HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Patescibacteria [C1 O1 F1 G2] bacterium HMT-873 (GCA_030530435.1)

Select a Genome:
BAKTA Annotations for GCA_030530435.1
Genome Selected: Patescibacteria [C1 O1 F1 G2] bacterium HMT-873
ContigsBases CDSrRNA tmRNAtRNA
38 922080 1146 0 0 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2368 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 2368 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JAUMUZ010000001.1 repeat_region open 1-686 CRISPR array with 3 repeats of length 38%2C consensus sequence ACTCAAATTTCATTAGTAAATTTCTACTGTTGTAGATT and spacer length 24
2 JAUMUZ010000001.1 repeat_region open 187-687 CRISPR array with 8 repeats of length 36%2C consensus sequence CTCAAATTTCATTAGTAAATTTCTACTGTTGTAGAT and spacer length 26
3 JAUMUZ010000001.1 GCA030530435_00713 CDS open 899-1423 _na     174_aa hypothetical protein
4 JAUMUZ010000001.1 GCA030530435_00714 CDS open 1538-1711 _na     57_aa hypothetical protein
5 JAUMUZ010000001.1 GCA030530435_00715 CDS open 2180-2401 _na     73_aa hypothetical protein
6 JAUMUZ010000001.1 GCA030530435_00716 CDS open 2408-2725 _na     105_aa hypothetical protein
7 JAUMUZ010000001.1 GCA030530435_00717 CDS open 2840-3049 _na     69_aa hypothetical protein
8 JAUMUZ010000001.1 GCA030530435_00718 CDS open 4184-4417 _na     77_aa hypothetical protein
9 JAUMUZ010000001.1 GCA030530435_00719 CDS open 4701-5030 _na     109_aa hypothetical protein
10 JAUMUZ010000001.1 GCA030530435_00720 CDS open 5430-5549 _na     39_aa hypothetical protein
11 JAUMUZ010000001.1 GCA030530435_00721 CDS open 5494-5631 _na     45_aa hypothetical protein
12 JAUMUZ010000001.1 GCA030530435_00722 CDS open 5718-5900 _na     60_aa hypothetical protein
13 JAUMUZ010000001.1 GCA030530435_00723 CDS open 5961-6167 _na     68_aa hypothetical protein
14 JAUMUZ010000001.1 GCA030530435_00724 CDS open 6276-6695 _na     139_aa thioredoxin-dependent peroxiredoxin
15 JAUMUZ010000001.1 GCA030530435_00725 CDS open 6701-6943 _na     80_aa secA SecA Wing/Scaffold domain-containing protein
16 JAUMUZ010000001.1 GCA030530435_00726 CDS open 6943-7365 _na     140_aa folD Bifunctional protein FolD
17 JAUMUZ010000001.1 GCA030530435_00727 CDS open 7393-7800 _na     135_aa folD Bifunctional protein FolD
18 JAUMUZ010000001.1 GCA030530435_00728 CDS open 7935-8612 _na     225_aa hypothetical protein
19 JAUMUZ010000001.1 GCA030530435_00729 CDS open 8767-9366 _na     199_aa Superoxide dismutase
20 JAUMUZ010000001.1 GCA030530435_00730 CDS open 9383-10060 _na     225_aa hypothetical protein
21 JAUMUZ010000001.1 GCA030530435_00731 CDS open 10163-10645 _na     160_aa hypothetical protein
22 JAUMUZ010000001.1 GCA030530435_00732 CDS open 11604-12431 _na     275_aa Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase
23 JAUMUZ010000001.1 GCA030530435_00733 CDS open 12747-13466 _na     239_aa VTT domain-containing protein
24 JAUMUZ010000001.1 GCA030530435_00734 CDS open 13657-14220 _na     187_aa peptide chain release factor N(5)-glutamine methyltransferase
25 JAUMUZ010000001.1 GCA030530435_00735 CDS open 14340-14717 _na     125_aa hypothetical protein
26 JAUMUZ010000001.1 GCA030530435_00736 CDS open 14808-15533 _na     241_aa Imelysin-like domain-containing protein
27 JAUMUZ010000001.1 GCA030530435_00737 CDS open 15549-16541 _na     330_aa hypothetical protein
28 JAUMUZ010000001.1 GCA030530435_00738 CDS open 16557-17126 _na     189_aa hypothetical protein
29 JAUMUZ010000001.1 GCA030530435_00739 CDS open 17235-18005 _na     256_aa Thioredoxin-like fold domain-containing protein
30 JAUMUZ010000001.1 GCA030530435_00740 CDS open 18163-18450 _na     95_aa DUF2975 domain-containing protein
31 JAUMUZ010000001.1 GCA030530435_00741 CDS open 18440-18685 _na     81_aa DUF2975 domain-containing protein
32 JAUMUZ010000001.1 GCA030530435_00742 CDS open 18687-18869 _na     60_aa Transcriptional regulator
33 JAUMUZ010000001.1 GCA030530435_00743 CDS open 19165-20328 _na     387_aa Bacterial type II secretion system protein E domain-containing protein
34 JAUMUZ010000001.1 GCA030530435_00744 CDS open 20740-21741 _na     333_aa tRNA(Ile)-lysidine synthase
35 JAUMUZ010000001.1 GCA030530435_00745 CDS open 21754-23211 _na     485_aa cls cardiolipin synthase
36 JAUMUZ010000001.1 GCA030530435_00746 CDS open 23442-23873 _na     143_aa rplK 50S ribosomal protein L11
37 JAUMUZ010000001.1 GCA030530435_00748 CDS open 24113-24313 _na     66_aa hypothetical protein
38 JAUMUZ010000001.1 GCA030530435_00749 CDS open 24355-24633 _na     92_aa hypothetical protein
39 JAUMUZ010000001.1 GCA030530435_00750 CDS open 24749-24964 _na     71_aa hypothetical protein
40 JAUMUZ010000001.1 GCA030530435_00751 CDS open 24980-25693 _na     237_aa Ribosomal RNA large subunit methyltransferase K/L-like methyltransferase domain-containing protein
41 JAUMUZ010000001.1 GCA030530435_00752 CDS open 25745-25936 _na     63_aa hypothetical protein
42 JAUMUZ010000001.1 GCA030530435_00753 CDS open 25982-26806 _na     274_aa recJ single-stranded-DNA-specific exonuclease RecJ
43 JAUMUZ010000001.1 GCA030530435_00754 CDS open 26879-27685 _na     268_aa recJ single-stranded-DNA-specific exonuclease RecJ
44 JAUMUZ010000001.1 GCA030530435_00755 CDS open 27740-28018 _na     92_aa DUF333 domain-containing protein
45 JAUMUZ010000001.1 GCA030530435_00756 CDS open 28020-28565 _na     181_aa DUF2304 domain-containing protein
46 JAUMUZ010000001.1 GCA030530435_00757 CDS open 28650-29060 _na     136_aa Glycosyltransferase 2-like domain-containing protein
47 JAUMUZ010000001.1 GCA030530435_00758 CDS open 29062-30066 _na     334_aa galE UDP-glucose 4-epimerase GalE
48 JAUMUZ010000001.1 GCA030530435_00759 CDS open 30014-30427 _na     137_aa Glycosyl transferase
49 JAUMUZ010000001.1 GCA030530435_00760 CDS open 30959-31210 _na     83_aa hypothetical protein
50 JAUMUZ010000001.1 GCA030530435_00761 CDS open 31594-32007 _na     137_aa Glycosyl transferase family 1 domain-containing protein
51 JAUMUZ010000001.1 GCA030530435_00762 CDS open 32044-32223 _na     59_aa hypothetical protein
52 JAUMUZ010000001.1 GCA030530435_00763 CDS open 32514-32741 _na     75_aa hypothetical protein
53 JAUMUZ010000001.1 GCA030530435_00764 CDS open 33147-33272 _na     41_aa hypothetical protein
54 JAUMUZ010000001.1 GCA030530435_00765 CDS open 33321-33770 _na     149_aa hypothetical protein
55 JAUMUZ010000001.1 GCA030530435_00766 CDS open 33807-34301 _na     164_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
56 JAUMUZ010000001.1 GCA030530435_00767 CDS open 34459-34902 _na     147_aa hypothetical protein
57 JAUMUZ010000001.1 GCA030530435_00768 CDS open 34954-35175 _na     73_aa hypothetical protein
58 JAUMUZ010000001.1 GCA030530435_00769 CDS open 35197-35604 _na     135_aa hypothetical protein
59 JAUMUZ010000001.1 GCA030530435_00770 CDS open 35694-35819 _na     41_aa hypothetical protein
60 JAUMUZ010000001.1 GCA030530435_00771 CDS open 36108-36623 _na     171_aa Glycosyl transferase family 1 domain-containing protein
61 JAUMUZ010000001.1 GCA030530435_00772 CDS open 36843-37265 _na     140_aa Glycosyltransferase
62 JAUMUZ010000001.1 GCA030530435_00773 CDS open 37392-37652 _na     86_aa hypothetical protein
63 JAUMUZ010000001.1 GCA030530435_00774 CDS open 38071-39462 _na     463_aa UDP-N-acetylglucosamine 2-epimerase domain-containing protein
64 JAUMUZ010000001.1 GCA030530435_00775 CDS open 39877-40296 _na     139_aa hypothetical protein
65 JAUMUZ010000001.1 GCA030530435_00776 CDS open 40315-40638 _na     107_aa hypothetical protein
66 JAUMUZ010000001.1 GCA030530435_00777 CDS open 40748-41650 _na     300_aa obgE GTPase ObgE
67 JAUMUZ010000001.1 GCA030530435_00778 CDS open 41678-42106 _na     142_aa hypothetical protein
68 JAUMUZ010000001.1 GCA030530435_00779 CDS open 42226-42405 _na     59_aa rpmG 50S ribosomal protein L33
69 JAUMUZ010000001.1 GCA030530435_00780 CDS open 42457-42753 _na     98_aa hypothetical protein
70 JAUMUZ010000001.1 GCA030530435_00781 CDS open 42890-43846 _na     318_aa Multi-copper polyphenol oxidoreductase laccase
71 JAUMUZ010000001.1 GCA030530435_00782 CDS open 44282-44686 _na     134_aa Single-stranded DNA-binding protein
72 JAUMUZ010000001.1 GCA030530435_00783 CDS open 44712-44984 _na     90_aa rpsR 30S ribosomal protein S18
73 JAUMUZ010000001.1 GCA030530435_00784 CDS open 45022-45246 _na     74_aa hypothetical protein
74 JAUMUZ010000001.1 GCA030530435_00785 CDS open 45268-45627 _na     119_aa trbC Conjugal transfer protein TrbC
75 JAUMUZ010000001.1 GCA030530435_00786 CDS open 45748-48288 _na     846_aa leuS leucine--tRNA ligase
76 JAUMUZ010000001.1 GCA030530435_00787 CDS open 48340-48651 _na     103_aa hypothetical protein
77 JAUMUZ010000001.1 GCA030530435_00788 CDS open 48752-49240 _na     162_aa hypothetical protein
78 JAUMUZ010000001.1 GCA030530435_00789 CDS open 49412-49642 _na     76_aa hypothetical protein
79 JAUMUZ010000001.1 GCA030530435_00790 CDS open 49679-50071 _na     130_aa hypothetical protein
80 JAUMUZ010000001.1 GCA030530435_00791 CDS open 50287-51039 _na     250_aa hypothetical protein
81 JAUMUZ010000001.1 GCA030530435_00792 CDS open 51081-52805 _na     574_aa hypothetical protein
82 JAUMUZ010000001.1 GCA030530435_00793 CDS open 53095-53190 _na     31_aa hypothetical protein
83 JAUMUZ010000001.1 GCA030530435_00794 CDS open 53388-53801 _na     137_aa hypothetical protein
84 JAUMUZ010000001.1 GCA030530435_00795 CDS open 53889-54656 _na     255_aa murC UDP-N-acetylmuramate--L-alanine ligase
85 JAUMUZ010000001.1 GCA030530435_00796 CDS open 55042-55404 _na     120_aa hypothetical protein
86 JAUMUZ010000001.1 GCA030530435_00797 CDS open 55588-56313 _na     241_aa 2-oxoacid:ferredoxin oxidoreductase subunit alpha
87 JAUMUZ010000001.1 GCA030530435_00798 CDS open 56317-56490 _na     57_aa hypothetical protein
88 JAUMUZ010000001.1 GCA030530435_00799 CDS open 57001-57336 _na     111_aa Thiamine pyrophosphate enzyme TPP-binding domain-containing protein
89 JAUMUZ010000001.1 GCA030530435_00800 CDS open 57878-58318 _na     146_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
90 JAUMUZ010000001.1 GCA030530435_00801 CDS open 58499-58840 _na     113_aa hypothetical protein
91 JAUMUZ010000001.1 GCA030530435_00802 CDS open 58794-59432 _na     212_aa AI-2E family transporter
92 JAUMUZ010000001.1 GCA030530435_00803 CDS open 59553-59969 _na     138_aa hypothetical protein
93 JAUMUZ010000001.1 GCA030530435_00804 CDS open 60044-61078 _na     344_aa dnaX DNA polymerase III subunit gamma/tau
94 JAUMUZ010000001.1 GCA030530435_00805 CDS open 61100-61486 _na     128_aa hypothetical protein
95 JAUMUZ010000001.1 GCA030530435_00806 CDS open 61594-62892 _na     432_aa serS serine--tRNA ligase
96 JAUMUZ010000001.1 GCA030530435_00807 CDS open 63085-63249 _na     54_aa hypothetical protein
97 JAUMUZ010000001.1 GCA030530435_00808 CDS open 64152-64514 _na     120_aa hypothetical protein
98 JAUMUZ010000001.1 GCA030530435_00809 CDS open 64599-64718 _na     39_aa hypothetical protein
99 JAUMUZ010000001.1 GCA030530435_00814 CDS open 65394-65888 _na     164_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
100 JAUMUZ010000001.1 GCA030530435_00815 CDS open 66003-67490 _na     495_aa Glycosyltransferase 2-like domain-containing protein
101 JAUMUZ010000001.1 GCA030530435_00816 CDS open 67499-67747 _na     82_aa hypothetical protein
102 JAUMUZ010000001.1 GCA030530435_00817 CDS open 67886-68326 _na     146_aa hypothetical protein
103 JAUMUZ010000001.1 GCA030530435_00818 CDS open 68552-68854 _na     100_aa hypothetical protein
104 JAUMUZ010000001.1 GCA030530435_00819 CDS open 68874-69224 _na     116_aa hypothetical protein
105 JAUMUZ010000001.1 GCA030530435_00820 CDS open 69800-70207 _na     135_aa hypothetical protein
106 JAUMUZ010000001.1 GCA030530435_00821 CDS open 70334-70747 _na     137_aa hypothetical protein
107 JAUMUZ010000001.1 GCA030530435_00822 CDS open 70960-71625 _na     221_aa DNA-binding response regulator
108 JAUMUZ010000001.1 GCA030530435_00823 CDS open 71632-72777 _na     381_aa histidine kinase
109 JAUMUZ010000001.1 GCA030530435_00824 CDS open 72860-73111 _na     83_aa grxC glutaredoxin 3
110 JAUMUZ010000001.1 GCA030530435_00825 CDS open 74137-74859 _na     240_aa DUF541 domain-containing protein
111 JAUMUZ010000001.1 GCA030530435_00826 CDS open 74881-75168 _na     95_aa yjdM Protein YjdM C-terminal domain-containing protein
112 JAUMUZ010000001.1 GCA030530435_00827 CDS open 75191-75853 _na     220_aa Putative gluconeogenesis factor
113 JAUMUZ010000001.1 GCA030530435_00828 CDS open 75863-76186 _na     107_aa hypothetical protein
114 JAUMUZ010000001.1 GCA030530435_00829 CDS open 76249-77121 _na     290_aa Band 7 domain-containing protein
115 JAUMUZ010000001.1 GCA030530435_00830 CDS open 77140-77562 _na     140_aa NfeD-like C-terminal domain-containing protein
116 JAUMUZ010000001.1 GCA030530435_00831 CDS open 77713-78198 _na     161_aa hrcA Heat-inducible transcription repressor HrcA C-terminal domain-containing protein
117 JAUMUZ010000001.1 GCA030530435_00832 CDS open 78375-78638 _na     87_aa rpsO 30S ribosomal protein S15
118 JAUMUZ010000001.1 GCA030530435_00833 CDS open 78740-79303 _na     187_aa Peptidase S54 rhomboid domain-containing protein
119 JAUMUZ010000001.1 GCA030530435_00834 CDS open 79330-79482 _na     50_aa hypothetical protein
120 JAUMUZ010000001.1 GCA030530435_00835 CDS open 79654-80385 _na     243_aa hypothetical protein
121 JAUMUZ010000001.1 GCA030530435_00836 CDS open 80656-80889 _na     77_aa hypothetical protein
122 JAUMUZ010000001.1 GCA030530435_00837 CDS open 80995-82059 _na     354_aa hypothetical protein
123 JAUMUZ010000001.1 GCA030530435_00838 CDS open 82147-82395 _na     82_aa hypothetical protein
124 JAUMUZ010000001.1 GCA030530435_00839 CDS open 82746-82916 _na     56_aa hypothetical protein
125 JAUMUZ010000001.1 GCA030530435_00840 CDS open 83183-83461 _na     92_aa hypothetical protein
126 JAUMUZ010000001.1 GCA030530435_00841 CDS open 83468-84124 _na     218_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
127 JAUMUZ010000001.1 GCA030530435_00842 CDS open 84283-84528 _na     81_aa hypothetical protein
128 JAUMUZ010000001.1 GCA030530435_00843 CDS open 84559-84963 _na     134_aa DNA-binding response regulator
129 JAUMUZ010000001.1 GCA030530435_00844 CDS open 85103-86836 _na     577_aa Clp R domain-containing protein
130 JAUMUZ010000001.1 GCA030530435_00845 CDS open 86891-87679 _na     262_aa clpB Chaperone protein ClpB
131 JAUMUZ010000001.1 GCA030530435_00846 CDS open 87741-88214 _na     157_aa Cyclic nucleotide-binding domain-containing protein
132 JAUMUZ010000001.1 GCA030530435_00847 CDS open 88201-88542 _na     113_aa N-acetyltransferase domain-containing protein
133 JAUMUZ010000001.1 GCA030530435_00848 CDS open 88573-88788 _na     71_aa hypothetical protein
134 JAUMUZ010000001.1 GCA030530435_00849 CDS open 89299-90930 _na     543_aa groL chaperonin GroEL
135 JAUMUZ010000001.1 GCA030530435_00850 CDS open 90947-91264 _na     105_aa Co-chaperonin GroES
136 JAUMUZ010000001.1 GCA030530435_00851 CDS open 91374-91595 _na     73_aa hypothetical protein
137 JAUMUZ010000001.1 GCA030530435_00852 CDS open 91617-92063 _na     148_aa HD/PDEase domain-containing protein
138 JAUMUZ010000001.1 GCA030530435_00853 CDS open 92068-93837 _na     589_aa secD Protein translocase subunit SecD
139 JAUMUZ010000001.1 GCA030530435_00854 CDS open 94040-95389 _na     449_aa RelA/SpoT domain-containing protein
140 JAUMUZ010000001.1 GCA030530435_00855 CDS open 95405-96247 _na     280_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
141 JAUMUZ010000001.1 GCA030530435_00856 CDS open 96272-96577 _na     101_aa hypothetical protein
142 JAUMUZ010000001.1 GCA030530435_00857 CDS open 96707-98137 _na     476_aa hypothetical protein
143 JAUMUZ010000001.1 GCA030530435_00858 CDS open 98189-98680 _na     163_aa hypothetical protein
144 JAUMUZ010000001.1 GCA030530435_00859 CDS open 98792-99799 _na     335_aa hypothetical protein
145 JAUMUZ010000001.1 GCA030530435_00860 CDS open 99935-100159 _na     74_aa hypothetical protein
146 JAUMUZ010000001.1 GCA030530435_00861 CDS open 100281-101258 _na     325_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
147 JAUMUZ010000001.1 GCA030530435_00862 CDS open 101400-101651 _na     83_aa hypothetical protein
148 JAUMUZ010000001.1 GCA030530435_00863 CDS open 101655-102332 _na     225_aa ABC transporter domain-containing protein
149 JAUMUZ010000001.1 GCA030530435_00864 CDS open 102335-105376 _na     1013_aa peptidoglycan glycosyltransferase
150 JAUMUZ010000001.1 GCA030530435_00865 CDS open 105641-107026 _na     461_aa Cell envelope-related transcriptional attenuator domain-containing protein
151 JAUMUZ010000001.1 GCA030530435_00713 gene open 899-1423
152 JAUMUZ010000001.1 GCA030530435_00714 gene open 1538-1711
153 JAUMUZ010000001.1 GCA030530435_00715 gene open 2180-2401
154 JAUMUZ010000001.1 GCA030530435_00716 gene open 2408-2725
155 JAUMUZ010000001.1 GCA030530435_00717 gene open 2840-3049
156 JAUMUZ010000001.1 GCA030530435_00718 gene open 4184-4417
157 JAUMUZ010000001.1 GCA030530435_00719 gene open 4701-5030
158 JAUMUZ010000001.1 GCA030530435_00720 gene open 5430-5549
159 JAUMUZ010000001.1 GCA030530435_00721 gene open 5494-5631
160 JAUMUZ010000001.1 GCA030530435_00722 gene open 5718-5900
161 JAUMUZ010000001.1 GCA030530435_00723 gene open 5961-6167
162 JAUMUZ010000001.1 GCA030530435_00724 gene open 6276-6695
163 JAUMUZ010000001.1 GCA030530435_00725 gene open 6701-6943 secA
164 JAUMUZ010000001.1 GCA030530435_00726 gene open 6943-7365 folD
165 JAUMUZ010000001.1 GCA030530435_00727 gene open 7393-7800 folD
166 JAUMUZ010000001.1 GCA030530435_00728 gene open 7935-8612
167 JAUMUZ010000001.1 GCA030530435_00729 gene open 8767-9366
168 JAUMUZ010000001.1 GCA030530435_00730 gene open 9383-10060
169 JAUMUZ010000001.1 GCA030530435_00731 gene open 10163-10645
170 JAUMUZ010000001.1 GCA030530435_00732 gene open 11604-12431
171 JAUMUZ010000001.1 GCA030530435_00733 gene open 12747-13466
172 JAUMUZ010000001.1 GCA030530435_00734 gene open 13657-14220
173 JAUMUZ010000001.1 GCA030530435_00735 gene open 14340-14717
174 JAUMUZ010000001.1 GCA030530435_00736 gene open 14808-15533
175 JAUMUZ010000001.1 GCA030530435_00737 gene open 15549-16541
176 JAUMUZ010000001.1 GCA030530435_00738 gene open 16557-17126
177 JAUMUZ010000001.1 GCA030530435_00739 gene open 17235-18005
178 JAUMUZ010000001.1 GCA030530435_00740 gene open 18163-18450
179 JAUMUZ010000001.1 GCA030530435_00741 gene open 18440-18685
180 JAUMUZ010000001.1 GCA030530435_00742 gene open 18687-18869
181 JAUMUZ010000001.1 GCA030530435_00743 gene open 19165-20328
182 JAUMUZ010000001.1 GCA030530435_00744 gene open 20740-21741
183 JAUMUZ010000001.1 GCA030530435_00745 gene open 21754-23211 cls
184 JAUMUZ010000001.1 GCA030530435_00746 gene open 23442-23873 rplK
185 JAUMUZ010000001.1 GCA030530435_00748 gene open 24113-24313
186 JAUMUZ010000001.1 GCA030530435_00749 gene open 24355-24633
187 JAUMUZ010000001.1 GCA030530435_00750 gene open 24749-24964
188 JAUMUZ010000001.1 GCA030530435_00751 gene open 24980-25693
189 JAUMUZ010000001.1 GCA030530435_00752 gene open 25745-25936
190 JAUMUZ010000001.1 GCA030530435_00753 gene open 25982-26806 recJ
191 JAUMUZ010000001.1 GCA030530435_00754 gene open 26879-27685 recJ
192 JAUMUZ010000001.1 GCA030530435_00755 gene open 27740-28018
193 JAUMUZ010000001.1 GCA030530435_00756 gene open 28020-28565
194 JAUMUZ010000001.1 GCA030530435_00757 gene open 28650-29060
195 JAUMUZ010000001.1 GCA030530435_00758 gene open 29062-30066 galE
196 JAUMUZ010000001.1 GCA030530435_00759 gene open 30014-30427
197 JAUMUZ010000001.1 GCA030530435_00760 gene open 30959-31210
198 JAUMUZ010000001.1 GCA030530435_00761 gene open 31594-32007
199 JAUMUZ010000001.1 GCA030530435_00762 gene open 32044-32223
200 JAUMUZ010000001.1 GCA030530435_00763 gene open 32514-32741
201 JAUMUZ010000001.1 GCA030530435_00764 gene open 33147-33272
202 JAUMUZ010000001.1 GCA030530435_00765 gene open 33321-33770
203 JAUMUZ010000001.1 GCA030530435_00766 gene open 33807-34301
204 JAUMUZ010000001.1 GCA030530435_00767 gene open 34459-34902
205 JAUMUZ010000001.1 GCA030530435_00768 gene open 34954-35175
206 JAUMUZ010000001.1 GCA030530435_00769 gene open 35197-35604
207 JAUMUZ010000001.1 GCA030530435_00770 gene open 35694-35819
208 JAUMUZ010000001.1 GCA030530435_00771 gene open 36108-36623
209 JAUMUZ010000001.1 GCA030530435_00772 gene open 36843-37265
210 JAUMUZ010000001.1 GCA030530435_00773 gene open 37392-37652
211 JAUMUZ010000001.1 GCA030530435_00774 gene open 38071-39462
212 JAUMUZ010000001.1 GCA030530435_00775 gene open 39877-40296
213 JAUMUZ010000001.1 GCA030530435_00776 gene open 40315-40638
214 JAUMUZ010000001.1 GCA030530435_00777 gene open 40748-41650 obgE
215 JAUMUZ010000001.1 GCA030530435_00778 gene open 41678-42106
216 JAUMUZ010000001.1 GCA030530435_00779 gene open 42226-42405 rpmG
217 JAUMUZ010000001.1 GCA030530435_00780 gene open 42457-42753
218 JAUMUZ010000001.1 GCA030530435_00781 gene open 42890-43846
219 JAUMUZ010000001.1 GCA030530435_00782 gene open 44282-44686
220 JAUMUZ010000001.1 GCA030530435_00783 gene open 44712-44984 rpsR
221 JAUMUZ010000001.1 GCA030530435_00784 gene open 45022-45246
222 JAUMUZ010000001.1 GCA030530435_00785 gene open 45268-45627 trbC
223 JAUMUZ010000001.1 GCA030530435_00786 gene open 45748-48288 leuS
224 JAUMUZ010000001.1 GCA030530435_00787 gene open 48340-48651
225 JAUMUZ010000001.1 GCA030530435_00788 gene open 48752-49240
226 JAUMUZ010000001.1 GCA030530435_00789 gene open 49412-49642
227 JAUMUZ010000001.1 GCA030530435_00790 gene open 49679-50071
228 JAUMUZ010000001.1 GCA030530435_00791 gene open 50287-51039
229 JAUMUZ010000001.1 GCA030530435_00792 gene open 51081-52805
230 JAUMUZ010000001.1 GCA030530435_00793 gene open 53095-53190
231 JAUMUZ010000001.1 GCA030530435_00794 gene open 53388-53801
232 JAUMUZ010000001.1 GCA030530435_00795 gene open 53889-54656 murC
233 JAUMUZ010000001.1 GCA030530435_00796 gene open 55042-55404
234 JAUMUZ010000001.1 GCA030530435_00797 gene open 55588-56313
235 JAUMUZ010000001.1 GCA030530435_00798 gene open 56317-56490
236 JAUMUZ010000001.1 GCA030530435_00799 gene open 57001-57336
237 JAUMUZ010000001.1 GCA030530435_00800 gene open 57878-58318 miaA
238 JAUMUZ010000001.1 GCA030530435_00801 gene open 58499-58840
239 JAUMUZ010000001.1 GCA030530435_00802 gene open 58794-59432
240 JAUMUZ010000001.1 GCA030530435_00803 gene open 59553-59969
241 JAUMUZ010000001.1 GCA030530435_00804 gene open 60044-61078 dnaX
242 JAUMUZ010000001.1 GCA030530435_00805 gene open 61100-61486
243 JAUMUZ010000001.1 GCA030530435_00806 gene open 61594-62892 serS
244 JAUMUZ010000001.1 GCA030530435_00807 gene open 63085-63249
245 JAUMUZ010000001.1 GCA030530435_00808 gene open 64152-64514
246 JAUMUZ010000001.1 GCA030530435_00809 gene open 64599-64718
247 JAUMUZ010000001.1 GCA030530435_00814 gene open 65394-65888 rsmG
248 JAUMUZ010000001.1 GCA030530435_00815 gene open 66003-67490
249 JAUMUZ010000001.1 GCA030530435_00816 gene open 67499-67747
250 JAUMUZ010000001.1 GCA030530435_00817 gene open 67886-68326
251 JAUMUZ010000001.1 GCA030530435_00818 gene open 68552-68854
252 JAUMUZ010000001.1 GCA030530435_00819 gene open 68874-69224
253 JAUMUZ010000001.1 GCA030530435_00820 gene open 69800-70207
254 JAUMUZ010000001.1 GCA030530435_00821 gene open 70334-70747
255 JAUMUZ010000001.1 GCA030530435_00822 gene open 70960-71625
256 JAUMUZ010000001.1 GCA030530435_00823 gene open 71632-72777
257 JAUMUZ010000001.1 GCA030530435_00824 gene open 72860-73111 grxC
258 JAUMUZ010000001.1 GCA030530435_00825 gene open 74137-74859
259 JAUMUZ010000001.1 GCA030530435_00826 gene open 74881-75168 yjdM
260 JAUMUZ010000001.1 GCA030530435_00827 gene open 75191-75853
261 JAUMUZ010000001.1 GCA030530435_00828 gene open 75863-76186
262 JAUMUZ010000001.1 GCA030530435_00829 gene open 76249-77121
263 JAUMUZ010000001.1 GCA030530435_00830 gene open 77140-77562
264 JAUMUZ010000001.1 GCA030530435_00831 gene open 77713-78198 hrcA
265 JAUMUZ010000001.1 GCA030530435_00832 gene open 78375-78638 rpsO
266 JAUMUZ010000001.1 GCA030530435_00833 gene open 78740-79303
267 JAUMUZ010000001.1 GCA030530435_00834 gene open 79330-79482
268 JAUMUZ010000001.1 GCA030530435_00835 gene open 79654-80385
269 JAUMUZ010000001.1 GCA030530435_00836 gene open 80656-80889
270 JAUMUZ010000001.1 GCA030530435_00837 gene open 80995-82059
271 JAUMUZ010000001.1 GCA030530435_00838 gene open 82147-82395
272 JAUMUZ010000001.1 GCA030530435_00839 gene open 82746-82916
273 JAUMUZ010000001.1 GCA030530435_00840 gene open 83183-83461
274 JAUMUZ010000001.1 GCA030530435_00841 gene open 83468-84124 murA
275 JAUMUZ010000001.1 GCA030530435_00842 gene open 84283-84528
276 JAUMUZ010000001.1 GCA030530435_00843 gene open 84559-84963
277 JAUMUZ010000001.1 GCA030530435_00844 gene open 85103-86836
278 JAUMUZ010000001.1 GCA030530435_00845 gene open 86891-87679 clpB
279 JAUMUZ010000001.1 GCA030530435_00846 gene open 87741-88214
280 JAUMUZ010000001.1 GCA030530435_00847 gene open 88201-88542
281 JAUMUZ010000001.1 GCA030530435_00848 gene open 88573-88788
282 JAUMUZ010000001.1 GCA030530435_00849 gene open 89299-90930 groL
283 JAUMUZ010000001.1 GCA030530435_00850 gene open 90947-91264
284 JAUMUZ010000001.1 GCA030530435_00851 gene open 91374-91595
285 JAUMUZ010000001.1 GCA030530435_00852 gene open 91617-92063
286 JAUMUZ010000001.1 GCA030530435_00853 gene open 92068-93837 secD
287 JAUMUZ010000001.1 GCA030530435_00854 gene open 94040-95389
288 JAUMUZ010000001.1 GCA030530435_00855 gene open 95405-96247 murD
289 JAUMUZ010000001.1 GCA030530435_00856 gene open 96272-96577
290 JAUMUZ010000001.1 GCA030530435_00857 gene open 96707-98137
291 JAUMUZ010000001.1 GCA030530435_00858 gene open 98189-98680
292 JAUMUZ010000001.1 GCA030530435_00859 gene open 98792-99799
293 JAUMUZ010000001.1 GCA030530435_00860 gene open 99935-100159
294 JAUMUZ010000001.1 GCA030530435_00861 gene open 100281-101258
295 JAUMUZ010000001.1 GCA030530435_00862 gene open 101400-101651
296 JAUMUZ010000001.1 GCA030530435_00863 gene open 101655-102332
297 JAUMUZ010000001.1 GCA030530435_00864 gene open 102335-105376
298 JAUMUZ010000001.1 GCA030530435_00865 gene open 105641-107026
299 JAUMUZ010000001.1 GCA030530435_00747 gene open 24021-24095 trnE
300 JAUMUZ010000001.1 GCA030530435_00810 gene open 64748-64822 trnE
301 JAUMUZ010000001.1 GCA030530435_00811 gene open 64859-64935 trnP
302 JAUMUZ010000001.1 GCA030530435_00812 gene open 64949-65025 trnI
303 JAUMUZ010000001.1 GCA030530435_00813 gene open 65051-65126 trnG
304 JAUMUZ010000001.1 GCA030530435_00747 tRNA open 24021-24095 trnE tRNA-Glu(ctc)
305 JAUMUZ010000001.1 GCA030530435_00810 tRNA open 64748-64822 trnE tRNA-Glu(ttc)
306 JAUMUZ010000001.1 GCA030530435_00811 tRNA open 64859-64935 trnP tRNA-Pro(tgg)
307 JAUMUZ010000001.1 GCA030530435_00812 tRNA open 64949-65025 trnI tRNA-Ile(gat)
308 JAUMUZ010000001.1 GCA030530435_00813 tRNA open 65051-65126 trnG tRNA-Gly(tcc)
309 JAUMUZ010000002.1 GCA030530435_01094 CDS open 60-242 _na     60_aa hypothetical protein
310 JAUMUZ010000002.1 GCA030530435_01095 CDS open 243-491 _na     82_aa hypothetical protein
311 JAUMUZ010000002.1 GCA030530435_01096 CDS open 522-659 _na     45_aa hypothetical protein
312 JAUMUZ010000002.1 GCA030530435_01097 CDS open 764-976 _na     70_aa hypothetical protein
313 JAUMUZ010000002.1 GCA030530435_01098 CDS open 1066-2049 _na     327_aa AAA+ ATPase domain-containing protein
314 JAUMUZ010000002.1 GCA030530435_01099 CDS open 2385-3533 _na     382_aa ABC transporter permease
315 JAUMUZ010000002.1 GCA030530435_01100 CDS open 3668-4189 _na     173_aa Macrolide ABC transporter ATP-binding protein
316 JAUMUZ010000002.1 GCA030530435_01101 CDS open 4335-6401 _na     688_aa Membrane fusion protein biotin-lipoyl like domain-containing protein
317 JAUMUZ010000002.1 GCA030530435_01102 CDS open 6607-7908 _na     433_aa Hemolysin
318 JAUMUZ010000002.1 GCA030530435_01103 CDS open 7930-9135 _na     401_aa Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein
319 JAUMUZ010000002.1 GCA030530435_01104 CDS open 9226-9480 _na     84_aa Ribonuclease P protein component
320 JAUMUZ010000002.1 GCA030530435_01105 CDS open 9493-9744 _na     83_aa rpmH 50S ribosomal protein L34
321 JAUMUZ010000002.1 GCA030530435_01106 CDS open 10134-10652 _na     172_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
322 JAUMUZ010000002.1 GCA030530435_01107 CDS open 10695-11042 _na     115_aa hypothetical protein
323 JAUMUZ010000002.1 GCA030530435_01108 CDS open 11417-11977 _na     186_aa DUF5671 domain-containing protein
324 JAUMUZ010000002.1 GCA030530435_01109 CDS open 12134-13177 _na     347_aa RNA polymerase sigma-70 domain-containing protein
325 JAUMUZ010000002.1 GCA030530435_01110 CDS open 13303-13434 _na     43_aa hypothetical protein
326 JAUMUZ010000002.1 GCA030530435_01111 CDS open 13665-14270 _na     201_aa Radical SAM core domain-containing protein
327 JAUMUZ010000002.1 GCA030530435_01112 CDS open 14301-14744 _na     147_aa hypothetical protein
328 JAUMUZ010000002.1 GCA030530435_01113 CDS open 14745-14957 _na     70_aa MotA/TolQ/ExbB proton channel domain-containing protein
329 JAUMUZ010000002.1 GCA030530435_01114 CDS open 14974-15513 _na     179_aa hypothetical protein
330 JAUMUZ010000002.1 GCA030530435_01115 CDS open 15527-16081 _na     184_aa Polysaccharide pyruvyl transferase domain-containing protein
331 JAUMUZ010000002.1 GCA030530435_01116 CDS open 16118-16606 _na     162_aa Polysaccharide pyruvyl transferase domain-containing protein
332 JAUMUZ010000002.1 GCA030530435_01117 CDS open 16743-17210 _na     155_aa FMN-binding domain-containing protein
333 JAUMUZ010000002.1 GCA030530435_01118 CDS open 17212-17598 _na     128_aa FAD:protein FMN transferase
334 JAUMUZ010000002.1 GCA030530435_01119 CDS open 17671-18090 _na     139_aa FAD:protein FMN transferase
335 JAUMUZ010000002.1 GCA030530435_01120 CDS open 18094-18843 _na     249_aa Rubredoxin
336 JAUMUZ010000002.1 GCA030530435_01121 CDS open 19108-19497 _na     129_aa hypothetical protein
337 JAUMUZ010000002.1 GCA030530435_01122 CDS open 19589-20683 _na     364_aa nusA Transcription termination/antitermination protein NusA
338 JAUMUZ010000002.1 GCA030530435_01123 CDS open 21176-21880 _na     234_aa era GTPase Era
339 JAUMUZ010000002.1 GCA030530435_01124 CDS open 22038-22343 _na     101_aa Methyltransferase domain-containing protein
340 JAUMUZ010000002.1 GCA030530435_01125 CDS open 22548-22997 _na     149_aa DUF5665 domain-containing protein
341 JAUMUZ010000002.1 GCA030530435_01127 CDS open 23237-23836 _na     199_aa hypothetical protein
342 JAUMUZ010000002.1 GCA030530435_01128 CDS open 24061-24519 _na     152_aa hypothetical protein
343 JAUMUZ010000002.1 GCA030530435_01129 CDS open 24596-24928 _na     110_aa hypothetical protein
344 JAUMUZ010000002.1 GCA030530435_01130 CDS open 24941-25225 _na     94_aa hypothetical protein
345 JAUMUZ010000002.1 GCA030530435_01131 CDS open 25274-25501 _na     75_aa hypothetical protein
346 JAUMUZ010000002.1 GCA030530435_01132 CDS open 25613-25858 _na     81_aa hypothetical protein
347 JAUMUZ010000002.1 GCA030530435_01133 CDS open 26010-26594 _na     194_aa hypothetical protein
348 JAUMUZ010000002.1 GCA030530435_01134 CDS open 26607-27029 _na     140_aa hypothetical protein
349 JAUMUZ010000002.1 GCA030530435_01135 CDS open 27063-27659 _na     198_aa hypothetical protein
350 JAUMUZ010000002.1 GCA030530435_01136 CDS open 27951-28484 _na     177_aa PPM-type phosphatase domain-containing protein
351 JAUMUZ010000002.1 GCA030530435_01137 CDS open 28491-28928 _na     145_aa hypothetical protein
352 JAUMUZ010000002.1 GCA030530435_01138 CDS open 29060-29347 _na     95_aa hypothetical protein
353 JAUMUZ010000002.1 GCA030530435_01139 CDS open 29396-31759 _na     787_aa traD Type IV secretion system coupling protein TraD DNA-binding domain-containing protein
354 JAUMUZ010000002.1 GCA030530435_01140 CDS open 32689-33048 _na     119_aa hypothetical protein
355 JAUMUZ010000002.1 GCA030530435_01141 CDS open 33487-33633 _na     48_aa hypothetical protein
356 JAUMUZ010000002.1 GCA030530435_01142 CDS open 33797-34258 _na     153_aa Gcp-like domain-containing protein
357 JAUMUZ010000002.1 GCA030530435_01143 CDS open 34187-34471 _na     94_aa hypothetical protein
358 JAUMUZ010000002.1 GCA030530435_01144 CDS open 34473-34700 _na     75_aa PH domain-containing protein
359 JAUMUZ010000002.1 GCA030530435_01145 CDS open 34841-35590 _na     249_aa FAD/NAD(P)-binding domain-containing protein
360 JAUMUZ010000002.1 GCA030530435_01146 CDS open 35967-36356 _na     129_aa hypothetical protein
361 JAUMUZ010000002.1 GCA030530435_01147 CDS open 36426-36659 _na     77_aa UvrABC system protein A
362 JAUMUZ010000002.1 GCA030530435_01148 CDS open 36993-37349 _na     118_aa hypothetical protein
363 JAUMUZ010000002.1 GCA030530435_01149 CDS open 37374-37502 _na     42_aa hypothetical protein
364 JAUMUZ010000002.1 GCA030530435_01150 CDS open 38193-38636 _na     147_aa hypothetical protein
365 JAUMUZ010000002.1 GCA030530435_01151 CDS open 38683-39027 _na     114_aa Phosphoribosyltransferase domain-containing protein
366 JAUMUZ010000002.1 GCA030530435_01152 CDS open 39248-39946 _na     232_aa Cytosol aminopeptidase domain-containing protein
367 JAUMUZ010000002.1 GCA030530435_01153 CDS open 39947-40654 _na     235_aa Cytosol aminopeptidase domain-containing protein
368 JAUMUZ010000002.1 GCA030530435_01154 CDS open 40657-41283 _na     208_aa 7TM-DISM receptor extracellular domain-containing protein
369 JAUMUZ010000002.1 GCA030530435_01155 CDS open 41839-42519 _na     226_aa hypothetical protein
370 JAUMUZ010000002.1 GCA030530435_01156 CDS open 42512-42610 _na     32_aa hypothetical protein
371 JAUMUZ010000002.1 GCA030530435_01157 CDS open 42607-42894 _na     95_aa hypothetical protein
372 JAUMUZ010000002.1 GCA030530435_01158 CDS open 43197-43400 _na     67_aa hypothetical protein
373 JAUMUZ010000002.1 GCA030530435_01159 CDS open 44046-44243 _na     65_aa hypothetical protein
374 JAUMUZ010000002.1 GCA030530435_01160 CDS open 44334-45068 _na     244_aa PDZ domain-containing protein
375 JAUMUZ010000002.1 GCA030530435_01161 CDS open 45074-45235 _na     53_aa hypothetical protein
376 JAUMUZ010000002.1 GCA030530435_01162 CDS open 45527-45841 _na     104_aa Serine hydroxymethyltransferase-like domain-containing protein
377 JAUMUZ010000002.1 GCA030530435_01163 CDS open 46013-46318 _na     101_aa hypothetical protein
378 JAUMUZ010000002.1 GCA030530435_01164 CDS open 46493-47053 _na     186_aa hypothetical protein
379 JAUMUZ010000002.1 GCA030530435_01165 CDS open 47025-47711 _na     228_aa ComEC/Rec2-related protein domain-containing protein
380 JAUMUZ010000002.1 GCA030530435_01166 CDS open 48560-49174 _na     204_aa Prolipoprotein diacylglyceryl transferase
381 JAUMUZ010000002.1 GCA030530435_01167 CDS open 49325-49768 _na     147_aa Partial Ribonuclease Y
382 JAUMUZ010000002.1 GCA030530435_01168 CDS open 49796-50851 _na     351_aa rny ribonuclease Y
383 JAUMUZ010000002.1 GCA030530435_01169 CDS open 51171-51443 _na     90_aa hypothetical protein
384 JAUMUZ010000002.1 GCA030530435_01170 CDS open 51482-54385 _na     967_aa SLH domain-containing protein
385 JAUMUZ010000002.1 GCA030530435_01171 CDS open 54503-54817 _na     104_aa SUF system FeS cluster assembly SufBD core domain-containing protein
386 JAUMUZ010000002.1 GCA030530435_01172 CDS open 54950-55759 _na     269_aa sufB Fe-S cluster assembly protein SufB
387 JAUMUZ010000002.1 GCA030530435_01173 CDS open 55905-56441 _na     178_aa ABC transporter domain-containing protein
388 JAUMUZ010000002.1 GCA030530435_01174 CDS open 56493-56639 _na     48_aa hypothetical protein
389 JAUMUZ010000002.1 GCA030530435_01175 CDS open 56862-57281 _na     139_aa SHOCT domain-containing protein
390 JAUMUZ010000002.1 GCA030530435_01176 CDS open 57283-57798 _na     171_aa Ribosomal RNA small subunit methyltransferase E
391 JAUMUZ010000002.1 GCA030530435_01177 CDS open 58833-59270 _na     145_aa Ribosomal RNA large subunit methyltransferase H
392 JAUMUZ010000002.1 GCA030530435_01094 gene open 60-242
393 JAUMUZ010000002.1 GCA030530435_01095 gene open 243-491
394 JAUMUZ010000002.1 GCA030530435_01096 gene open 522-659
395 JAUMUZ010000002.1 GCA030530435_01097 gene open 764-976
396 JAUMUZ010000002.1 GCA030530435_01098 gene open 1066-2049
397 JAUMUZ010000002.1 GCA030530435_01099 gene open 2385-3533
398 JAUMUZ010000002.1 GCA030530435_01100 gene open 3668-4189
399 JAUMUZ010000002.1 GCA030530435_01101 gene open 4335-6401
400 JAUMUZ010000002.1 GCA030530435_01102 gene open 6607-7908
401 JAUMUZ010000002.1 GCA030530435_01103 gene open 7930-9135
402 JAUMUZ010000002.1 GCA030530435_01104 gene open 9226-9480
403 JAUMUZ010000002.1 GCA030530435_01105 gene open 9493-9744 rpmH
404 JAUMUZ010000002.1 GCA030530435_01106 gene open 10134-10652
405 JAUMUZ010000002.1 GCA030530435_01107 gene open 10695-11042
406 JAUMUZ010000002.1 GCA030530435_01108 gene open 11417-11977
407 JAUMUZ010000002.1 GCA030530435_01109 gene open 12134-13177
408 JAUMUZ010000002.1 GCA030530435_01110 gene open 13303-13434
409 JAUMUZ010000002.1 GCA030530435_01111 gene open 13665-14270
410 JAUMUZ010000002.1 GCA030530435_01112 gene open 14301-14744
411 JAUMUZ010000002.1 GCA030530435_01113 gene open 14745-14957
412 JAUMUZ010000002.1 GCA030530435_01114 gene open 14974-15513
413 JAUMUZ010000002.1 GCA030530435_01115 gene open 15527-16081
414 JAUMUZ010000002.1 GCA030530435_01116 gene open 16118-16606
415 JAUMUZ010000002.1 GCA030530435_01117 gene open 16743-17210
416 JAUMUZ010000002.1 GCA030530435_01118 gene open 17212-17598
417 JAUMUZ010000002.1 GCA030530435_01119 gene open 17671-18090
418 JAUMUZ010000002.1 GCA030530435_01120 gene open 18094-18843
419 JAUMUZ010000002.1 GCA030530435_01121 gene open 19108-19497
420 JAUMUZ010000002.1 GCA030530435_01122 gene open 19589-20683 nusA
421 JAUMUZ010000002.1 GCA030530435_01123 gene open 21176-21880 era
422 JAUMUZ010000002.1 GCA030530435_01124 gene open 22038-22343
423 JAUMUZ010000002.1 GCA030530435_01125 gene open 22548-22997
424 JAUMUZ010000002.1 GCA030530435_01127 gene open 23237-23836
425 JAUMUZ010000002.1 GCA030530435_01128 gene open 24061-24519
426 JAUMUZ010000002.1 GCA030530435_01129 gene open 24596-24928
427 JAUMUZ010000002.1 GCA030530435_01130 gene open 24941-25225
428 JAUMUZ010000002.1 GCA030530435_01131 gene open 25274-25501
429 JAUMUZ010000002.1 GCA030530435_01132 gene open 25613-25858
430 JAUMUZ010000002.1 GCA030530435_01133 gene open 26010-26594
431 JAUMUZ010000002.1 GCA030530435_01134 gene open 26607-27029
432 JAUMUZ010000002.1 GCA030530435_01135 gene open 27063-27659
433 JAUMUZ010000002.1 GCA030530435_01136 gene open 27951-28484
434 JAUMUZ010000002.1 GCA030530435_01137 gene open 28491-28928
435 JAUMUZ010000002.1 GCA030530435_01138 gene open 29060-29347
436 JAUMUZ010000002.1 GCA030530435_01139 gene open 29396-31759 traD
437 JAUMUZ010000002.1 GCA030530435_01140 gene open 32689-33048
438 JAUMUZ010000002.1 GCA030530435_01141 gene open 33487-33633
439 JAUMUZ010000002.1 GCA030530435_01142 gene open 33797-34258
440 JAUMUZ010000002.1 GCA030530435_01143 gene open 34187-34471
441 JAUMUZ010000002.1 GCA030530435_01144 gene open 34473-34700
442 JAUMUZ010000002.1 GCA030530435_01145 gene open 34841-35590
443 JAUMUZ010000002.1 GCA030530435_01146 gene open 35967-36356
444 JAUMUZ010000002.1 GCA030530435_01147 gene open 36426-36659
445 JAUMUZ010000002.1 GCA030530435_01148 gene open 36993-37349
446 JAUMUZ010000002.1 GCA030530435_01149 gene open 37374-37502
447 JAUMUZ010000002.1 GCA030530435_01150 gene open 38193-38636
448 JAUMUZ010000002.1 GCA030530435_01151 gene open 38683-39027
449 JAUMUZ010000002.1 GCA030530435_01152 gene open 39248-39946
450 JAUMUZ010000002.1 GCA030530435_01153 gene open 39947-40654
451 JAUMUZ010000002.1 GCA030530435_01154 gene open 40657-41283
452 JAUMUZ010000002.1 GCA030530435_01155 gene open 41839-42519
453 JAUMUZ010000002.1 GCA030530435_01156 gene open 42512-42610
454 JAUMUZ010000002.1 GCA030530435_01157 gene open 42607-42894
455 JAUMUZ010000002.1 GCA030530435_01158 gene open 43197-43400
456 JAUMUZ010000002.1 GCA030530435_01159 gene open 44046-44243
457 JAUMUZ010000002.1 GCA030530435_01160 gene open 44334-45068
458 JAUMUZ010000002.1 GCA030530435_01161 gene open 45074-45235
459 JAUMUZ010000002.1 GCA030530435_01162 gene open 45527-45841
460 JAUMUZ010000002.1 GCA030530435_01163 gene open 46013-46318
461 JAUMUZ010000002.1 GCA030530435_01164 gene open 46493-47053
462 JAUMUZ010000002.1 GCA030530435_01165 gene open 47025-47711
463 JAUMUZ010000002.1 GCA030530435_01166 gene open 48560-49174
464 JAUMUZ010000002.1 GCA030530435_01167 gene open 49325-49768
465 JAUMUZ010000002.1 GCA030530435_01168 gene open 49796-50851 rny
466 JAUMUZ010000002.1 GCA030530435_01169 gene open 51171-51443
467 JAUMUZ010000002.1 GCA030530435_01170 gene open 51482-54385
468 JAUMUZ010000002.1 GCA030530435_01171 gene open 54503-54817
469 JAUMUZ010000002.1 GCA030530435_01172 gene open 54950-55759 sufB
470 JAUMUZ010000002.1 GCA030530435_01173 gene open 55905-56441
471 JAUMUZ010000002.1 GCA030530435_01174 gene open 56493-56639
472 JAUMUZ010000002.1 GCA030530435_01175 gene open 56862-57281
473 JAUMUZ010000002.1 GCA030530435_01176 gene open 57283-57798
474 JAUMUZ010000002.1 GCA030530435_01177 gene open 58833-59270
475 JAUMUZ010000002.1 GCA030530435_01126 gene open 23089-23162 trnR
476 JAUMUZ010000002.1 GCA030530435_01178 gene open 59376-59451 trnT
477 JAUMUZ010000002.1 GCA030530435_01126 tRNA open 23089-23162 trnR tRNA-Arg(cct)
478 JAUMUZ010000002.1 GCA030530435_01178 tRNA open 59376-59451 trnT tRNA-Thr(tgt)
479 JAUMUZ010000003.1 GCA030530435_00018 CDS open 38-550 _na     170_aa hypothetical protein
480 JAUMUZ010000003.1 GCA030530435_00019 CDS open 668-1084 _na     138_aa hypothetical protein
481 JAUMUZ010000003.1 GCA030530435_00020 CDS open 1612-1959 _na     115_aa hypothetical protein
482 JAUMUZ010000003.1 GCA030530435_00021 CDS open 1990-2292 _na     100_aa hypothetical protein
483 JAUMUZ010000003.1 GCA030530435_00022 CDS open 2653-2820 _na     55_aa hypothetical protein
484 JAUMUZ010000003.1 GCA030530435_00023 CDS open 2956-3129 _na     57_aa hypothetical protein
485 JAUMUZ010000003.1 GCA030530435_00024 CDS open 3374-3553 _na     59_aa hypothetical protein
486 JAUMUZ010000003.1 GCA030530435_00025 CDS open 3809-4021 _na     70_aa hypothetical protein
487 JAUMUZ010000003.1 GCA030530435_00026 CDS open 4145-4348 _na     67_aa hypothetical protein
488 JAUMUZ010000003.1 GCA030530435_00027 CDS open 4376-4585 _na     69_aa hypothetical protein
489 JAUMUZ010000003.1 GCA030530435_00028 CDS open 4718-5287 _na     189_aa hypothetical protein
490 JAUMUZ010000003.1 GCA030530435_00029 CDS open 5570-5800 _na     76_aa hypothetical protein
491 JAUMUZ010000003.1 GCA030530435_00030 CDS open 7253-7399 _na     48_aa hypothetical protein
492 JAUMUZ010000003.1 GCA030530435_00031 CDS open 7483-7644 _na     53_aa hypothetical protein
493 JAUMUZ010000003.1 GCA030530435_00032 CDS open 7811-8875 _na     354_aa hypothetical protein
494 JAUMUZ010000003.1 GCA030530435_00033 CDS open 8888-9967 _na     359_aa hypothetical protein
495 JAUMUZ010000003.1 GCA030530435_00034 CDS open 10027-10329 _na     100_aa hypothetical protein
496 JAUMUZ010000003.1 GCA030530435_00035 CDS open 10348-10605 _na     85_aa hypothetical protein
497 JAUMUZ010000003.1 GCA030530435_00036 CDS open 11386-11802 _na     138_aa hypothetical protein
498 JAUMUZ010000003.1 GCA030530435_00037 CDS open 11867-12850 _na     327_aa hypothetical protein
499 JAUMUZ010000003.1 GCA030530435_00038 CDS open 12866-13156 _na     96_aa hypothetical protein
500 JAUMUZ010000003.1 GCA030530435_00039 CDS open 13708-14223 _na     171_aa hypothetical protein