HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Patescibacteria [C1 O1 F1 G2] bacterium HMT-873 (GCA_030530435.1)

Select a Genome:
BAKTA Annotations for GCA_030530435.1
Genome Selected: Patescibacteria [C1 O1 F1 G2] bacterium HMT-873
ContigsBases CDSrRNA tmRNAtRNA
38 922080 1146 0 0 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2368 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2368 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JAUMUZ010000012.1 GCA030530435_00576 gene open 3104-3427
1502 JAUMUZ010000012.1 GCA030530435_00577 gene open 3437-3877
1503 JAUMUZ010000012.1 GCA030530435_00578 gene open 3902-4279
1504 JAUMUZ010000012.1 GCA030530435_00579 gene open 4316-5071
1505 JAUMUZ010000012.1 GCA030530435_00580 gene open 5083-5268
1506 JAUMUZ010000012.1 GCA030530435_00581 gene open 5531-5950
1507 JAUMUZ010000012.1 GCA030530435_00582 gene open 6093-6473
1508 JAUMUZ010000012.1 GCA030530435_00583 gene open 7346-8557
1509 JAUMUZ010000012.1 GCA030530435_00584 gene open 8594-9049
1510 JAUMUZ010000012.1 GCA030530435_00585 gene open 9092-9622
1511 JAUMUZ010000012.1 GCA030530435_00586 gene open 9858-10895
1512 JAUMUZ010000012.1 GCA030530435_00587 gene open 11157-11726
1513 JAUMUZ010000012.1 GCA030530435_00588 gene open 11751-12281
1514 JAUMUZ010000012.1 GCA030530435_00589 gene open 12306-12821
1515 JAUMUZ010000012.1 GCA030530435_00590 gene open 12900-13229
1516 JAUMUZ010000012.1 GCA030530435_00591 gene open 13420-14748
1517 JAUMUZ010000012.1 GCA030530435_00592 gene open 14804-15475
1518 JAUMUZ010000012.1 GCA030530435_00593 gene open 15706-15927
1519 JAUMUZ010000012.1 GCA030530435_00594 gene open 16097-16663
1520 JAUMUZ010000012.1 GCA030530435_00595 gene open 16850-17017
1521 JAUMUZ010000012.1 GCA030530435_00596 gene open 17039-18028 rseP
1522 JAUMUZ010000012.1 GCA030530435_00597 gene open 18034-18246
1523 JAUMUZ010000012.1 GCA030530435_00598 gene open 18296-18448
1524 JAUMUZ010000012.1 GCA030530435_00599 gene open 18778-19032
1525 JAUMUZ010000012.1 GCA030530435_00600 gene open 19100-20524 dnaA
1526 JAUMUZ010000012.1 GCA030530435_00601 gene open 20914-21264 rplS
1527 JAUMUZ010000012.1 GCA030530435_00602 gene open 21424-23394
1528 JAUMUZ010000012.1 GCA030530435_00603 gene open 23505-23801
1529 JAUMUZ010000012.1 GCA030530435_00604 gene open 23811-24779
1530 JAUMUZ010000012.1 GCA030530435_00606 gene open 24951-25187
1531 JAUMUZ010000012.1 GCA030530435_00607 gene open 25291-26166
1532 JAUMUZ010000012.1 GCA030530435_00608 gene open 26387-26695
1533 JAUMUZ010000012.1 GCA030530435_00609 gene open 26741-27442
1534 JAUMUZ010000012.1 GCA030530435_00610 gene open 27717-28430 rpsB
1535 JAUMUZ010000012.1 GCA030530435_00611 gene open 28471-28821
1536 JAUMUZ010000012.1 GCA030530435_00612 gene open 28848-29639 tsf
1537 JAUMUZ010000012.1 GCA030530435_00613 gene open 29691-29885
1538 JAUMUZ010000012.1 GCA030530435_00615 gene open 30460-30927
1539 JAUMUZ010000012.1 GCA030530435_00616 gene open 31594-31809
1540 JAUMUZ010000012.1 GCA030530435_00617 gene open 32144-32476
1541 JAUMUZ010000012.1 GCA030530435_00618 gene open 32482-33237
1542 JAUMUZ010000012.1 GCA030530435_00605 gene open 24851-24925 trnW
1543 JAUMUZ010000012.1 GCA030530435_00614 gene open 30353-30428 trnT
1544 JAUMUZ010000012.1 GCA030530435_00605 tRNA open 24851-24925 trnW tRNA-Trp(cca)
1545 JAUMUZ010000012.1 GCA030530435_00614 tRNA open 30353-30428 trnT tRNA-Thr(ggt)
1546 JAUMUZ010000013.1 GCA030530435_00619 CDS open 298-741 _na     147_aa ftsL Cell division protein FtsL
1547 JAUMUZ010000013.1 GCA030530435_00620 CDS open 741-1322 _na     193_aa recR recombination mediator RecR
1548 JAUMUZ010000013.1 GCA030530435_00621 CDS open 1406-2104 _na     232_aa rplA 50S ribosomal protein L1
1549 JAUMUZ010000013.1 GCA030530435_00622 CDS open 2202-2873 _na     223_aa NodB-like y domain-containing protein
1550 JAUMUZ010000013.1 GCA030530435_00623 CDS open 3087-3362 _na     91_aa hypothetical protein
1551 JAUMUZ010000013.1 GCA030530435_00624 CDS open 3564-4262 _na     232_aa Nucleotidyl transferase domain-containing protein
1552 JAUMUZ010000013.1 GCA030530435_00625 CDS open 4343-5041 _na     232_aa DUF4143 domain-containing protein
1553 JAUMUZ010000013.1 GCA030530435_00626 CDS open 5042-5392 _na     116_aa hypothetical protein
1554 JAUMUZ010000013.1 GCA030530435_00627 CDS open 5719-6117 _na     132_aa hypothetical protein
1555 JAUMUZ010000013.1 GCA030530435_00628 CDS open 6313-6594 _na     93_aa hypothetical protein
1556 JAUMUZ010000013.1 GCA030530435_00629 CDS open 6663-6761 _na     32_aa hypothetical protein
1557 JAUMUZ010000013.1 GCA030530435_00630 CDS open 6797-7822 _na     341_aa pheS phenylalanine--tRNA ligase subunit alpha
1558 JAUMUZ010000013.1 GCA030530435_00631 CDS open 8006-8950 _na     314_aa Beta sliding clamp
1559 JAUMUZ010000013.1 GCA030530435_00632 CDS open 9089-9538 _na     149_aa Nudix hydrolase domain-containing protein
1560 JAUMUZ010000013.1 GCA030530435_00633 CDS open 9543-10001 _na     152_aa hypothetical protein
1561 JAUMUZ010000013.1 GCA030530435_00634 CDS open 10123-10485 _na     120_aa hypothetical protein
1562 JAUMUZ010000013.1 GCA030530435_00635 CDS open 10594-11004 _na     136_aa atpB F0F1 ATP synthase subunit A
1563 JAUMUZ010000013.1 GCA030530435_00636 CDS open 11357-11833 _na     158_aa ATP synthase subunit b
1564 JAUMUZ010000013.1 GCA030530435_00637 CDS open 11836-12180 _na     114_aa hypothetical protein
1565 JAUMUZ010000013.1 GCA030530435_00638 CDS open 12213-13736 _na     507_aa atpA F0F1 ATP synthase subunit alpha
1566 JAUMUZ010000013.1 GCA030530435_00639 CDS open 13750-14658 _na     302_aa atpG ATP synthase F1 subunit gamma
1567 JAUMUZ010000013.1 GCA030530435_00640 CDS open 14787-15035 _na     82_aa hypothetical protein
1568 JAUMUZ010000013.1 GCA030530435_00641 CDS open 15123-15599 _na     158_aa hypothetical protein
1569 JAUMUZ010000013.1 GCA030530435_00642 CDS open 15654-16070 _na     138_aa hypothetical protein
1570 JAUMUZ010000013.1 GCA030530435_00643 CDS open 16152-16745 _na     197_aa hypothetical protein
1571 JAUMUZ010000013.1 GCA030530435_00644 CDS open 16851-17264 _na     137_aa Na/Pi symporter
1572 JAUMUZ010000013.1 GCA030530435_00645 CDS open 17505-17789 _na     94_aa RNase H type-1 domain-containing protein
1573 JAUMUZ010000013.1 GCA030530435_00646 CDS open 17831-18406 _na     191_aa hypothetical protein
1574 JAUMUZ010000013.1 GCA030530435_00647 CDS open 18470-18646 _na     58_aa hypothetical protein
1575 JAUMUZ010000013.1 GCA030530435_00648 CDS open 18733-19152 _na     139_aa GNAT family N-acetyltransferase
1576 JAUMUZ010000013.1 GCA030530435_00649 CDS open 19370-20098 _na     242_aa RNA methyltransferase
1577 JAUMUZ010000013.1 GCA030530435_00650 CDS open 20609-20881 _na     90_aa hypothetical protein
1578 JAUMUZ010000013.1 GCA030530435_00651 CDS open 20952-21209 _na     85_aa hypothetical protein
1579 JAUMUZ010000013.1 GCA030530435_00652 CDS open 21350-22747 _na     465_aa atpD F0F1 ATP synthase subunit beta
1580 JAUMUZ010000013.1 GCA030530435_00653 CDS open 22785-23237 _na     150_aa atpC ATP synthase F1 subunit epsilon
1581 JAUMUZ010000013.1 GCA030530435_00654 CDS open 24098-24241 _na     47_aa hypothetical protein
1582 JAUMUZ010000013.1 GCA030530435_00655 CDS open 24424-25242 _na     272_aa queH Epoxyqueuosine reductase QueH
1583 JAUMUZ010000013.1 GCA030530435_00656 CDS open 25993-26487 _na     164_aa Glycosyltransferase 2-like domain-containing protein
1584 JAUMUZ010000013.1 GCA030530435_00657 CDS open 26710-27147 _na     145_aa hypothetical protein
1585 JAUMUZ010000013.1 GCA030530435_00658 CDS open 27476-27703 _na     75_aa hypothetical protein
1586 JAUMUZ010000013.1 GCA030530435_00659 CDS open 28096-28314 _na     72_aa hypothetical protein
1587 JAUMUZ010000013.1 GCA030530435_00660 CDS open 29546-29731 _na     61_aa Glycosyltransferase family 2 protein
1588 JAUMUZ010000013.1 GCA030530435_00661 CDS open 30277-30480 _na     67_aa hypothetical protein
1589 JAUMUZ010000013.1 GCA030530435_00662 CDS open 31704-32048 _na     114_aa hypothetical protein
1590 JAUMUZ010000013.1 GCA030530435_00663 CDS open 33384-33536 _na     50_aa hypothetical protein
1591 JAUMUZ010000013.1 GCA030530435_00619 gene open 298-741 ftsL
1592 JAUMUZ010000013.1 GCA030530435_00620 gene open 741-1322 recR
1593 JAUMUZ010000013.1 GCA030530435_00621 gene open 1406-2104 rplA
1594 JAUMUZ010000013.1 GCA030530435_00622 gene open 2202-2873
1595 JAUMUZ010000013.1 GCA030530435_00623 gene open 3087-3362
1596 JAUMUZ010000013.1 GCA030530435_00624 gene open 3564-4262
1597 JAUMUZ010000013.1 GCA030530435_00625 gene open 4343-5041
1598 JAUMUZ010000013.1 GCA030530435_00626 gene open 5042-5392
1599 JAUMUZ010000013.1 GCA030530435_00627 gene open 5719-6117
1600 JAUMUZ010000013.1 GCA030530435_00628 gene open 6313-6594
1601 JAUMUZ010000013.1 GCA030530435_00629 gene open 6663-6761
1602 JAUMUZ010000013.1 GCA030530435_00630 gene open 6797-7822 pheS
1603 JAUMUZ010000013.1 GCA030530435_00631 gene open 8006-8950
1604 JAUMUZ010000013.1 GCA030530435_00632 gene open 9089-9538
1605 JAUMUZ010000013.1 GCA030530435_00633 gene open 9543-10001
1606 JAUMUZ010000013.1 GCA030530435_00634 gene open 10123-10485
1607 JAUMUZ010000013.1 GCA030530435_00635 gene open 10594-11004 atpB
1608 JAUMUZ010000013.1 GCA030530435_00636 gene open 11357-11833
1609 JAUMUZ010000013.1 GCA030530435_00637 gene open 11836-12180
1610 JAUMUZ010000013.1 GCA030530435_00638 gene open 12213-13736 atpA
1611 JAUMUZ010000013.1 GCA030530435_00639 gene open 13750-14658 atpG
1612 JAUMUZ010000013.1 GCA030530435_00640 gene open 14787-15035
1613 JAUMUZ010000013.1 GCA030530435_00641 gene open 15123-15599
1614 JAUMUZ010000013.1 GCA030530435_00642 gene open 15654-16070
1615 JAUMUZ010000013.1 GCA030530435_00643 gene open 16152-16745
1616 JAUMUZ010000013.1 GCA030530435_00644 gene open 16851-17264
1617 JAUMUZ010000013.1 GCA030530435_00645 gene open 17505-17789
1618 JAUMUZ010000013.1 GCA030530435_00646 gene open 17831-18406
1619 JAUMUZ010000013.1 GCA030530435_00647 gene open 18470-18646
1620 JAUMUZ010000013.1 GCA030530435_00648 gene open 18733-19152
1621 JAUMUZ010000013.1 GCA030530435_00649 gene open 19370-20098
1622 JAUMUZ010000013.1 GCA030530435_00650 gene open 20609-20881
1623 JAUMUZ010000013.1 GCA030530435_00651 gene open 20952-21209
1624 JAUMUZ010000013.1 GCA030530435_00652 gene open 21350-22747 atpD
1625 JAUMUZ010000013.1 GCA030530435_00653 gene open 22785-23237 atpC
1626 JAUMUZ010000013.1 GCA030530435_00654 gene open 24098-24241
1627 JAUMUZ010000013.1 GCA030530435_00655 gene open 24424-25242 queH
1628 JAUMUZ010000013.1 GCA030530435_00656 gene open 25993-26487
1629 JAUMUZ010000013.1 GCA030530435_00657 gene open 26710-27147
1630 JAUMUZ010000013.1 GCA030530435_00658 gene open 27476-27703
1631 JAUMUZ010000013.1 GCA030530435_00659 gene open 28096-28314
1632 JAUMUZ010000013.1 GCA030530435_00660 gene open 29546-29731
1633 JAUMUZ010000013.1 GCA030530435_00661 gene open 30277-30480
1634 JAUMUZ010000013.1 GCA030530435_00662 gene open 31704-32048
1635 JAUMUZ010000013.1 GCA030530435_00663 gene open 33384-33536
1636 JAUMUZ010000014.1 GCA030530435_00664 CDS open 362-499 _na     45_aa hypothetical protein
1637 JAUMUZ010000014.1 GCA030530435_00665 CDS open 591-812 _na     73_aa hypothetical protein
1638 JAUMUZ010000014.1 GCA030530435_00666 CDS open 851-1306 _na     151_aa hypothetical protein
1639 JAUMUZ010000014.1 GCA030530435_00667 CDS open 1310-1495 _na     61_aa hypothetical protein
1640 JAUMUZ010000014.1 GCA030530435_00668 CDS open 1488-1844 _na     118_aa hypothetical protein
1641 JAUMUZ010000014.1 GCA030530435_00669 CDS open 1959-2336 _na     125_aa hypothetical protein
1642 JAUMUZ010000014.1 GCA030530435_00670 CDS open 2358-3506 _na     382_aa hypothetical protein
1643 JAUMUZ010000014.1 GCA030530435_00671 CDS open 3545-3661 _na     38_aa hypothetical protein
1644 JAUMUZ010000014.1 GCA030530435_00672 CDS open 3678-3866 _na     62_aa hypothetical protein
1645 JAUMUZ010000014.1 GCA030530435_00675 CDS open 4635-5210 _na     191_aa gspG Type II secretion system protein GspG C-terminal domain-containing protein
1646 JAUMUZ010000014.1 GCA030530435_00677 CDS open 5530-5790 _na     86_aa hypothetical protein
1647 JAUMUZ010000014.1 GCA030530435_00679 CDS open 6085-6522 _na     145_aa hypothetical protein
1648 JAUMUZ010000014.1 GCA030530435_00680 CDS open 7060-7596 _na     178_aa putative transcriptional regulatory protein BLM37_03485
1649 JAUMUZ010000014.1 GCA030530435_00681 CDS open 7646-8068 _na     140_aa hypothetical protein
1650 JAUMUZ010000014.1 GCA030530435_00682 CDS open 8400-8768 _na     122_aa hypothetical protein
1651 JAUMUZ010000014.1 GCA030530435_00683 CDS open 8994-9476 _na     160_aa hypothetical protein
1652 JAUMUZ010000014.1 GCA030530435_00684 CDS open 9480-9926 _na     148_aa hypothetical protein
1653 JAUMUZ010000014.1 GCA030530435_00685 CDS open 9933-11399 _na     488_aa Penicillin-binding protein transpeptidase domain-containing protein
1654 JAUMUZ010000014.1 GCA030530435_00686 CDS open 11517-12149 _na     210_aa RNA-binding S4 domain-containing protein
1655 JAUMUZ010000014.1 GCA030530435_00687 CDS open 12361-12609 _na     82_aa pth aminoacyl-tRNA hydrolase
1656 JAUMUZ010000014.1 GCA030530435_00688 CDS open 12804-13925 _na     373_aa SLH domain-containing protein
1657 JAUMUZ010000014.1 GCA030530435_00689 CDS open 13932-14159 _na     75_aa hypothetical protein
1658 JAUMUZ010000014.1 GCA030530435_00690 CDS open 14199-14981 _na     260_aa Bacterial type II secretion system protein E domain-containing protein
1659 JAUMUZ010000014.1 GCA030530435_00691 CDS open 15083-15442 _na     119_aa hypothetical protein
1660 JAUMUZ010000014.1 GCA030530435_00692 CDS open 15769-16116 _na     115_aa rplT 50S ribosomal protein L20
1661 JAUMUZ010000014.1 GCA030530435_00693 CDS open 16142-16339 _na     65_aa rpmI 50S ribosomal protein L35
1662 JAUMUZ010000014.1 GCA030530435_00694 CDS open 16394-16726 _na     110_aa infC translation initiation factor IF-3
1663 JAUMUZ010000014.1 GCA030530435_00695 CDS open 16730-16906 _na     58_aa hypothetical protein
1664 JAUMUZ010000014.1 GCA030530435_00696 CDS open 16910-17209 _na     99_aa rpsT 30S ribosomal protein S20
1665 JAUMUZ010000014.1 GCA030530435_00697 CDS open 17291-18931 _na     546_aa Bacterial Ig-like domain-containing protein
1666 JAUMUZ010000014.1 GCA030530435_00698 CDS open 18956-19759 _na     267_aa recF DNA replication/repair protein RecF
1667 JAUMUZ010000014.1 GCA030530435_00699 CDS open 20022-20303 _na     93_aa Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
1668 JAUMUZ010000014.1 GCA030530435_00700 CDS open 20342-20758 _na     138_aa hypothetical protein
1669 JAUMUZ010000014.1 GCA030530435_00701 CDS open 20703-21248 _na     181_aa psbP PsbP C-terminal domain-containing protein
1670 JAUMUZ010000014.1 GCA030530435_00703 CDS open 21706-22038 _na     110_aa hypothetical protein
1671 JAUMUZ010000014.1 GCA030530435_00704 CDS open 22048-22326 _na     92_aa hypothetical protein
1672 JAUMUZ010000014.1 GCA030530435_00705 CDS open 22346-22981 _na     211_aa SUF system FeS cluster assembly SufBD core domain-containing protein
1673 JAUMUZ010000014.1 GCA030530435_00706 CDS open 23051-23374 _na     107_aa hypothetical protein
1674 JAUMUZ010000014.1 GCA030530435_00707 CDS open 23663-24772 _na     369_aa traD Type IV secretion system coupling protein TraD DNA-binding domain-containing protein
1675 JAUMUZ010000014.1 GCA030530435_00708 CDS open 24812-25630 _na     272_aa Type IV secretion system DNA-binding domain-containing protein
1676 JAUMUZ010000014.1 GCA030530435_00709 CDS open 25702-26304 _na     200_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
1677 JAUMUZ010000014.1 GCA030530435_00710 CDS open 27055-29196 _na     713_aa fusA elongation factor G
1678 JAUMUZ010000014.1 GCA030530435_00711 CDS open 29225-29473 _na     82_aa hypothetical protein
1679 JAUMUZ010000014.1 GCA030530435_00664 gene open 362-499
1680 JAUMUZ010000014.1 GCA030530435_00665 gene open 591-812
1681 JAUMUZ010000014.1 GCA030530435_00666 gene open 851-1306
1682 JAUMUZ010000014.1 GCA030530435_00667 gene open 1310-1495
1683 JAUMUZ010000014.1 GCA030530435_00668 gene open 1488-1844
1684 JAUMUZ010000014.1 GCA030530435_00669 gene open 1959-2336
1685 JAUMUZ010000014.1 GCA030530435_00670 gene open 2358-3506
1686 JAUMUZ010000014.1 GCA030530435_00671 gene open 3545-3661
1687 JAUMUZ010000014.1 GCA030530435_00672 gene open 3678-3866
1688 JAUMUZ010000014.1 GCA030530435_00675 gene open 4635-5210 gspG
1689 JAUMUZ010000014.1 GCA030530435_00677 gene open 5530-5790
1690 JAUMUZ010000014.1 GCA030530435_00679 gene open 6085-6522
1691 JAUMUZ010000014.1 GCA030530435_00680 gene open 7060-7596
1692 JAUMUZ010000014.1 GCA030530435_00681 gene open 7646-8068
1693 JAUMUZ010000014.1 GCA030530435_00682 gene open 8400-8768
1694 JAUMUZ010000014.1 GCA030530435_00683 gene open 8994-9476
1695 JAUMUZ010000014.1 GCA030530435_00684 gene open 9480-9926
1696 JAUMUZ010000014.1 GCA030530435_00685 gene open 9933-11399
1697 JAUMUZ010000014.1 GCA030530435_00686 gene open 11517-12149
1698 JAUMUZ010000014.1 GCA030530435_00687 gene open 12361-12609 pth
1699 JAUMUZ010000014.1 GCA030530435_00688 gene open 12804-13925
1700 JAUMUZ010000014.1 GCA030530435_00689 gene open 13932-14159
1701 JAUMUZ010000014.1 GCA030530435_00690 gene open 14199-14981
1702 JAUMUZ010000014.1 GCA030530435_00691 gene open 15083-15442
1703 JAUMUZ010000014.1 GCA030530435_00692 gene open 15769-16116 rplT
1704 JAUMUZ010000014.1 GCA030530435_00693 gene open 16142-16339 rpmI
1705 JAUMUZ010000014.1 GCA030530435_00694 gene open 16394-16726 infC
1706 JAUMUZ010000014.1 GCA030530435_00695 gene open 16730-16906
1707 JAUMUZ010000014.1 GCA030530435_00696 gene open 16910-17209 rpsT
1708 JAUMUZ010000014.1 GCA030530435_00697 gene open 17291-18931
1709 JAUMUZ010000014.1 GCA030530435_00698 gene open 18956-19759 recF
1710 JAUMUZ010000014.1 GCA030530435_00699 gene open 20022-20303
1711 JAUMUZ010000014.1 GCA030530435_00700 gene open 20342-20758
1712 JAUMUZ010000014.1 GCA030530435_00701 gene open 20703-21248 psbP
1713 JAUMUZ010000014.1 GCA030530435_00703 gene open 21706-22038
1714 JAUMUZ010000014.1 GCA030530435_00704 gene open 22048-22326
1715 JAUMUZ010000014.1 GCA030530435_00705 gene open 22346-22981
1716 JAUMUZ010000014.1 GCA030530435_00706 gene open 23051-23374
1717 JAUMUZ010000014.1 GCA030530435_00707 gene open 23663-24772 traD
1718 JAUMUZ010000014.1 GCA030530435_00708 gene open 24812-25630
1719 JAUMUZ010000014.1 GCA030530435_00709 gene open 25702-26304
1720 JAUMUZ010000014.1 GCA030530435_00710 gene open 27055-29196 fusA
1721 JAUMUZ010000014.1 GCA030530435_00711 gene open 29225-29473
1722 JAUMUZ010000014.1 GCA030530435_00673 gene open 4290-4364 trnR
1723 JAUMUZ010000014.1 GCA030530435_00674 gene open 4479-4553 trnF
1724 JAUMUZ010000014.1 GCA030530435_00676 gene open 5433-5511
1725 JAUMUZ010000014.1 GCA030530435_00678 gene open 5912-5989 trnR
1726 JAUMUZ010000014.1 GCA030530435_00702 gene open 21287-21360 trnC
1727 JAUMUZ010000014.1 GCA030530435_00712 gene open 29475-29559 trnL
1728 JAUMUZ010000014.1 GCA030530435_00673 tRNA open 4290-4364 trnR tRNA-Arg(tct)
1729 JAUMUZ010000014.1 GCA030530435_00674 tRNA open 4479-4553 trnF tRNA-Phe(gaa)
1730 JAUMUZ010000014.1 GCA030530435_00676 tRNA open 5433-5511 tRNA-Xxx
1731 JAUMUZ010000014.1 GCA030530435_00678 tRNA open 5912-5989 trnR tRNA-Arg(gcg)
1732 JAUMUZ010000014.1 GCA030530435_00702 tRNA open 21287-21360 trnC tRNA-Cys(gca)
1733 JAUMUZ010000014.1 GCA030530435_00712 tRNA open 29475-29559 trnL tRNA-Leu(tag)
1734 JAUMUZ010000015.1 GCA030530435_00867 CDS open 897-1214 _na     105_aa hypothetical protein
1735 JAUMUZ010000015.1 GCA030530435_00868 CDS open 1205-1303 _na     32_aa hypothetical protein
1736 JAUMUZ010000015.1 GCA030530435_00869 CDS open 1316-1876 _na     186_aa VTT domain-containing protein
1737 JAUMUZ010000015.1 GCA030530435_00870 CDS open 1954-2871 _na     305_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
1738 JAUMUZ010000015.1 GCA030530435_00871 CDS open 2873-3238 _na     121_aa ybeY rRNA maturation RNase YbeY
1739 JAUMUZ010000015.1 GCA030530435_00872 CDS open 3715-4209 _na     164_aa murB UDP-N-acetylmuramate dehydrogenase
1740 JAUMUZ010000015.1 GCA030530435_00873 CDS open 4338-4655 _na     105_aa hypothetical protein
1741 JAUMUZ010000015.1 GCA030530435_00874 CDS open 5006-5569 _na     187_aa Tetratricopeptide repeat-like domain-containing protein
1742 JAUMUZ010000015.1 GCA030530435_00875 CDS open 5841-6395 _na     184_aa VWFA domain-containing protein
1743 JAUMUZ010000015.1 GCA030530435_00876 CDS open 6399-7505 _na     368_aa DUF4012 domain-containing protein
1744 JAUMUZ010000015.1 GCA030530435_00877 CDS open 7502-8068 _na     188_aa hypothetical protein
1745 JAUMUZ010000015.1 GCA030530435_00878 CDS open 8252-8581 _na     109_aa hypothetical protein
1746 JAUMUZ010000015.1 GCA030530435_00879 CDS open 8657-10285 _na     542_aa DUF1704 domain-containing protein
1747 JAUMUZ010000015.1 GCA030530435_00880 CDS open 10289-11797 _na     502_aa DUF1704 domain-containing protein
1748 JAUMUZ010000015.1 GCA030530435_00881 CDS open 11926-13131 _na     401_aa DUF2130 domain-containing protein
1749 JAUMUZ010000015.1 GCA030530435_00882 CDS open 13133-13522 _na     129_aa YgjP-like metallopeptidase domain-containing protein
1750 JAUMUZ010000015.1 GCA030530435_00883 CDS open 13649-14596 _na     315_aa Peptidase C39-like domain-containing protein
1751 JAUMUZ010000015.1 GCA030530435_00884 CDS open 14966-15907 _na     313_aa Kazal-like domain-containing protein
1752 JAUMUZ010000015.1 GCA030530435_00885 CDS open 16271-17014 _na     247_aa DUF5667 domain-containing protein
1753 JAUMUZ010000015.1 GCA030530435_00886 CDS open 17219-17479 _na     86_aa DUF465 domain-containing protein
1754 JAUMUZ010000015.1 GCA030530435_00887 CDS open 17684-18226 _na     180_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
1755 JAUMUZ010000015.1 GCA030530435_00888 CDS open 18602-18823 _na     73_aa hypothetical protein
1756 JAUMUZ010000015.1 GCA030530435_00889 CDS open 19053-19265 _na     70_aa tfoX TfoX N-terminal domain-containing protein
1757 JAUMUZ010000015.1 GCA030530435_00890 CDS open 19278-20033 _na     251_aa tgt tRNA guanosine(34) transglycosylase Tgt
1758 JAUMUZ010000015.1 GCA030530435_00891 CDS open 20091-20282 _na     63_aa hypothetical protein
1759 JAUMUZ010000015.1 GCA030530435_00892 CDS open 20322-20492 _na     56_aa hypothetical protein
1760 JAUMUZ010000015.1 GCA030530435_00893 CDS open 20702-21058 _na     118_aa hypothetical protein
1761 JAUMUZ010000015.1 GCA030530435_00894 CDS open 21062-21292 _na     76_aa hypothetical protein
1762 JAUMUZ010000015.1 GCA030530435_00895 CDS open 21341-21538 _na     65_aa hypothetical protein
1763 JAUMUZ010000015.1 GCA030530435_00896 CDS open 21542-22099 _na     185_aa hypothetical protein
1764 JAUMUZ010000015.1 GCA030530435_00897 CDS open 23147-23842 _na     231_aa hypothetical protein
1765 JAUMUZ010000015.1 GCA030530435_00898 CDS open 23950-24777 _na     275_aa AAA+ ATPase domain-containing protein
1766 JAUMUZ010000015.1 GCA030530435_00899 CDS open 24952-25242 _na     96_aa hypothetical protein
1767 JAUMUZ010000015.1 GCA030530435_00900 CDS open 25653-26789 _na     378_aa NAD-dependent malic enzyme
1768 JAUMUZ010000015.1 GCA030530435_00901 CDS open 26907-27749 _na     280_aa SLH domain-containing protein
1769 JAUMUZ010000015.1 GCA030530435_00902 CDS open 27893-28456 _na     187_aa hypothetical protein
1770 JAUMUZ010000015.1 GCA030530435_00867 gene open 897-1214
1771 JAUMUZ010000015.1 GCA030530435_00868 gene open 1205-1303
1772 JAUMUZ010000015.1 GCA030530435_00869 gene open 1316-1876
1773 JAUMUZ010000015.1 GCA030530435_00870 gene open 1954-2871
1774 JAUMUZ010000015.1 GCA030530435_00871 gene open 2873-3238 ybeY
1775 JAUMUZ010000015.1 GCA030530435_00872 gene open 3715-4209 murB
1776 JAUMUZ010000015.1 GCA030530435_00873 gene open 4338-4655
1777 JAUMUZ010000015.1 GCA030530435_00874 gene open 5006-5569
1778 JAUMUZ010000015.1 GCA030530435_00875 gene open 5841-6395
1779 JAUMUZ010000015.1 GCA030530435_00876 gene open 6399-7505
1780 JAUMUZ010000015.1 GCA030530435_00877 gene open 7502-8068
1781 JAUMUZ010000015.1 GCA030530435_00878 gene open 8252-8581
1782 JAUMUZ010000015.1 GCA030530435_00879 gene open 8657-10285
1783 JAUMUZ010000015.1 GCA030530435_00880 gene open 10289-11797
1784 JAUMUZ010000015.1 GCA030530435_00881 gene open 11926-13131
1785 JAUMUZ010000015.1 GCA030530435_00882 gene open 13133-13522
1786 JAUMUZ010000015.1 GCA030530435_00883 gene open 13649-14596
1787 JAUMUZ010000015.1 GCA030530435_00884 gene open 14966-15907
1788 JAUMUZ010000015.1 GCA030530435_00885 gene open 16271-17014
1789 JAUMUZ010000015.1 GCA030530435_00886 gene open 17219-17479
1790 JAUMUZ010000015.1 GCA030530435_00887 gene open 17684-18226
1791 JAUMUZ010000015.1 GCA030530435_00888 gene open 18602-18823
1792 JAUMUZ010000015.1 GCA030530435_00889 gene open 19053-19265 tfoX
1793 JAUMUZ010000015.1 GCA030530435_00890 gene open 19278-20033 tgt
1794 JAUMUZ010000015.1 GCA030530435_00891 gene open 20091-20282
1795 JAUMUZ010000015.1 GCA030530435_00892 gene open 20322-20492
1796 JAUMUZ010000015.1 GCA030530435_00893 gene open 20702-21058
1797 JAUMUZ010000015.1 GCA030530435_00894 gene open 21062-21292
1798 JAUMUZ010000015.1 GCA030530435_00895 gene open 21341-21538
1799 JAUMUZ010000015.1 GCA030530435_00896 gene open 21542-22099
1800 JAUMUZ010000015.1 GCA030530435_00897 gene open 23147-23842
1801 JAUMUZ010000015.1 GCA030530435_00898 gene open 23950-24777
1802 JAUMUZ010000015.1 GCA030530435_00899 gene open 24952-25242
1803 JAUMUZ010000015.1 GCA030530435_00900 gene open 25653-26789
1804 JAUMUZ010000015.1 GCA030530435_00901 gene open 26907-27749
1805 JAUMUZ010000015.1 GCA030530435_00902 gene open 27893-28456
1806 JAUMUZ010000015.1 GCA030530435_00866 gene open 2-78 trnV
1807 JAUMUZ010000015.1 GCA030530435_00866 tRNA open 2-78 trnV tRNA-Val(tac)
1808 JAUMUZ010000016.1 GCA030530435_00903 CDS open 266-868 _na     200_aa ATP-dependent Clp protease proteolytic subunit
1809 JAUMUZ010000016.1 GCA030530435_00904 CDS open 878-1093 _na     71_aa hypothetical protein
1810 JAUMUZ010000016.1 GCA030530435_00905 CDS open 1124-1597 _na     157_aa hypothetical protein
1811 JAUMUZ010000016.1 GCA030530435_00906 CDS open 2883-3152 _na     89_aa hypothetical protein
1812 JAUMUZ010000016.1 GCA030530435_00907 CDS open 3432-3593 _na     53_aa hypothetical protein
1813 JAUMUZ010000016.1 GCA030530435_00908 CDS open 3639-6638 _na     999_aa SLH domain-containing protein
1814 JAUMUZ010000016.1 GCA030530435_00909 CDS open 6705-7232 _na     175_aa hypothetical protein
1815 JAUMUZ010000016.1 GCA030530435_00910 CDS open 7405-8028 _na     207_aa hypothetical protein
1816 JAUMUZ010000016.1 GCA030530435_00911 CDS open 8296-9312 _na     338_aa tyrS tyrosine--tRNA ligase
1817 JAUMUZ010000016.1 GCA030530435_00912 CDS open 9430-9903 _na     157_aa lspA signal peptidase II
1818 JAUMUZ010000016.1 GCA030530435_00913 CDS open 10106-10675 _na     189_aa hypothetical protein
1819 JAUMUZ010000016.1 GCA030530435_00914 CDS open 10679-11218 _na     179_aa AMMECR1 domain-containing protein
1820 JAUMUZ010000016.1 GCA030530435_00915 CDS open 11286-12254 _na     322_aa AAA family ATPase
1821 JAUMUZ010000016.1 GCA030530435_00916 CDS open 12468-13091 _na     207_aa nth endonuclease III
1822 JAUMUZ010000016.1 GCA030530435_00917 CDS open 13084-14166 _na     360_aa POTRA domain-containing protein
1823 JAUMUZ010000016.1 GCA030530435_00918 CDS open 14261-14503 _na     80_aa Ribosome-binding factor A
1824 JAUMUZ010000016.1 GCA030530435_00919 CDS open 14541-14903 _na     120_aa hypothetical protein
1825 JAUMUZ010000016.1 GCA030530435_00920 CDS open 14887-15855 _na     322_aa Pseudouridine synthase
1826 JAUMUZ010000016.1 GCA030530435_00921 CDS open 15848-16222 _na     124_aa DUF1304 domain-containing protein
1827 JAUMUZ010000016.1 GCA030530435_00922 CDS open 16325-16855 _na     176_aa Methyltransferase
1828 JAUMUZ010000016.1 GCA030530435_00923 CDS open 16700-17101 _na     133_aa hypothetical protein
1829 JAUMUZ010000016.1 GCA030530435_00924 CDS open 17121-18050 _na     309_aa hypothetical protein
1830 JAUMUZ010000016.1 GCA030530435_00925 CDS open 18195-19016 _na     273_aa hypothetical protein
1831 JAUMUZ010000016.1 GCA030530435_00926 CDS open 19047-19343 _na     98_aa hypothetical protein
1832 JAUMUZ010000016.1 GCA030530435_00927 CDS open 19431-19730 _na     99_aa hypothetical protein
1833 JAUMUZ010000016.1 GCA030530435_00928 CDS open 19717-19950 _na     77_aa hypothetical protein
1834 JAUMUZ010000016.1 GCA030530435_00929 CDS open 20607-20906 _na     99_aa hypothetical protein
1835 JAUMUZ010000016.1 GCA030530435_00930 CDS open 21128-21394 _na     88_aa hypothetical protein
1836 JAUMUZ010000016.1 GCA030530435_00931 CDS open 21541-21978 _na     145_aa ndk nucleoside-diphosphate kinase
1837 JAUMUZ010000016.1 GCA030530435_00932 CDS open 22037-22894 _na     285_aa mscS Mechanosensitive ion channel protein MscS
1838 JAUMUZ010000016.1 GCA030530435_00933 CDS open 22898-23842 _na     314_aa DUF4300 domain-containing protein
1839 JAUMUZ010000016.1 GCA030530435_00934 CDS open 23949-24236 _na     95_aa ClpX-type ZB domain-containing protein
1840 JAUMUZ010000016.1 GCA030530435_00935 CDS open 24343-26223 _na     626_aa lepA translation elongation factor 4
1841 JAUMUZ010000016.1 GCA030530435_00936 CDS open 26430-26570 _na     46_aa hypothetical protein
1842 JAUMUZ010000016.1 GCA030530435_00937 CDS open 26891-27079 _na     62_aa hypothetical protein
1843 JAUMUZ010000016.1 GCA030530435_00938 CDS open 27425-27625 _na     66_aa hypothetical protein
1844 JAUMUZ010000016.1 GCA030530435_00903 gene open 266-868
1845 JAUMUZ010000016.1 GCA030530435_00904 gene open 878-1093
1846 JAUMUZ010000016.1 GCA030530435_00905 gene open 1124-1597
1847 JAUMUZ010000016.1 GCA030530435_00906 gene open 2883-3152
1848 JAUMUZ010000016.1 GCA030530435_00907 gene open 3432-3593
1849 JAUMUZ010000016.1 GCA030530435_00908 gene open 3639-6638
1850 JAUMUZ010000016.1 GCA030530435_00909 gene open 6705-7232
1851 JAUMUZ010000016.1 GCA030530435_00910 gene open 7405-8028
1852 JAUMUZ010000016.1 GCA030530435_00911 gene open 8296-9312 tyrS
1853 JAUMUZ010000016.1 GCA030530435_00912 gene open 9430-9903 lspA
1854 JAUMUZ010000016.1 GCA030530435_00913 gene open 10106-10675
1855 JAUMUZ010000016.1 GCA030530435_00914 gene open 10679-11218
1856 JAUMUZ010000016.1 GCA030530435_00915 gene open 11286-12254
1857 JAUMUZ010000016.1 GCA030530435_00916 gene open 12468-13091 nth
1858 JAUMUZ010000016.1 GCA030530435_00917 gene open 13084-14166
1859 JAUMUZ010000016.1 GCA030530435_00918 gene open 14261-14503
1860 JAUMUZ010000016.1 GCA030530435_00919 gene open 14541-14903
1861 JAUMUZ010000016.1 GCA030530435_00920 gene open 14887-15855
1862 JAUMUZ010000016.1 GCA030530435_00921 gene open 15848-16222
1863 JAUMUZ010000016.1 GCA030530435_00922 gene open 16325-16855
1864 JAUMUZ010000016.1 GCA030530435_00923 gene open 16700-17101
1865 JAUMUZ010000016.1 GCA030530435_00924 gene open 17121-18050
1866 JAUMUZ010000016.1 GCA030530435_00925 gene open 18195-19016
1867 JAUMUZ010000016.1 GCA030530435_00926 gene open 19047-19343
1868 JAUMUZ010000016.1 GCA030530435_00927 gene open 19431-19730
1869 JAUMUZ010000016.1 GCA030530435_00928 gene open 19717-19950
1870 JAUMUZ010000016.1 GCA030530435_00929 gene open 20607-20906
1871 JAUMUZ010000016.1 GCA030530435_00930 gene open 21128-21394
1872 JAUMUZ010000016.1 GCA030530435_00931 gene open 21541-21978 ndk
1873 JAUMUZ010000016.1 GCA030530435_00932 gene open 22037-22894 mscS
1874 JAUMUZ010000016.1 GCA030530435_00933 gene open 22898-23842
1875 JAUMUZ010000016.1 GCA030530435_00934 gene open 23949-24236
1876 JAUMUZ010000016.1 GCA030530435_00935 gene open 24343-26223 lepA
1877 JAUMUZ010000016.1 GCA030530435_00936 gene open 26430-26570
1878 JAUMUZ010000016.1 GCA030530435_00937 gene open 26891-27079
1879 JAUMUZ010000016.1 GCA030530435_00938 gene open 27425-27625
1880 JAUMUZ010000017.1 repeat_region open 215-513 CRISPR array with 5 repeats of length 37%2C consensus sequence TATCTACCACAGTAGAAATTTACTAATGAAATTTGAG and spacer length 26
1881 JAUMUZ010000017.1 GCA030530435_00939 CDS open 720-1001 _na     93_aa cas2 CRISPR-associated endonuclease Cas2
1882 JAUMUZ010000017.1 GCA030530435_00940 CDS open 1003-1974 _na     323_aa cas1 type V CRISPR-associated endonuclease Cas1
1883 JAUMUZ010000017.1 GCA030530435_00941 CDS open 1983-2534 _na     183_aa cas4 type V CRISPR-associated protein Cas4
1884 JAUMUZ010000017.1 GCA030530435_00942 CDS open 2557-3090 _na     177_aa hypothetical protein
1885 JAUMUZ010000017.1 GCA030530435_00943 CDS open 3102-6815 _na     1237_aa cas12a type V CRISPR-associated protein Cas12a/Cpf1
1886 JAUMUZ010000017.1 GCA030530435_00944 CDS open 6897-8930 _na     677_aa Guanylate cyclase domain-containing protein
1887 JAUMUZ010000017.1 GCA030530435_00945 CDS open 8921-9481 _na     186_aa hypothetical protein
1888 JAUMUZ010000017.1 GCA030530435_00946 CDS open 9606-11813 _na     735_aa MBG domain-containing protein
1889 JAUMUZ010000017.1 GCA030530435_00947 CDS open 11815-12777 _na     320_aa DUF5667 domain-containing protein
1890 JAUMUZ010000017.1 GCA030530435_00948 CDS open 12899-15919 _na     1006_aa TRCF
1891 JAUMUZ010000017.1 GCA030530435_00949 CDS open 15921-16466 _na     181_aa frr ribosome recycling factor
1892 JAUMUZ010000017.1 GCA030530435_00950 CDS open 16604-17476 _na     290_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
1893 JAUMUZ010000017.1 GCA030530435_00951 CDS open 17557-18492 _na     311_aa SAM-dependent MTase RsmB/NOP-type domain-containing protein
1894 JAUMUZ010000017.1 GCA030530435_00952 CDS open 18659-20131 _na     490_aa der ribosome biogenesis GTPase Der
1895 JAUMUZ010000017.1 GCA030530435_00953 CDS open 20148-21167 _na     339_aa TraB/GumN family protein
1896 JAUMUZ010000017.1 GCA030530435_00954 CDS open 21295-23196 _na     633_aa ftsH ATP-dependent zinc metalloprotease FtsH
1897 JAUMUZ010000017.1 GCA030530435_00955 CDS open 23258-24088 _na     276_aa hypothetical protein
1898 JAUMUZ010000017.1 GCA030530435_00956 CDS open 24178-24939 _na     253_aa hypothetical protein
1899 JAUMUZ010000017.1 GCA030530435_00957 CDS open 25114-26163 _na     349_aa Adenine DNA glycosylase
1900 JAUMUZ010000017.1 GCA030530435_00939 gene open 720-1001 cas2
1901 JAUMUZ010000017.1 GCA030530435_00940 gene open 1003-1974 cas1
1902 JAUMUZ010000017.1 GCA030530435_00941 gene open 1983-2534 cas4
1903 JAUMUZ010000017.1 GCA030530435_00942 gene open 2557-3090
1904 JAUMUZ010000017.1 GCA030530435_00943 gene open 3102-6815 cas12a
1905 JAUMUZ010000017.1 GCA030530435_00944 gene open 6897-8930
1906 JAUMUZ010000017.1 GCA030530435_00945 gene open 8921-9481
1907 JAUMUZ010000017.1 GCA030530435_00946 gene open 9606-11813
1908 JAUMUZ010000017.1 GCA030530435_00947 gene open 11815-12777
1909 JAUMUZ010000017.1 GCA030530435_00948 gene open 12899-15919
1910 JAUMUZ010000017.1 GCA030530435_00949 gene open 15921-16466 frr
1911 JAUMUZ010000017.1 GCA030530435_00950 gene open 16604-17476
1912 JAUMUZ010000017.1 GCA030530435_00951 gene open 17557-18492
1913 JAUMUZ010000017.1 GCA030530435_00952 gene open 18659-20131 der
1914 JAUMUZ010000017.1 GCA030530435_00953 gene open 20148-21167
1915 JAUMUZ010000017.1 GCA030530435_00954 gene open 21295-23196 ftsH
1916 JAUMUZ010000017.1 GCA030530435_00955 gene open 23258-24088
1917 JAUMUZ010000017.1 GCA030530435_00956 gene open 24178-24939
1918 JAUMUZ010000017.1 GCA030530435_00957 gene open 25114-26163
1919 JAUMUZ010000018.1 GCA030530435_00958 CDS open 24-581 _na     185_aa pilX Type 4 fimbrial biogenesis protein PilX N-terminal domain-containing protein
1920 JAUMUZ010000018.1 GCA030530435_00959 CDS open 612-743 _na     43_aa hypothetical protein
1921 JAUMUZ010000018.1 GCA030530435_00960 CDS open 750-998 _na     82_aa hypothetical protein
1922 JAUMUZ010000018.1 GCA030530435_00961 CDS open 1040-1717 _na     225_aa Type II secretion system protein J
1923 JAUMUZ010000018.1 GCA030530435_00962 CDS open 1735-2418 _na     227_aa Type II secretion system protein
1924 JAUMUZ010000018.1 GCA030530435_00963 CDS open 2827-3039 _na     70_aa hypothetical protein
1925 JAUMUZ010000018.1 GCA030530435_00964 CDS open 3090-4160 _na     356_aa gspF Type II secretion system protein GspF domain-containing protein
1926 JAUMUZ010000018.1 GCA030530435_00965 CDS open 4177-4722 _na     181_aa pilO Type 4a pilus biogenesis protein PilO
1927 JAUMUZ010000018.1 GCA030530435_00966 CDS open 4780-5367 _na     195_aa pilN PilN domain-containing protein
1928 JAUMUZ010000018.1 GCA030530435_00967 CDS open 5519-5851 _na     110_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1929 JAUMUZ010000018.1 GCA030530435_00969 CDS open 6080-6568 _na     162_aa hypothetical protein
1930 JAUMUZ010000018.1 GCA030530435_00970 CDS open 6568-6657 _na     29_aa hypothetical protein
1931 JAUMUZ010000018.1 GCA030530435_00971 CDS open 7067-11092 _na     1341_aa rpoC DNA-directed RNA polymerase subunit beta'
1932 JAUMUZ010000018.1 GCA030530435_00972 CDS open 11115-11516 _na     133_aa hypothetical protein
1933 JAUMUZ010000018.1 GCA030530435_00973 CDS open 11570-15160 _na     1196_aa rpoB DNA-directed RNA polymerase subunit beta
1934 JAUMUZ010000018.1 GCA030530435_00974 CDS open 15420-17933 _na     837_aa ATPase
1935 JAUMUZ010000018.1 GCA030530435_00975 CDS open 18199-18462 _na     87_aa DUF1294 domain-containing protein
1936 JAUMUZ010000018.1 GCA030530435_00976 CDS open 18548-18739 _na     63_aa hypothetical protein
1937 JAUMUZ010000018.1 GCA030530435_00977 CDS open 19044-19385 _na     113_aa hypothetical protein
1938 JAUMUZ010000018.1 GCA030530435_00978 CDS open 19524-19886 _na     120_aa DUF5667 domain-containing protein
1939 JAUMUZ010000018.1 GCA030530435_00979 CDS open 20183-20743 _na     186_aa DNA-3-methyladenine glycosylase
1940 JAUMUZ010000018.1 GCA030530435_00980 CDS open 21106-21855 _na     249_aa hypothetical protein
1941 JAUMUZ010000018.1 GCA030530435_00981 CDS open 21967-24180 _na     737_aa DNA 3'-5' helicase
1942 JAUMUZ010000018.1 GCA030530435_00958 gene open 24-581 pilX
1943 JAUMUZ010000018.1 GCA030530435_00959 gene open 612-743
1944 JAUMUZ010000018.1 GCA030530435_00960 gene open 750-998
1945 JAUMUZ010000018.1 GCA030530435_00961 gene open 1040-1717
1946 JAUMUZ010000018.1 GCA030530435_00962 gene open 1735-2418
1947 JAUMUZ010000018.1 GCA030530435_00963 gene open 2827-3039
1948 JAUMUZ010000018.1 GCA030530435_00964 gene open 3090-4160 gspF
1949 JAUMUZ010000018.1 GCA030530435_00965 gene open 4177-4722 pilO
1950 JAUMUZ010000018.1 GCA030530435_00966 gene open 4780-5367 pilN
1951 JAUMUZ010000018.1 GCA030530435_00967 gene open 5519-5851 tsaE
1952 JAUMUZ010000018.1 GCA030530435_00969 gene open 6080-6568
1953 JAUMUZ010000018.1 GCA030530435_00970 gene open 6568-6657
1954 JAUMUZ010000018.1 GCA030530435_00971 gene open 7067-11092 rpoC
1955 JAUMUZ010000018.1 GCA030530435_00972 gene open 11115-11516
1956 JAUMUZ010000018.1 GCA030530435_00973 gene open 11570-15160 rpoB
1957 JAUMUZ010000018.1 GCA030530435_00974 gene open 15420-17933
1958 JAUMUZ010000018.1 GCA030530435_00975 gene open 18199-18462
1959 JAUMUZ010000018.1 GCA030530435_00976 gene open 18548-18739
1960 JAUMUZ010000018.1 GCA030530435_00977 gene open 19044-19385
1961 JAUMUZ010000018.1 GCA030530435_00978 gene open 19524-19886
1962 JAUMUZ010000018.1 GCA030530435_00979 gene open 20183-20743
1963 JAUMUZ010000018.1 GCA030530435_00980 gene open 21106-21855
1964 JAUMUZ010000018.1 GCA030530435_00981 gene open 21967-24180
1965 JAUMUZ010000018.1 GCA030530435_00968 gene open 5934-6008 trnN
1966 JAUMUZ010000018.1 GCA030530435_00968 tRNA open 5934-6008 trnN tRNA-Asn(gtt)
1967 JAUMUZ010000019.1 GCA030530435_00988 CDS open 56-229 _na     57_aa hypothetical protein
1968 JAUMUZ010000019.1 GCA030530435_00989 CDS open 573-671 _na     32_aa hypothetical protein
1969 JAUMUZ010000019.1 GCA030530435_00990 CDS open 896-1018 _na     40_aa hypothetical protein
1970 JAUMUZ010000019.1 GCA030530435_00991 CDS open 1376-1519 _na     47_aa hypothetical protein
1971 JAUMUZ010000019.1 GCA030530435_00992 CDS open 2258-2446 _na     62_aa hypothetical protein
1972 JAUMUZ010000019.1 GCA030530435_00993 CDS open 2849-2992 _na     47_aa hypothetical protein
1973 JAUMUZ010000019.1 GCA030530435_00994 CDS open 3461-3838 _na     125_aa hypothetical protein
1974 JAUMUZ010000019.1 GCA030530435_00995 CDS open 4620-4931 _na     103_aa HTH hxlR-type domain-containing protein
1975 JAUMUZ010000019.1 GCA030530435_00996 CDS open 5147-5395 _na     82_aa Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein
1976 JAUMUZ010000019.1 GCA030530435_00997 CDS open 5515-6099 _na     194_aa msbA Lipid A export ATP-binding/permease protein MsbA
1977 JAUMUZ010000019.1 GCA030530435_00998 CDS open 6157-6624 _na     155_aa hypothetical protein
1978 JAUMUZ010000019.1 GCA030530435_00999 CDS open 6712-7260 _na     182_aa hypothetical protein
1979 JAUMUZ010000019.1 GCA030530435_01000 CDS open 7285-7899 _na     204_aa VTT domain-containing protein
1980 JAUMUZ010000019.1 GCA030530435_01001 CDS open 8120-9541 _na     473_aa glycine--tRNA ligase
1981 JAUMUZ010000019.1 GCA030530435_01002 CDS open 9775-10221 _na     148_aa hypothetical protein
1982 JAUMUZ010000019.1 GCA030530435_01003 CDS open 10243-11061 _na     272_aa Methyltransferase
1983 JAUMUZ010000019.1 GCA030530435_01004 CDS open 11167-11505 _na     112_aa hypothetical protein
1984 JAUMUZ010000019.1 GCA030530435_01005 CDS open 11827-13209 _na     460_aa recG ATP-dependent DNA helicase RecG
1985 JAUMUZ010000019.1 GCA030530435_01006 CDS open 13763-13921 _na     52_aa hypothetical protein
1986 JAUMUZ010000019.1 GCA030530435_01007 CDS open 14015-15238 _na     407_aa Beta-Casp domain-containing protein
1987 JAUMUZ010000019.1 GCA030530435_01008 CDS open 15251-15511 _na     86_aa hypothetical protein
1988 JAUMUZ010000019.1 GCA030530435_01009 CDS open 15515-16162 _na     215_aa hypothetical protein
1989 JAUMUZ010000019.1 GCA030530435_01010 CDS open 16137-16760 _na     207_aa Methyltransferase domain-containing protein
1990 JAUMUZ010000019.1 GCA030530435_01011 CDS open 16782-17183 _na     133_aa Lipoprotein
1991 JAUMUZ010000019.1 GCA030530435_01012 CDS open 17486-17800 _na     104_aa trxA thioredoxin
1992 JAUMUZ010000019.1 GCA030530435_01013 CDS open 18184-18321 _na     45_aa hypothetical protein
1993 JAUMUZ010000019.1 GCA030530435_01014 CDS open 18364-18672 _na     102_aa hypothetical protein
1994 JAUMUZ010000019.1 GCA030530435_01015 CDS open 18721-19329 _na     202_aa Tim44-like domain-containing protein
1995 JAUMUZ010000019.1 GCA030530435_01016 CDS open 19349-20392 _na     347_aa recA recombinase RecA
1996 JAUMUZ010000019.1 GCA030530435_01017 CDS open 20515-20700 _na     61_aa hypothetical protein
1997 JAUMUZ010000019.1 GCA030530435_00988 gene open 56-229
1998 JAUMUZ010000019.1 GCA030530435_00989 gene open 573-671
1999 JAUMUZ010000019.1 GCA030530435_00990 gene open 896-1018
2000 JAUMUZ010000019.1 GCA030530435_00991 gene open 1376-1519