HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-169 (GCA_030371665.1)

Select a Genome:
BAKTA Annotations for GCA_030371665.1
Genome Selected: Actinomyces oris clade-169
ContigsBases CDSrRNA tmRNAtRNA
37 3006394 2452 3 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5036 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 5036 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JAUDBR010000009.1 GCA030371665_02507 gene open 122374-124254
3002 JAUDBR010000009.1 GCA030371665_02508 gene open 124251-125357
3003 JAUDBR010000009.1 GCA030371665_02509 gene open 125414-126631
3004 JAUDBR010000009.1 GCA030371665_02510 gene open 126636-127502 tagG
3005 JAUDBR010000009.1 GCA030371665_02511 gene open 127586-128812 tagH
3006 JAUDBR010000009.1 GCA030371665_02512 gene open 128840-129913
3007 JAUDBR010000009.1 GCA030371665_02513 gene open 130050-131060
3008 JAUDBR010000009.1 GCA030371665_02514 gene open 131057-132163
3009 JAUDBR010000009.1 GCA030371665_02465 gene open 74588-74669 trnY
3010 JAUDBR010000009.1 GCA030371665_02466 gene open 74780-74852 trnT
3011 JAUDBR010000009.1 GCA030371665_02467 gene open 74891-74964 trnM
3012 JAUDBR010000009.1 GCA030371665_02465 tRNA open 74588-74669 trnY tRNA-Tyr(gta)
3013 JAUDBR010000009.1 GCA030371665_02466 tRNA open 74780-74852 trnT tRNA-Thr(ggt)
3014 JAUDBR010000009.1 GCA030371665_02467 tRNA open 74891-74964 trnM tRNA-Met(cat)
3015 JAUDBR010000010.1 GCA030371665_00369 CDS open 145-1005 _na     286_aa HTH lysR-type domain-containing protein
3016 JAUDBR010000010.1 GCA030371665_00370 CDS open 1111-2073 _na     320_aa eamA EamA domain-containing protein
3017 JAUDBR010000010.1 GCA030371665_00371 CDS open 2070-2762 _na     230_aa NAD(P)H-binding protein
3018 JAUDBR010000010.1 GCA030371665_00372 CDS open 2715-4895 _na     726_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
3019 JAUDBR010000010.1 GCA030371665_00373 CDS open 4949-5890 _na     313_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
3020 JAUDBR010000010.1 GCA030371665_00374 CDS open 5935-6537 _na     200_aa nicotinamidase
3021 JAUDBR010000010.1 GCA030371665_00375 CDS open 6658-7728 _na     356_aa Serine/threonine protein kinase
3022 JAUDBR010000010.1 GCA030371665_00376 CDS open 7987-9834 _na     615_aa Methionine--tRNA ligase
3023 JAUDBR010000010.1 GCA030371665_00377 CDS open 9841-10767 _na     308_aa ycfH putative deoxyribonuclease YcfH
3024 JAUDBR010000010.1 GCA030371665_00378 CDS open 11088-12110 _na     340_aa G5 domain-containing protein
3025 JAUDBR010000010.1 GCA030371665_00379 CDS open 12280-13221 _na     313_aa G5 domain-containing protein
3026 JAUDBR010000010.1 GCA030371665_00380 CDS open 13340-14434 _na     364_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
3027 JAUDBR010000010.1 GCA030371665_00381 CDS open 14431-15417 _na     328_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
3028 JAUDBR010000010.1 GCA030371665_00382 CDS open 15417-17327 _na     636_aa ccmA heme ABC exporter ATP-binding protein CcmA
3029 JAUDBR010000010.1 GCA030371665_00383 CDS open 17460-18005 _na     181_aa hypothetical protein
3030 JAUDBR010000010.1 GCA030371665_00384 CDS open 18103-18816 _na     237_aa FHA domain-containing protein
3031 JAUDBR010000010.1 GCA030371665_00385 CDS open 18828-20987 _na     719_aa FHA domain-containing protein
3032 JAUDBR010000010.1 GCA030371665_00386 CDS open 20987-22453 _na     488_aa sPS1 non-specific serine/threonine protein kinase
3033 JAUDBR010000010.1 GCA030371665_00387 CDS open 22542-23657 _na     371_aa Winged helix DNA-binding domain-containing protein
3034 JAUDBR010000010.1 GCA030371665_00388 CDS open 24449-27829 _na     1126_aa FHA domain-containing protein
3035 JAUDBR010000010.1 GCA030371665_00389 CDS open 27826-30411 _na     861_aa Transglutaminase
3036 JAUDBR010000010.1 GCA030371665_00390 CDS open 30408-31787 _na     459_aa DUF58 domain-containing protein
3037 JAUDBR010000010.1 GCA030371665_00391 CDS open 31793-32758 _na     321_aa mMP0363 AAA+ ATPase domain-containing protein
3038 JAUDBR010000010.1 GCA030371665_00392 CDS open 32839-39129 _na     2096_aa Fibronectin type-III domain-containing protein
3039 JAUDBR010000010.1 GCA030371665_00393 CDS open 39126-39566 _na     146_aa Bacterial sugar transferase domain-containing protein
3040 JAUDBR010000010.1 GCA030371665_00394 CDS open 39566-41020 _na     484_aa wcaJ Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
3041 JAUDBR010000010.1 GCA030371665_00395 CDS open 41721-42998 _na     425_aa Polysaccharide biosynthesis protein
3042 JAUDBR010000010.1 GCA030371665_00396 CDS open 43168-43899 _na     243_aa pgsA CDP-alcohol phosphatidyltransferase
3043 JAUDBR010000010.1 GCA030371665_00397 CDS open 44026-44931 _na     301_aa Polysaccharide pyruvyl transferase family protein
3044 JAUDBR010000010.1 GCA030371665_00398 CDS open 45004-46179 _na     391_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
3045 JAUDBR010000010.1 GCA030371665_00399 CDS open 46176-47309 _na     377_aa rfaB Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
3046 JAUDBR010000010.1 GCA030371665_00400 CDS open 48021-49637 _na     538_aa Peptidase
3047 JAUDBR010000010.1 GCA030371665_00401 CDS open 49799-50467 _na     222_aa DUF4352 domain-containing protein
3048 JAUDBR010000010.1 GCA030371665_00402 CDS open 50921-54034 _na     1037_aa Laminin G domain-containing protein
3049 JAUDBR010000010.1 GCA030371665_00403 CDS open 54178-54420 _na     80_aa parD Type II toxin-antitoxin system ParD family antitoxin
3050 JAUDBR010000010.1 GCA030371665_00404 CDS open 54417-54707 _na     96_aa Toxin
3051 JAUDBR010000010.1 GCA030371665_00405 CDS open 54806-55777 _na     323_aa diaminopimelate dehydrogenase
3052 JAUDBR010000010.1 GCA030371665_00406 CDS open 55850-56929 _na     359_aa Glycosyltransferase family 2 protein
3053 JAUDBR010000010.1 GCA030371665_00407 CDS open 57073-58128 _na     351_aa Glycosyltransferase
3054 JAUDBR010000010.1 GCA030371665_00408 CDS open 58125-59177 _na     350_aa Glycosyltransferase 2-like domain-containing protein
3055 JAUDBR010000010.1 GCA030371665_00409 CDS open 59376-60692 _na     438_aa MFS transporter
3056 JAUDBR010000010.1 GCA030371665_00410 CDS open 60985-62250 _na     421_aa O-antigen polymerase
3057 JAUDBR010000010.1 GCA030371665_00411 CDS open 62365-63024 _na     219_aa Capsular polysaccharide biosynthesis protein
3058 JAUDBR010000010.1 GCA030371665_00412 CDS open 63267-64049 _na     260_aa HTH tetR-type domain-containing protein
3059 JAUDBR010000010.1 GCA030371665_00413 CDS open 64054-65274 _na     406_aa oafA Acyltransferase 3 domain-containing protein
3060 JAUDBR010000010.1 GCA030371665_00415 CDS open 65759-66751 _na     330_aa glmU Nucleotidyl transferase domain-containing protein
3061 JAUDBR010000010.1 GCA030371665_00416 CDS open 66889-67881 _na     330_aa prsA ribose-phosphate diphosphokinase
3062 JAUDBR010000010.1 GCA030371665_00417 CDS open 68299-70209 _na     636_aa Fibronectin type-III domain-containing protein
3063 JAUDBR010000010.1 GCA030371665_00418 CDS open 70329-72545 _na     738_aa Polysaccharide chain length determinant N-terminal domain-containing protein
3064 JAUDBR010000010.1 GCA030371665_00419 CDS open 73069-74442 _na     457_aa Beta-carotene 15%2C15'-monooxygenase
3065 JAUDBR010000010.1 GCA030371665_00420 CDS open 74453-78202 _na     1249_aa mfd transcription-repair coupling factor
3066 JAUDBR010000010.1 GCA030371665_00421 CDS open 78237-78914 _na     225_aa ABC transporter ATP-binding protein
3067 JAUDBR010000010.1 GCA030371665_00422 CDS open 78911-80002 _na     363_aa ABC transporter permease
3068 JAUDBR010000010.1 GCA030371665_00423 CDS open 79999-80763 _na     254_aa FtsX-like permease family protein
3069 JAUDBR010000010.1 GCA030371665_00424 CDS open 81493-82365 _na     290_aa Lipoprotein
3070 JAUDBR010000010.1 GCA030371665_00425 CDS open 82576-83862 _na     428_aa eno phosphopyruvate hydratase
3071 JAUDBR010000010.1 GCA030371665_00426 CDS open 84097-84789 _na     230_aa ftsL Cell division protein FtsL
3072 JAUDBR010000010.1 GCA030371665_00427 CDS open 84786-85301 _na     171_aa Septum formation initiator family protein
3073 JAUDBR010000010.1 GCA030371665_00428 CDS open 85357-86388 _na     343_aa Ppx/GppA phosphatase N-terminal domain-containing protein
3074 JAUDBR010000010.1 GCA030371665_00429 CDS open 86385-87257 _na     290_aa type I 3-dehydroquinate dehydratase
3075 JAUDBR010000010.1 GCA030371665_00430 CDS open 87360-87857 _na     165_aa NTP pyrophosphohydrolase
3076 JAUDBR010000010.1 GCA030371665_00431 CDS open 88118-88705 _na     195_aa Tat pathway signal sequence domain protein
3077 JAUDBR010000010.1 GCA030371665_00432 CDS open 89410-89874 _na     154_aa DUF4440 domain-containing protein
3078 JAUDBR010000010.1 GCA030371665_00433 CDS open 89892-90233 _na     113_aa Transcriptional regulator
3079 JAUDBR010000010.1 GCA030371665_00434 CDS open 90461-91072 _na     203_aa rplY 50S ribosomal protein L25/general stress protein Ctc
3080 JAUDBR010000010.1 GCA030371665_00435 CDS open 91163-91765 _na     200_aa pth aminoacyl-tRNA hydrolase
3081 JAUDBR010000010.1 GCA030371665_00436 CDS open 91777-92514 _na     245_aa citB DNA-binding response regulator
3082 JAUDBR010000010.1 GCA030371665_00437 CDS open 92496-94397 _na     633_aa histidine kinase
3083 JAUDBR010000010.1 GCA030371665_00438 CDS open 94436-95338 _na     300_aa ABC transporter permease
3084 JAUDBR010000010.1 GCA030371665_00439 CDS open 95406-96377 _na     323_aa ABC transporter domain-containing protein
3085 JAUDBR010000010.1 GCA030371665_00440 CDS open 96815-97765 _na     316_aa Bax inhibitor-1/YccA family protein
3086 JAUDBR010000010.1 GCA030371665_00441 CDS open 97958-98365 _na     135_aa fkpA Peptidyl-prolyl cis-trans isomerase
3087 JAUDBR010000010.1 GCA030371665_00442 CDS open 98722-99234 _na     170_aa DUF2992 domain-containing protein
3088 JAUDBR010000010.1 GCA030371665_00443 CDS open 99494-101380 _na     628_aa ilvD dihydroxy-acid dehydratase
3089 JAUDBR010000010.1 GCA030371665_00444 CDS open 101462-102310 _na     282_aa ABC transporter domain-containing protein
3090 JAUDBR010000010.1 GCA030371665_00445 CDS open 102307-103302 _na     331_aa ABC transporter domain-containing protein
3091 JAUDBR010000010.1 GCA030371665_00446 CDS open 103365-104921 _na     518_aa ddpA Solute-binding protein family 5 domain-containing protein
3092 JAUDBR010000010.1 GCA030371665_00447 CDS open 104918-106663 _na     581_aa ABC transporter%2C permease protein
3093 JAUDBR010000010.1 GCA030371665_00448 CDS open 106833-107366 _na     177_aa DUF4242 domain-containing protein
3094 JAUDBR010000010.1 GCA030371665_00449 CDS open 107523-107846 _na     107_aa Transcriptional regulator
3095 JAUDBR010000010.1 GCA030371665_00450 CDS open 107843-108202 _na     119_aa RelE/StbE family addiction module toxin
3096 JAUDBR010000010.1 GCA030371665_00451 CDS open 108330-109916 _na     528_aa ilvA threonine ammonia-lyase%2C biosynthetic
3097 JAUDBR010000010.1 GCA030371665_00452 CDS open 110124-110678 _na     184_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
3098 JAUDBR010000010.1 GCA030371665_00453 CDS open 110824-112809 _na     661_aa ATPase of the ABC class
3099 JAUDBR010000010.1 GCA030371665_00454 CDS open 112942-113670 _na     242_aa Conserved domain protein
3100 JAUDBR010000010.1 GCA030371665_00455 CDS open 114149-114586 _na     145_aa Integral membrane protein
3101 JAUDBR010000010.1 GCA030371665_00456 CDS open 114682-116049 _na     455_aa SLH domain-containing protein
3102 JAUDBR010000010.1 GCA030371665_00457 CDS open 116232-116744 _na     170_aa hypothetical protein
3103 JAUDBR010000010.1 GCA030371665_00458 CDS open 116871-117587 _na     238_aa msrA Peptide methionine sulfoxide reductase MsrA
3104 JAUDBR010000010.1 GCA030371665_00459 CDS open 117756-118241 _na     161_aa greA Transcription elongation factor GreA
3105 JAUDBR010000010.1 GCA030371665_00460 CDS open 118582-119292 _na     236_aa yqfA Hemolysin III family channel protein
3106 JAUDBR010000010.1 GCA030371665_00461 CDS open 119664-120491 _na     275_aa uppS isoprenyl transferase
3107 JAUDBR010000010.1 GCA030371665_00462 CDS open 120876-122453 _na     525_aa srmB DEAD/DEAH box helicase
3108 JAUDBR010000010.1 GCA030371665_00463 CDS open 122652-123542 _na     296_aa Esterase
3109 JAUDBR010000010.1 GCA030371665_00464 CDS open 123847-123996 _na     49_aa hypothetical protein
3110 JAUDBR010000010.1 GCA030371665_00465 CDS open 124387-124791 _na     134_aa hypothetical protein
3111 JAUDBR010000010.1 GCA030371665_00369 gene open 145-1005
3112 JAUDBR010000010.1 GCA030371665_00370 gene open 1111-2073 eamA
3113 JAUDBR010000010.1 GCA030371665_00371 gene open 2070-2762
3114 JAUDBR010000010.1 GCA030371665_00372 gene open 2715-4895
3115 JAUDBR010000010.1 GCA030371665_00373 gene open 4949-5890 rsmI
3116 JAUDBR010000010.1 GCA030371665_00374 gene open 5935-6537
3117 JAUDBR010000010.1 GCA030371665_00375 gene open 6658-7728
3118 JAUDBR010000010.1 GCA030371665_00376 gene open 7987-9834
3119 JAUDBR010000010.1 GCA030371665_00377 gene open 9841-10767 ycfH
3120 JAUDBR010000010.1 GCA030371665_00378 gene open 11088-12110
3121 JAUDBR010000010.1 GCA030371665_00379 gene open 12280-13221
3122 JAUDBR010000010.1 GCA030371665_00380 gene open 13340-14434 rsmA
3123 JAUDBR010000010.1 GCA030371665_00381 gene open 14431-15417 ispE
3124 JAUDBR010000010.1 GCA030371665_00382 gene open 15417-17327 ccmA
3125 JAUDBR010000010.1 GCA030371665_00383 gene open 17460-18005
3126 JAUDBR010000010.1 GCA030371665_00384 gene open 18103-18816
3127 JAUDBR010000010.1 GCA030371665_00385 gene open 18828-20987
3128 JAUDBR010000010.1 GCA030371665_00386 gene open 20987-22453 sPS1
3129 JAUDBR010000010.1 GCA030371665_00387 gene open 22542-23657
3130 JAUDBR010000010.1 GCA030371665_00388 gene open 24449-27829
3131 JAUDBR010000010.1 GCA030371665_00389 gene open 27826-30411
3132 JAUDBR010000010.1 GCA030371665_00390 gene open 30408-31787
3133 JAUDBR010000010.1 GCA030371665_00391 gene open 31793-32758 mMP0363
3134 JAUDBR010000010.1 GCA030371665_00392 gene open 32839-39129
3135 JAUDBR010000010.1 GCA030371665_00393 gene open 39126-39566
3136 JAUDBR010000010.1 GCA030371665_00394 gene open 39566-41020 wcaJ
3137 JAUDBR010000010.1 GCA030371665_00395 gene open 41721-42998
3138 JAUDBR010000010.1 GCA030371665_00396 gene open 43168-43899 pgsA
3139 JAUDBR010000010.1 GCA030371665_00397 gene open 44026-44931
3140 JAUDBR010000010.1 GCA030371665_00398 gene open 45004-46179
3141 JAUDBR010000010.1 GCA030371665_00399 gene open 46176-47309 rfaB
3142 JAUDBR010000010.1 GCA030371665_00400 gene open 48021-49637
3143 JAUDBR010000010.1 GCA030371665_00401 gene open 49799-50467
3144 JAUDBR010000010.1 GCA030371665_00402 gene open 50921-54034
3145 JAUDBR010000010.1 GCA030371665_00403 gene open 54178-54420 parD
3146 JAUDBR010000010.1 GCA030371665_00404 gene open 54417-54707
3147 JAUDBR010000010.1 GCA030371665_00405 gene open 54806-55777
3148 JAUDBR010000010.1 GCA030371665_00406 gene open 55850-56929
3149 JAUDBR010000010.1 GCA030371665_00407 gene open 57073-58128
3150 JAUDBR010000010.1 GCA030371665_00408 gene open 58125-59177
3151 JAUDBR010000010.1 GCA030371665_00409 gene open 59376-60692
3152 JAUDBR010000010.1 GCA030371665_00410 gene open 60985-62250
3153 JAUDBR010000010.1 GCA030371665_00411 gene open 62365-63024
3154 JAUDBR010000010.1 GCA030371665_00412 gene open 63267-64049
3155 JAUDBR010000010.1 GCA030371665_00413 gene open 64054-65274 oafA
3156 JAUDBR010000010.1 GCA030371665_00415 gene open 65759-66751 glmU
3157 JAUDBR010000010.1 GCA030371665_00416 gene open 66889-67881 prsA
3158 JAUDBR010000010.1 GCA030371665_00417 gene open 68299-70209
3159 JAUDBR010000010.1 GCA030371665_00418 gene open 70329-72545
3160 JAUDBR010000010.1 GCA030371665_00419 gene open 73069-74442
3161 JAUDBR010000010.1 GCA030371665_00420 gene open 74453-78202 mfd
3162 JAUDBR010000010.1 GCA030371665_00421 gene open 78237-78914
3163 JAUDBR010000010.1 GCA030371665_00422 gene open 78911-80002
3164 JAUDBR010000010.1 GCA030371665_00423 gene open 79999-80763
3165 JAUDBR010000010.1 GCA030371665_00424 gene open 81493-82365
3166 JAUDBR010000010.1 GCA030371665_00425 gene open 82576-83862 eno
3167 JAUDBR010000010.1 GCA030371665_00426 gene open 84097-84789 ftsL
3168 JAUDBR010000010.1 GCA030371665_00427 gene open 84786-85301
3169 JAUDBR010000010.1 GCA030371665_00428 gene open 85357-86388
3170 JAUDBR010000010.1 GCA030371665_00429 gene open 86385-87257
3171 JAUDBR010000010.1 GCA030371665_00430 gene open 87360-87857
3172 JAUDBR010000010.1 GCA030371665_00431 gene open 88118-88705
3173 JAUDBR010000010.1 GCA030371665_00432 gene open 89410-89874
3174 JAUDBR010000010.1 GCA030371665_00433 gene open 89892-90233
3175 JAUDBR010000010.1 GCA030371665_00434 gene open 90461-91072 rplY
3176 JAUDBR010000010.1 GCA030371665_00435 gene open 91163-91765 pth
3177 JAUDBR010000010.1 GCA030371665_00436 gene open 91777-92514 citB
3178 JAUDBR010000010.1 GCA030371665_00437 gene open 92496-94397
3179 JAUDBR010000010.1 GCA030371665_00438 gene open 94436-95338
3180 JAUDBR010000010.1 GCA030371665_00439 gene open 95406-96377
3181 JAUDBR010000010.1 GCA030371665_00440 gene open 96815-97765
3182 JAUDBR010000010.1 GCA030371665_00441 gene open 97958-98365 fkpA
3183 JAUDBR010000010.1 GCA030371665_00442 gene open 98722-99234
3184 JAUDBR010000010.1 GCA030371665_00443 gene open 99494-101380 ilvD
3185 JAUDBR010000010.1 GCA030371665_00444 gene open 101462-102310
3186 JAUDBR010000010.1 GCA030371665_00445 gene open 102307-103302
3187 JAUDBR010000010.1 GCA030371665_00446 gene open 103365-104921 ddpA
3188 JAUDBR010000010.1 GCA030371665_00447 gene open 104918-106663
3189 JAUDBR010000010.1 GCA030371665_00448 gene open 106833-107366
3190 JAUDBR010000010.1 GCA030371665_00449 gene open 107523-107846
3191 JAUDBR010000010.1 GCA030371665_00450 gene open 107843-108202
3192 JAUDBR010000010.1 GCA030371665_00451 gene open 108330-109916 ilvA
3193 JAUDBR010000010.1 GCA030371665_00452 gene open 110124-110678 ssuE
3194 JAUDBR010000010.1 GCA030371665_00453 gene open 110824-112809
3195 JAUDBR010000010.1 GCA030371665_00454 gene open 112942-113670
3196 JAUDBR010000010.1 GCA030371665_00455 gene open 114149-114586
3197 JAUDBR010000010.1 GCA030371665_00456 gene open 114682-116049
3198 JAUDBR010000010.1 GCA030371665_00457 gene open 116232-116744
3199 JAUDBR010000010.1 GCA030371665_00458 gene open 116871-117587 msrA
3200 JAUDBR010000010.1 GCA030371665_00459 gene open 117756-118241 greA
3201 JAUDBR010000010.1 GCA030371665_00460 gene open 118582-119292 yqfA
3202 JAUDBR010000010.1 GCA030371665_00461 gene open 119664-120491 uppS
3203 JAUDBR010000010.1 GCA030371665_00462 gene open 120876-122453 srmB
3204 JAUDBR010000010.1 GCA030371665_00463 gene open 122652-123542
3205 JAUDBR010000010.1 GCA030371665_00464 gene open 123847-123996
3206 JAUDBR010000010.1 GCA030371665_00465 gene open 124387-124791
3207 JAUDBR010000010.1 GCA030371665_00414 gene open 65495-65566 trnQ
3208 JAUDBR010000010.1 GCA030371665_00414 tRNA open 65495-65566 trnQ tRNA-Gln(ttg)
3209 JAUDBR010000011.1 repeat_region open 19877-21421 CRISPR array with 22 repeats of length 36%2C consensus sequence GTCGCAGTTCCTTCGGGAACTGCACTTCATTGAGGC and spacer length 35
3210 JAUDBR010000011.1 GCA030371665_00466 CDS open 1562-3955 _na     797_aa glgX glycogen debranching protein GlgX
3211 JAUDBR010000011.1 GCA030371665_00467 CDS open 4159-4917 _na     252_aa fixA Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein
3212 JAUDBR010000011.1 GCA030371665_00468 CDS open 5015-5995 _na     326_aa Electron transporter
3213 JAUDBR010000011.1 GCA030371665_00469 CDS open 6082-8145 _na     687_aa PQQ enzyme repeat protein
3214 JAUDBR010000011.1 GCA030371665_00470 CDS open 8531-9718 _na     395_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
3215 JAUDBR010000011.1 GCA030371665_00471 CDS open 10120-10416 _na     98_aa hypothetical protein
3216 JAUDBR010000011.1 GCA030371665_00472 CDS open 10613-10978 _na     121_aa DUF5655 domain-containing protein
3217 JAUDBR010000011.1 GCA030371665_00473 CDS open 11135-12322 _na     395_aa Type I-U CRISPR-associated protein Cas7
3218 JAUDBR010000011.1 GCA030371665_00474 CDS open 12322-13887 _na     521_aa csb2 type I-U CRISPR-associated protein Csb2
3219 JAUDBR010000011.1 GCA030371665_00475 CDS open 13884-16571 _na     895_aa cas3u type I-U CRISPR-associated helicase/endonuclease Cas3
3220 JAUDBR010000011.1 GCA030371665_00476 CDS open 16571-17602 _na     343_aa Aldehyde dehydrogenase
3221 JAUDBR010000011.1 GCA030371665_00477 CDS open 17808-19088 _na     426_aa CRISPR-associated endonuclease Cas1
3222 JAUDBR010000011.1 GCA030371665_00478 CDS open 19114-19401 _na     95_aa CRISPR-associated endonuclease Cas1
3223 JAUDBR010000011.1 GCA030371665_00479 CDS open 19401-19700 _na     99_aa cas2 CRISPR-associated endonuclease Cas2
3224 JAUDBR010000011.1 GCA030371665_00480 CDS open 21452-22672 _na     406_aa cysteine desulfurase
3225 JAUDBR010000011.1 GCA030371665_00481 CDS open 22864-23976 _na     370_aa nudC NAD(+) diphosphatase
3226 JAUDBR010000011.1 GCA030371665_00482 CDS open 24040-26127 _na     695_aa recQ DNA 3'-5' helicase
3227 JAUDBR010000011.1 GCA030371665_00483 CDS open 26158-27138 _na     326_aa Cyclodehydratase
3228 JAUDBR010000011.1 GCA030371665_00484 CDS open 27307-28554 _na     415_aa endopeptidase La
3229 JAUDBR010000011.1 GCA030371665_00485 CDS open 28750-30345 _na     531_aa Zinc-dependent metalloprotease
3230 JAUDBR010000011.1 GCA030371665_00486 CDS open 30406-30987 _na     193_aa PPA1309 family protein
3231 JAUDBR010000011.1 GCA030371665_00487 CDS open 31222-34428 _na     1068_aa UPF0182 protein HMPREF0059_00283
3232 JAUDBR010000011.1 GCA030371665_00489 CDS open 34746-35585 _na     279_aa ppk2 polyphosphate kinase 2
3233 JAUDBR010000011.1 GCA030371665_00490 CDS open 35582-36337 _na     251_aa sIR2 NAD-dependent protein deacylase
3234 JAUDBR010000011.1 GCA030371665_00491 CDS open 36475-36690 _na     71_aa ATP-binding protein
3235 JAUDBR010000011.1 GCA030371665_00492 CDS open 36935-40558 _na     1207_aa DNA 3'-5' helicase
3236 JAUDBR010000011.1 GCA030371665_00493 CDS open 40555-43974 _na     1139_aa DNA 3'-5' helicase
3237 JAUDBR010000011.1 GCA030371665_00494 CDS open 44014-45330 _na     438_aa ycbJ Phosphotransferase enzyme family protein
3238 JAUDBR010000011.1 GCA030371665_00495 CDS open 45618-46868 _na     416_aa tadA Bacterial type II secretion system protein E domain-containing protein
3239 JAUDBR010000011.1 GCA030371665_00496 CDS open 46868-47719 _na     283_aa tadB Type II secretion system protein GspF domain-containing protein
3240 JAUDBR010000011.1 GCA030371665_00497 CDS open 47716-48669 _na     317_aa gspF Type II secretion system protein GspF domain-containing protein
3241 JAUDBR010000011.1 GCA030371665_00498 CDS open 48757-48987 _na     76_aa DUF4244 domain-containing protein
3242 JAUDBR010000011.1 GCA030371665_00499 CDS open 48977-49450 _na     157_aa tadE Pilus assembly protein TadE
3243 JAUDBR010000011.1 GCA030371665_00500 CDS open 49607-50020 _na     137_aa Pilus assembly protein
3244 JAUDBR010000011.1 GCA030371665_00501 CDS open 50017-50523 _na     168_aa Flp pilus-assembly TadG-like N-terminal domain-containing protein
3245 JAUDBR010000011.1 GCA030371665_00502 CDS open 50591-50989 _na     132_aa Cyclic nucleotide-binding protein
3246 JAUDBR010000011.1 GCA030371665_00503 CDS open 51020-51931 _na     303_aa lysR HTH lysR-type domain-containing protein
3247 JAUDBR010000011.1 GCA030371665_00504 CDS open 52032-53153 _na     373_aa prfB peptide chain release factor 2
3248 JAUDBR010000011.1 GCA030371665_00505 CDS open 53412-54236 _na     274_aa CAAX protease family protein
3249 JAUDBR010000011.1 GCA030371665_00506 CDS open 54175-54726 _na     183_aa 6-O-methylguanine DNA methyltransferase
3250 JAUDBR010000011.1 GCA030371665_00507 CDS open 54952-56634 _na     560_aa ettA energy-dependent translational throttle protein EttA
3251 JAUDBR010000011.1 GCA030371665_00508 CDS open 56915-57463 _na     182_aa Restriction endonuclease
3252 JAUDBR010000011.1 GCA030371665_00509 CDS open 57571-58278 _na     235_aa Peptidase M23 domain-containing protein
3253 JAUDBR010000011.1 GCA030371665_00510 CDS open 58524-59504 _na     326_aa tesB Acyl-CoA thioesterase II
3254 JAUDBR010000011.1 GCA030371665_00511 CDS open 59501-61198 _na     565_aa ptsA Phosphoenolpyruvate-protein phosphotransferase
3255 JAUDBR010000011.1 GCA030371665_00512 CDS open 61567-61794 _na     75_aa ptsG2 PTS EIIB type-1 domain-containing protein
3256 JAUDBR010000011.1 GCA030371665_00513 CDS open 62229-64442 _na     737_aa malQ 4-alpha-glucanotransferase
3257 JAUDBR010000011.1 GCA030371665_00514 CDS open 64594-65055 _na     153_aa PTS system%2C glucose subfamily%2C IIA component
3258 JAUDBR010000011.1 GCA030371665_00515 CDS open 65052-65282 _na     76_aa PTS EIIB type-1 domain-containing protein
3259 JAUDBR010000011.1 GCA030371665_00516 CDS open 65471-66220 _na     249_aa mngR HTH gntR-type domain-containing protein
3260 JAUDBR010000011.1 GCA030371665_00517 CDS open 66481-67929 _na     482_aa ptsG1 PTS EIIC type-1 domain-containing protein
3261 JAUDBR010000011.1 GCA030371665_00518 CDS open 68061-70661 _na     866_aa pepN aminopeptidase N
3262 JAUDBR010000011.1 GCA030371665_00519 CDS open 70854-72650 _na     598_aa LPXTG-domain-containing protein cell wall anchor domain
3263 JAUDBR010000011.1 GCA030371665_00520 CDS open 72876-73979 _na     367_aa Cell envelope-related transcriptional attenuator domain-containing protein
3264 JAUDBR010000011.1 GCA030371665_00521 CDS open 74137-75099 _na     320_aa LPXTG cell wall anchor domain-containing protein
3265 JAUDBR010000011.1 GCA030371665_00522 CDS open 75303-77492 _na     729_aa M13-type metalloendopeptidase
3266 JAUDBR010000011.1 GCA030371665_00523 CDS open 77582-78082 _na     166_aa ribose-5-phosphate isomerase
3267 JAUDBR010000011.1 GCA030371665_00524 CDS open 78085-79086 _na     333_aa nei DNA-(apurinic or apyrimidinic site) lyase
3268 JAUDBR010000011.1 GCA030371665_00525 CDS open 79127-80425 _na     432_aa AB hydrolase-1 domain-containing protein
3269 JAUDBR010000011.1 GCA030371665_00526 CDS open 80510-81085 _na     191_aa cysE serine O-acetyltransferase
3270 JAUDBR010000011.1 GCA030371665_00527 CDS open 81211-82140 _na     309_aa cysK cysteine synthase A
3271 JAUDBR010000011.1 GCA030371665_00528 CDS open 82682-83470 _na     262_aa Impact N-terminal domain-containing protein
3272 JAUDBR010000011.1 GCA030371665_00529 CDS open 83627-83791 _na     54_aa rpmF 50S ribosomal protein L32
3273 JAUDBR010000011.1 GCA030371665_00532 CDS open 84300-85664 _na     454_aa tig trigger factor
3274 JAUDBR010000011.1 GCA030371665_00533 CDS open 85835-86968 _na     377_aa bcsA Glycosyltransferase 2-like domain-containing protein
3275 JAUDBR010000011.1 GCA030371665_00534 CDS open 87543-87911 _na     122_aa Cupin
3276 JAUDBR010000011.1 GCA030371665_00535 CDS open 88228-88866 _na     212_aa clpP ATP-dependent Clp protease proteolytic subunit
3277 JAUDBR010000011.1 GCA030371665_00536 CDS open 88868-89542 _na     224_aa ATP-dependent Clp protease proteolytic subunit
3278 JAUDBR010000011.1 GCA030371665_00537 CDS open 89776-91098 _na     440_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
3279 JAUDBR010000011.1 GCA030371665_00538 CDS open 91095-91427 _na     110_aa chorismate mutase
3280 JAUDBR010000011.1 GCA030371665_00539 CDS open 91555-93456 _na     633_aa fAA1 Acyl-CoA synthetase
3281 JAUDBR010000011.1 GCA030371665_00540 CDS open 93504-95333 _na     609_aa fAA1 Acyl-CoA synthetase
3282 JAUDBR010000011.1 GCA030371665_00541 CDS open 95709-97001 _na     430_aa Tat (Twin-arginine translocation) pathway signal sequence
3283 JAUDBR010000011.1 GCA030371665_00542 CDS open 97083-98120 _na     345_aa ugpA ABC transmembrane type-1 domain-containing protein
3284 JAUDBR010000011.1 GCA030371665_00543 CDS open 98117-98980 _na     287_aa ugpE ABC transmembrane type-1 domain-containing protein
3285 JAUDBR010000011.1 GCA030371665_00544 CDS open 99182-100960 _na     592_aa Alpha-amylase
3286 JAUDBR010000011.1 GCA030371665_00545 CDS open 100941-101954 _na     337_aa lacI Bacterial regulatory protein%2C LacI family
3287 JAUDBR010000011.1 GCA030371665_00546 CDS open 101984-102529 _na     181_aa GNAT family acetyltransferase
3288 JAUDBR010000011.1 GCA030371665_00547 CDS open 102643-105459 _na     938_aa valS valine--tRNA ligase
3289 JAUDBR010000011.1 GCA030371665_00548 CDS open 105662-107311 _na     549_aa arc proteasome ATPase
3290 JAUDBR010000011.1 GCA030371665_00549 CDS open 107317-109092 _na     591_aa pafA2 Proteasome accessory factor PafA2
3291 JAUDBR010000011.1 GCA030371665_00550 CDS open 109089-109277 _na     62_aa Prokaryotic ubiquitin-like protein Pup
3292 JAUDBR010000011.1 GCA030371665_00551 CDS open 109274-110818 _na     514_aa Proteasome protein
3293 JAUDBR010000011.1 GCA030371665_00552 CDS open 111225-111860 _na     211_aa ABC transporter permease
3294 JAUDBR010000011.1 GCA030371665_00553 CDS open 111853-114264 _na     803_aa ccmA heme ABC exporter ATP-binding protein CcmA
3295 JAUDBR010000011.1 GCA030371665_00554 CDS open 114275-116110 _na     611_aa mdlB ABC transporter ATP-binding protein
3296 JAUDBR010000011.1 GCA030371665_00555 CDS open 116113-117852 _na     579_aa mdlB ABC transporter ATP-binding protein
3297 JAUDBR010000011.1 GCA030371665_00556 CDS open 118066-119019 _na     317_aa rbbA ABC transporter domain-containing protein
3298 JAUDBR010000011.1 GCA030371665_00557 CDS open 119137-119946 _na     269_aa yadH ABC-2 type transporter transmembrane domain-containing protein
3299 JAUDBR010000011.1 GCA030371665_00558 CDS open 120014-120856 _na     280_aa HTH tetR-type domain-containing protein
3300 JAUDBR010000011.1 GCA030371665_00466 gene open 1562-3955 glgX
3301 JAUDBR010000011.1 GCA030371665_00467 gene open 4159-4917 fixA
3302 JAUDBR010000011.1 GCA030371665_00468 gene open 5015-5995
3303 JAUDBR010000011.1 GCA030371665_00469 gene open 6082-8145
3304 JAUDBR010000011.1 GCA030371665_00470 gene open 8531-9718 mnmA
3305 JAUDBR010000011.1 GCA030371665_00471 gene open 10120-10416
3306 JAUDBR010000011.1 GCA030371665_00472 gene open 10613-10978
3307 JAUDBR010000011.1 GCA030371665_00473 gene open 11135-12322
3308 JAUDBR010000011.1 GCA030371665_00474 gene open 12322-13887 csb2
3309 JAUDBR010000011.1 GCA030371665_00475 gene open 13884-16571 cas3u
3310 JAUDBR010000011.1 GCA030371665_00476 gene open 16571-17602
3311 JAUDBR010000011.1 GCA030371665_00477 gene open 17808-19088
3312 JAUDBR010000011.1 GCA030371665_00478 gene open 19114-19401
3313 JAUDBR010000011.1 GCA030371665_00479 gene open 19401-19700 cas2
3314 JAUDBR010000011.1 GCA030371665_00480 gene open 21452-22672
3315 JAUDBR010000011.1 GCA030371665_00481 gene open 22864-23976 nudC
3316 JAUDBR010000011.1 GCA030371665_00482 gene open 24040-26127 recQ
3317 JAUDBR010000011.1 GCA030371665_00483 gene open 26158-27138
3318 JAUDBR010000011.1 GCA030371665_00484 gene open 27307-28554
3319 JAUDBR010000011.1 GCA030371665_00485 gene open 28750-30345
3320 JAUDBR010000011.1 GCA030371665_00486 gene open 30406-30987
3321 JAUDBR010000011.1 GCA030371665_00487 gene open 31222-34428
3322 JAUDBR010000011.1 GCA030371665_00489 gene open 34746-35585 ppk2
3323 JAUDBR010000011.1 GCA030371665_00490 gene open 35582-36337 sIR2
3324 JAUDBR010000011.1 GCA030371665_00491 gene open 36475-36690
3325 JAUDBR010000011.1 GCA030371665_00492 gene open 36935-40558
3326 JAUDBR010000011.1 GCA030371665_00493 gene open 40555-43974
3327 JAUDBR010000011.1 GCA030371665_00494 gene open 44014-45330 ycbJ
3328 JAUDBR010000011.1 GCA030371665_00495 gene open 45618-46868 tadA
3329 JAUDBR010000011.1 GCA030371665_00496 gene open 46868-47719 tadB
3330 JAUDBR010000011.1 GCA030371665_00497 gene open 47716-48669 gspF
3331 JAUDBR010000011.1 GCA030371665_00498 gene open 48757-48987
3332 JAUDBR010000011.1 GCA030371665_00499 gene open 48977-49450 tadE
3333 JAUDBR010000011.1 GCA030371665_00500 gene open 49607-50020
3334 JAUDBR010000011.1 GCA030371665_00501 gene open 50017-50523
3335 JAUDBR010000011.1 GCA030371665_00502 gene open 50591-50989
3336 JAUDBR010000011.1 GCA030371665_00503 gene open 51020-51931 lysR
3337 JAUDBR010000011.1 GCA030371665_00504 gene open 52032-53153 prfB
3338 JAUDBR010000011.1 GCA030371665_00505 gene open 53412-54236
3339 JAUDBR010000011.1 GCA030371665_00506 gene open 54175-54726
3340 JAUDBR010000011.1 GCA030371665_00507 gene open 54952-56634 ettA
3341 JAUDBR010000011.1 GCA030371665_00508 gene open 56915-57463
3342 JAUDBR010000011.1 GCA030371665_00509 gene open 57571-58278
3343 JAUDBR010000011.1 GCA030371665_00510 gene open 58524-59504 tesB
3344 JAUDBR010000011.1 GCA030371665_00511 gene open 59501-61198 ptsA
3345 JAUDBR010000011.1 GCA030371665_00512 gene open 61567-61794 ptsG2
3346 JAUDBR010000011.1 GCA030371665_00513 gene open 62229-64442 malQ
3347 JAUDBR010000011.1 GCA030371665_00514 gene open 64594-65055
3348 JAUDBR010000011.1 GCA030371665_00515 gene open 65052-65282
3349 JAUDBR010000011.1 GCA030371665_00516 gene open 65471-66220 mngR
3350 JAUDBR010000011.1 GCA030371665_00517 gene open 66481-67929 ptsG1
3351 JAUDBR010000011.1 GCA030371665_00518 gene open 68061-70661 pepN
3352 JAUDBR010000011.1 GCA030371665_00519 gene open 70854-72650
3353 JAUDBR010000011.1 GCA030371665_00520 gene open 72876-73979
3354 JAUDBR010000011.1 GCA030371665_00521 gene open 74137-75099
3355 JAUDBR010000011.1 GCA030371665_00522 gene open 75303-77492
3356 JAUDBR010000011.1 GCA030371665_00523 gene open 77582-78082
3357 JAUDBR010000011.1 GCA030371665_00524 gene open 78085-79086 nei
3358 JAUDBR010000011.1 GCA030371665_00525 gene open 79127-80425
3359 JAUDBR010000011.1 GCA030371665_00526 gene open 80510-81085 cysE
3360 JAUDBR010000011.1 GCA030371665_00527 gene open 81211-82140 cysK
3361 JAUDBR010000011.1 GCA030371665_00528 gene open 82682-83470
3362 JAUDBR010000011.1 GCA030371665_00529 gene open 83627-83791 rpmF
3363 JAUDBR010000011.1 GCA030371665_00532 gene open 84300-85664 tig
3364 JAUDBR010000011.1 GCA030371665_00533 gene open 85835-86968 bcsA
3365 JAUDBR010000011.1 GCA030371665_00534 gene open 87543-87911
3366 JAUDBR010000011.1 GCA030371665_00535 gene open 88228-88866 clpP
3367 JAUDBR010000011.1 GCA030371665_00536 gene open 88868-89542
3368 JAUDBR010000011.1 GCA030371665_00537 gene open 89776-91098 clpX
3369 JAUDBR010000011.1 GCA030371665_00538 gene open 91095-91427
3370 JAUDBR010000011.1 GCA030371665_00539 gene open 91555-93456 fAA1
3371 JAUDBR010000011.1 GCA030371665_00540 gene open 93504-95333 fAA1
3372 JAUDBR010000011.1 GCA030371665_00541 gene open 95709-97001
3373 JAUDBR010000011.1 GCA030371665_00542 gene open 97083-98120 ugpA
3374 JAUDBR010000011.1 GCA030371665_00543 gene open 98117-98980 ugpE
3375 JAUDBR010000011.1 GCA030371665_00544 gene open 99182-100960
3376 JAUDBR010000011.1 GCA030371665_00545 gene open 100941-101954 lacI
3377 JAUDBR010000011.1 GCA030371665_00546 gene open 101984-102529
3378 JAUDBR010000011.1 GCA030371665_00547 gene open 102643-105459 valS
3379 JAUDBR010000011.1 GCA030371665_00548 gene open 105662-107311 arc
3380 JAUDBR010000011.1 GCA030371665_00549 gene open 107317-109092 pafA2
3381 JAUDBR010000011.1 GCA030371665_00550 gene open 109089-109277
3382 JAUDBR010000011.1 GCA030371665_00551 gene open 109274-110818
3383 JAUDBR010000011.1 GCA030371665_00552 gene open 111225-111860
3384 JAUDBR010000011.1 GCA030371665_00553 gene open 111853-114264 ccmA
3385 JAUDBR010000011.1 GCA030371665_00554 gene open 114275-116110 mdlB
3386 JAUDBR010000011.1 GCA030371665_00555 gene open 116113-117852 mdlB
3387 JAUDBR010000011.1 GCA030371665_00556 gene open 118066-119019 rbbA
3388 JAUDBR010000011.1 GCA030371665_00557 gene open 119137-119946 yadH
3389 JAUDBR010000011.1 GCA030371665_00558 gene open 120014-120856
3390 JAUDBR010000011.1 GCA030371665_00488 gene open 34547-34623 trnfM
3391 JAUDBR010000011.1 GCA030371665_00530 gene open 83826-83896 trnG
3392 JAUDBR010000011.1 GCA030371665_00531 gene open 83945-84018 trnP
3393 JAUDBR010000011.1 GCA030371665_00488 tRNA open 34547-34623 trnfM tRNA-fMet(cat)
3394 JAUDBR010000011.1 GCA030371665_00530 tRNA open 83826-83896 trnG tRNA-Gly(tcc)
3395 JAUDBR010000011.1 GCA030371665_00531 tRNA open 83945-84018 trnP tRNA-Pro(tgg)
3396 JAUDBR010000012.1 GCA030371665_00559 CDS open 359-1759 _na     466_aa NlpC/P60 domain-containing protein
3397 JAUDBR010000012.1 GCA030371665_00560 CDS open 1826-2326 _na     166_aa ppa Inorganic pyrophosphatase
3398 JAUDBR010000012.1 GCA030371665_00561 CDS open 2562-3953 _na     463_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
3399 JAUDBR010000012.1 GCA030371665_00562 CDS open 4032-5270 _na     412_aa Zinc-dependent metalloprotease
3400 JAUDBR010000012.1 GCA030371665_00563 CDS open 5384-5938 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
3401 JAUDBR010000012.1 GCA030371665_00564 CDS open 6160-7482 _na     440_aa NlpC/P60 domain-containing protein
3402 JAUDBR010000012.1 GCA030371665_00565 CDS open 7788-9854 _na     688_aa ftsH ATP-dependent zinc metalloprotease FtsH
3403 JAUDBR010000012.1 GCA030371665_00566 CDS open 9906-10478 _na     190_aa folE GTP cyclohydrolase I FolE
3404 JAUDBR010000012.1 GCA030371665_00567 CDS open 10538-10948 _na     136_aa yvaD YvaD family protein
3405 JAUDBR010000012.1 GCA030371665_00568 CDS open 10945-11418 _na     157_aa qacE QacE family quaternary ammonium compound efflux SMR transporter
3406 JAUDBR010000012.1 GCA030371665_00569 CDS open 11415-11738 _na     107_aa qacE QacE family quaternary ammonium compound efflux SMR transporter
3407 JAUDBR010000012.1 GCA030371665_00570 CDS open 12201-13421 _na     406_aa histidine kinase
3408 JAUDBR010000012.1 GCA030371665_00571 CDS open 13466-14140 _na     224_aa citB Response regulator receiver domain protein
3409 JAUDBR010000012.1 GCA030371665_00572 CDS open 14185-16671 _na     828_aa ABC3 transporter permease C-terminal domain-containing protein
3410 JAUDBR010000012.1 GCA030371665_00573 CDS open 16671-17639 _na     322_aa ABC transporter domain-containing protein
3411 JAUDBR010000012.1 GCA030371665_00574 CDS open 18014-18892 _na     292_aa folP dihydropteroate synthase
3412 JAUDBR010000012.1 GCA030371665_00575 CDS open 18889-21648 _na     919_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
3413 JAUDBR010000012.1 GCA030371665_00576 CDS open 21648-22148 _na     166_aa DUF3180 domain-containing protein
3414 JAUDBR010000012.1 GCA030371665_00577 CDS open 22175-22750 _na     191_aa YdbS-like PH domain-containing protein
3415 JAUDBR010000012.1 GCA030371665_00578 CDS open 22747-24513 _na     588_aa PH domain-containing protein
3416 JAUDBR010000012.1 GCA030371665_00579 CDS open 24666-25634 _na     322_aa Oxidoreductase
3417 JAUDBR010000012.1 GCA030371665_00580 CDS open 25873-26886 _na     337_aa panC pantoate--beta-alanine ligase
3418 JAUDBR010000012.1 GCA030371665_00581 CDS open 27168-27599 _na     143_aa panD aspartate 1-decarboxylase
3419 JAUDBR010000012.1 GCA030371665_00582 CDS open 27641-29380 _na     579_aa lysS lysine--tRNA ligase
3420 JAUDBR010000012.1 GCA030371665_00583 CDS open 29574-30875 _na     433_aa ATPase AAA-type core domain-containing protein
3421 JAUDBR010000012.1 GCA030371665_00584 CDS open 30877-31485 _na     202_aa rloB RloB family protein
3422 JAUDBR010000012.1 GCA030371665_00585 CDS open 31482-32018 _na     178_aa Cell wall synthesis protein Wag31
3423 JAUDBR010000012.1 GCA030371665_00586 CDS open 32070-32627 _na     185_aa Cell wall synthesis protein Wag31
3424 JAUDBR010000012.1 GCA030371665_00587 CDS open 32624-33361 _na     245_aa Pentapeptide repeat protein
3425 JAUDBR010000012.1 GCA030371665_00588 CDS open 33438-33617 _na     59_aa hypothetical protein
3426 JAUDBR010000012.1 GCA030371665_00589 CDS open 33572-35785 _na     737_aa ABC transporter permease
3427 JAUDBR010000012.1 GCA030371665_00590 CDS open 35782-36618 _na     278_aa ABC transporter domain-containing protein
3428 JAUDBR010000012.1 GCA030371665_00591 CDS open 36615-37205 _na     196_aa padR Transcription regulator PadR N-terminal domain-containing protein
3429 JAUDBR010000012.1 GCA030371665_00592 CDS open 37395-38387 _na     330_aa fepD Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
3430 JAUDBR010000012.1 GCA030371665_00593 CDS open 38384-39502 _na     372_aa Iron ABC transporter permease
3431 JAUDBR010000012.1 GCA030371665_00594 CDS open 39499-40491 _na     330_aa fepC ABC transporter%2C ATP-binding protein
3432 JAUDBR010000012.1 GCA030371665_00595 CDS open 40488-41588 _na     366_aa fepB Fe2+-enterobactin ABC transporter substrate-binding protein
3433 JAUDBR010000012.1 GCA030371665_00596 CDS open 41703-43238 _na     511_aa adhE Succinate-semialdehyde dehydrogenase
3434 JAUDBR010000012.1 GCA030371665_00597 CDS open 43278-44528 _na     416_aa gdhA Glutamate dehydrogenase
3435 JAUDBR010000012.1 GCA030371665_00598 CDS open 44604-45926 _na     440_aa gabT 4-aminobutyrate--2-oxoglutarate transaminase
3436 JAUDBR010000012.1 GCA030371665_00599 CDS open 46120-47700 _na     526_aa pucR PucR family transcriptional regulator
3437 JAUDBR010000012.1 GCA030371665_00600 CDS open 48012-49439 _na     475_aa adhE Aminobutyraldehyde dehydrogenase
3438 JAUDBR010000012.1 GCA030371665_00601 CDS open 49470-50330 _na     286_aa Universal stress family protein
3439 JAUDBR010000012.1 GCA030371665_00602 CDS open 50327-51910 _na     527_aa potE Amino acid permease
3440 JAUDBR010000012.1 GCA030371665_00603 CDS open 52084-53454 _na     456_aa hemL Putative glutamate-1-semialdehyde-2%2C1-aminomutase
3441 JAUDBR010000012.1 GCA030371665_00604 CDS open 53406-53507 _na     33_aa hypothetical protein
3442 JAUDBR010000012.1 GCA030371665_00605 CDS open 53544-53852 _na     102_aa ClbS/DfsB family four-helix bundle protein
3443 JAUDBR010000012.1 GCA030371665_00606 CDS open 54555-56126 _na     523_aa Amino acid/peptide transporter
3444 JAUDBR010000012.1 GCA030371665_00607 CDS open 56328-57959 _na     543_aa pTR2 Amino acid/peptide transporter
3445 JAUDBR010000012.1 GCA030371665_00608 CDS open 58272-59540 _na     422_aa lldD FMN hydroxy acid dehydrogenase domain-containing protein
3446 JAUDBR010000012.1 GCA030371665_00609 CDS open 59966-61555 _na     529_aa Mannitol dehydrogenase
3447 JAUDBR010000012.1 GCA030371665_00610 CDS open 61700-62350 _na     216_aa lactate utilization protein C
3448 JAUDBR010000012.1 GCA030371665_00611 CDS open 62350-64083 _na     577_aa lutB LutB/LldF family L-lactate oxidation iron-sulfur protein
3449 JAUDBR010000012.1 GCA030371665_00612 CDS open 64080-64910 _na     276_aa glpC Cysteine-rich domain-containing protein
3450 JAUDBR010000012.1 GCA030371665_00613 CDS open 65383-66063 _na     226_aa Sap%2C sulfolipid-1-addressing protein
3451 JAUDBR010000012.1 GCA030371665_00614 CDS open 66243-66860 _na     205_aa acrR HTH tetR-type domain-containing protein
3452 JAUDBR010000012.1 GCA030371665_00615 CDS open 66987-67820 _na     277_aa Chromosome condensation regulator
3453 JAUDBR010000012.1 GCA030371665_00616 CDS open 68394-68537 _na     47_aa hypothetical protein
3454 JAUDBR010000012.1 GCA030371665_00617 CDS open 68852-70561 _na     569_aa lldP L-lactate permease
3455 JAUDBR010000012.1 GCA030371665_00618 CDS open 70976-73057 _na     693_aa Heavy metal translocating P-type ATPase
3456 JAUDBR010000012.1 GCA030371665_00619 CDS open 73288-74823 _na     511_aa glpK glycerol kinase GlpK
3457 JAUDBR010000012.1 GCA030371665_00620 CDS open 74914-75654 _na     246_aa MIP family channel protein
3458 JAUDBR010000012.1 GCA030371665_00621 CDS open 75820-77619 _na     599_aa glpA Glycerol-3-phosphate dehydrogenase
3459 JAUDBR010000012.1 GCA030371665_00622 CDS open 78008-79162 _na     384_aa sugar-binding transcriptional regulator
3460 JAUDBR010000012.1 GCA030371665_00623 CDS open 79289-79921 _na     210_aa amino-acid N-acetyltransferase
3461 JAUDBR010000012.1 GCA030371665_00624 CDS open 80061-80546 _na     161_aa SRPBCC family protein
3462 JAUDBR010000012.1 GCA030371665_00625 CDS open 80669-81364 _na     231_aa DUF2628 domain-containing protein
3463 JAUDBR010000012.1 GCA030371665_00626 CDS open 81522-82421 _na     299_aa Tat pathway signal sequence domain protein
3464 JAUDBR010000012.1 GCA030371665_00627 CDS open 83275-84162 _na     295_aa Adenine DNA glycosylase
3465 JAUDBR010000012.1 GCA030371665_00628 CDS open 84312-85550 _na     412_aa DUF4232 domain-containing protein
3466 JAUDBR010000012.1 GCA030371665_00629 CDS open 85608-86675 _na     355_aa disA DNA integrity scanning diadenylate cyclase DisA
3467 JAUDBR010000012.1 GCA030371665_00630 CDS open 86993-88414 _na     473_aa radA DNA repair protein RadA
3468 JAUDBR010000012.1 GCA030371665_00631 CDS open 88478-89047 _na     189_aa hypothetical protein
3469 JAUDBR010000012.1 GCA030371665_00632 CDS open 89281-91371 _na     696_aa tkt transketolase
3470 JAUDBR010000012.1 GCA030371665_00633 CDS open 91634-92965 _na     443_aa Major facilitator superfamily (MFS) profile domain-containing protein
3471 JAUDBR010000012.1 GCA030371665_00634 CDS open 93003-94427 _na     474_aa Tat (Twin-arginine translocation) pathway signal sequence
3472 JAUDBR010000012.1 GCA030371665_00635 CDS open 94512-95972 _na     486_aa yqiK Band 7 domain-containing protein
3473 JAUDBR010000012.1 GCA030371665_00636 CDS open 96072-96575 _na     167_aa Nodulation efficiency protein D
3474 JAUDBR010000012.1 GCA030371665_00637 CDS open 96682-98937 _na     751_aa DUF4439 domain-containing protein
3475 JAUDBR010000012.1 GCA030371665_00638 CDS open 99147-100211 _na     354_aa dhaK dihydroxyacetone kinase subunit DhaK
3476 JAUDBR010000012.1 GCA030371665_00639 CDS open 100279-100938 _na     219_aa dhaL dihydroxyacetone kinase subunit DhaL
3477 JAUDBR010000012.1 GCA030371665_00640 CDS open 100935-101435 _na     166_aa phosphoenolpyruvate--glycerone phosphotransferase
3478 JAUDBR010000012.1 GCA030371665_00641 CDS open 102141-102809 _na     222_aa trkA RCK N-terminal domain-containing protein
3479 JAUDBR010000012.1 GCA030371665_00642 CDS open 102850-104445 _na     531_aa MFS transporter
3480 JAUDBR010000012.1 GCA030371665_00643 CDS open 104539-105234 _na     231_aa TetR/AcrR family transcriptional regulator
3481 JAUDBR010000012.1 GCA030371665_00644 CDS open 105311-106933 _na     540_aa trkH TrkH family potassium uptake protein
3482 JAUDBR010000012.1 GCA030371665_00645 CDS open 107210-107452 _na     80_aa Helix-turn-helix domain-containing protein
3483 JAUDBR010000012.1 GCA030371665_00646 CDS open 107599-107697 _na     32_aa 30S ribosomal protein bS22
3484 JAUDBR010000012.1 GCA030371665_00647 CDS open 107801-109111 _na     436_aa murB UDP-N-acetylmuramate dehydrogenase
3485 JAUDBR010000012.1 GCA030371665_00648 CDS open 109294-110379 _na     361_aa adenosine deaminase
3486 JAUDBR010000012.1 GCA030371665_00649 CDS open 110749-111960 _na     403_aa Aminoglycoside phosphotransferase domain-containing protein
3487 JAUDBR010000012.1 GCA030371665_00650 CDS open 111991-112554 _na     187_aa hypothetical protein
3488 JAUDBR010000012.1 GCA030371665_00651 CDS open 113197-114411 _na     404_aa aspB Aminotransferase
3489 JAUDBR010000012.1 GCA030371665_00653 CDS open 114789-115025 _na     78_aa secE preprotein translocase subunit SecE
3490 JAUDBR010000012.1 GCA030371665_00654 CDS open 115161-115973 _na     270_aa nusG transcription termination/antitermination protein NusG
3491 JAUDBR010000012.1 GCA030371665_00655 CDS open 116233-116664 _na     143_aa rplK 50S ribosomal protein L11
3492 JAUDBR010000012.1 GCA030371665_00656 CDS open 116763-117452 _na     229_aa rplA 50S ribosomal protein L1
3493 JAUDBR010000012.1 GCA030371665_00657 CDS open 118403-120109 _na     568_aa ompA OmpA family protein
3494 JAUDBR010000012.1 GCA030371665_00559 gene open 359-1759
3495 JAUDBR010000012.1 GCA030371665_00560 gene open 1826-2326 ppa
3496 JAUDBR010000012.1 GCA030371665_00561 gene open 2562-3953 dacB
3497 JAUDBR010000012.1 GCA030371665_00562 gene open 4032-5270
3498 JAUDBR010000012.1 GCA030371665_00563 gene open 5384-5938 hpt
3499 JAUDBR010000012.1 GCA030371665_00564 gene open 6160-7482
3500 JAUDBR010000012.1 GCA030371665_00565 gene open 7788-9854 ftsH