HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium coyleae (GCA_030229005.1)

Select a Genome:
BAKTA Annotations for GCA_030229005.1
Genome Selected: Corynebacterium coyleae
ContigsBases CDSrRNA tmRNAtRNA
72 2405598 2262 3 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4649 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4649 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JASPIC010000011.1 GCA030229005_00120 gene open 63076-63360
3502 JASPIC010000011.1 GCA030229005_00121 gene open 63353-63865
3503 JASPIC010000011.1 GCA030229005_00122 gene open 63836-64522
3504 JASPIC010000011.1 GCA030229005_00123 gene open 65166-66455
3505 JASPIC010000011.1 GCA030229005_00124 gene open 66508-67311
3506 JASPIC010000011.1 GCA030229005_00125 gene open 67613-68461
3507 JASPIC010000012.1 GCA030229005_00126 CDS open 644-2146 _na     500_aa DUF4185 domain-containing protein
3508 JASPIC010000012.1 GCA030229005_00127 CDS open 2228-3664 _na     478_aa Multidrug MFS transporter
3509 JASPIC010000012.1 GCA030229005_00128 CDS open 3690-4205 _na     171_aa Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein
3510 JASPIC010000012.1 GCA030229005_00129 CDS open 4252-5028 _na     258_aa Spermidine synthase
3511 JASPIC010000012.1 GCA030229005_00130 CDS open 5045-5536 _na     163_aa 2'-5' RNA ligase
3512 JASPIC010000012.1 GCA030229005_00131 CDS open 5575-6594 _na     339_aa hypothetical protein
3513 JASPIC010000012.1 GCA030229005_00132 CDS open 6591-6878 _na     95_aa hypothetical protein
3514 JASPIC010000012.1 GCA030229005_00133 CDS open 6997-8208 _na     403_aa Ferrisiderophore receptor Irp6A
3515 JASPIC010000012.1 GCA030229005_00134 CDS open 8235-9290 _na     351_aa Iron-siderophore ABC transporter permease
3516 JASPIC010000012.1 GCA030229005_00135 CDS open 9295-10047 _na     250_aa ATP-binding protein
3517 JASPIC010000012.1 GCA030229005_00136 CDS open 10104-10877 _na     257_aa merR MerR family transcriptional regulator
3518 JASPIC010000012.1 GCA030229005_00137 CDS open 10929-11423 _na     164_aa DUF1707 domain-containing protein
3519 JASPIC010000012.1 GCA030229005_00138 CDS open 11461-12555 _na     364_aa Lipoprotein
3520 JASPIC010000012.1 GCA030229005_00139 CDS open 12638-14173 _na     511_aa HNH nuclease domain-containing protein
3521 JASPIC010000012.1 GCA030229005_00140 CDS open 14176-14742 _na     188_aa DNA repair protein
3522 JASPIC010000012.1 GCA030229005_00141 CDS open 14795-15646 _na     283_aa Peptidase S1 domain-containing protein
3523 JASPIC010000012.1 GCA030229005_00142 CDS open 15627-16466 _na     279_aa DUF418 domain-containing protein
3524 JASPIC010000012.1 GCA030229005_00143 CDS open 16544-17218 _na     224_aa Response regulator transcription factor
3525 JASPIC010000012.1 GCA030229005_00144 CDS open 17215-18246 _na     343_aa histidine kinase
3526 JASPIC010000012.1 GCA030229005_00145 CDS open 18243-18689 _na     148_aa aac(3)-XI aminoglycoside N-acetyltransferase AAC(3)-XI
3527 JASPIC010000012.1 GCA030229005_00146 CDS open 18801-19874 _na     357_aa Integral membrane bound transporter domain-containing protein
3528 JASPIC010000012.1 GCA030229005_00147 CDS open 19970-20287 _na     105_aa amphi-Trp domain-containing protein
3529 JASPIC010000012.1 GCA030229005_00148 CDS open 20309-20596 _na     95_aa putative glycolipid-binding domain-containing protein
3530 JASPIC010000012.1 GCA030229005_00149 CDS open 20550-21071 _na     173_aa arfB alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB
3531 JASPIC010000012.1 GCA030229005_00150 CDS open 21126-21434 _na     102_aa higA HigA family addiction module antitoxin
3532 JASPIC010000012.1 GCA030229005_00151 CDS open 21421-21702 _na     93_aa Plasmid maintenance system killer protein
3533 JASPIC010000012.1 GCA030229005_00152 CDS open 21832-22077 _na     81_aa copG Ribbon-helix-helix protein%2C CopG family
3534 JASPIC010000012.1 GCA030229005_00153 CDS open 22080-22322 _na     80_aa Toxin
3535 JASPIC010000012.1 GCA030229005_00154 CDS open 22534-22695 _na     53_aa VOC family protein
3536 JASPIC010000012.1 GCA030229005_00155 CDS open 22805-23011 _na     68_aa hypothetical protein
3537 JASPIC010000012.1 GCA030229005_00156 CDS open 22962-23276 _na     104_aa Nucleotidyltransferase
3538 JASPIC010000012.1 GCA030229005_00157 CDS open 23566-25047 _na     493_aa HEPN domain-containing protein
3539 JASPIC010000012.1 GCA030229005_00158 CDS open 25930-27876 _na     648_aa DUF4209 domain-containing protein
3540 JASPIC010000012.1 GCA030229005_00159 CDS open 28494-29468 _na     324_aa NAD-dependent epimerase/dehydratase domain-containing protein
3541 JASPIC010000012.1 GCA030229005_00160 CDS open 29794-29922 _na     42_aa Monooxygenase
3542 JASPIC010000012.1 GCA030229005_00161 CDS open 29966-30355 _na     129_aa soxR HTH merR-type domain-containing protein
3543 JASPIC010000012.1 GCA030229005_00162 CDS open 30454-31875 _na     473_aa merA mercury(II) reductase
3544 JASPIC010000012.1 GCA030229005_00163 CDS open 31872-32222 _na     116_aa Mercuric ion transport protein
3545 JASPIC010000012.1 GCA030229005_00164 CDS open 32415-32684 _na     89_aa Peptide chain release factor 1
3546 JASPIC010000012.1 GCA030229005_00165 CDS open 33179-33532 _na     117_aa mmeI Type IIL restriction-modification enzyme MmeI
3547 JASPIC010000012.1 GCA030229005_00166 CDS open 33603-34457 _na     284_aa erm(X) 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(X)
3548 JASPIC010000012.1 GCA030229005_00167 CDS open 34807-35154 _na     115_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
3549 JASPIC010000012.1 GCA030229005_00168 CDS open 35443-36177 _na     244_aa ABC transporter
3550 JASPIC010000012.1 GCA030229005_00169 CDS open 36164-38170 _na     668_aa DUF1430 domain-containing protein
3551 JASPIC010000012.1 GCA030229005_00170 CDS open 38204-38500 _na     98_aa recombinase family protein
3552 JASPIC010000012.1 GCA030229005_00171 CDS open 38519-39607 _na     362_aa ychF redox-regulated ATPase YchF
3553 JASPIC010000012.1 GCA030229005_00172 CDS open 39631-41067 _na     478_aa AI-2E family transporter
3554 JASPIC010000012.1 GCA030229005_00173 CDS open 41099-42148 _na     349_aa DNA recombinase
3555 JASPIC010000012.1 GCA030229005_00174 CDS open 42160-42837 _na     225_aa DUF6542 domain-containing protein
3556 JASPIC010000012.1 GCA030229005_00175 CDS open 42891-43862 _na     323_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
3557 JASPIC010000012.1 GCA030229005_00176 CDS open 43966-45222 _na     418_aa xseA exodeoxyribonuclease VII large subunit
3558 JASPIC010000012.1 GCA030229005_00177 CDS open 45265-45534 _na     89_aa exodeoxyribonuclease VII small subunit
3559 JASPIC010000012.1 GCA030229005_00178 CDS open 45545-46195 _na     216_aa DUF4245 domain-containing protein
3560 JASPIC010000012.1 GCA030229005_00179 CDS open 46260-47270 _na     336_aa glpX class II fructose-bisphosphatase
3561 JASPIC010000012.1 GCA030229005_00180 CDS open 47324-48016 _na     230_aa CAAX protease
3562 JASPIC010000012.1 GCA030229005_00181 CDS open 48120-49520 _na     466_aa Fumarate hydratase class II
3563 JASPIC010000012.1 GCA030229005_00182 CDS open 49587-50090 _na     167_aa Serine/threonine protein kinase
3564 JASPIC010000012.1 GCA030229005_00183 CDS open 50118-50726 _na     202_aa HTH tetR-type domain-containing protein
3565 JASPIC010000012.1 GCA030229005_00184 CDS open 50720-52279 _na     519_aa MFS transporter
3566 JASPIC010000012.1 GCA030229005_00185 CDS open 52347-52955 _na     202_aa LGFP repeat-containing protein
3567 JASPIC010000012.1 GCA030229005_00186 CDS open 52981-53601 _na     206_aa lysR LysR substrate-binding domain-containing protein
3568 JASPIC010000012.1 GCA030229005_00187 CDS open 53627-54013 _na     128_aa Transcriptional regulator
3569 JASPIC010000012.1 GCA030229005_00188 CDS open 54010-55302 _na     430_aa Serine hydroxymethyltransferase
3570 JASPIC010000012.1 GCA030229005_00189 CDS open 55415-56338 _na     307_aa coaA type I pantothenate kinase
3571 JASPIC010000012.1 GCA030229005_00190 CDS open 56351-57130 _na     259_aa isoprenyl transferase
3572 JASPIC010000012.1 GCA030229005_00191 CDS open 57151-57450 _na     99_aa Secreted protein
3573 JASPIC010000012.1 GCA030229005_00192 CDS open 57450-58331 _na     293_aa mca mycothiol conjugate amidase Mca
3574 JASPIC010000012.1 GCA030229005_00193 CDS open 58434-58883 _na     149_aa DUF4307 domain-containing protein
3575 JASPIC010000012.1 GCA030229005_00194 CDS open 58990-59511 _na     173_aa greA transcription elongation factor GreA
3576 JASPIC010000012.1 GCA030229005_00195 CDS open 59549-60058 _na     169_aa Secreted protein
3577 JASPIC010000012.1 GCA030229005_00196 CDS open 60174-60968 _na     264_aa Bax inhibitor-1/YccA family protein
3578 JASPIC010000012.1 GCA030229005_00197 CDS open 61055-61996 _na     313_aa Suppressor of fused-like domain-containing protein
3579 JASPIC010000012.1 GCA030229005_00198 CDS open 62002-62454 _na     150_aa S-ribosylhomocysteine lyase
3580 JASPIC010000012.1 GCA030229005_00200 CDS open 62895-64226 _na     443_aa Phytase-like domain-containing protein
3581 JASPIC010000012.1 GCA030229005_00201 CDS open 64301-64921 _na     206_aa Abortive infection protein
3582 JASPIC010000012.1 GCA030229005_00126 gene open 644-2146
3583 JASPIC010000012.1 GCA030229005_00127 gene open 2228-3664
3584 JASPIC010000012.1 GCA030229005_00128 gene open 3690-4205
3585 JASPIC010000012.1 GCA030229005_00129 gene open 4252-5028
3586 JASPIC010000012.1 GCA030229005_00130 gene open 5045-5536
3587 JASPIC010000012.1 GCA030229005_00131 gene open 5575-6594
3588 JASPIC010000012.1 GCA030229005_00132 gene open 6591-6878
3589 JASPIC010000012.1 GCA030229005_00133 gene open 6997-8208
3590 JASPIC010000012.1 GCA030229005_00134 gene open 8235-9290
3591 JASPIC010000012.1 GCA030229005_00135 gene open 9295-10047
3592 JASPIC010000012.1 GCA030229005_00136 gene open 10104-10877 merR
3593 JASPIC010000012.1 GCA030229005_00137 gene open 10929-11423
3594 JASPIC010000012.1 GCA030229005_00138 gene open 11461-12555
3595 JASPIC010000012.1 GCA030229005_00139 gene open 12638-14173
3596 JASPIC010000012.1 GCA030229005_00140 gene open 14176-14742
3597 JASPIC010000012.1 GCA030229005_00141 gene open 14795-15646
3598 JASPIC010000012.1 GCA030229005_00142 gene open 15627-16466
3599 JASPIC010000012.1 GCA030229005_00143 gene open 16544-17218
3600 JASPIC010000012.1 GCA030229005_00144 gene open 17215-18246
3601 JASPIC010000012.1 GCA030229005_00145 gene open 18243-18689 aac(3)-XI
3602 JASPIC010000012.1 GCA030229005_00146 gene open 18801-19874
3603 JASPIC010000012.1 GCA030229005_00147 gene open 19970-20287
3604 JASPIC010000012.1 GCA030229005_00148 gene open 20309-20596
3605 JASPIC010000012.1 GCA030229005_00149 gene open 20550-21071 arfB
3606 JASPIC010000012.1 GCA030229005_00150 gene open 21126-21434 higA
3607 JASPIC010000012.1 GCA030229005_00151 gene open 21421-21702
3608 JASPIC010000012.1 GCA030229005_00152 gene open 21832-22077 copG
3609 JASPIC010000012.1 GCA030229005_00153 gene open 22080-22322
3610 JASPIC010000012.1 GCA030229005_00154 gene open 22534-22695
3611 JASPIC010000012.1 GCA030229005_00155 gene open 22805-23011
3612 JASPIC010000012.1 GCA030229005_00156 gene open 22962-23276
3613 JASPIC010000012.1 GCA030229005_00157 gene open 23566-25047
3614 JASPIC010000012.1 GCA030229005_00158 gene open 25930-27876
3615 JASPIC010000012.1 GCA030229005_00159 gene open 28494-29468
3616 JASPIC010000012.1 GCA030229005_00160 gene open 29794-29922
3617 JASPIC010000012.1 GCA030229005_00161 gene open 29966-30355 soxR
3618 JASPIC010000012.1 GCA030229005_00162 gene open 30454-31875 merA
3619 JASPIC010000012.1 GCA030229005_00163 gene open 31872-32222
3620 JASPIC010000012.1 GCA030229005_00164 gene open 32415-32684
3621 JASPIC010000012.1 GCA030229005_00165 gene open 33179-33532 mmeI
3622 JASPIC010000012.1 GCA030229005_00166 gene open 33603-34457 erm(X)
3623 JASPIC010000012.1 GCA030229005_00167 gene open 34807-35154
3624 JASPIC010000012.1 GCA030229005_00168 gene open 35443-36177
3625 JASPIC010000012.1 GCA030229005_00169 gene open 36164-38170
3626 JASPIC010000012.1 GCA030229005_00170 gene open 38204-38500
3627 JASPIC010000012.1 GCA030229005_00171 gene open 38519-39607 ychF
3628 JASPIC010000012.1 GCA030229005_00172 gene open 39631-41067
3629 JASPIC010000012.1 GCA030229005_00173 gene open 41099-42148
3630 JASPIC010000012.1 GCA030229005_00174 gene open 42160-42837
3631 JASPIC010000012.1 GCA030229005_00175 gene open 42891-43862
3632 JASPIC010000012.1 GCA030229005_00176 gene open 43966-45222 xseA
3633 JASPIC010000012.1 GCA030229005_00177 gene open 45265-45534
3634 JASPIC010000012.1 GCA030229005_00178 gene open 45545-46195
3635 JASPIC010000012.1 GCA030229005_00179 gene open 46260-47270 glpX
3636 JASPIC010000012.1 GCA030229005_00180 gene open 47324-48016
3637 JASPIC010000012.1 GCA030229005_00181 gene open 48120-49520
3638 JASPIC010000012.1 GCA030229005_00182 gene open 49587-50090
3639 JASPIC010000012.1 GCA030229005_00183 gene open 50118-50726
3640 JASPIC010000012.1 GCA030229005_00184 gene open 50720-52279
3641 JASPIC010000012.1 GCA030229005_00185 gene open 52347-52955
3642 JASPIC010000012.1 GCA030229005_00186 gene open 52981-53601 lysR
3643 JASPIC010000012.1 GCA030229005_00187 gene open 53627-54013
3644 JASPIC010000012.1 GCA030229005_00188 gene open 54010-55302
3645 JASPIC010000012.1 GCA030229005_00189 gene open 55415-56338 coaA
3646 JASPIC010000012.1 GCA030229005_00190 gene open 56351-57130
3647 JASPIC010000012.1 GCA030229005_00191 gene open 57151-57450
3648 JASPIC010000012.1 GCA030229005_00192 gene open 57450-58331 mca
3649 JASPIC010000012.1 GCA030229005_00193 gene open 58434-58883
3650 JASPIC010000012.1 GCA030229005_00194 gene open 58990-59511 greA
3651 JASPIC010000012.1 GCA030229005_00195 gene open 59549-60058
3652 JASPIC010000012.1 GCA030229005_00196 gene open 60174-60968
3653 JASPIC010000012.1 GCA030229005_00197 gene open 61055-61996
3654 JASPIC010000012.1 GCA030229005_00198 gene open 62002-62454
3655 JASPIC010000012.1 GCA030229005_00200 gene open 62895-64226
3656 JASPIC010000012.1 GCA030229005_00201 gene open 64301-64921
3657 JASPIC010000012.1 GCA030229005_00199 gene open 62663-62736 trnL
3658 JASPIC010000012.1 GCA030229005_00199 tRNA open 62663-62736 trnL tRNA-Leu(taa)
3659 JASPIC010000013.1 GCA030229005_00202 CDS open 21-329 _na     102_aa Transposase
3660 JASPIC010000013.1 GCA030229005_00203 CDS open 275-730 _na     151_aa hypothetical protein
3661 JASPIC010000013.1 GCA030229005_00204 CDS open 838-1800 _na     320_aa era GTPase Era
3662 JASPIC010000013.1 GCA030229005_00205 CDS open 1826-2506 _na     226_aa recO DNA repair protein RecO
3663 JASPIC010000013.1 GCA030229005_00206 CDS open 2516-3241 _na     241_aa isoprenyl transferase
3664 JASPIC010000013.1 GCA030229005_00207 CDS open 3238-3618 _na     126_aa Transcriptional repressor
3665 JASPIC010000013.1 GCA030229005_00208 CDS open 3760-4113 _na     117_aa HTH arsR-type domain-containing protein
3666 JASPIC010000013.1 GCA030229005_00209 CDS open 4278-5660 _na     460_aa glycine--tRNA ligase
3667 JASPIC010000013.1 GCA030229005_00210 CDS open 5660-6166 _na     168_aa DUF4178 domain-containing protein
3668 JASPIC010000013.1 GCA030229005_00211 CDS open 6163-6603 _na     146_aa hypothetical protein
3669 JASPIC010000013.1 GCA030229005_00212 CDS open 6664-8661 _na     665_aa parA Chromosome partitioning protein ParA
3670 JASPIC010000013.1 GCA030229005_00213 CDS open 8681-9991 _na     436_aa deoxyguanosinetriphosphate triphosphohydrolase
3671 JASPIC010000013.1 GCA030229005_00214 CDS open 10012-10179 _na     55_aa Transposase
3672 JASPIC010000013.1 GCA030229005_00215 CDS open 10406-11374 _na     322_aa Arsenic-transporting ATPase
3673 JASPIC010000013.1 GCA030229005_00216 CDS open 11365-11622 _na     85_aa cory-CC-star protein
3674 JASPIC010000013.1 GCA030229005_00217 CDS open 11606-13330 _na     574_aa cstA Carbon starvation protein CstA
3675 JASPIC010000013.1 GCA030229005_00218 CDS open 14095-15000 _na     301_aa hypothetical protein
3676 JASPIC010000013.1 GCA030229005_00219 CDS open 15085-15333 _na     82_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
3677 JASPIC010000013.1 GCA030229005_00220 CDS open 15333-15749 _na     138_aa ribonuclease domain-containing protein
3678 JASPIC010000013.1 GCA030229005_00221 CDS open 15785-17797 _na     670_aa DNA primase
3679 JASPIC010000013.1 GCA030229005_00222 CDS open 17924-18145 _na     73_aa DUF1902 domain-containing protein
3680 JASPIC010000013.1 GCA030229005_00223 CDS open 18399-19547 _na     382_aa irrE IrrE N-terminal-like domain-containing protein
3681 JASPIC010000013.1 GCA030229005_00224 CDS open 19551-20036 _na     161_aa DUF4411 domain-containing protein
3682 JASPIC010000013.1 GCA030229005_00225 CDS open 20148-20828 _na     226_aa Putative 8-oxoguanine DNA glycosylase OGG-like protein
3683 JASPIC010000013.1 GCA030229005_00226 CDS open 20850-21446 _na     198_aa Nucleoside triphosphate hydrolase
3684 JASPIC010000013.1 GCA030229005_00227 CDS open 21436-21858 _na     140_aa Alpha helical Porin B
3685 JASPIC010000013.1 GCA030229005_00228 CDS open 22006-22809 _na     267_aa Transglycosylase SLT domain-containing protein
3686 JASPIC010000013.1 GCA030229005_00229 CDS open 22885-24162 _na     425_aa eno phosphopyruvate hydratase
3687 JASPIC010000013.1 GCA030229005_00230 CDS open 24335-25186 _na     283_aa Transcriptional regulator
3688 JASPIC010000013.1 GCA030229005_00231 CDS open 25258-25905 _na     215_aa Septum formation initiator
3689 JASPIC010000013.1 GCA030229005_00232 CDS open 25916-26299 _na     127_aa hypothetical protein
3690 JASPIC010000013.1 GCA030229005_00233 CDS open 26414-26986 _na     190_aa Septum formation initiator family protein
3691 JASPIC010000013.1 GCA030229005_00234 CDS open 26983-27918 _na     311_aa Ppx/GppA phosphatase family protein
3692 JASPIC010000013.1 GCA030229005_00235 CDS open 28011-29174 _na     387_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
3693 JASPIC010000013.1 GCA030229005_00236 CDS open 29264-30547 _na     427_aa wecC UDP-N-acetyl-D-mannosamine dehydrogenase
3694 JASPIC010000013.1 GCA030229005_00238 CDS open 30722-32020 _na     432_aa Glycosyltransferase family 4 protein
3695 JASPIC010000013.1 GCA030229005_00239 CDS open 32007-33434 _na     475_aa glycosyltransferase family 4 protein
3696 JASPIC010000013.1 GCA030229005_00240 CDS open 33480-35378 _na     632_aa Glycosyltransferase
3697 JASPIC010000013.1 GCA030229005_00241 CDS open 35375-36190 _na     271_aa ABC transporter ATP-binding protein
3698 JASPIC010000013.1 GCA030229005_00242 CDS open 36180-36884 _na     234_aa Transport permease protein
3699 JASPIC010000013.1 GCA030229005_00243 CDS open 37210-37938 _na     242_aa DUF6270 domain-containing protein
3700 JASPIC010000013.1 GCA030229005_00244 CDS open 38157-39506 _na     449_aa Asparagine synthetase domain-containing protein
3701 JASPIC010000013.1 GCA030229005_00245 CDS open 39908-42577 _na     889_aa Glycosyltransferase
3702 JASPIC010000013.1 GCA030229005_00246 CDS open 42767-44794 _na     675_aa heparinase II/III family protein
3703 JASPIC010000013.1 GCA030229005_00247 CDS open 45648-46196 _na     182_aa IS3 family transposase
3704 JASPIC010000013.1 GCA030229005_00248 CDS open 46180-46569 _na     129_aa HTH-like domain-containing protein
3705 JASPIC010000013.1 GCA030229005_00249 CDS open 46619-46759 _na     46_aa transposase
3706 JASPIC010000013.1 GCA030229005_00250 CDS open 47049-47711 _na     220_aa tetR TetR family transcriptional regulator
3707 JASPIC010000013.1 GCA030229005_00251 CDS open 49143-49382 _na     79_aa hypothetical protein
3708 JASPIC010000013.1 GCA030229005_00252 CDS open 49581-49829 _na     82_aa hypothetical protein
3709 JASPIC010000013.1 GCA030229005_00202 gene open 21-329
3710 JASPIC010000013.1 GCA030229005_00203 gene open 275-730
3711 JASPIC010000013.1 GCA030229005_00204 gene open 838-1800 era
3712 JASPIC010000013.1 GCA030229005_00205 gene open 1826-2506 recO
3713 JASPIC010000013.1 GCA030229005_00206 gene open 2516-3241
3714 JASPIC010000013.1 GCA030229005_00207 gene open 3238-3618
3715 JASPIC010000013.1 GCA030229005_00208 gene open 3760-4113
3716 JASPIC010000013.1 GCA030229005_00209 gene open 4278-5660
3717 JASPIC010000013.1 GCA030229005_00210 gene open 5660-6166
3718 JASPIC010000013.1 GCA030229005_00211 gene open 6163-6603
3719 JASPIC010000013.1 GCA030229005_00212 gene open 6664-8661 parA
3720 JASPIC010000013.1 GCA030229005_00213 gene open 8681-9991
3721 JASPIC010000013.1 GCA030229005_00214 gene open 10012-10179
3722 JASPIC010000013.1 GCA030229005_00215 gene open 10406-11374
3723 JASPIC010000013.1 GCA030229005_00216 gene open 11365-11622
3724 JASPIC010000013.1 GCA030229005_00217 gene open 11606-13330 cstA
3725 JASPIC010000013.1 GCA030229005_00218 gene open 14095-15000
3726 JASPIC010000013.1 GCA030229005_00219 gene open 15085-15333
3727 JASPIC010000013.1 GCA030229005_00220 gene open 15333-15749
3728 JASPIC010000013.1 GCA030229005_00221 gene open 15785-17797
3729 JASPIC010000013.1 GCA030229005_00222 gene open 17924-18145
3730 JASPIC010000013.1 GCA030229005_00223 gene open 18399-19547 irrE
3731 JASPIC010000013.1 GCA030229005_00224 gene open 19551-20036
3732 JASPIC010000013.1 GCA030229005_00225 gene open 20148-20828
3733 JASPIC010000013.1 GCA030229005_00226 gene open 20850-21446
3734 JASPIC010000013.1 GCA030229005_00227 gene open 21436-21858
3735 JASPIC010000013.1 GCA030229005_00228 gene open 22006-22809
3736 JASPIC010000013.1 GCA030229005_00229 gene open 22885-24162 eno
3737 JASPIC010000013.1 GCA030229005_00230 gene open 24335-25186
3738 JASPIC010000013.1 GCA030229005_00231 gene open 25258-25905
3739 JASPIC010000013.1 GCA030229005_00232 gene open 25916-26299
3740 JASPIC010000013.1 GCA030229005_00233 gene open 26414-26986
3741 JASPIC010000013.1 GCA030229005_00234 gene open 26983-27918
3742 JASPIC010000013.1 GCA030229005_00235 gene open 28011-29174 wecB
3743 JASPIC010000013.1 GCA030229005_00236 gene open 29264-30547 wecC
3744 JASPIC010000013.1 GCA030229005_00238 gene open 30722-32020
3745 JASPIC010000013.1 GCA030229005_00239 gene open 32007-33434
3746 JASPIC010000013.1 GCA030229005_00240 gene open 33480-35378
3747 JASPIC010000013.1 GCA030229005_00241 gene open 35375-36190
3748 JASPIC010000013.1 GCA030229005_00242 gene open 36180-36884
3749 JASPIC010000013.1 GCA030229005_00243 gene open 37210-37938
3750 JASPIC010000013.1 GCA030229005_00244 gene open 38157-39506
3751 JASPIC010000013.1 GCA030229005_00245 gene open 39908-42577
3752 JASPIC010000013.1 GCA030229005_00246 gene open 42767-44794
3753 JASPIC010000013.1 GCA030229005_00247 gene open 45648-46196
3754 JASPIC010000013.1 GCA030229005_00248 gene open 46180-46569
3755 JASPIC010000013.1 GCA030229005_00249 gene open 46619-46759
3756 JASPIC010000013.1 GCA030229005_00250 gene open 47049-47711 tetR
3757 JASPIC010000013.1 GCA030229005_00251 gene open 49143-49382
3758 JASPIC010000013.1 GCA030229005_00252 gene open 49581-49829
3759 JASPIC010000013.1 GCA030229005_00237 gene open 30610-30683 trnI
3760 JASPIC010000013.1 GCA030229005_00237 tRNA open 30610-30683 trnI tRNA-Ile2(cat)
3761 JASPIC010000014.1 repeat_region open 34032-36937 CRISPR array with 48 repeats of length 28%2C consensus sequence GGCTCATCCCCGCGAGTGCGGGGCAGAC and spacer length 33
3762 JASPIC010000014.1 GCA030229005_00253 CDS open 28-348 _na     106_aa hypothetical protein
3763 JASPIC010000014.1 GCA030229005_00254 CDS open 359-901 _na     180_aa hutD HutD family protein
3764 JASPIC010000014.1 GCA030229005_00255 CDS open 978-2402 _na     474_aa dcuC C4-dicarboxylate transporter DcuC
3765 JASPIC010000014.1 GCA030229005_00256 CDS open 2426-3757 _na     443_aa Plasmid pRiA4b Orf3-like domain-containing protein
3766 JASPIC010000014.1 GCA030229005_00257 CDS open 3794-4111 _na     105_aa DUF202 domain-containing protein
3767 JASPIC010000014.1 GCA030229005_00258 CDS open 4108-4470 _na     120_aa DUF202 domain-containing protein
3768 JASPIC010000014.1 GCA030229005_00259 CDS open 4467-4916 _na     149_aa VanZ-like domain-containing protein
3769 JASPIC010000014.1 GCA030229005_00260 CDS open 4994-5929 _na     311_aa Acryloyl-CoA reductase
3770 JASPIC010000014.1 GCA030229005_00261 CDS open 5919-6971 _na     350_aa Transmembrane protein
3771 JASPIC010000014.1 GCA030229005_00262 CDS open 7445-10288 _na     947_aa leuS leucine--tRNA ligase
3772 JASPIC010000014.1 GCA030229005_00263 CDS open 10502-12253 _na     583_aa AAA family ATPase
3773 JASPIC010000014.1 GCA030229005_00264 CDS open 12503-12958 _na     151_aa Secreted protein
3774 JASPIC010000014.1 GCA030229005_00265 CDS open 13212-13679 _na     155_aa Secreted protein
3775 JASPIC010000014.1 GCA030229005_00266 CDS open 13814-15130 _na     438_aa Septum formation initiator
3776 JASPIC010000014.1 GCA030229005_00267 CDS open 15254-15358 _na     34_aa hypothetical protein
3777 JASPIC010000014.1 GCA030229005_00268 CDS open 15511-15768 _na     85_aa Secreted protein
3778 JASPIC010000014.1 GCA030229005_00269 CDS open 15782-17023 _na     413_aa Phosphate transporter
3779 JASPIC010000014.1 GCA030229005_00270 CDS open 17168-18529 _na     453_aa Septum formation initiator
3780 JASPIC010000014.1 GCA030229005_00271 CDS open 18829-19998 _na     389_aa Filamentation induced by cAMP protein fic
3781 JASPIC010000014.1 GCA030229005_00272 CDS open 20302-20748 _na     148_aa hypothetical protein
3782 JASPIC010000014.1 GCA030229005_00273 CDS open 20745-21392 _na     215_aa Fido domain-containing protein
3783 JASPIC010000014.1 GCA030229005_00274 CDS open 21450-21785 _na     111_aa HTH cro/C1-type domain-containing protein
3784 JASPIC010000014.1 GCA030229005_00275 CDS open 22313-22447 _na     44_aa hypothetical protein
3785 JASPIC010000014.1 GCA030229005_00276 CDS open 22515-22835 _na     106_aa hypothetical protein
3786 JASPIC010000014.1 GCA030229005_00277 CDS open 22888-23637 _na     249_aa Oxidoreductase
3787 JASPIC010000014.1 GCA030229005_00278 CDS open 23709-25166 _na     485_aa FAD-dependent oxidoreductase
3788 JASPIC010000014.1 GCA030229005_00279 CDS open 25166-25459 _na     97_aa (2Fe-2S)-binding protein
3789 JASPIC010000014.1 GCA030229005_00280 CDS open 25472-26629 _na     385_aa FAD-binding oxidoreductase
3790 JASPIC010000014.1 GCA030229005_00281 CDS open 26662-28116 _na     484_aa Alanine:cation symporter family protein
3791 JASPIC010000014.1 GCA030229005_00282 CDS open 28149-29207 _na     352_aa Proline racemase family protein
3792 JASPIC010000014.1 GCA030229005_00283 CDS open 29216-30127 _na     303_aa N-acetylneuraminate lyase
3793 JASPIC010000014.1 GCA030229005_00284 CDS open 30255-30887 _na     210_aa gntR GntR family transcriptional regulator
3794 JASPIC010000014.1 GCA030229005_00285 CDS open 30943-32418 _na     491_aa Aldehyde dehydrogenase
3795 JASPIC010000014.1 GCA030229005_00286 CDS open 37225-40041 _na     938_aa CRISPR-associated helicase/endonuclease Cas3
3796 JASPIC010000014.1 GCA030229005_00287 CDS open 40098-41846 _na     582_aa casA type I-E CRISPR-associated protein Cse1/CasA
3797 JASPIC010000014.1 GCA030229005_00288 CDS open 41843-42487 _na     214_aa casB type I-E CRISPR-associated protein Cse2/CasB
3798 JASPIC010000014.1 GCA030229005_00289 CDS open 42507-43637 _na     376_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3799 JASPIC010000014.1 GCA030229005_00290 CDS open 43637-44359 _na     240_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3800 JASPIC010000014.1 GCA030229005_00291 CDS open 44356-45057 _na     233_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
3801 JASPIC010000014.1 GCA030229005_00292 CDS open 45057-45998 _na     313_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3802 JASPIC010000014.1 GCA030229005_00293 CDS open 45995-46339 _na     114_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
3803 JASPIC010000014.1 GCA030229005_00294 CDS open 46486-47265 _na     259_aa Ornithine cyclodeaminase
3804 JASPIC010000014.1 GCA030229005_00295 CDS open 47267-47407 _na     46_aa hypothetical protein
3805 JASPIC010000014.1 GCA030229005_00296 CDS open 47440-48636 _na     398_aa gltS sodium/glutamate symporter
3806 JASPIC010000014.1 GCA030229005_00297 CDS open 48885-49241 _na     118_aa Or membrane protein
3807 JASPIC010000014.1 GCA030229005_00253 gene open 28-348
3808 JASPIC010000014.1 GCA030229005_00254 gene open 359-901 hutD
3809 JASPIC010000014.1 GCA030229005_00255 gene open 978-2402 dcuC
3810 JASPIC010000014.1 GCA030229005_00256 gene open 2426-3757
3811 JASPIC010000014.1 GCA030229005_00257 gene open 3794-4111
3812 JASPIC010000014.1 GCA030229005_00258 gene open 4108-4470
3813 JASPIC010000014.1 GCA030229005_00259 gene open 4467-4916
3814 JASPIC010000014.1 GCA030229005_00260 gene open 4994-5929
3815 JASPIC010000014.1 GCA030229005_00261 gene open 5919-6971
3816 JASPIC010000014.1 GCA030229005_00262 gene open 7445-10288 leuS
3817 JASPIC010000014.1 GCA030229005_00263 gene open 10502-12253
3818 JASPIC010000014.1 GCA030229005_00264 gene open 12503-12958
3819 JASPIC010000014.1 GCA030229005_00265 gene open 13212-13679
3820 JASPIC010000014.1 GCA030229005_00266 gene open 13814-15130
3821 JASPIC010000014.1 GCA030229005_00267 gene open 15254-15358
3822 JASPIC010000014.1 GCA030229005_00268 gene open 15511-15768
3823 JASPIC010000014.1 GCA030229005_00269 gene open 15782-17023
3824 JASPIC010000014.1 GCA030229005_00270 gene open 17168-18529
3825 JASPIC010000014.1 GCA030229005_00271 gene open 18829-19998
3826 JASPIC010000014.1 GCA030229005_00272 gene open 20302-20748
3827 JASPIC010000014.1 GCA030229005_00273 gene open 20745-21392
3828 JASPIC010000014.1 GCA030229005_00274 gene open 21450-21785
3829 JASPIC010000014.1 GCA030229005_00275 gene open 22313-22447
3830 JASPIC010000014.1 GCA030229005_00276 gene open 22515-22835
3831 JASPIC010000014.1 GCA030229005_00277 gene open 22888-23637
3832 JASPIC010000014.1 GCA030229005_00278 gene open 23709-25166
3833 JASPIC010000014.1 GCA030229005_00279 gene open 25166-25459
3834 JASPIC010000014.1 GCA030229005_00280 gene open 25472-26629
3835 JASPIC010000014.1 GCA030229005_00281 gene open 26662-28116
3836 JASPIC010000014.1 GCA030229005_00282 gene open 28149-29207
3837 JASPIC010000014.1 GCA030229005_00283 gene open 29216-30127
3838 JASPIC010000014.1 GCA030229005_00284 gene open 30255-30887 gntR
3839 JASPIC010000014.1 GCA030229005_00285 gene open 30943-32418
3840 JASPIC010000014.1 GCA030229005_00286 gene open 37225-40041
3841 JASPIC010000014.1 GCA030229005_00287 gene open 40098-41846 casA
3842 JASPIC010000014.1 GCA030229005_00288 gene open 41843-42487 casB
3843 JASPIC010000014.1 GCA030229005_00289 gene open 42507-43637 cas7e
3844 JASPIC010000014.1 GCA030229005_00290 gene open 43637-44359 cas5e
3845 JASPIC010000014.1 GCA030229005_00291 gene open 44356-45057 cas6e
3846 JASPIC010000014.1 GCA030229005_00292 gene open 45057-45998 cas1e
3847 JASPIC010000014.1 GCA030229005_00293 gene open 45995-46339 cas2e
3848 JASPIC010000014.1 GCA030229005_00294 gene open 46486-47265
3849 JASPIC010000014.1 GCA030229005_00295 gene open 47267-47407
3850 JASPIC010000014.1 GCA030229005_00296 gene open 47440-48636 gltS
3851 JASPIC010000014.1 GCA030229005_00297 gene open 48885-49241
3852 JASPIC010000015.1 GCA030229005_00298 CDS open 216-992 _na     258_aa ATP-binding protein
3853 JASPIC010000015.1 GCA030229005_00299 CDS open 1249-2478 _na     409_aa Bacillibactin exporter
3854 JASPIC010000015.1 GCA030229005_00300 CDS open 2570-3247 _na     225_aa acrR HTH tetR-type domain-containing protein
3855 JASPIC010000015.1 GCA030229005_00301 CDS open 3496-3687 _na     63_aa hypothetical protein
3856 JASPIC010000015.1 GCA030229005_00302 CDS open 4116-4253 _na     45_aa hypothetical protein
3857 JASPIC010000015.1 GCA030229005_00303 CDS open 4254-5399 _na     381_aa irrE IrrE N-terminal-like domain-containing protein
3858 JASPIC010000015.1 GCA030229005_00304 CDS open 5638-6012 _na     124_aa Glutaredoxin family protein
3859 JASPIC010000015.1 GCA030229005_00305 CDS open 6053-6439 _na     128_aa Phosphoserine phosphatase
3860 JASPIC010000015.1 GCA030229005_00306 CDS open 6432-6938 _na     168_aa N-acetyltransferase domain-containing protein
3861 JASPIC010000015.1 GCA030229005_00307 CDS open 7289-8146 _na     285_aa Methyltransferase
3862 JASPIC010000015.1 GCA030229005_00308 CDS open 8562-8969 _na     135_aa Arsenate reductase
3863 JASPIC010000015.1 GCA030229005_00309 CDS open 8979-10058 _na     359_aa arsB ACR3 family arsenite efflux transporter
3864 JASPIC010000015.1 GCA030229005_00310 CDS open 10141-10488 _na     115_aa arsR ArsR family transcriptional regulator
3865 JASPIC010000015.1 GCA030229005_00311 CDS open 10517-10993 _na     158_aa 4-carboxymuconolactone decarboxylase
3866 JASPIC010000015.1 GCA030229005_00312 CDS open 11949-12641 _na     230_aa Potassium transporter
3867 JASPIC010000015.1 GCA030229005_00313 CDS open 12634-14010 _na     458_aa ATPase
3868 JASPIC010000015.1 GCA030229005_00314 CDS open 14048-14887 _na     279_aa Glycosyltransferase
3869 JASPIC010000015.1 GCA030229005_00315 CDS open 14927-15922 _na     331_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
3870 JASPIC010000015.1 GCA030229005_00316 CDS open 15932-16834 _na     300_aa AEC family transporter
3871 JASPIC010000015.1 GCA030229005_00317 CDS open 16908-17897 _na     329_aa Sugar ABC transporter substrate-binding protein
3872 JASPIC010000015.1 GCA030229005_00318 CDS open 17894-18955 _na     353_aa xylH Xylose transport system permease protein XylH
3873 JASPIC010000015.1 GCA030229005_00319 CDS open 18956-19714 _na     252_aa ABC transporter ATP-binding protein
3874 JASPIC010000015.1 GCA030229005_00320 CDS open 19775-20086 _na     103_aa DUF4229 domain-containing protein
3875 JASPIC010000015.1 GCA030229005_00321 CDS open 20114-20392 _na     92_aa Secreted protein
3876 JASPIC010000015.1 GCA030229005_00322 CDS open 20615-20863 _na     82_aa Helix-turn-helix domain-containing protein
3877 JASPIC010000015.1 GCA030229005_00323 CDS open 20860-21858 _na     332_aa galE UDP-glucose 4-epimerase GalE
3878 JASPIC010000015.1 GCA030229005_00324 CDS open 21858-22868 _na     336_aa ccsB c-type cytochrome biogenesis protein CcsB
3879 JASPIC010000015.1 GCA030229005_00325 CDS open 22895-24556 _na     553_aa resB Cytochrome C biogenesis protein ResB
3880 JASPIC010000015.1 GCA030229005_00326 CDS open 24557-25330 _na     257_aa resC Cytochrome C biogenesis protein ResC
3881 JASPIC010000015.1 GCA030229005_00327 CDS open 25331-25918 _na     195_aa Effector protein
3882 JASPIC010000015.1 GCA030229005_00328 CDS open 25928-26557 _na     209_aa Phosphoglycerate mutase
3883 JASPIC010000015.1 GCA030229005_00329 CDS open 26554-27876 _na     440_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
3884 JASPIC010000015.1 GCA030229005_00330 CDS open 27897-28733 _na     278_aa NAD(P)-dependent oxidoreductase
3885 JASPIC010000015.1 GCA030229005_00331 CDS open 28912-29730 _na     272_aa VTT domain-containing protein
3886 JASPIC010000015.1 GCA030229005_00332 CDS open 29831-30145 _na     104_aa Antitoxin FitA-like ribbon-helix-helix domain-containing protein
3887 JASPIC010000015.1 GCA030229005_00333 CDS open 30142-30564 _na     140_aa vapC Ribonuclease VapC
3888 JASPIC010000015.1 GCA030229005_00334 CDS open 30561-31940 _na     459_aa protoporphyrinogen oxidase
3889 JASPIC010000015.1 GCA030229005_00335 CDS open 31940-32989 _na     349_aa hemE uroporphyrinogen decarboxylase
3890 JASPIC010000015.1 GCA030229005_00336 CDS open 33016-35541 _na     841_aa HAD family hydrolase
3891 JASPIC010000015.1 GCA030229005_00337 CDS open 35542-36063 _na     173_aa terC Tellurium resistance protein TerC
3892 JASPIC010000015.1 GCA030229005_00338 CDS open 36071-36685 _na     204_aa DUF2975 domain-containing protein
3893 JASPIC010000015.1 GCA030229005_00339 CDS open 36678-37688 _na     336_aa hemB porphobilinogen synthase
3894 JASPIC010000015.1 GCA030229005_00340 CDS open 37722-39422 _na     566_aa uroporphyrinogen-III C-methyltransferase
3895 JASPIC010000015.1 GCA030229005_00341 CDS open 39555-40436 _na     293_aa hemC hydroxymethylbilane synthase
3896 JASPIC010000015.1 GCA030229005_00342 CDS open 40437-41762 _na     441_aa glutamyl-tRNA reductase
3897 JASPIC010000015.1 GCA030229005_00343 CDS open 41808-42044 _na     78_aa Glutaredoxin family protein
3898 JASPIC010000015.1 GCA030229005_00344 CDS open 42130-43164 _na     344_aa HAD-IB family hydrolase
3899 JASPIC010000015.1 GCA030229005_00345 CDS open 43157-43663 _na     168_aa N-acetyltransferase domain-containing protein
3900 JASPIC010000015.1 GCA030229005_00346 CDS open 43699-44160 _na     153_aa RNA-binding protein
3901 JASPIC010000015.1 GCA030229005_00347 CDS open 44456-44812 _na     118_aa hypothetical protein
3902 JASPIC010000015.1 GCA030229005_00298 gene open 216-992
3903 JASPIC010000015.1 GCA030229005_00299 gene open 1249-2478
3904 JASPIC010000015.1 GCA030229005_00300 gene open 2570-3247 acrR
3905 JASPIC010000015.1 GCA030229005_00301 gene open 3496-3687
3906 JASPIC010000015.1 GCA030229005_00302 gene open 4116-4253
3907 JASPIC010000015.1 GCA030229005_00303 gene open 4254-5399 irrE
3908 JASPIC010000015.1 GCA030229005_00304 gene open 5638-6012
3909 JASPIC010000015.1 GCA030229005_00305 gene open 6053-6439
3910 JASPIC010000015.1 GCA030229005_00306 gene open 6432-6938
3911 JASPIC010000015.1 GCA030229005_00307 gene open 7289-8146
3912 JASPIC010000015.1 GCA030229005_00308 gene open 8562-8969
3913 JASPIC010000015.1 GCA030229005_00309 gene open 8979-10058 arsB
3914 JASPIC010000015.1 GCA030229005_00310 gene open 10141-10488 arsR
3915 JASPIC010000015.1 GCA030229005_00311 gene open 10517-10993
3916 JASPIC010000015.1 GCA030229005_00312 gene open 11949-12641
3917 JASPIC010000015.1 GCA030229005_00313 gene open 12634-14010
3918 JASPIC010000015.1 GCA030229005_00314 gene open 14048-14887
3919 JASPIC010000015.1 GCA030229005_00315 gene open 14927-15922
3920 JASPIC010000015.1 GCA030229005_00316 gene open 15932-16834
3921 JASPIC010000015.1 GCA030229005_00317 gene open 16908-17897
3922 JASPIC010000015.1 GCA030229005_00318 gene open 17894-18955 xylH
3923 JASPIC010000015.1 GCA030229005_00319 gene open 18956-19714
3924 JASPIC010000015.1 GCA030229005_00320 gene open 19775-20086
3925 JASPIC010000015.1 GCA030229005_00321 gene open 20114-20392
3926 JASPIC010000015.1 GCA030229005_00322 gene open 20615-20863
3927 JASPIC010000015.1 GCA030229005_00323 gene open 20860-21858 galE
3928 JASPIC010000015.1 GCA030229005_00324 gene open 21858-22868 ccsB
3929 JASPIC010000015.1 GCA030229005_00325 gene open 22895-24556 resB
3930 JASPIC010000015.1 GCA030229005_00326 gene open 24557-25330 resC
3931 JASPIC010000015.1 GCA030229005_00327 gene open 25331-25918
3932 JASPIC010000015.1 GCA030229005_00328 gene open 25928-26557
3933 JASPIC010000015.1 GCA030229005_00329 gene open 26554-27876 hemL
3934 JASPIC010000015.1 GCA030229005_00330 gene open 27897-28733
3935 JASPIC010000015.1 GCA030229005_00331 gene open 28912-29730
3936 JASPIC010000015.1 GCA030229005_00332 gene open 29831-30145
3937 JASPIC010000015.1 GCA030229005_00333 gene open 30142-30564 vapC
3938 JASPIC010000015.1 GCA030229005_00334 gene open 30561-31940
3939 JASPIC010000015.1 GCA030229005_00335 gene open 31940-32989 hemE
3940 JASPIC010000015.1 GCA030229005_00336 gene open 33016-35541
3941 JASPIC010000015.1 GCA030229005_00337 gene open 35542-36063 terC
3942 JASPIC010000015.1 GCA030229005_00338 gene open 36071-36685
3943 JASPIC010000015.1 GCA030229005_00339 gene open 36678-37688 hemB
3944 JASPIC010000015.1 GCA030229005_00340 gene open 37722-39422
3945 JASPIC010000015.1 GCA030229005_00341 gene open 39555-40436 hemC
3946 JASPIC010000015.1 GCA030229005_00342 gene open 40437-41762
3947 JASPIC010000015.1 GCA030229005_00343 gene open 41808-42044
3948 JASPIC010000015.1 GCA030229005_00344 gene open 42130-43164
3949 JASPIC010000015.1 GCA030229005_00345 gene open 43157-43663
3950 JASPIC010000015.1 GCA030229005_00346 gene open 43699-44160
3951 JASPIC010000015.1 GCA030229005_00347 gene open 44456-44812
3952 JASPIC010000016.1 GCA030229005_00348 CDS open 164-406 _na     80_aa hypothetical protein
3953 JASPIC010000016.1 GCA030229005_00349 CDS open 508-708 _na     66_aa hypothetical protein
3954 JASPIC010000016.1 GCA030229005_00350 CDS open 797-1963 _na     388_aa helix-turn-helix domain-containing protein
3955 JASPIC010000016.1 GCA030229005_00351 CDS open 2230-3309 _na     359_aa whiB WhiB family transcriptional regulator
3956 JASPIC010000016.1 GCA030229005_00352 CDS open 3400-3585 _na     61_aa helix-turn-helix domain-containing protein
3957 JASPIC010000016.1 GCA030229005_00353 CDS open 3582-4031 _na     149_aa helix-turn-helix domain-containing protein
3958 JASPIC010000016.1 GCA030229005_00354 CDS open 4082-4801 _na     239_aa hypothetical protein
3959 JASPIC010000016.1 GCA030229005_00355 CDS open 5198-5773 _na     191_aa nicotinamidase
3960 JASPIC010000016.1 GCA030229005_00356 CDS open 5774-6421 _na     215_aa DUF305 domain-containing protein
3961 JASPIC010000016.1 GCA030229005_00357 CDS open 6541-6816 _na     91_aa DUF3618 domain-containing protein
3962 JASPIC010000016.1 GCA030229005_00358 CDS open 6897-7382 _na     161_aa bcp thioredoxin-dependent thiol peroxidase
3963 JASPIC010000016.1 GCA030229005_00360 CDS open 7592-8050 _na     152_aa Transcriptional regulator
3964 JASPIC010000016.1 GCA030229005_00361 CDS open 8047-8418 _na     123_aa DUF3817 domain-containing protein
3965 JASPIC010000016.1 GCA030229005_00362 CDS open 8463-8837 _na     124_aa Lipoprotein
3966 JASPIC010000016.1 GCA030229005_00363 CDS open 8860-9459 _na     199_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
3967 JASPIC010000016.1 GCA030229005_00364 CDS open 9453-10181 _na     242_aa rph ribonuclease PH
3968 JASPIC010000016.1 GCA030229005_00365 CDS open 10227-11225 _na     332_aa CAAX protease
3969 JASPIC010000016.1 GCA030229005_00366 CDS open 11381-12148 _na     255_aa Metallo-beta-lactamase domain-containing protein
3970 JASPIC010000016.1 GCA030229005_00367 CDS open 12212-13030 _na     272_aa murI glutamate racemase
3971 JASPIC010000016.1 GCA030229005_00368 CDS open 13027-13881 _na     284_aa Rhomboid family intramembrane serine protease
3972 JASPIC010000016.1 GCA030229005_00369 CDS open 13906-14865 _na     319_aa Peptidase
3973 JASPIC010000016.1 GCA030229005_00370 CDS open 14875-15384 _na     169_aa DUF2017 domain-containing protein
3974 JASPIC010000016.1 GCA030229005_00371 CDS open 15424-15762 _na     112_aa clpS ATP-dependent Clp protease adapter ClpS
3975 JASPIC010000016.1 GCA030229005_00372 CDS open 15818-17143 _na     441_aa nicotinate phosphoribosyltransferase
3976 JASPIC010000016.1 GCA030229005_00373 CDS open 17147-19105 _na     652_aa DNA 5'-3' helicase
3977 JASPIC010000016.1 GCA030229005_00374 CDS open 19095-19820 _na     241_aa peptidyl-tRNA hydrolase
3978 JASPIC010000016.1 GCA030229005_00375 CDS open 19912-21612 _na     566_aa ctaD cytochrome c oxidase subunit I
3979 JASPIC010000016.1 GCA030229005_00376 CDS open 21841-22830 _na     329_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
3980 JASPIC010000016.1 GCA030229005_00377 CDS open 22953-23669 _na     238_aa Transcriptional regulator
3981 JASPIC010000016.1 GCA030229005_00378 CDS open 23731-25896 _na     721_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
3982 JASPIC010000016.1 GCA030229005_00379 CDS open 25908-26444 _na     178_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
3983 JASPIC010000016.1 GCA030229005_00380 CDS open 26523-26753 _na     76_aa nrdH Glutaredoxin-like protein NrdH
3984 JASPIC010000016.1 GCA030229005_00381 CDS open 27075-27197 _na     40_aa ykgO type B 50S ribosomal protein L36
3985 JASPIC010000016.1 GCA030229005_00382 CDS open 27339-28157 _na     272_aa nadE ammonia-dependent NAD(+) synthetase
3986 JASPIC010000016.1 GCA030229005_00383 CDS open 28154-28570 _na     138_aa PIN domain-containing protein
3987 JASPIC010000016.1 GCA030229005_00384 CDS open 28570-28950 _na     126_aa Antitoxin
3988 JASPIC010000016.1 GCA030229005_00385 CDS open 28998-29804 _na     268_aa Fructosamine kinase
3989 JASPIC010000016.1 GCA030229005_00386 CDS open 29797-30216 _na     139_aa Methylated-DNA--protein-cysteine methyltransferase
3990 JASPIC010000016.1 GCA030229005_00387 CDS open 30627-31580 _na     317_aa MULE transposase domain-containing protein
3991 JASPIC010000016.1 GCA030229005_00390 CDS open 32017-32808 _na     263_aa Thioredoxin domain-containing protein
3992 JASPIC010000016.1 GCA030229005_00391 CDS open 32876-33358 _na     160_aa mauE Methylamine utilisation protein MauE domain-containing protein
3993 JASPIC010000016.1 GCA030229005_00392 CDS open 33377-35002 _na     541_aa pgm phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent)
3994 JASPIC010000016.1 GCA030229005_00393 CDS open 35118-36536 _na     472_aa Sodium:alanine symporter
3995 JASPIC010000016.1 GCA030229005_00394 CDS open 36547-36894 _na     115_aa fluC Fluoride-specific ion channel FluC
3996 JASPIC010000016.1 GCA030229005_00395 CDS open 36887-37261 _na     124_aa fluC Fluoride-specific ion channel FluC
3997 JASPIC010000016.1 GCA030229005_00396 CDS open 37280-37630 _na     116_aa Fluoride-specific ion channel
3998 JASPIC010000016.1 GCA030229005_00397 CDS open 37623-37988 _na     121_aa fluC Fluoride-specific ion channel FluC
3999 JASPIC010000016.1 GCA030229005_00398 CDS open 37991-40546 _na     851_aa ABC transporter permease
4000 JASPIC010000016.1 GCA030229005_00399 CDS open 40553-41281 _na     242_aa Peptide ABC transporter ATP-binding protein