | 20529-21119 | _na 196_aa | rplJ | 50S ribosomal protein L10 |
| 43 | JASOTL010000001.1 | GCA030223965_00078 | CDS | open | 21686-22327 | _na 213_aa | yitT | YitT family protein |
| 44 | JASOTL010000001.1 | GCA030223965_00079 | CDS | open | 22797-23498 | _na 233_aa | rplA | 50S ribosomal protein L1 |
| 45 | JASOTL010000001.1 | GCA030223965_00080 | CDS | open | 23538-23963 | _na 141_aa | rplK | 50S ribosomal protein L11 |
| 46 | JASOTL010000001.1 | GCA030223965_00081 | CDS | open | 24011-24553 | _na 180_aa | nusG | transcription termination/antitermination protein NusG |
| 47 | JASOTL010000001.1 | GCA030223965_00082 | CDS | open | 24568-24783 | _na 71_aa | secE | preprotein translocase subunit SecE |
| 48 | JASOTL010000001.1 | GCA030223965_00083 | CDS | open | 24793-24942 | _na 49_aa | rpmG | 50S ribosomal protein L33 |
| 49 | JASOTL010000001.1 | GCA030223965_00084 | CDS | open | 25128-26015 | _na 295_aa | CAAX amino terminal protease family protein | |
| 50 | JASOTL010000001.1 | GCA030223965_00085 | CDS | open | 26048-28348 | _na 766_aa | dinG | DEAD2 domain protein |
| 51 | JASOTL010000001.1 | GCA030223965_00086 | CDS | open | 28378-28842 | _na 154_aa | trmL | Putative tRNA (cytidine(34)-2'-O)-methyltransferase |
| 52 | JASOTL010000001.1 | GCA030223965_00087 | CDS | open | 28836-30392 | _na 518_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 53 | JASOTL010000001.1 | GCA030223965_00088 | CDS | open | 30499-31653 | _na 384_aa | histidine kinase | |
| 54 | JASOTL010000001.1 | GCA030223965_00089 | CDS | open | 31640-32314 | _na 224_aa | ompR | Response regulator ArlR |
| 55 | JASOTL010000001.1 | GCA030223965_00090 | CDS | open | 32311-32787 | _na 158_aa | dihydrofolate reductase | |
| 56 | JASOTL010000001.1 | GCA030223965_00092 | CDS | open | 33136-33591 | _na 151_aa | Glyoxalase family protein | |
| 57 | JASOTL010000001.1 | GCA030223965_00093 | CDS | open | 33782-35047 | _na 421_aa | gdhA | Glutamate dehydrogenase |
| 58 | JASOTL010000001.1 | GCA030223965_00094 | CDS | open | 35464-36348 | _na 294_aa | yitT | Putative membrane protein |
| 59 | JASOTL010000001.1 | GCA030223965_00095 | CDS | open | 36565-37260 | _na 231_aa | CAAX amino terminal protease family protein | |
| 60 | JASOTL010000001.1 | GCA030223965_00096 | CDS | open | 37253-37792 | _na 179_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 61 | JASOTL010000001.1 | GCA030223965_00097 | CDS | open | 37785-40397 | _na 870_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 62 | JASOTL010000001.1 | GCA030223965_00098 | CDS | open | 40378-41367 | _na 329_aa | Pseudouridine synthase | |
| 63 | JASOTL010000001.1 | GCA030223965_00099 | CDS | open | 41441-42127 | _na 228_aa | YceG-like family protein | |
| 64 | JASOTL010000001.1 | GCA030223965_00100 | CDS | open | 43050-44135 | _na 361_aa | pepP | putative peptidase SA1530 |
| 65 | JASOTL010000001.1 | GCA030223965_00101 | CDS | open | 45505-45723 | _na 72_aa | DUF2922 domain-containing protein | |
| 66 | JASOTL010000001.1 | GCA030223965_00102 | CDS | open | 45810-46031 | _na 73_aa | DUF1659 domain-containing protein | |
| 67 | JASOTL010000001.1 | GCA030223965_00103 | CDS | open | 46115-46591 | _na 158_aa | N-acetylmuramoyl-L-alanine amidase | |
| 68 | JASOTL010000001.1 | GCA030223965_00104 | CDS | open | 46604-47344 | _na 246_aa | Sigma-70%2C region 4 | |
| 69 | JASOTL010000001.1 | GCA030223965_00105 | CDS | open | 48744-49433 | _na 229_aa | SMODS and SLOG-associating 2TM effector domain-containing protein | |
| 70 | JASOTL010000001.1 | GCA030223965_00106 | CDS | open | 49516-52245 | _na 909_aa | SLH domain-containing protein | |
| 71 | JASOTL010000001.1 | GCA030223965_00107 | CDS | open | 53025-53348 | _na 107_aa | Addiction module toxin%2C RelE/StbE family | |
| 72 | JASOTL010000001.1 | GCA030223965_00108 | CDS | open | 53345-53665 | _na 106_aa | Antitoxin | |
| 73 | JASOTL010000001.1 | GCA030223965_00109 | CDS | open | 54984-56108 | _na 374_aa | pucG | Purine catabolism protein PucG |
| 74 | JASOTL010000001.1 | GCA030223965_00110 | CDS | open | 56242-56847 | _na 201_aa | fmnP | Riboflavin transporter |
| 75 | JASOTL010000001.1 | GCA030223965_00111 | CDS | open | 57118-58557 | _na 479_aa | L%2CD-TPase catalytic domain-containing protein | |
| 76 | JASOTL010000001.1 | GCA030223965_00112 | CDS | open | 58698-59267 | _na 189_aa | fic | protein adenylyltransferase Fic |
| 77 | JASOTL010000001.1 | GCA030223965_00114 | CDS | open | 59763-60692 | _na 309_aa | mdh | L-lactate dehydrogenase |
| 78 | JASOTL010000001.1 | GCA030223965_00115 | CDS | open | 60721-61122 | _na 133_aa | Zn-finger containing protein | |
| 79 | JASOTL010000001.1 | GCA030223965_00116 | CDS | open | 61188-62351 | _na 387_aa | abgB | Peptidase M20 domain-containing protein 2 |
| 80 | JASOTL010000001.1 | GCA030223965_00117 | CDS | open | 62371-63759 | _na 462_aa | C4-dicarboxylate anaerobic carrier | |
| 81 | JASOTL010000001.1 | GCA030223965_00118 | CDS | open | 63934-64221 | _na 95_aa | lysR | LysR family transcriptional regulator |
| 82 | JASOTL010000001.1 | GCA030223965_00119 | CDS | open | 64227-64820 | _na 197_aa | lysR | LysR substrate binding domain protein |
| 83 | JASOTL010000001.1 | GCA030223965_00120 | CDS | open | 64953-65846 | _na 297_aa | Copper amine oxidase-like N-terminal domain-containing protein | |
| 84 | JASOTL010000001.1 | GCA030223965_00121 | CDS | open | 65961-67079 | _na 372_aa | Copper amine oxidase N-terminal domain protein | |
| 85 | JASOTL010000001.1 | GCA030223965_00122 | CDS | open | 67149-68447 | _na 432_aa | folC | tetrahydrofolate synthase |
| 86 | JASOTL010000001.1 | GCA030223965_00123 | CDS | open | 68444-71095 | _na 883_aa | valS | valine--tRNA ligase |
| 87 | JASOTL010000001.1 | GCA030223965_00124 | CDS | open | 71360-72151 | _na 263_aa | hypothetical protein | |
| 88 | JASOTL010000001.1 | GCA030223965_00125 | CDS | open | 72215-73207 | _na 330_aa | trpS | tryptophan--tRNA ligase |
| 89 | JASOTL010000001.1 | GCA030223965_00126 | CDS | open | 73197-74120 | _na 307_aa | CAAX amino terminal protease family protein | |
| 90 | JASOTL010000001.1 | GCA030223965_00127 | CDS | open | 74062-75345 | _na 427_aa | ssnA | 5-methylthioadenosine/S-adenosylhomocysteine deaminase |
| 91 | JASOTL010000001.1 | GCA030223965_00128 | CDS | open | 75449-76096 | _na 215_aa | yadS | Glycine transporter domain-containing protein |
| 92 | JASOTL010000001.1 | GCA030223965_00129 | CDS | open | 76107-76418 | _na 103_aa | Thiamine-binding protein domain-containing protein | |
| 93 | JASOTL010000001.1 | GCA030223965_00130 | CDS | open | 76601-77563 | _na 320_aa | Peptidase family T4 | |
| 94 | JASOTL010000001.1 | GCA030223965_00131 | CDS | open | 77613-78362 | _na 249_aa | ECF transporter S component | |
| 95 | JASOTL010000001.1 | GCA030223965_00132 | CDS | open | 78364-79146 | _na 260_aa | coaX | Type III pantothenate kinase |
| 96 | JASOTL010000001.1 | GCA030223965_00133 | CDS | open | 79165-79995 | _na 276_aa | murI | glutamate racemase |
| 97 | JASOTL010000001.1 | GCA030223965_00135 | CDS | open | 80330-80998 | _na 222_aa | gntR | Transcriptional regulator%2C GntR family |
| 98 | JASOTL010000001.1 | GCA030223965_00136 | CDS | open | 81193-81816 | _na 207_aa | PepSY domain-containing protein | |
| 99 | JASOTL010000001.1 | GCA030223965_00137 | CDS | open | 82036-82338 | _na 100_aa | DUF3870 domain-containing protein | |
| 100 | JASOTL010000001.1 | GCA030223965_00138 | CDS | open | 82340-83128 | _na 262_aa | Beta-lactamase class A catalytic domain-containing protein | |
| 101 | JASOTL010000001.1 | GCA030223965_00139 | CDS | open | 83154-84335 | _na 393_aa | DUF819 domain-containing protein | |
| 102 | JASOTL010000001.1 | GCA030223965_00140 | CDS | open | 84388-85482 | _na 364_aa | Dipeptide epimerase | |
| 103 | JASOTL010000001.1 | GCA030223965_00141 | CDS | open | 85955-88693 | _na 912_aa | secA | preprotein translocase subunit SecA |
| 104 | JASOTL010000001.1 | GCA030223965_00142 | CDS | open | 88910-90430 | _na 506_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 105 | JASOTL010000001.1 | GCA030223965_00144 | CDS | open | 91406-91534 | _na 42_aa | hypothetical protein | |
| 106 | JASOTL010000001.1 | GCA030223965_00145 | CDS | open | 91663-91932 | _na 89_aa | transposase | |
| 107 | JASOTL010000001.1 | GCA030223965_00146 | CDS | open | 92265-92714 | _na 149_aa | CopY/TcrY family copper transport repressor | |
| 108 | JASOTL010000001.1 | GCA030223965_00147 | CDS | open | 92734-94836 | _na 700_aa | zntA | P-type Cu(+) transporter |
| 109 | JASOTL010000001.1 | GCA030223965_00148 | CDS | open | 95036-95428 | _na 130_aa | Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein | |
| 110 | JASOTL010000001.1 | GCA030223965_00150 | CDS | open | 97119-97544 | _na 141_aa | HTH marR-type domain-containing protein | |
| 111 | JASOTL010000001.1 | GCA030223965_00151 | CDS | open | 97546-97908 | _na 120_aa | Lipoprotein | |
| 112 | JASOTL010000001.1 | GCA030223965_00152 | CDS | open | 98313-100844 | _na 843_aa | mgtA | magnesium-translocating P-type ATPase |
| 113 | JASOTL010000001.1 | GCA030223965_00153 | CDS | open | 101196-102506 | _na 436_aa | metL1 | aspartate kinase |
| 114 | JASOTL010000001.1 | GCA030223965_00154 | CDS | open | 102509-103486 | _na 325_aa | asd | aspartate-semialdehyde dehydrogenase |
| 115 | JASOTL010000001.1 | GCA030223965_00155 | CDS | open | 103488-104669 | _na 393_aa | thrA | Homoserine dehydrogenase |
| 116 | JASOTL010000001.1 | GCA030223965_00156 | CDS | open | 104666-106960 | _na 764_aa | thrB | homoserine kinase |
| 117 | JASOTL010000001.1 | GCA030223965_00157 | CDS | open | 107056-108468 | _na 470_aa | Aldehyde dehydrogenase (NAD) family protein | |
| 118 | JASOTL010000001.1 | GCA030223965_00158 | CDS | open | 108449-109285 | _na 278_aa | eutJ | ethanolamine utilization protein EutJ |
| 119 | JASOTL010000001.1 | GCA030223965_00159 | CDS | open | 109290-109937 | _na 215_aa | Phosphate propanoyltransferase | |
| 120 | JASOTL010000001.1 | GCA030223965_00160 | CDS | open | 109951-110814 | _na 287_aa | Permease | |
| 121 | JASOTL010000001.1 | GCA030223965_00161 | CDS | open | 110822-111967 | _na 381_aa | metK | methionine adenosyltransferase |
| 122 | JASOTL010000001.1 | GCA030223965_00162 | CDS | open | 111972-112973 | _na 333_aa | araC | Transcriptional regulator%2C AraC family |
| 123 | JASOTL010000001.1 | GCA030223965_00163 | CDS | open | 112983-114269 | _na 428_aa | pocR | PocR domain-containing protein |
| 124 | JASOTL010000001.1 | GCA030223965_00164 | CDS | open | 114314-115423 | _na 369_aa | Putative NADPH-dependent butanol dehydrogenase | |
| 125 | JASOTL010000001.1 | GCA030223965_00165 | CDS | open | 115542-116747 | _na 401_aa | Aldehyde dehydrogenase (NAD) family protein | |
| 126 | JASOTL010000001.1 | GCA030223965_00166 | CDS | open | 116756-117019 | _na 87_aa | ccmL | Carbon dioxide concentrating mechanism protein CcmL |
| 127 | JASOTL010000001.1 | GCA030223965_00167 | CDS | open | 117027-117560 | _na 177_aa | BMC domain protein | |
| 128 | JASOTL010000001.1 | GCA030223965_00168 | CDS | open | 117553-118077 | _na 174_aa | hypothetical protein | |
| 129 | JASOTL010000001.1 | GCA030223965_00169 | CDS | open | 118163-118444 | _na 93_aa | pduA | propanediol utilization microcompartment protein PduA |
| 130 | JASOTL010000001.1 | GCA030223965_00170 | CDS | open | 118469-119254 | _na 261_aa | pduB | propanediol utilization microcompartment protein PduB |
| 131 | JASOTL010000001.1 | GCA030223965_00171 | CDS | open | 119265-120182 | _na 305_aa | Putative pyruvate formate-lyase 1-activating enzyme | |
| 132 | JASOTL010000001.1 | GCA030223965_00172 | CDS | open | 120196-122769 | _na 857_aa | Formate C-acetyltransferase | |
| 133 | JASOTL010000001.1 | GCA030223965_00173 | CDS | open | 123058-123588 | _na 176_aa | BMC domain protein | |
| 134 | JASOTL010000001.1 | GCA030223965_00174 | CDS | open | 123579-125297 | _na 572_aa | Tetratricopeptide repeat protein | |
| 135 | JASOTL010000001.1 | GCA030223965_00175 | CDS | open | 125305-125895 | _na 196_aa | DUF4125 domain-containing protein | |
| 136 | JASOTL010000001.1 | GCA030223965_00176 | CDS | open | 126155-126661 | _na 168_aa | eCF-S | ECF transporter S component |
| 137 | JASOTL010000001.1 | GCA030223965_00177 | CDS | open | 126717-127442 | _na 241_aa | Fic family protein | |
| 138 | JASOTL010000001.1 | GCA030223965_00178 | CDS | open | 127538-128458 | _na 306_aa | hslO | Hsp33 family molecular chaperone HslO |
| 139 | JASOTL010000001.1 | GCA030223965_00179 | CDS | open | 128461-129186 | _na 241_aa | Methyltransferase | |
| 140 | JASOTL010000001.1 | GCA030223965_00180 | CDS | open | 129183-129920 | _na 245_aa | sIR2 | protein acetyllysine N-acetyltransferase |
| 141 | JASOTL010000001.1 | GCA030223965_00181 | CDS | open | 129932-130879 | _na 315_aa | ydiL | CAAX amino terminal protease family protein |
| 142 | JASOTL010000001.1 | GCA030223965_00182 | CDS | open | 130833-131360 | _na 175_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 143 | JASOTL010000001.1 | GCA030223965_00183 | CDS | open | 131458-131982 | _na 174_aa | DUF4364 domain-containing protein | |
| 144 | JASOTL010000001.1 | GCA030223965_00184 | CDS | open | 132050-134125 | _na 691_aa | zntA | Cd(2+)-exporting ATPase |
| 145 | JASOTL010000001.1 | GCA030223965_00185 | CDS | open | 134127-134444 | _na 105_aa | DUF1490 domain-containing protein | |
| 146 | JASOTL010000001.1 | GCA030223965_00186 | CDS | open | 134884-136554 | _na 556_aa | histidine kinase | |
| 147 | JASOTL010000001.1 | GCA030223965_00187 | CDS | open | 136556-137236 | _na 226_aa | ompR | Response regulator ArlR |
| 148 | JASOTL010000001.1 | GCA030223965_00188 | CDS | open | 137267-137905 | _na 212_aa | phoU | phosphate signaling complex protein PhoU |
| 149 | JASOTL010000001.1 | GCA030223965_00189 | CDS | open | 137905-138660 | _na 251_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 150 | JASOTL010000001.1 | GCA030223965_00190 | CDS | open | 138660-139541 | _na 293_aa | pstA | phosphate ABC transporter permease PstA |
| 151 | JASOTL010000001.1 | GCA030223965_00191 | CDS | open | 139534-140442 | _na 302_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 152 | JASOTL010000001.1 | GCA030223965_00192 | CDS | open | 140460-141362 | _na 300_aa | Phosphate ABC transporter%2C phosphate-binding protein | |
| 153 | JASOTL010000001.1 | GCA030223965_00193 | CDS | open | 141537-142046 | _na 169_aa | niaR | putative transcription repressor NiaR |
| 154 | JASOTL010000001.1 | GCA030223965_00194 | CDS | open | 142054-142899 | _na 281_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 155 | JASOTL010000001.1 | GCA030223965_00195 | CDS | open | 142871-144133 | _na 420_aa | nadB | L-aspartate oxidase |
| 156 | JASOTL010000001.1 | GCA030223965_00196 | CDS | open | 144135-145052 | _na 305_aa | nadA | quinolinate synthase NadA |
| 157 | JASOTL010000001.1 | GCA030223965_00197 | CDS | open | 145346-146356 | _na 336_aa | gcvT | Aminomethyltransferase |
| 158 | JASOTL010000001.1 | GCA030223965_00198 | CDS | open | 146523-149003 | _na 826_aa | Efflux ABC transporter%2C permease protein | |
| 159 | JASOTL010000001.1 | GCA030223965_00199 | CDS | open | 148987-149664 | _na 225_aa | lolD | ABC transporter domain-containing protein |
| 160 | JASOTL010000001.1 | GCA030223965_00200 | CDS | open | 149753-150550 | _na 265_aa | kdpD | histidine kinase |
| 161 | JASOTL010000001.1 | GCA030223965_00201 | CDS | open | 150920-151234 | _na 104_aa | Conjugal transfer protein | |
| 162 | JASOTL010000001.1 | GCA030223965_00202 | CDS | open | 151253-151636 | _na 127_aa | Conjugative transposon protein | |
| 163 | JASOTL010000001.1 | GCA030223965_00203 | CDS | open | 151676-153070 | _na 464_aa | ftsK | FtsK domain-containing protein |
| 164 | JASOTL010000001.1 | GCA030223965_00204 | CDS | open | 153303-154451 | _na 382_aa | mobT | MobT family relaxase |
| 165 | JASOTL010000001.1 | GCA030223965_00205 | CDS | open | 154494-154715 | _na 73_aa | Conjugal transfer protein | |
| 166 | JASOTL010000001.1 | GCA030223965_00206 | CDS | open | 154832-155329 | _na 165_aa | Conjugative transposon protein | |
| 167 | JASOTL010000001.1 | GCA030223965_00207 | CDS | open | 155719-158166 | _na 815_aa | virB4 | ATP/GTP-binding protein |
| 168 | JASOTL010000001.1 | GCA030223965_00208 | CDS | open | 158169-160346 | _na 725_aa | ytxH | YtxH domain-containing protein |
| 169 | JASOTL010000001.1 | GCA030223965_00209 | CDS | open | 160343-161344 | _na 333_aa | nlpC | NlpC/P60 domain-containing protein |
| 170 | JASOTL010000001.1 | GCA030223965_00210 | CDS | open | 161341-162276 | _na 311_aa | Conjugal transfer protein | |
| 171 | JASOTL010000001.1 | GCA030223965_00213 | CDS | open | 162653-164572 | _na 639_aa | tet(M) | tetracycline resistance ribosomal protection protein Tet(M) |
| 172 | JASOTL010000001.1 | GCA030223965_00214 | CDS | open | 164918-165271 | _na 117_aa | hipB | HTH cro/C1-type domain-containing protein |
| 173 | JASOTL010000001.1 | GCA030223965_00215 | CDS | open | 165776-166201 | _na 141_aa | rpoE | RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein |
| 174 | JASOTL010000001.1 | GCA030223965_00216 | CDS | open | 166198-166428 | _na 76_aa | Helix-turn-helix conjugative transposon-like domain-containing protein | |
| 175 | JASOTL010000001.1 | GCA030223965_00217 | CDS | open | 166890-167093 | _na 67_aa | DNA binding domain%2C excisionase family | |
| 176 | JASOTL010000001.1 | GCA030223965_00218 | CDS | open | 167175-168392 | _na 405_aa | xerD | Integrase |
| 177 | JASOTL010000001.1 | GCA030223965_00219 | CDS | open | 168605-169273 | _na 222_aa | ompR | Response regulator receiver domain-containing protein |
| 178 | JASOTL010000001.1 | GCA030223965_00220 | CDS | open | 169635-173636 | _na 1333_aa | Efflux ABC transporter%2C permease protein | |
| 179 | JASOTL010000001.1 | GCA030223965_00221 | CDS | open | 173644-174411 | _na 255_aa | lolD | Lipoprotein-releasing system ATP-binding protein LolD |
| 180 | JASOTL010000001.1 | GCA030223965_00222 | CDS | open | 174510-174965 | _na 151_aa | smpB | SsrA-binding protein SmpB |
| 181 | JASOTL010000001.1 | GCA030223965_00223 | CDS | open | 174958-177060 | _na 700_aa | rnr | ribonuclease R |
| 182 | JASOTL010000001.1 | GCA030223965_00224 | CDS | open | 177060-178232 | _na 390_aa | ddlA | D-alanine--D-alanine ligase |
| 183 | JASOTL010000001.1 | GCA030223965_00225 | CDS | open | 178237-179790 | _na 517_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 184 | JASOTL010000001.1 | GCA030223965_00226 | CDS | open | 179800-180570 | _na 256_aa | menH | Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system |
| 185 | JASOTL010000001.1 | GCA030223965_00227 | CDS | open | 180557-181003 | _na 148_aa | hypothetical protein | |
| 186 | JASOTL010000001.1 | GCA030223965_00228 | CDS | open | 181110-181349 | _na 79_aa | grxC | Glutaredoxin |
| 187 | JASOTL010000001.1 | GCA030223965_00229 | CDS | open | 181388-182281 | _na 297_aa | DUF1700 domain-containing protein | |
| 188 | JASOTL010000001.1 | GCA030223965_00230 | CDS | open | 182556-183542 | _na 328_aa | G5 domain-containing protein | |
| 189 | JASOTL010000001.1 | GCA030223965_00231 | CDS | open | 183986-184615 | _na 209_aa | Hydrolase%2C NUDIX family | |
| 190 | JASOTL010000001.1 | GCA030223965_00232 | CDS | open | 184605-185636 | _na 343_aa | Phospholipase%2C patatin family | |
| 191 | JASOTL010000001.1 | GCA030223965_00233 | CDS | open | 185633-186052 | _na 139_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 192 | JASOTL010000001.1 | GCA030223965_00234 | CDS | open | 186246-187103 | _na 285_aa | Putative membrane protein | |
| 193 | JASOTL010000001.1 | GCA030223965_00235 | CDS | open | 187383-188831 | _na 482_aa | Xaa-His dipeptidase | |
| 194 | JASOTL010000001.1 | GCA030223965_00236 | CDS | open | 188841-190250 | _na 469_aa | p-aminobenzoyl-glutamate transporter | |
| 195 | JASOTL010000001.1 | GCA030223965_00237 | CDS | open | 190657-191304 | _na 215_aa | tetR | Transcriptional regulator%2C TetR family |
| 196 | JASOTL010000001.1 | GCA030223965_00238 | CDS | open | 191648-192067 | _na 139_aa | comEB | Putative ComE operon protein 2 |
| 197 | JASOTL010000001.1 | GCA030223965_00239 | CDS | open | 192064-192642 | _na 192_aa | rnh1 | ribonuclease H |
| 198 | JASOTL010000001.1 | GCA030223965_00240 | CDS | open | 192731-193621 | _na 296_aa | fructose bisphosphate aldolase | |
| 199 | JASOTL010000001.1 | GCA030223965_00241 | CDS | open | 193921-195564 | _na 547_aa | Tryptophan 2%2C3-dioxygenase | |
| 200 | JASOTL010000001.1 | GCA030223965_00242 | CDS | open | 195650-196990 | _na 446_aa | Sodium:neurotransmitter symporter family protein | |
| 201 | JASOTL010000001.1 | GCA030223965_00243 | CDS | open | 197059-197748 | _na 229_aa | gloB | hydroxyacylglutathione hydrolase |
| 202 | JASOTL010000001.1 | GCA030223965_00244 | CDS | open | 198458-200080 | _na 540_aa | groL | chaperonin GroEL |
| 203 | JASOTL010000001.1 | GCA030223965_00245 | CDS | open | 200110-200391 | _na 93_aa | groES | Co-chaperonin GroES |
| 204 | JASOTL010000001.1 | GCA030223965_00246 | CDS | open | 201389-201925 | _na 178_aa | 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein | |
| 205 | JASOTL010000001.1 | GCA030223965_00247 | CDS | open | 201973-202314 | _na 113_aa | rplQ | 50S ribosomal protein L17 |
| 206 | JASOTL010000001.1 | GCA030223965_00248 | CDS | open | 202325-203272 | _na 315_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 207 | JASOTL010000001.1 | GCA030223965_00249 | CDS | open | 203299-203694 | _na 131_aa | rpsK | 30S ribosomal protein S11 |
| 208 | JASOTL010000001.1 | GCA030223965_00250 | CDS | open | 203707-204069 | _na 120_aa | rpsM | 30S ribosomal protein S13 |
| 209 | JASOTL010000001.1 | GCA030223965_00251 | CDS | open | 204081-204194 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 210 | JASOTL010000001.1 | GCA030223965_00252 | CDS | open | 204217-204435 | _na 72_aa | infA | translation initiation factor IF-1 |
| 211 | JASOTL010000001.1 | GCA030223965_00253 | CDS | open | 204454-204675 | _na 73_aa | 50S ribosomal protein L14e | |
| 212 | JASOTL010000001.1 | GCA030223965_00254 | CDS | open | 204712-205353 | _na 213_aa | adk | adenylate kinase |
| 213 | JASOTL010000001.1 | GCA030223965_00255 | CDS | open | 205363-206643 | _na 426_aa | secY | preprotein translocase subunit SecY |
| 214 | JASOTL010000001.1 | GCA030223965_00256 | CDS | open | 206643-207092 | _na 149_aa | rplO | 50S ribosomal protein L15 |
| 215 | JASOTL010000001.1 | GCA030223965_00257 | CDS | open | 207106-207282 | _na 58_aa | rpmD | 50S ribosomal protein L30 |
| 216 | JASOTL010000001.1 | GCA030223965_00258 | CDS | open | 207293-207799 | _na 168_aa | rpsE | 30S ribosomal protein S5 |
| 217 | JASOTL010000001.1 | GCA030223965_00259 | CDS | open | 207813-208175 | _na 120_aa | rplR | 50S ribosomal protein L18 |
| 218 | JASOTL010000001.1 | GCA030223965_00260 | CDS | open | 208191-208727 | _na 178_aa | rplF | 50S ribosomal protein L6 |
| 219 | JASOTL010000001.1 | GCA030223965_00261 | CDS | open | 208742-209137 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 220 | JASOTL010000001.1 | GCA030223965_00262 | CDS | open | 209168-209353 | _na 61_aa | rpsN | type Z 30S ribosomal protein S14 |
| 221 | JASOTL010000001.1 | GCA030223965_00263 | CDS | open | 209365-209910 | _na 181_aa | rplE | 50S ribosomal protein L5 |
| 222 | JASOTL010000001.1 | GCA030223965_00264 | CDS | open | 209922-210230 | _na 102_aa | rplX | 50S ribosomal protein L24 |
| 223 | JASOTL010000001.1 | GCA030223965_00265 | CDS | open | 210245-210613 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 224 | JASOTL010000001.1 | GCA030223965_00266 | CDS | open | 210637-210891 | _na 84_aa | rpsQ | 30S ribosomal protein S17 |
| 225 | JASOTL010000001.1 | GCA030223965_00267 | CDS | open | 210896-211102 | _na 68_aa | rpmC | 50S ribosomal protein L29 |
| 226 | JASOTL010000001.1 | GCA030223965_00268 | CDS | open | 211092-211523 | _na 143_aa | rplP | 50S ribosomal protein L16 |
| 227 | JASOTL010000001.1 | GCA030223965_00269 | CDS | open | 211541-212296 | _na 251_aa | rpsC | 30S ribosomal protein S3 |
| 228 | JASOTL010000001.1 | GCA030223965_00270 | CDS | open | 212308-212643 | _na 111_aa | rplV | 50S ribosomal protein L22 |
| 229 | JASOTL010000001.1 | GCA030223965_00271 | CDS | open | 212655-212939 | _na 94_aa | rpsS | 30S ribosomal protein S19 |
| 230 | JASOTL010000001.1 | GCA030223965_00272 | CDS | open | 212953-213783 | _na 276_aa | rplB | 50S ribosomal protein L2 |
| 231 | JASOTL010000001.1 | GCA030223965_00273 | CDS | open | 213802-214089 | _na 95_aa | rplW | 50S ribosomal protein L23 |
| 232 | JASOTL010000001.1 | GCA030223965_00274 | CDS | open | 214089-214712 | _na 207_aa | rplD | 50S ribosomal protein L4 |
| 233 | JASOTL010000001.1 | GCA030223965_00275 | CDS | open | 214730-215362 | _na 210_aa | rplC | 50S ribosomal protein L3 |
| 234 | JASOTL010000001.1 | GCA030223965_00276 | CDS | open | 215421-215738 | _na 105_aa | rpsJ | 30S ribosomal protein S10 |
| 235 | JASOTL010000001.1 | GCA030223965_00277 | CDS | open | 216449-217972 | _na 507_aa | ahpF | alkyl hydroperoxide reductase subunit F |
| 236 | JASOTL010000001.1 | GCA030223965_00278 | CDS | open | 217972-218541 | _na 189_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 237 | JASOTL010000001.1 | GCA030223965_00279 | CDS | open | 219024-219821 | _na 265_aa | fixA | Electron transfer flavoprotein small subunit |
| 238 | JASOTL010000001.1 | GCA030223965_00280 | CDS | open | 219830-220825 | _na 331_aa | fixB | Electron transfer flavoprotein large subunit |
| 239 | JASOTL010000001.1 | GCA030223965_00281 | CDS | open | 221586-222278 | _na 230_aa | lrgB | Murein hydrolase effector protein LrgB |
| 240 | JASOTL010000001.1 | GCA030223965_00282 | CDS | open | 222271-222621 | _na 116_aa | lrgA | LrgA family protein |
| 241 | JASOTL010000001.1 | GCA030223965_00283 | CDS | open | 222635-223606 | _na 323_aa | fixB | Electron transfer flavoprotein large subunit |
| 242 | JASOTL010000001.1 | GCA030223965_00284 | CDS | open | 223619-224389 | _na 256_aa | fixA | Electron transfer flavoprotein small subunit |
| 243 | JASOTL010000001.1 | GCA030223965_00285 | CDS | open | 224400-225536 | _na 378_aa | caiA | Acyl-CoA dehydrogenase |
| 244 | JASOTL010000001.1 | GCA030223965_00286 | CDS | open | 225556-226968 | _na 470_aa | glcD | putative FAD-linked oxidoreductase Rv2280 |
| 245 | JASOTL010000001.1 | GCA030223965_00287 | CDS | open | 227139-228575 | _na 478_aa | HTH cro/C1-type domain-containing protein | |
| 246 | JASOTL010000001.1 | GCA030223965_00288 | CDS | open | 228915-235493 | _na 2192_aa | SLH domain-containing protein | |
| 247 | JASOTL010000001.1 | GCA030223965_00289 | CDS | open | 236141-237853 | _na 570_aa | yfcC | putative basic amino acid antiporter YfcC |
| 248 | JASOTL010000001.1 | GCA030223965_00290 | CDS | open | 237866-239050 | _na 394_aa | iadA | beta-aspartyl-peptidase |
| 249 | JASOTL010000001.1 | GCA030223965_00291 | CDS | open | 239387-240217 | _na 276_aa | Sortase family protein | |
| 250 | JASOTL010000001.1 | GCA030223965_00292 | CDS | open | 240207-241037 | _na 276_aa | srtA | Sortase family protein |
| 251 | JASOTL010000001.1 | GCA030223965_00293 | CDS | open | 241021-242037 | _na 338_aa | Sortase family protein | |
| 252 | JASOTL010000001.1 | GCA030223965_00294 | CDS | open | 242077-243294 | _na 405_aa | LPXTG-motif cell wall anchor domain protein | |
| 253 | JASOTL010000001.1 | GCA030223965_00295 | CDS | open | 243401-245575 | _na 724_aa | isopeptide-forming domain-containing fimbrial protein | |
| 254 | JASOTL010000001.1 | GCA030223965_00296 | CDS | open | 246212-260380 | _na 4722_aa | spaA | SpaA isopeptide-forming pilin-related protein |
| 255 | JASOTL010000001.1 | GCA030223965_00297 | CDS | open | 261515-262768 | _na 417_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 256 | JASOTL010000001.1 | GCA030223965_00298 | CDS | open | 262768-263451 | _na 227_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 257 | JASOTL010000001.1 | GCA030223965_00299 | CDS | open | 263448-265592 | _na 714_aa | efflux RND transporter periplasmic adaptor subunit | |
| 258 | JASOTL010000001.1 | GCA030223965_00300 | CDS | open | 265765-267066 | _na 433_aa | Na+/H+ antiporter family protein | |
| 259 | JASOTL010000001.1 | GCA030223965_00301 | CDS | open | 267322-267966 | _na 214_aa | opuBB | ABC transporter permease |
| 260 | JASOTL010000001.1 | GCA030223965_00302 | CDS | open | 267959-268936 | _na 325_aa | osmF | Glycine betaine/carnitine/choline-binding protein |
| 261 | JASOTL010000001.1 | GCA030223965_00303 | CDS | open | 268936-269571 | _na 211_aa | opuBB | Choline transport system permease protein opuBB |
| 262 | JASOTL010000001.1 | GCA030223965_00304 | CDS | open | 269564-270784 | _na 406_aa | opuBA | Quaternary amine transport ATP-binding protein |
| 263 | JASOTL010000001.1 | GCA030223965_00305 | CDS | open | 271146-272354 | _na 402_aa | ATP synthase F0%2C A subunit | |
| 264 | JASOTL010000001.1 | GCA030223965_00306 | CDS | open | 272374-272817 | _na 147_aa | hypothetical protein | |
| 265 | JASOTL010000001.1 | GCA030223965_00307 | CDS | open | 272820-273686 | _na 288_aa | Radical SAM domain protein | |
| 266 | JASOTL010000001.1 | GCA030223965_00308 | CDS | open | 273719-275173 | _na 484_aa | pncB | nicotinate phosphoribosyltransferase |
| 267 | JASOTL010000001.1 | GCA030223965_00309 | CDS | open | 275447-276265 | _na 272_aa | ttcA | tRNA 2-thiocytidine biosynthesis protein TtcA |
| 268 | JASOTL010000001.1 | GCA030223965_00310 | CDS | open | 276387-277598 | _na 403_aa | norV | Anaerobic nitric oxide reductase flavorubredoxin |
| 269 | JASOTL010000001.1 | GCA030223965_00311 | CDS | open | 278416-278766 | _na 116_aa | Transcriptional regulator%2C Spx/MgsR family | |
| 270 | JASOTL010000001.1 | GCA030223965_00312 | CDS | open | 278857-280383 | _na 508_aa | trkA | Putative ATP synthase F0%2C A subunit |
| 271 | JASOTL010000001.1 | GCA030223965_00313 | CDS | open | 280373-281569 | _na 398_aa | DUF4825 domain-containing protein | |
| 272 | JASOTL010000001.1 | GCA030223965_00314 | CDS | open | 281681-283039 | _na 452_aa | norM | MATE efflux family protein |
| 273 | JASOTL010000001.1 | GCA030223965_00315 | CDS | open | 283032-283658 | _na 208_aa | NAD(P)H-hydrate epimerase | |
| 274 | JASOTL010000001.1 | GCA030223965_00316 | CDS | open | 283949-284584 | _na 211_aa | Melibiose operon regulatory protein | |
| 275 | JASOTL010000001.1 | GCA030223965_00317 | CDS | open | 284640-286076 | _na 478_aa | algI | Putative alginate O-acetyltransferase AlgI |
| 276 | JASOTL010000001.1 | GCA030223965_00318 | CDS | open | 286085-287113 | _na 342_aa | Putative lipoprotein | |
| 277 | JASOTL010000001.1 | GCA030223965_00319 | CDS | open | 287287-288162 | _na 291_aa | lysR | LysR substrate binding domain protein |
| 278 | JASOTL010000001.1 | GCA030223965_00320 | CDS | open | 288164-288685 | _na 173_aa | PAP2 family protein | |
| 279 | JASOTL010000001.1 | GCA030223965_00321 | CDS | open | 288693-289382 | _na 229_aa | hypothetical protein | |
| 280 | JASOTL010000001.1 | GCA030223965_00322 | CDS | open | 289411-290016 | _na 201_aa | Peptidase C39-like domain-containing protein | |
| 281 | JASOTL010000001.1 | GCA030223965_00323 | CDS | open | 290056-290793 | _na 245_aa | Putative DNA metabolism protein | |
| 282 | JASOTL010000001.1 | GCA030223965_00324 | CDS | open | 291138-292736 | _na 532_aa | nptA | Na/Pi cotransporter family protein |
| 283 | JASOTL010000001.1 | GCA030223965_00325 | CDS | open | 292938-294158 | _na 406_aa | btlA | Transporter%2C major facilitator family protein |
| 284 | JASOTL010000001.1 | GCA030223965_00326 | CDS | open | 294191-294463 | _na 90_aa | CrcB-like protein | |
| 285 | JASOTL010000001.1 | GCA030223965_00327 | CDS | open | 294465-295004 | _na 179_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 286 | JASOTL010000001.1 | GCA030223965_00328 | CDS | open | 295009-295428 | _na 139_aa | Histidine kinase | |
| 287 | JASOTL010000001.1 | GCA030223965_00329 | CDS | open | 295437-295649 | _na 70_aa | xRE | DNA-binding helix-turn-helix protein |
| 288 | JASOTL010000001.1 | GCA030223965_00330 | CDS | open | 295843-296247 | _na 134_aa | Manganese transport regulator | |
| 289 | JASOTL010000001.1 | GCA030223965_00331 | CDS | open | 296244-297356 | _na 370_aa | ABC 3 transport family protein | |
| 290 | JASOTL010000001.1 | GCA030223965_00332 | CDS | open | 297353-298234 | _na 293_aa | ABC 3 transport family protein | |
| 291 | JASOTL010000001.1 | GCA030223965_00333 | CDS | open | 298227-298952 | _na 241_aa | mntA | Manganese transport system ATP-binding protein MntA |
| 292 | JASOTL010000001.1 | GCA030223965_00334 | CDS | open | 298962-299915 | _na 317_aa | Putative manganese ABC transporter substrate-binding lipoprotein | |
| 293 | JASOTL010000001.1 | GCA030223965_00335 | CDS | open | 300295-301173 | _na 292_aa | Lipoprotein | |
| 294 | JASOTL010000001.1 | GCA030223965_00336 | CDS | open | 301260-301742 | _na 160_aa | fadM | Thioesterase domain-containing protein |
| 295 | JASOTL010000001.1 | GCA030223965_00337 | CDS | open | 301959-302084 | _na 41_aa | hypothetical protein | |
| 296 | JASOTL010000001.1 | GCA030223965_00338 | CDS | open | 302144-302887 | _na 247_aa | AB hydrolase-1 domain-containing protein | |
| 297 | JASOTL010000001.1 | GCA030223965_00339 | CDS | open | 303199-303957 | _na 252_aa | fabG | Cyclopentanol dehydrogenase |
| 298 | JASOTL010000001.1 | GCA030223965_00340 | CDS | open | 304087-304398 | _na 103_aa | padR | Transcriptional regulator%2C PadR family |
| 299 | JASOTL010000001.1 | GCA030223965_00341 | CDS | open | 304401-305642 | _na 413_aa | DUF2812 domain-containing protein | |
| 300 | JASOTL010000001.1 | GCA030223965_00342 | CDS | open | 305938-306765 | _na 275_aa | Methyltransferase domain protein | |
| 301 | JASOTL010000001.1 | GCA030223965_00343 | CDS | open | 306850-307488 | _na 212_aa | DUF6796 domain-containing protein | |
| 302 | JASOTL010000001.1 | GCA030223965_00344 | CDS | open | 307810-308481 | _na 223_aa | Mg2+ transporter-C family protein | |
| 303 | JASOTL010000001.1 | GCA030223965_00345 | CDS | open | 308723-308944 | _na 73_aa | DUF3784 domain-containing protein | |
| 304 | JASOTL010000001.1 | GCA030223965_00346 | CDS | open | 309092-309349 | _na 85_aa | abrB | Transcriptional regulator%2C AbrB family |
| 305 | JASOTL010000001.1 | GCA030223965_00347 | CDS | open | 309349-309615 | _na 88_aa | relE | Addiction module toxin%2C RelE/StbE family |
| 306 | JASOTL010000001.1 | GCA030223965_00348 | CDS | open | 309650-309793 | _na 47_aa | hypothetical protein | |
| 307 | JASOTL010000001.1 | GCA030223965_00349 | CDS | open | 309790-310242 | _na 150_aa | tnpA | IS200/IS605 family transposase |
| 308 | JASOTL010000001.1 | GCA030223965_00350 | CDS | open | 310806-311237 | _na 143_aa | helix-turn-helix domain-containing protein | |
| 309 | JASOTL010000001.1 | GCA030223965_00351 | CDS | open | 311234-313147 | _na 637_aa | DNA methyltransferase | |
| 310 | JASOTL010000001.1 | GCA030223965_00352 | CDS | open | 313152-313979 | _na 275_aa | DNA methyltransferase | |
| 311 | JASOTL010000001.1 | GCA030223965_00353 | CDS | open | 313982-315472 | _na 496_aa | hypothetical protein | |
| 312 | JASOTL010000001.1 | GCA030223965_00354 | CDS | open | 315809-315982 | _na 57_aa | Helix-turn-helix domain-containing protein | |
| 313 | JASOTL010000001.1 | GCA030223965_00355 | CDS | open | 315979-316350 | _na 123_aa | tnpV | TnpV protein |
| 314 | JASOTL010000001.1 | GCA030223965_00356 | CDS | open | 316429-318033 | _na 534_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 315 | JASOTL010000001.1 | GCA030223965_00357 | CDS | open | 318222-319259 | _na 345_aa | phnD | Phosphate/phosphite/phosphonate ABC transporter%2C periplasmic binding protein |
| 316 | JASOTL010000001.1 | GCA030223965_00358 | CDS | open | 319300-320064 | _na 254_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 317 | JASOTL010000001.1 | GCA030223965_00359 | CDS | open | 320061-320882 | _na 273_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 318 | JASOTL010000001.1 | GCA030223965_00360 | CDS | open | 320884-321696 | _na 270_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 319 | JASOTL010000001.1 | GCA030223965_00361 | CDS | open | 321693-323132 | _na 479_aa | 5'-nucleotidase protein | |
| 320 | JASOTL010000001.1 | GCA030223965_00362 | CDS | open | 323294-323956 | _na 220_aa | Endo-1%2C4-beta-xylanase A | |
| 321 | JASOTL010000001.1 | GCA030223965_00363 | CDS | open | 324716-325234 | _na 172_aa | nfnB | NADH dehydrogenase |
| 322 | JASOTL010000001.1 | GCA030223965_00364 | CDS | open | 325342-326574 | _na 410_aa | Nramp family divalent metal transporter | |
| 323 | JASOTL010000001.1 | GCA030223965_00365 | CDS | open | 326801-327556 | _na 251_aa | iclR | IclR helix-turn-helix protein |
| 324 | JASOTL010000001.1 | GCA030223965_00366 | CDS | open | 327654-328628 | _na 324_aa | Agmatinase family protein | |
| 325 | JASOTL010000001.1 | GCA030223965_00367 | CDS | open | 328722-329651 | _na 309_aa | glsA | glutaminase A |
| 326 | JASOTL010000001.1 | GCA030223965_00368 | CDS | open | 329817-330680 | _na 287_aa | ypuA | DUF1002 domain-containing protein |
| 327 | JASOTL010000001.1 | GCA030223965_00369 | CDS | open | 330866-331462 | _na 198_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 328 | JASOTL010000001.1 | GCA030223965_00370 | CDS | open | 331449-333782 | _na 777_aa | lon | endopeptidase La |
| 329 | JASOTL010000001.1 | GCA030223965_00371 | CDS | open | 333829-335046 | _na 405_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 330 | JASOTL010000001.1 | GCA030223965_00372 | CDS | open | 335055-335639 | _na 194_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 331 | JASOTL010000001.1 | GCA030223965_00373 | CDS | open | 335656-337005 | _na 449_aa | tig | trigger factor |
| 332 | JASOTL010000001.1 | GCA030223965_00374 | CDS | open | 337076-337297 | _na 73_aa | Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein | |
| 333 | JASOTL010000001.1 | GCA030223965_00375 | CDS | open | 337299-339002 | _na 567_aa | proS | proline--tRNA ligase |
| 334 | JASOTL010000001.1 | GCA030223965_00376 | CDS | open | 339046-339372 | _na 108_aa | hypothetical protein | |
| 335 | JASOTL010000001.1 | GCA030223965_00377 | CDS | open | 339557-339751 | _na 64_aa | hypothetical protein | |
| 336 | JASOTL010000001.1 | GCA030223965_00378 | CDS | open | 339738-339920 | _na 60_aa | Phage protein | |
| 337 | JASOTL010000001.1 | GCA030223965_00379 | CDS | open | 340032-340280 | _na 82_aa | hypothetical protein | |
| 338 | JASOTL010000001.1 | GCA030223965_00380 | CDS | open | 345768-346061 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 339 | JASOTL010000001.1 | GCA030223965_00381 | CDS | open | 346063-347094 | _na 343_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 340 | JASOTL010000001.1 | GCA030223965_00382 | CDS | open | 347091-347744 | _na 217_aa | cas4 | CRISPR-associated protein Cas4 |
| 341 | JASOTL010000001.1 | GCA030223965_00383 | CDS | open | 347746-348597 | _na 283_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 342 | JASOTL010000001.1 | GCA030223965_00384 | CDS | open | 348590-350554 | _na 654_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 343 | JASOTL010000001.1 | GCA030223965_00385 | CDS | open | 350568-351272 | _na 234_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 344 | JASOTL010000001.1 | GCA030223965_00386 | CDS | open | 351483-354062 | _na 859_aa | CRISPR-associated endonuclease Cas3-HD | |
| 345 | JASOTL010000001.1 | GCA030223965_00387 | CDS | open | 354098-355036 | _na 312_aa | serA | 4-phosphoerythronate dehydrogenase |
| 346 | JASOTL010000001.1 | GCA030223965_00388 | CDS | open | 355190-356746 | _na 518_aa | SH3 domain protein | |
| 347 | JASOTL010000001.1 | GCA030223965_00389 | CDS | open | 356856-357422 | _na 188_aa | RNA polymerase sigma factor | |
| 348 | JASOTL010000001.1 | GCA030223965_00390 | CDS | open | 357419-358180 | _na 253_aa | Signal peptide protein%2C YSIRK family | |
| 349 | JASOTL010000001.1 | GCA030223965_00391 | CDS | open | 358287-359138 | _na 283_aa | dnaJ | DnaJ domain protein |
| 350 | JASOTL010000001.1 | GCA030223965_00392 | CDS | open | 359131-359790 | _na 219_aa | Zinicin-like metallopeptidase | |
| 351 | JASOTL010000001.1 | GCA030223965_00393 | CDS | open | 359883-360683 | _na 266_aa | dppD | Glutathione import ATP-binding protein GsiA |
| 352 | JASOTL010000001.1 | GCA030223965_00394 | CDS | open | 360688-361644 | _na 318_aa | dppD | ABC transporter ATP-binding protein |
| 353 | JASOTL010000001.1 | GCA030223965_00395 | CDS | open | 361646-362488 | _na 280_aa | dppC | Glutathione transport system permease protein GsiD |
| 354 | JASOTL010000001.1 | GCA030223965_00396 | CDS | open | 362496-363425 | _na 309_aa | dppB | Dipeptide ABC transporter%2C permease protein DppB |
| 355 | JASOTL010000001.1 | GCA030223965_00397 | CDS | open | 363493-365019 | _na 508_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 356 | JASOTL010000001.1 | GCA030223965_00398 | CDS | open | 365035-366282 | _na 415_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 357 | JASOTL010000001.1 | GCA030223965_00399 | CDS | open | 366425-367579 | _na 384_aa | aspB | Aminotransferase |
| 358 | JASOTL010000001.1 | GCA030223965_00400 | CDS | open | 367668-368351 | _na 227_aa | DUF554 domain-containing protein | |
| 359 | JASOTL010000001.1 | GCA030223965_00401 | CDS | open | 368358-369233 | _na 291_aa | alkA | DNA-(apurinic or apyrimidinic site) lyase |
| 360 | JASOTL010000001.1 | GCA030223965_00402 | CDS | open | 369281-369910 | _na 209_aa | rex | redox-sensing transcriptional repressor Rex |
| 361 | JASOTL010000001.1 | GCA030223965_00403 | CDS | open | 370190-370933 | _na 247_aa | srtB | class B sortase |
| 362 | JASOTL010000001.1 | GCA030223965_00404 | CDS | open | 370959-371135 | _na 58_aa | hypothetical protein | |
| 363 | JASOTL010000001.1 | GCA030223965_00405 | CDS | open | 371137-372039 | _na 300_aa | fN0238 | Amidinotransferase |
| 364 | JASOTL010000001.1 | GCA030223965_00406 | CDS | open | 372137-372967 | _na 276_aa | folD | Bifunctional protein FolD |
| 365 | JASOTL010000001.1 | GCA030223965_00407 | CDS | open | 373046-373780 | _na 244_aa | ymfI | elongation factor P 5-aminopentanone reductase |
| 366 | JASOTL010000001.1 | GCA030223965_00408 | CDS | open | 373893-375128 | _na 411_aa | gltP | Serine/threonine transporter family protein |
| 367 | JASOTL010000001.1 | GCA030223965_00409 | CDS | open | 375134-376015 | _na 293_aa | sdaAA | L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha |
| 368 | JASOTL010000001.1 | GCA030223965_00410 | CDS | open | 376016-376684 | _na 222_aa | sdaAB | L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta |
| 369 | JASOTL010000001.1 | GCA030223965_00411 | CDS | open | 376932-378509 | _na 525_aa | p-aminobenzoyl-glutamate transport protein | |
| 370 | JASOTL010000001.1 | GCA030223965_00412 | CDS | open | 378634-379101 | _na 155_aa | radical SAM protein | |
| 371 | JASOTL010000001.1 | GCA030223965_00413 | CDS | open | 379456-379899 | _na 147_aa | marR | Transcriptional regulator%2C MarR family |
| 372 | JASOTL010000001.1 | GCA030223965_00414 | CDS | open | 379950-380792 | _na 280_aa | degV | EDD domain protein%2C DegV family |
| 373 | JASOTL010000001.1 | GCA030223965_00415 | CDS | open | 380918-381835 | _na 305_aa | DUF2232 domain-containing protein | |
| 374 | JASOTL010000001.1 | GCA030223965_00416 | CDS | open | 381847-383844 | _na 665_aa | gdpP | Cyclic-di-AMP phosphodiesterase |
| 375 | JASOTL010000001.1 | GCA030223965_00417 | CDS | open | 383846-384295 | _na 149_aa | rplI | 50S ribosomal protein L9 |
| 376 | JASOTL010000001.1 | GCA030223965_00418 | CDS | open | 384301-385662 | _na 453_aa | dnaB | replicative DNA helicase |
| 377 | JASOTL010000001.1 | GCA030223965_00419 | CDS | open | 385763-386638 | _na 291_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 378 | JASOTL010000001.1 | GCA030223965_00420 | CDS | open | 386646-387440 | _na 264_aa | nit1 | (R)-stereoselective amidase |
| 379 | JASOTL010000001.1 | GCA030223965_00421 | CDS | open | 387574-388047 | _na 157_aa | tnpA | IS200/IS605 family transposase |
| 380 | JASOTL010000001.1 | GCA030223965_00422 | CDS | open | 388256-388897 | _na 213_aa | sdpI | DUF1648 domain-containing protein |
| 381 | JASOTL010000001.1 | GCA030223965_00423 | CDS | open | 388887-389159 | _na 90_aa | arsR | Toxin-antitoxin system%2C antitoxin component%2C ArsR domain protein |
| 382 | JASOTL010000001.1 | GCA030223965_00424 | CDS | open | 389599-390348 | _na 249_aa | iclR | Transcriptional regulator kdgR |
| 383 | JASOTL010000001.1 | GCA030223965_00425 | CDS | open | 390540-391772 | _na 410_aa | Fic family protein | |
| 384 | JASOTL010000001.1 | GCA030223965_00426 | CDS | open | 391866-393752 | _na 628_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 385 | JASOTL010000001.1 | GCA030223965_00427 | CDS | open | 394069-394707 | _na 212_aa | murI | XkdX family protein |
| 386 | JASOTL010000001.1 | GCA030223965_00428 | CDS | open | 394712-395584 | _na 290_aa | Lipid kinase%2C YegS/Rv2252/BmrU family | |
| 387 | JASOTL010000001.1 | GCA030223965_00429 | CDS | open | 395775-397604 | _na 609_aa | Arylsulfatase | |
| 388 | JASOTL010000001.1 | GCA030223965_00430 | CDS | open | 397605-398498 | _na 297_aa | Putative membrane protein | |
| 389 | JASOTL010000001.1 | GCA030223965_00431 | CDS | open | 398685-398840 | _na 51_aa | Lipoprotein | |
| 390 | JASOTL010000001.1 | GCA030223965_00432 | CDS | open | 398999-400348 | _na 449_aa | Hemerythrin HHE cation binding domain protein | |
| 391 | JASOTL010000001.1 | GCA030223965_00433 | CDS | open | 400378-401397 | _na 339_aa | mnmH | tRNA 2-selenouridine(34) synthase MnmH |
| 392 | JASOTL010000001.1 | GCA030223965_00434 | CDS | open | 401461-402462 | _na 333_aa | selD | selenide%2C water dikinase SelD |
| 393 | JASOTL010000001.1 | GCA030223965_00435 | CDS | open | 402466-403044 | _na 192_aa | yedF | sulfurtransferase-like selenium metabolism protein YedF |
| 394 | JASOTL010000001.1 | GCA030223965_00436 | CDS | open | 403041-403247 | _na 68_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 395 | JASOTL010000001.1 | GCA030223965_00437 | CDS | open | 403244-404368 | _na 374_aa | putative cysteine desulfurase | |
| 396 | JASOTL010000001.1 | GCA030223965_00438 | CDS | open | 404820-405542 | _na 240_aa | DUF624 domain-containing protein | |
| 397 | JASOTL010000001.1 | GCA030223965_00439 | CDS | open | 405722-406651 | _na 309_aa | glsA | glutaminase A |
| 398 | JASOTL010000001.1 | GCA030223965_00440 | CDS | open | 406661-408130 | _na 489_aa | alsT | Amino acid carrier protein |
| 399 | JASOTL010000001.1 | GCA030223965_00441 | CDS | open | 408233-408583 | _na 116_aa | Phage holin family protein | |
| 400 | JASOTL010000001.1 | GCA030223965_00442 | CDS | open | 408626-408931 | _na 101_aa | DUF4298 domain-containing protein | |
| 401 | JASOTL010000001.1 | GCA030223965_00443 | CDS | open | 409117-409725 | _na 202_aa | ttdB | L(+)-tartrate dehydratase subunit beta |
| 402 | JASOTL010000001.1 | GCA030223965_00444 | CDS | open | 409722-410618 | _na 298_aa | ttdA | L(+)-tartrate dehydratase subunit alpha |
| 403 | JASOTL010000001.1 | GCA030223965_00445 | CDS | open | 410631-411905 | _na 424_aa | citT | Transporter%2C DASS family |
| 404 | JASOTL010000001.1 | GCA030223965_00446 | CDS | open | 412213-413256 | _na 347_aa | araC | Transcriptional regulator%2C AraC family |
| 405 | JASOTL010000001.1 | GCA030223965_00447 | CDS | open | 413356-414537 | _na 393_aa | abgB | putative hydrolase YxeP |
| 406 | JASOTL010000001.1 | GCA030223965_00448 | CDS | open | 414644-418312 | _na 1222_aa | purL2 | phosphoribosylformylglycinamidine synthase |
| 407 | JASOTL010000001.1 | GCA030223965_00449 | CDS | open | 418302-419663 | _na 453_aa | purF | amidophosphoribosyltransferase |
| 408 | JASOTL010000001.1 | GCA030223965_00450 | CDS | open | 419729-419839 | _na 36_aa | hypothetical protein | |
| 409 | JASOTL010000001.1 | GCA030223965_00451 | CDS | open | 419984-422503 | _na 839_aa | mprF | bifunctional lysylphosphatidylglycerol flippase/synthetase MprF |
| 410 | JASOTL010000001.1 | GCA030223965_00452 | CDS | open | 422500-423216 | _na 238_aa | menH | Hydrolase%2C alpha/beta domain protein |
| 411 | JASOTL010000001.1 | GCA030223965_00453 | CDS | open | 423424-429231 | _na 1935_aa | SLH domain-containing protein | |
| 412 | JASOTL010000001.1 | GCA030223965_00454 | CDS | open | 429459-430778 | _na 439_aa | lAP4 | M18 family aminopeptidase |
| 413 | JASOTL010000001.1 | GCA030223965_00455 | CDS | open | 430797-432233 | _na 478_aa | potE | Inner membrane transporter ycaM |
| 414 | JASOTL010000001.1 | GCA030223965_00456 | CDS | open | 432825-433937 | _na 370_aa | Methionine synthase%2C vitamin-B12 independent | |
| 415 | JASOTL010000001.1 | GCA030223965_00457 | CDS | open | 433959-435071 | _na 370_aa | metE | 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase |
| 416 | JASOTL010000001.1 | GCA030223965_00458 | CDS | open | 435410-435814 | _na 134_aa | DUF5082 domain-containing protein | |
| 417 | JASOTL010000001.1 | GCA030223965_00459 | CDS | open | 435837-437441 | _na 534_aa | nhaP2 | potassium/proton antiporter |
| 418 | JASOTL010000001.1 | GCA030223965_00460 | CDS | open | 437564-437857 | _na 97_aa | hypothetical protein | |
| 419 | JASOTL010000001.1 | GCA030223965_00461 | CDS | open | 437838-439034 | _na 398_aa | aspB | Aminotransferase |
| 420 | JASOTL010000001.1 | GCA030223965_00462 | CDS | open | 439060-440016 | _na 318_aa | dnaC | ATP-binding protein |
| 421 | JASOTL010000001.1 | GCA030223965_00463 | CDS | open | 439991-441004 | _na 337_aa | dnaD | DnaD domain protein |
| 422 | JASOTL010000001.1 | GCA030223965_00464 | CDS | open | 441008-441580 | _na 190_aa | Acetyltransferase%2C GNAT family | |
| 423 | JASOTL010000001.1 | GCA030223965_00465 | CDS | open | 441795-442280 | _na 161_aa | lrp | HTH-type transcriptional regulator lrpC |
| 424 | JASOTL010000001.1 | GCA030223965_00466 | CDS | open | 442299-443000 | _na 233_aa | ompR | Response regulator transcription factor |
| 425 | JASOTL010000001.1 | GCA030223965_00467 | CDS | open | 443000-444808 | _na 602_aa | walK | histidine kinase |
| 426 | JASOTL010000001.1 | GCA030223965_00468 | CDS | open | 444789-446129 | _na 446_aa | yycH | YycH protein |
| 427 | JASOTL010000001.1 | GCA030223965_00469 | CDS | open | 446132-446980 | _na 282_aa | yycH | YycH protein |
| 428 | JASOTL010000001.1 | GCA030223965_00470 | CDS | open | 447039-447824 | _na 261_aa | phnP | Metallohydrolase |
| 429 | JASOTL010000001.1 | GCA030223965_00471 | CDS | open | 447844-448590 | _na 248_aa | surE | 5'/3'-nucleotidase SurE |
| 430 | JASOTL010000001.1 | GCA030223965_00472 | CDS | open | 448748-449227 | _na 159_aa | DUF4825 domain-containing protein | |
| 431 | JASOTL010000001.1 | GCA030223965_00473 | CDS | open | 449617-457062 | _na 2481_aa | SLH domain-containing protein | |
| 432 | JASOTL010000001.1 | GCA030223965_00474 | CDS | open | 457285-458607 | _na 440_aa | mgtE | magnesium transporter |
| 433 | JASOTL010000001.1 | GCA030223965_00475 | CDS | open | 458856-459404 | _na 182_aa | DNA-binding helix-turn-helix protein | |
| 434 | JASOTL010000001.1 | GCA030223965_00476 | CDS | open | 459623-460519 | _na 298_aa | Alpha/beta hydrolase fold-3 domain-containing protein | |
| 435 | JASOTL010000001.1 | GCA030223965_00477 | CDS | open | 460534-461757 | _na 407_aa | araC | Transcriptional regulator%2C AraC family |
| 436 | JASOTL010000001.1 | GCA030223965_00478 | CDS | open | 461958-463289 | _na 443_aa | spoVV | Transporter gate domain protein |
| 437 | JASOTL010000001.1 | GCA030223965_00479 | CDS | open | 463338-464009 | _na 223_aa | Flavin reductase like domain-containing protein | |
| 438 | JASOTL010000001.1 | GCA030223965_00480 | CDS | open | 464603-466006 | _na 467_aa | Amino acid carrier protein | |
| 439 | JASOTL010000001.1 | GCA030223965_00481 | CDS | open | 466018-466941 | _na 307_aa | glsA | glutaminase A |
| 440 | JASOTL010000001.1 | GCA030223965_00482 | CDS | open | 467200-468141 | _na 313_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 441 | JASOTL010000001.1 | GCA030223965_00483 | CDS | open | 468519-469154 | _na 211_aa | zinT | ZinT domain-containing protein |
| 442 | JASOTL010000001.1 | GCA030223965_00484 | CDS | open | 469235-470530 | _na 431_aa | znuA | putative zinc transport system zinc-binding lipoprotein AdcA |
| 443 | JASOTL010000001.1 | GCA030223965_00485 | CDS | open | 470534-471208 | _na 224_aa | znuC | Zinc import ATP-binding protein ZnuC |
| 444 | JASOTL010000001.1 | GCA030223965_00486 | CDS | open | 471195-471992 | _na 265_aa | znuB | High-affinity zinc uptake system membrane protein znuB |
| 445 | JASOTL010000001.1 | GCA030223965_00487 | CDS | open | 472181-474184 | _na 667_aa | pepD | C69 family dipeptidase |
| 446 | JASOTL010000001.1 | GCA030223965_00488 | CDS | open | 474258-475214 | _na 318_aa | yqjG | Glutathionyl-hydroquinone reductase YqjG |
| 447 | JASOTL010000001.1 | GCA030223965_00489 | CDS | open | 475321-477156 | _na 611_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 448 | JASOTL010000001.1 | GCA030223965_00490 | CDS | open | 477233-478273 | _na 346_aa | nrdB | ribonucleotide-diphosphate reductase subunit beta |
| 449 | JASOTL010000001.1 | GCA030223965_00491 | CDS | open | 478513-481041 | _na 842_aa | nrdD | ribonucleoside-diphosphate reductase subunit alpha |
| 450 | JASOTL010000001.1 | GCA030223965_00492 | CDS | open | 481332-483092 | _na 586_aa | Copper amine oxidase N-terminal domain protein | |
| 451 | JASOTL010000001.1 | GCA030223965_00493 | CDS | open | 484087-484806 | _na 239_aa | DUF5673 domain-containing protein | |
| 452 | JASOTL010000001.1 | GCA030223965_00494 | CDS | open | 484803-485327 | _na 174_aa | hypothetical protein | |
| 453 | JASOTL010000001.1 | GCA030223965_00495 | CDS | open | 485330-485902 | _na 190_aa | lytG | Exo-glucosaminidase LytG family protein |
| 454 | JASOTL010000001.1 | GCA030223965_00496 | CDS | open | 485892-486710 | _na 272_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 455 | JASOTL010000001.1 | GCA030223965_00497 | CDS | open | 486721-487200 | _na 159_aa | rnaY | HDIG domain protein |
| 456 | JASOTL010000001.1 | GCA030223965_00498 | CDS | open | 487200-487754 | _na 184_aa | folE | GTP cyclohydrolase I FolE |
| 457 | JASOTL010000001.1 | GCA030223965_00499 | CDS | open | 487922-489292 | _na 456_aa | dacC | serine-type D-Ala-D-Ala carboxypeptidase |
| 458 | JASOTL010000001.1 | GCA030223965_00501 | CDS | open | 489607-489927 | _na 106_aa | cutA1 | Divalent cation tolerance protein%2C CutA1 family |
| 459 | JASOTL010000001.1 | GCA030223965_00502 | CDS | open | 490031-490363 | _na 110_aa | yvlD | Phage holin family protein |
| 460 | JASOTL010000001.1 | GCA030223965_00503 | CDS | open | 490659-491075 | _na 138_aa | DUF4367 domain-containing protein | |
| 461 | JASOTL010000001.1 | GCA030223965_00504 | CDS | open | 491075-491965 | _na 296_aa | phzF | Phenazine biosynthesis protein%2C PhzF family |
| 462 | JASOTL010000001.1 | GCA030223965_00505 | CDS | open | 491968-492819 | _na 283_aa | Stage 0 sporulation protein J | |
| 463 | JASOTL010000001.1 | GCA030223965_00506 | CDS | open | 492812-493567 | _na 251_aa | parA | Sporulation initiation inhibitor protein soj |
| 464 | JASOTL010000001.1 | GCA030223965_00507 | CDS | open | 493841-494533 | _na 230_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 465 | JASOTL010000001.1 | GCA030223965_00508 | CDS | open | 494523-496427 | _na 634_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 466 | JASOTL010000001.1 | GCA030223965_00509 | CDS | open | 496434-497813 | _na 459_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 467 | JASOTL010000001.1 | GCA030223965_00510 | CDS | open | 497891-498694 | _na 267_aa | jag | RNA-binding cell elongation regulator Jag/EloR |
| 468 | JASOTL010000001.1 | GCA030223965_00511 | CDS | open | 498694-499428 | _na 244_aa | yidC | Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein |
| 469 | JASOTL010000001.1 | GCA030223965_00512 | CDS | open | 499446-499661 | _na 71_aa | yidD | membrane protein insertion efficiency factor YidD |
| 470 | JASOTL010000001.1 | GCA030223965_00513 | CDS | open | 499658-499993 | _na 111_aa | rnpA | ribonuclease P protein component |
| 471 | JASOTL010000001.1 | GCA030223965_00514 | CDS | open | 500569-501918 | _na 449_aa | dnaA | chromosomal replication initiator protein DnaA |
| 472 | JASOTL010000001.1 | GCA030223965_00515 | CDS | open | 502067-503161 | _na 364_aa | dnaN | DNA polymerase III subunit beta |
| 473 | JASOTL010000001.1 | GCA030223965_00516 | CDS | open | 503164-503376 | _na 70_aa | ybcJ | Ribosome-associated protein |
| 474 | JASOTL010000001.1 | GCA030223965_00517 | CDS | open | 503373-504446 | _na 357_aa | recF | DNA replication/repair protein RecF |
| 475 | JASOTL010000001.1 | GCA030223965_00518 | CDS | open | 504463-506376 | _na 637_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 476 | JASOTL010000001.1 | GCA030223965_00519 | CDS | open | 506386-508815 | _na 809_aa | gyrA | DNA gyrase subunit A |
| 477 | JASOTL010000001.1 | GCA030223965_00520 | CDS | open | 508824-509135 | _na 103_aa | sTAS | Anti-sigma factor antagonist |
| 478 | JASOTL010000001.1 | GCA030223965_00521 | CDS | open | 509137-509487 | _na 116_aa | Anti-sigma factor | |
| 479 | JASOTL010000001.1 | GCA030223965_00522 | CDS | open | 509497-510282 | _na 261_aa | SigB/SigF/SigG family RNA polymerase sigma factor | |
| 480 | JASOTL010000001.1 | GCA030223965_00523 | CDS | open | 510282-510953 | _na 223_aa | Transporter-associated domain-containing protein | |
| 481 | JASOTL010000001.1 | GCA030223965_00524 | CDS | open | 511153-512640 | _na 495_aa | glpK | glycerol kinase GlpK |
| 482 | JASOTL010000001.1 | GCA030223965_00525 | CDS | open | 513286-514449 | _na 387_aa | Putative membrane protein | |
| 483 | JASOTL010000001.1 | GCA030223965_00526 | CDS | open | 514909-516060 | _na 383_aa | Putative membrane protein | |
| 484 | JASOTL010000001.1 | GCA030223965_00527 | CDS | open | 516077-517168 | _na 363_aa | Glycerol dehydrogenase | |
| 485 | JASOTL010000001.1 | GCA030223965_00528 | CDS | open | 517245-518246 | _na 333_aa | DUF4234 domain-containing protein | |
| 486 | JASOTL010000001.1 | GCA030223965_00529 | CDS | open | 518243-518899 | _na 218_aa | Zinc-ribbon domain-containing protein | |
| 487 | JASOTL010000001.1 | GCA030223965_00530 | CDS | open | 518903-519310 | _na 135_aa | DUF2752 domain-containing protein | |
| 488 | JASOTL010000001.1 | GCA030223965_00531 | CDS | open | 519483-520727 | _na 414_aa | cdsB | UPF0597 protein HMPREF9286_1685 |
| 489 | JASOTL010000001.1 | GCA030223965_00532 | CDS | open | 520782-521060 | _na 92_aa | hypothetical protein | |
| 490 | JASOTL010000001.1 | GCA030223965_00533 | CDS | open | 521133-522569 | _na 478_aa | gumN | GumN protein |
| 491 | JASOTL010000001.1 | GCA030223965_00534 | CDS | open | 522570-523649 | _na 359_aa | Aminotransferase | |
| 492 | JASOTL010000001.1 | GCA030223965_00535 | CDS | open | 523737-524735 | _na 332_aa | gLY1 | Low specificity L-threonine aldolase |
| 493 | JASOTL010000001.1 | GCA030223965_00536 | CDS | open | 524744-525379 | _na 211_aa | rIC | Hemerythrin HHE cation binding domain protein |
| 494 | JASOTL010000001.1 | GCA030223965_00537 | CDS | open | 525586-526629 | _na 347_aa | Fic family protein | |
| 495 | JASOTL010000001.1 | GCA030223965_00538 | CDS | open | 526840-529593 | _na 917_aa | copZ | copper chaperone CopZ |
| 496 | JASOTL010000001.1 | GCA030223965_00539 | CDS | open | 529590-529859 | _na 89_aa | frmR | Copper-sensing transcriptional repressor CsoR |
| 497 | JASOTL010000001.1 | GCA030223965_00540 | CDS | open | 529866-530327 | _na 153_aa | Lipoprotein | |
| 498 | JASOTL010000001.1 | GCA030223965_00541 | CDS | open | 530517-530843 | _na 108_aa | Lipoprotein | |
| 499 | JASOTL010000001.1 | GCA030223965_00542 | CDS | open | 530851-531042 | _na 63_aa | DNA-binding helix-turn-helix protein | |
| 500 | JASOTL010000001.1 | GCA030223965_00543 | CDS | open | 531131-532531 | _na 466_aa | cls | phospholipase D |

