HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Anaerococcus octavius (GCA_030825475.1)

Select a Genome:
BAKTA Annotations for GCA_030825475.1
Genome Selected: Anaerococcus octavius
ContigsBases CDSrRNA tmRNAtRNA
76 1719998 1635 0 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3360 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3360 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JAPJPW010000003.1 GCA030825475_00108 gene open 68656-68943 rpsS
502 JAPJPW010000003.1 GCA030825475_00109 gene open 68953-69783 rplB
503 JAPJPW010000003.1 GCA030825475_00110 gene open 69795-70088 rplW
504 JAPJPW010000003.1 GCA030825475_00111 gene open 70088-70711 rplD
505 JAPJPW010000003.1 GCA030825475_00112 gene open 70723-71358 rplC
506 JAPJPW010000003.1 GCA030825475_00113 gene open 71414-71725 rpsJ
507 JAPJPW010000003.1 GCA030825475_00114 gene open 72127-72552
508 JAPJPW010000004.1 repeat_region open 141-1031 CRISPR array with 15 repeats of length 28%2C consensus sequence GGATCACCCCCGCGTATGCGGGATAAAC and spacer length 33
509 JAPJPW010000004.1 GCA030825475_00126 CDS open 1041-1937 _na     298_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
510 JAPJPW010000004.1 GCA030825475_00127 CDS open 1937-2875 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
511 JAPJPW010000004.1 GCA030825475_00128 CDS open 2877-3518 _na     213_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
512 JAPJPW010000004.1 GCA030825475_00129 CDS open 3530-4246 _na     238_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
513 JAPJPW010000004.1 GCA030825475_00130 CDS open 4256-5329 _na     357_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
514 JAPJPW010000004.1 GCA030825475_00131 CDS open 5322-5942 _na     206_aa casB type I-E CRISPR-associated protein Cse2/CasB
515 JAPJPW010000004.1 GCA030825475_00132 CDS open 5943-7634 _na     563_aa casA type I-E CRISPR-associated protein Cse1/CasA
516 JAPJPW010000004.1 GCA030825475_00133 CDS open 7603-10368 _na     921_aa CRISPR-associated helicase Cas3
517 JAPJPW010000004.1 GCA030825475_00134 CDS open 10380-10916 _na     178_aa Thermonuclease
518 JAPJPW010000004.1 GCA030825475_00135 CDS open 10995-11282 _na     95_aa Cupin domain
519 JAPJPW010000004.1 GCA030825475_00136 CDS open 11308-11781 _na     157_aa hypothetical protein
520 JAPJPW010000004.1 GCA030825475_00137 CDS open 11884-12171 _na     95_aa SsrA-binding protein
521 JAPJPW010000004.1 GCA030825475_00138 CDS open 12224-14431 _na     735_aa rnr ribonuclease R
522 JAPJPW010000004.1 GCA030825475_00139 CDS open 14490-14717 _na     75_aa secG preprotein translocase subunit SecG
523 JAPJPW010000004.1 GCA030825475_00140 CDS open 14864-16171 _na     435_aa eno phosphopyruvate hydratase
524 JAPJPW010000004.1 GCA030825475_00141 CDS open 16196-16948 _na     250_aa tpiA triose-phosphate isomerase
525 JAPJPW010000004.1 GCA030825475_00142 CDS open 16958-18154 _na     398_aa Phosphoglycerate kinase
526 JAPJPW010000004.1 GCA030825475_00143 CDS open 18210-19214 _na     334_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
527 JAPJPW010000004.1 GCA030825475_00144 CDS open 19288-20217 _na     309_aa trxB thioredoxin-disulfide reductase
528 JAPJPW010000004.1 GCA030825475_00145 CDS open 20228-20686 _na     152_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
529 JAPJPW010000004.1 GCA030825475_00146 CDS open 20679-21530 _na     283_aa Cof-type HAD-IIB family hydrolase
530 JAPJPW010000004.1 GCA030825475_00147 CDS open 21523-22116 _na     197_aa nth endonuclease III
531 JAPJPW010000004.1 GCA030825475_00148 CDS open 22268-23458 _na     396_aa rodA rod shape-determining protein RodA
532 JAPJPW010000004.1 GCA030825475_00149 CDS open 23455-24096 _na     213_aa V-type ATP synthase subunit D
533 JAPJPW010000004.1 GCA030825475_00150 CDS open 24102-25463 _na     453_aa V-type ATP synthase beta chain
534 JAPJPW010000004.1 GCA030825475_00151 CDS open 25463-27214 _na     583_aa V-type ATP synthase alpha chain
535 JAPJPW010000004.1 GCA030825475_00152 CDS open 27198-27803 _na     201_aa ATPase
536 JAPJPW010000004.1 GCA030825475_00153 CDS open 27815-28054 _na     79_aa ATP synthase (F/14-kDa) subunit
537 JAPJPW010000004.1 GCA030825475_00154 CDS open 28056-28484 _na     142_aa V-type ATP synthase subunit K
538 JAPJPW010000004.1 GCA030825475_00155 CDS open 28510-30390 _na     626_aa V-type ATP synthase subunit I
539 JAPJPW010000004.1 GCA030825475_00156 CDS open 30408-31286 _na     292_aa V-type ATP synthase subunit I
540 JAPJPW010000004.1 GCA030825475_00157 CDS open 31289-32269 _na     326_aa ATPase
541 JAPJPW010000004.1 GCA030825475_00158 CDS open 32369-33721 _na     450_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
542 JAPJPW010000004.1 GCA030825475_00159 CDS open 33782-36025 _na     747_aa bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1
543 JAPJPW010000004.1 GCA030825475_00160 CDS open 36034-36612 _na     192_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
544 JAPJPW010000004.1 GCA030825475_00161 CDS open 36602-37255 _na     217_aa cmk (d)CMP kinase
545 JAPJPW010000004.1 GCA030825475_00162 CDS open 37243-38466 _na     407_aa Monoamine oxidase
546 JAPJPW010000004.1 GCA030825475_00163 CDS open 38507-39202 _na     231_aa Pseudouridine synthase
547 JAPJPW010000004.1 GCA030825475_00164 CDS open 39192-39725 _na     177_aa scpB SMC-Scp complex subunit ScpB
548 JAPJPW010000004.1 GCA030825475_00165 CDS open 39718-40422 _na     234_aa Segregation and condensation protein A
549 JAPJPW010000004.1 GCA030825475_00166 CDS open 40422-40967 _na     181_aa ADP-ribose pyrophosphatase
550 JAPJPW010000004.1 GCA030825475_00167 CDS open 40954-42654 _na     566_aa recN DNA repair protein RecN
551 JAPJPW010000004.1 GCA030825475_00168 CDS open 42654-43106 _na     150_aa Arginine repressor
552 JAPJPW010000004.1 GCA030825475_00169 CDS open 43116-43943 _na     275_aa Farnesyl diphosphate synthase
553 JAPJPW010000004.1 GCA030825475_00170 CDS open 43936-44121 _na     61_aa xseB exodeoxyribonuclease VII small subunit
554 JAPJPW010000004.1 GCA030825475_00171 CDS open 44114-45301 _na     395_aa xseA exodeoxyribonuclease VII large subunit
555 JAPJPW010000004.1 GCA030825475_00172 CDS open 45303-45677 _na     124_aa nusB transcription antitermination factor NusB
556 JAPJPW010000004.1 GCA030825475_00173 CDS open 45677-46003 _na     108_aa Asp23/Gls24 family protein
557 JAPJPW010000004.1 GCA030825475_00174 CDS open 46013-46570 _na     185_aa efp elongation factor P
558 JAPJPW010000004.1 GCA030825475_00175 CDS open 46710-47867 _na     385_aa tRNA(Met) cytidine acetate ligase
559 JAPJPW010000004.1 GCA030825475_00176 CDS open 47936-48421 _na     161_aa ATPase
560 JAPJPW010000004.1 GCA030825475_00177 CDS open 48433-48915 _na     160_aa coaD pantetheine-phosphate adenylyltransferase
561 JAPJPW010000004.1 GCA030825475_00178 CDS open 48906-49454 _na     182_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
562 JAPJPW010000004.1 GCA030825475_00179 CDS open 49442-51442 _na     666_aa recG ATP-dependent DNA helicase recG
563 JAPJPW010000004.1 GCA030825475_00180 CDS open 51442-53016 _na     524_aa yloV DAK2 domain fusion protein YloV
564 JAPJPW010000004.1 GCA030825475_00181 CDS open 53024-53377 _na     117_aa Asp23/Gls24 family envelope stress response protein
565 JAPJPW010000004.1 GCA030825475_00182 CDS open 53641-54567 _na     308_aa (Fe-S)-binding protein
566 JAPJPW010000004.1 GCA030825475_00183 CDS open 54586-55773 _na     395_aa Sulfurtransferase
567 JAPJPW010000004.1 GCA030825475_00184 CDS open 55751-56164 _na     137_aa hypothetical protein
568 JAPJPW010000004.1 GCA030825475_00185 CDS open 56128-56982 _na     284_aa Thiosulfate sulfurtransferase
569 JAPJPW010000004.1 GCA030825475_00186 CDS open 56992-57723 _na     243_aa TVP38/TMEM64 family membrane protein
570 JAPJPW010000004.1 GCA030825475_00187 CDS open 57698-58369 _na     223_aa TVP38/TMEM64 family membrane protein
571 JAPJPW010000004.1 GCA030825475_00188 CDS open 58341-58994 _na     217_aa TIGR04283 family arsenosugar biosynthesis glycosyltransferase
572 JAPJPW010000004.1 GCA030825475_00189 CDS open 59024-59845 _na     273_aa Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
573 JAPJPW010000004.1 GCA030825475_00190 CDS open 59845-60765 _na     306_aa cysA Sulfate/thiosulfate import ATP-binding protein CysA
574 JAPJPW010000004.1 GCA030825475_00191 CDS open 60753-61541 _na     262_aa ABC transmembrane type-1 domain-containing protein
575 JAPJPW010000004.1 GCA030825475_00192 CDS open 61525-62382 _na     285_aa ABC transmembrane type-1 domain-containing protein
576 JAPJPW010000004.1 GCA030825475_00193 CDS open 62358-63656 _na     432_aa ABC transporter substrate-binding protein
577 JAPJPW010000004.1 GCA030825475_00194 CDS open 63646-64083 _na     145_aa C-GCAxxG-C-C family protein
578 JAPJPW010000004.1 GCA030825475_00195 CDS open 64040-65533 _na     497_aa TIGR04282 family arsenosugar biosynthesis glycosyltransferase
579 JAPJPW010000004.1 GCA030825475_00126 gene open 1041-1937 cas2e
580 JAPJPW010000004.1 GCA030825475_00127 gene open 1937-2875 cas1e
581 JAPJPW010000004.1 GCA030825475_00128 gene open 2877-3518 cas6e
582 JAPJPW010000004.1 GCA030825475_00129 gene open 3530-4246 cas5e
583 JAPJPW010000004.1 GCA030825475_00130 gene open 4256-5329 cas7e
584 JAPJPW010000004.1 GCA030825475_00131 gene open 5322-5942 casB
585 JAPJPW010000004.1 GCA030825475_00132 gene open 5943-7634 casA
586 JAPJPW010000004.1 GCA030825475_00133 gene open 7603-10368
587 JAPJPW010000004.1 GCA030825475_00134 gene open 10380-10916
588 JAPJPW010000004.1 GCA030825475_00135 gene open 10995-11282
589 JAPJPW010000004.1 GCA030825475_00136 gene open 11308-11781
590 JAPJPW010000004.1 GCA030825475_00137 gene open 11884-12171
591 JAPJPW010000004.1 GCA030825475_00138 gene open 12224-14431 rnr
592 JAPJPW010000004.1 GCA030825475_00139 gene open 14490-14717 secG
593 JAPJPW010000004.1 GCA030825475_00140 gene open 14864-16171 eno
594 JAPJPW010000004.1 GCA030825475_00141 gene open 16196-16948 tpiA
595 JAPJPW010000004.1 GCA030825475_00142 gene open 16958-18154
596 JAPJPW010000004.1 GCA030825475_00143 gene open 18210-19214 gap
597 JAPJPW010000004.1 GCA030825475_00144 gene open 19288-20217 trxB
598 JAPJPW010000004.1 GCA030825475_00145 gene open 20228-20686
599 JAPJPW010000004.1 GCA030825475_00146 gene open 20679-21530
600 JAPJPW010000004.1 GCA030825475_00147 gene open 21523-22116 nth
601 JAPJPW010000004.1 GCA030825475_00148 gene open 22268-23458 rodA
602 JAPJPW010000004.1 GCA030825475_00149 gene open 23455-24096
603 JAPJPW010000004.1 GCA030825475_00150 gene open 24102-25463
604 JAPJPW010000004.1 GCA030825475_00151 gene open 25463-27214
605 JAPJPW010000004.1 GCA030825475_00152 gene open 27198-27803
606 JAPJPW010000004.1 GCA030825475_00153 gene open 27815-28054
607 JAPJPW010000004.1 GCA030825475_00154 gene open 28056-28484
608 JAPJPW010000004.1 GCA030825475_00155 gene open 28510-30390
609 JAPJPW010000004.1 GCA030825475_00156 gene open 30408-31286
610 JAPJPW010000004.1 GCA030825475_00157 gene open 31289-32269
611 JAPJPW010000004.1 GCA030825475_00158 gene open 32369-33721 miaB
612 JAPJPW010000004.1 GCA030825475_00159 gene open 33782-36025
613 JAPJPW010000004.1 GCA030825475_00160 gene open 36034-36612
614 JAPJPW010000004.1 GCA030825475_00161 gene open 36602-37255 cmk
615 JAPJPW010000004.1 GCA030825475_00162 gene open 37243-38466
616 JAPJPW010000004.1 GCA030825475_00163 gene open 38507-39202
617 JAPJPW010000004.1 GCA030825475_00164 gene open 39192-39725 scpB
618 JAPJPW010000004.1 GCA030825475_00165 gene open 39718-40422
619 JAPJPW010000004.1 GCA030825475_00166 gene open 40422-40967
620 JAPJPW010000004.1 GCA030825475_00167 gene open 40954-42654 recN
621 JAPJPW010000004.1 GCA030825475_00168 gene open 42654-43106
622 JAPJPW010000004.1 GCA030825475_00169 gene open 43116-43943
623 JAPJPW010000004.1 GCA030825475_00170 gene open 43936-44121 xseB
624 JAPJPW010000004.1 GCA030825475_00171 gene open 44114-45301 xseA
625 JAPJPW010000004.1 GCA030825475_00172 gene open 45303-45677 nusB
626 JAPJPW010000004.1 GCA030825475_00173 gene open 45677-46003
627 JAPJPW010000004.1 GCA030825475_00174 gene open 46013-46570 efp
628 JAPJPW010000004.1 GCA030825475_00175 gene open 46710-47867
629 JAPJPW010000004.1 GCA030825475_00176 gene open 47936-48421
630 JAPJPW010000004.1 GCA030825475_00177 gene open 48433-48915 coaD
631 JAPJPW010000004.1 GCA030825475_00178 gene open 48906-49454 rsmD
632 JAPJPW010000004.1 GCA030825475_00179 gene open 49442-51442 recG
633 JAPJPW010000004.1 GCA030825475_00180 gene open 51442-53016 yloV
634 JAPJPW010000004.1 GCA030825475_00181 gene open 53024-53377
635 JAPJPW010000004.1 GCA030825475_00182 gene open 53641-54567
636 JAPJPW010000004.1 GCA030825475_00183 gene open 54586-55773
637 JAPJPW010000004.1 GCA030825475_00184 gene open 55751-56164
638 JAPJPW010000004.1 GCA030825475_00185 gene open 56128-56982
639 JAPJPW010000004.1 GCA030825475_00186 gene open 56992-57723
640 JAPJPW010000004.1 GCA030825475_00187 gene open 57698-58369
641 JAPJPW010000004.1 GCA030825475_00188 gene open 58341-58994
642 JAPJPW010000004.1 GCA030825475_00189 gene open 59024-59845
643 JAPJPW010000004.1 GCA030825475_00190 gene open 59845-60765 cysA
644 JAPJPW010000004.1 GCA030825475_00191 gene open 60753-61541
645 JAPJPW010000004.1 GCA030825475_00192 gene open 61525-62382
646 JAPJPW010000004.1 GCA030825475_00193 gene open 62358-63656
647 JAPJPW010000004.1 GCA030825475_00194 gene open 63646-64083
648 JAPJPW010000004.1 GCA030825475_00195 gene open 64040-65533
649 JAPJPW010000005.1 GCA030825475_00238 CDS open 746-1600 _na     284_aa rihB Pyrimidine-specific ribonucleoside hydrolase rihB
650 JAPJPW010000005.1 GCA030825475_00239 CDS open 1576-2106 _na     176_aa FUSC family protein
651 JAPJPW010000005.1 GCA030825475_00240 CDS open 2164-3174 _na     336_aa SCP domain-containing protein
652 JAPJPW010000005.1 GCA030825475_00241 CDS open 3280-3939 _na     219_aa hypothetical protein
653 JAPJPW010000005.1 GCA030825475_00242 CDS open 4064-5080 _na     338_aa hypothetical protein
654 JAPJPW010000005.1 GCA030825475_00243 CDS open 5114-6640 _na     508_aa clcA H(+)/Cl(-) exchange transporter ClcA
655 JAPJPW010000005.1 GCA030825475_00244 CDS open 6660-7322 _na     220_aa hypothetical protein
656 JAPJPW010000005.1 GCA030825475_00245 CDS open 7390-7929 _na     179_aa putative membrane protein
657 JAPJPW010000005.1 GCA030825475_00246 CDS open 7972-8391 _na     139_aa putative DNA-binding protein with PD1-like DNA-binding motif
658 JAPJPW010000005.1 GCA030825475_00247 CDS open 8399-9031 _na     210_aa CpXC domain-containing protein
659 JAPJPW010000005.1 GCA030825475_00248 CDS open 9099-10385 _na     428_aa hemZ coproporphyrinogen dehydrogenase HemZ
660 JAPJPW010000005.1 GCA030825475_00249 CDS open 10464-16322 _na     1952_aa PII-type proteinase
661 JAPJPW010000005.1 GCA030825475_00250 CDS open 16344-16868 _na     174_aa hypothetical protein
662 JAPJPW010000005.1 GCA030825475_00251 CDS open 18926-19786 _na     286_aa Peptidase C39-like domain-containing protein
663 JAPJPW010000005.1 GCA030825475_00252 CDS open 19967-21379 _na     470_aa Cytosol non-specific dipeptidase
664 JAPJPW010000005.1 GCA030825475_00253 CDS open 21522-21788 _na     88_aa Phosphocarrier protein HPr
665 JAPJPW010000005.1 GCA030825475_00254 CDS open 21928-22659 _na     243_aa sufC Fe-S cluster assembly ATPase SufC
666 JAPJPW010000005.1 GCA030825475_00255 CDS open 22663-24075 _na     470_aa sufB Fe-S cluster assembly protein SufB
667 JAPJPW010000005.1 GCA030825475_00256 CDS open 24075-25115 _na     346_aa sufD SufD family Fe-S cluster assembly protein
668 JAPJPW010000005.1 GCA030825475_00257 CDS open 25117-26337 _na     406_aa Cysteine desulfurase
669 JAPJPW010000005.1 GCA030825475_00258 CDS open 26339-26758 _na     139_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
670 JAPJPW010000005.1 GCA030825475_00259 CDS open 27237-28469 _na     410_aa arcA arginine deiminase
671 JAPJPW010000005.1 GCA030825475_00260 CDS open 29368-31881 _na     837_aa Heat shock protein F84-1
672 JAPJPW010000005.1 GCA030825475_00261 CDS open 31884-33056 _na     390_aa Arginine dihydrolase ArgZ/ArgE-like C-terminal second subdomain domain-containing protein
673 JAPJPW010000005.1 GCA030825475_00262 CDS open 33058-34152 _na     364_aa putative conserved protein
674 JAPJPW010000005.1 GCA030825475_00263 CDS open 34457-35332 _na     291_aa larE ATP-dependent sacrificial sulfur transferase LarE
675 JAPJPW010000005.1 GCA030825475_00264 CDS open 35322-36068 _na     248_aa larB nickel pincer cofactor biosynthesis protein LarB
676 JAPJPW010000005.1 GCA030825475_00265 CDS open 36069-36908 _na     279_aa larC LarC family nickel insertion protein
677 JAPJPW010000005.1 GCA030825475_00266 CDS open 36974-37327 _na     117_aa DUF111 domain-containing protein
678 JAPJPW010000005.1 GCA030825475_00267 CDS open 37335-38570 _na     411_aa Ferrichrome/ferrioxamine B periplasmic transporter
679 JAPJPW010000005.1 GCA030825475_00268 CDS open 38563-39531 _na     322_aa putative ABC transporter permease protein HI_1471
680 JAPJPW010000005.1 GCA030825475_00269 CDS open 39518-40255 _na     245_aa ABC transporter ATP-binding protein
681 JAPJPW010000005.1 GCA030825475_00270 CDS open 40318-41259 _na     313_aa Aromatic amino acid exporter
682 JAPJPW010000005.1 GCA030825475_00271 CDS open 41383-42384 _na     333_aa Degradation activator
683 JAPJPW010000005.1 GCA030825475_00272 CDS open 42371-43282 _na     303_aa Ribokinase
684 JAPJPW010000005.1 GCA030825475_00273 CDS open 43261-43653 _na     130_aa rbsD D-ribose pyranase
685 JAPJPW010000005.1 GCA030825475_00274 CDS open 43662-45182 _na     506_aa ccmA heme ABC exporter ATP-binding protein CcmA
686 JAPJPW010000005.1 GCA030825475_00275 CDS open 45140-46084 _na     314_aa rbsC Ribose transport system permease protein rbsC
687 JAPJPW010000005.1 GCA030825475_00276 CDS open 46094-47038 _na     314_aa D-ribose-binding periplasmic protein
688 JAPJPW010000005.1 GCA030825475_00277 CDS open 47110-47370 _na     86_aa Glutaredoxin-related protein
689 JAPJPW010000005.1 GCA030825475_00278 CDS open 47370-47879 _na     169_aa dihydrofolate reductase
690 JAPJPW010000005.1 GCA030825475_00279 CDS open 47914-49041 _na     375_aa nagA N-acetylglucosamine-6-phosphate deacetylase
691 JAPJPW010000005.1 GCA030825475_00280 CDS open 49068-49709 _na     213_aa yitT YitT family protein
692 JAPJPW010000005.1 GCA030825475_00281 CDS open 49857-51722 _na     621_aa PRD domain-containing protein
693 JAPJPW010000005.1 GCA030825475_00282 CDS open 51731-52183 _na     150_aa gutM transcriptional regulator GutM
694 JAPJPW010000005.1 GCA030825475_00283 CDS open 52199-52750 _na     183_aa PTS glucitol/sorbitol transporter subunit IIC
695 JAPJPW010000005.1 GCA030825475_00284 CDS open 52752-53798 _na     348_aa Glucitol/sorbitol-specific phosphotransferase enzyme IIB component
696 JAPJPW010000005.1 GCA030825475_00285 CDS open 53822-54184 _na     120_aa PTS system glucitol/sorbitol-specific transporter subunit IIA
697 JAPJPW010000005.1 GCA030825475_00286 CDS open 54187-54999 _na     270_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG
698 JAPJPW010000005.1 GCA030825475_00287 CDS open 55001-55681 _na     226_aa Fructose-6-phosphate aldolase 1
699 JAPJPW010000005.1 GCA030825475_00238 gene open 746-1600 rihB
700 JAPJPW010000005.1 GCA030825475_00239 gene open 1576-2106
701 JAPJPW010000005.1 GCA030825475_00240 gene open 2164-3174
702 JAPJPW010000005.1 GCA030825475_00241 gene open 3280-3939
703 JAPJPW010000005.1 GCA030825475_00242 gene open 4064-5080
704 JAPJPW010000005.1 GCA030825475_00243 gene open 5114-6640 clcA
705 JAPJPW010000005.1 GCA030825475_00244 gene open 6660-7322
706 JAPJPW010000005.1 GCA030825475_00245 gene open 7390-7929
707 JAPJPW010000005.1 GCA030825475_00246 gene open 7972-8391
708 JAPJPW010000005.1 GCA030825475_00247 gene open 8399-9031
709 JAPJPW010000005.1 GCA030825475_00248 gene open 9099-10385 hemZ
710 JAPJPW010000005.1 GCA030825475_00249 gene open 10464-16322
711 JAPJPW010000005.1 GCA030825475_00250 gene open 16344-16868
712 JAPJPW010000005.1 GCA030825475_00251 gene open 18926-19786
713 JAPJPW010000005.1 GCA030825475_00252 gene open 19967-21379
714 JAPJPW010000005.1 GCA030825475_00253 gene open 21522-21788
715 JAPJPW010000005.1 GCA030825475_00254 gene open 21928-22659 sufC
716 JAPJPW010000005.1 GCA030825475_00255 gene open 22663-24075 sufB
717 JAPJPW010000005.1 GCA030825475_00256 gene open 24075-25115 sufD
718 JAPJPW010000005.1 GCA030825475_00257 gene open 25117-26337
719 JAPJPW010000005.1 GCA030825475_00258 gene open 26339-26758 sufU
720 JAPJPW010000005.1 GCA030825475_00259 gene open 27237-28469 arcA
721 JAPJPW010000005.1 GCA030825475_00260 gene open 29368-31881
722 JAPJPW010000005.1 GCA030825475_00261 gene open 31884-33056
723 JAPJPW010000005.1 GCA030825475_00262 gene open 33058-34152
724 JAPJPW010000005.1 GCA030825475_00263 gene open 34457-35332 larE
725 JAPJPW010000005.1 GCA030825475_00264 gene open 35322-36068 larB
726 JAPJPW010000005.1 GCA030825475_00265 gene open 36069-36908 larC
727 JAPJPW010000005.1 GCA030825475_00266 gene open 36974-37327
728 JAPJPW010000005.1 GCA030825475_00267 gene open 37335-38570
729 JAPJPW010000005.1 GCA030825475_00268 gene open 38563-39531
730 JAPJPW010000005.1 GCA030825475_00269 gene open 39518-40255
731 JAPJPW010000005.1 GCA030825475_00270 gene open 40318-41259
732 JAPJPW010000005.1 GCA030825475_00271 gene open 41383-42384
733 JAPJPW010000005.1 GCA030825475_00272 gene open 42371-43282
734 JAPJPW010000005.1 GCA030825475_00273 gene open 43261-43653 rbsD
735 JAPJPW010000005.1 GCA030825475_00274 gene open 43662-45182 ccmA
736 JAPJPW010000005.1 GCA030825475_00275 gene open 45140-46084 rbsC
737 JAPJPW010000005.1 GCA030825475_00276 gene open 46094-47038
738 JAPJPW010000005.1 GCA030825475_00277 gene open 47110-47370
739 JAPJPW010000005.1 GCA030825475_00278 gene open 47370-47879
740 JAPJPW010000005.1 GCA030825475_00279 gene open 47914-49041 nagA
741 JAPJPW010000005.1 GCA030825475_00280 gene open 49068-49709 yitT
742 JAPJPW010000005.1 GCA030825475_00281 gene open 49857-51722
743 JAPJPW010000005.1 GCA030825475_00282 gene open 51731-52183 gutM
744 JAPJPW010000005.1 GCA030825475_00283 gene open 52199-52750
745 JAPJPW010000005.1 GCA030825475_00284 gene open 52752-53798
746 JAPJPW010000005.1 GCA030825475_00285 gene open 53822-54184
747 JAPJPW010000005.1 GCA030825475_00286 gene open 54187-54999 fabG
748 JAPJPW010000005.1 GCA030825475_00287 gene open 55001-55681
749 JAPJPW010000006.1 regulatory_region open 32330-32425 TPP riboswitch aptamer (THI element)
750 JAPJPW010000006.1 GCA030825475_00291 CDS open 89-1396 _na     435_aa brnQ branched-chain amino acid transport system II carrier protein
751 JAPJPW010000006.1 GCA030825475_00292 CDS open 1633-2313 _na     226_aa DUF6873 domain-containing protein
752 JAPJPW010000006.1 GCA030825475_00295 CDS open 2899-3528 _na     209_aa yxeO putative amino-acid import ATP-binding protein YxeO
753 JAPJPW010000006.1 GCA030825475_00296 CDS open 3521-4312 _na     263_aa ABC-type putative transport system%2C permease component
754 JAPJPW010000006.1 GCA030825475_00297 CDS open 4479-6368 _na     629_aa msbA Lipid A export ATP-binding/permease protein MsbA
755 JAPJPW010000006.1 GCA030825475_00298 CDS open 6361-8121 _na     586_aa Multidrug export ATP-binding/permease protein SAV1866
756 JAPJPW010000006.1 GCA030825475_00299 CDS open 8118-8561 _na     147_aa marR MarR family transcriptional regulator
757 JAPJPW010000006.1 GCA030825475_00300 CDS open 8669-9574 _na     301_aa AAA ATPase containing von Willebrand factor type A (VWA) domain
758 JAPJPW010000006.1 GCA030825475_00301 CDS open 9567-11288 _na     573_aa Nitric oxide reductase activation protein
759 JAPJPW010000006.1 GCA030825475_00302 CDS open 11396-12043 _na     215_aa Fluoroquinolones export ATP-binding protein Rv2688c/MT2762
760 JAPJPW010000006.1 GCA030825475_00303 CDS open 12024-12821 _na     265_aa ABC-2 family transporter protein
761 JAPJPW010000006.1 GCA030825475_00304 CDS open 12805-13557 _na     250_aa ABC-2 family transporter protein
762 JAPJPW010000006.1 GCA030825475_00305 CDS open 13919-15550 _na     543_aa murJ murein biosynthesis integral membrane protein MurJ
763 JAPJPW010000006.1 GCA030825475_00306 CDS open 15609-16169 _na     186_aa ssuB Aliphatic sulfonates import ATP-binding protein SsuB
764 JAPJPW010000006.1 GCA030825475_00307 CDS open 16162-16905 _na     247_aa cmpB Bicarbonate transport system permease protein CmpB
765 JAPJPW010000006.1 GCA030825475_00308 CDS open 16883-17959 _na     358_aa ABC-type taurine transport system%2C periplasmic component
766 JAPJPW010000006.1 GCA030825475_00309 CDS open 17979-19502 _na     507_aa Iron hydrogenase 1
767 JAPJPW010000006.1 GCA030825475_00310 CDS open 19499-19792 _na     97_aa hypothetical protein
768 JAPJPW010000006.1 GCA030825475_00311 CDS open 19866-21518 _na     550_aa histidine kinase
769 JAPJPW010000006.1 GCA030825475_00312 CDS open 21515-22174 _na     219_aa DNA-binding response regulator
770 JAPJPW010000006.1 GCA030825475_00313 CDS open 22177-22794 _na     205_aa Phosphate transport system phoU-like protein
771 JAPJPW010000006.1 GCA030825475_00314 CDS open 22796-23761 _na     321_aa pstB phosphate ABC transporter ATP-binding protein PstB
772 JAPJPW010000006.1 GCA030825475_00315 CDS open 23774-24586 _na     270_aa pstA phosphate ABC transporter permease PstA
773 JAPJPW010000006.1 GCA030825475_00316 CDS open 24606-25466 _na     286_aa pstC phosphate ABC transporter permease subunit PstC
774 JAPJPW010000006.1 GCA030825475_00317 CDS open 25471-26490 _na     339_aa Phosphate ABC transporter substrate-binding protein
775 JAPJPW010000006.1 GCA030825475_00318 CDS open 26649-28004 _na     451_aa ygfU Purine permease ygfU
776 JAPJPW010000006.1 GCA030825475_00319 CDS open 28225-29238 _na     337_aa asnA aspartate--ammonia ligase
777 JAPJPW010000006.1 GCA030825475_00320 CDS open 29268-30005 _na     245_aa cmpC Bicarbonate transport ATP-binding protein CmpC
778 JAPJPW010000006.1 GCA030825475_00321 CDS open 30002-31096 _na     364_aa Nitrate ABC transporter substrate-binding protein
779 JAPJPW010000006.1 GCA030825475_00322 CDS open 31100-31891 _na     263_aa ssuC Aliphatic sulfonates transport permease protein ssuC
780 JAPJPW010000006.1 GCA030825475_00323 CDS open 31842-32135 _na     97_aa putative conserved protein
781 JAPJPW010000006.1 GCA030825475_00324 CDS open 32463-34265 _na     600_aa recQ DNA helicase RecQ
782 JAPJPW010000006.1 GCA030825475_00325 CDS open 34303-35493 _na     396_aa DUF4097 domain-containing protein
783 JAPJPW010000006.1 GCA030825475_00326 CDS open 35483-35914 _na     143_aa hypothetical protein
784 JAPJPW010000006.1 GCA030825475_00327 CDS open 35907-36650 _na     247_aa truA tRNA pseudouridine(38-40) synthase TruA
785 JAPJPW010000006.1 GCA030825475_00328 CDS open 36647-37441 _na     264_aa Transporter
786 JAPJPW010000006.1 GCA030825475_00329 CDS open 37434-38291 _na     285_aa energy-coupling factor transporter ATPase
787 JAPJPW010000006.1 GCA030825475_00330 CDS open 38288-39109 _na     273_aa energy-coupling factor transporter ATPase
788 JAPJPW010000006.1 GCA030825475_00331 CDS open 39118-40536 _na     472_aa putative vancomycin resistance protein
789 JAPJPW010000006.1 GCA030825475_00332 CDS open 40533-41672 _na     379_aa Ribosomal RNA large subunit methyltransferase L
790 JAPJPW010000006.1 GCA030825475_00333 CDS open 41755-42576 _na     273_aa putative dienelactone hydrolase
791 JAPJPW010000006.1 GCA030825475_00334 CDS open 42578-43957 _na     459_aa Dihydrolipoamide dehydrogenase
792 JAPJPW010000006.1 GCA030825475_00335 CDS open 44024-44569 _na     181_aa UPF0340 protein CYJ34_00395
793 JAPJPW010000006.1 GCA030825475_00336 CDS open 44777-45679 _na     300_aa DNA-(apurinic or apyrimidinic site) lyase
794 JAPJPW010000006.1 GCA030825475_00337 CDS open 45679-46458 _na     259_aa srtB class B sortase
795 JAPJPW010000006.1 GCA030825475_00338 CDS open 46542-46775 _na     77_aa Glutaredoxin 2
796 JAPJPW010000006.1 GCA030825475_00339 CDS open 46825-47646 _na     273_aa Cof-type HAD-IIB family hydrolase
797 JAPJPW010000006.1 GCA030825475_00340 CDS open 47679-47951 _na     90_aa hypothetical protein
798 JAPJPW010000006.1 GCA030825475_00341 CDS open 48036-48743 _na     235_aa Aldose 1-epimerase
799 JAPJPW010000006.1 GCA030825475_00342 CDS open 48740-49249 _na     169_aa Ferritin
800 JAPJPW010000006.1 GCA030825475_00343 CDS open 49242-49550 _na     102_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
801 JAPJPW010000006.1 GCA030825475_00344 CDS open 49612-50262 _na     216_aa queH Epoxyqueuosine reductase QueH
802 JAPJPW010000006.1 GCA030825475_00345 CDS open 50337-50729 _na     130_aa rpsI 30S ribosomal protein S9
803 JAPJPW010000006.1 GCA030825475_00346 CDS open 50740-51180 _na     146_aa rplM 50S ribosomal protein L13
804 JAPJPW010000006.1 GCA030825475_00291 gene open 89-1396 brnQ
805 JAPJPW010000006.1 GCA030825475_00292 gene open 1633-2313
806 JAPJPW010000006.1 GCA030825475_00295 gene open 2899-3528 yxeO
807 JAPJPW010000006.1 GCA030825475_00296 gene open 3521-4312
808 JAPJPW010000006.1 GCA030825475_00297 gene open 4479-6368 msbA
809 JAPJPW010000006.1 GCA030825475_00298 gene open 6361-8121
810 JAPJPW010000006.1 GCA030825475_00299 gene open 8118-8561 marR
811 JAPJPW010000006.1 GCA030825475_00300 gene open 8669-9574
812 JAPJPW010000006.1 GCA030825475_00301 gene open 9567-11288
813 JAPJPW010000006.1 GCA030825475_00302 gene open 11396-12043
814 JAPJPW010000006.1 GCA030825475_00303 gene open 12024-12821
815 JAPJPW010000006.1 GCA030825475_00304 gene open 12805-13557
816 JAPJPW010000006.1 GCA030825475_00305 gene open 13919-15550 murJ
817 JAPJPW010000006.1 GCA030825475_00306 gene open 15609-16169 ssuB
818 JAPJPW010000006.1 GCA030825475_00307 gene open 16162-16905 cmpB
819 JAPJPW010000006.1 GCA030825475_00308 gene open 16883-17959
820 JAPJPW010000006.1 GCA030825475_00309 gene open 17979-19502
821 JAPJPW010000006.1 GCA030825475_00310 gene open 19499-19792
822 JAPJPW010000006.1 GCA030825475_00311 gene open 19866-21518
823 JAPJPW010000006.1 GCA030825475_00312 gene open 21515-22174
824 JAPJPW010000006.1 GCA030825475_00313 gene open 22177-22794
825 JAPJPW010000006.1 GCA030825475_00314 gene open 22796-23761 pstB
826 JAPJPW010000006.1 GCA030825475_00315 gene open 23774-24586 pstA
827 JAPJPW010000006.1 GCA030825475_00316 gene open 24606-25466 pstC
828 JAPJPW010000006.1 GCA030825475_00317 gene open 25471-26490
829 JAPJPW010000006.1 GCA030825475_00318 gene open 26649-28004 ygfU
830 JAPJPW010000006.1 GCA030825475_00319 gene open 28225-29238 asnA
831 JAPJPW010000006.1 GCA030825475_00320 gene open 29268-30005 cmpC
832 JAPJPW010000006.1 GCA030825475_00321 gene open 30002-31096
833 JAPJPW010000006.1 GCA030825475_00322 gene open 31100-31891 ssuC
834 JAPJPW010000006.1 GCA030825475_00323 gene open 31842-32135
835 JAPJPW010000006.1 GCA030825475_00324 gene open 32463-34265 recQ
836 JAPJPW010000006.1 GCA030825475_00325 gene open 34303-35493
837 JAPJPW010000006.1 GCA030825475_00326 gene open 35483-35914
838 JAPJPW010000006.1 GCA030825475_00327 gene open 35907-36650 truA
839 JAPJPW010000006.1 GCA030825475_00328 gene open 36647-37441
840 JAPJPW010000006.1 GCA030825475_00329 gene open 37434-38291
841 JAPJPW010000006.1 GCA030825475_00330 gene open 38288-39109
842 JAPJPW010000006.1 GCA030825475_00331 gene open 39118-40536
843 JAPJPW010000006.1 GCA030825475_00332 gene open 40533-41672
844 JAPJPW010000006.1 GCA030825475_00333 gene open 41755-42576
845 JAPJPW010000006.1 GCA030825475_00334 gene open 42578-43957
846 JAPJPW010000006.1 GCA030825475_00335 gene open 44024-44569
847 JAPJPW010000006.1 GCA030825475_00336 gene open 44777-45679
848 JAPJPW010000006.1 GCA030825475_00337 gene open 45679-46458 srtB
849 JAPJPW010000006.1 GCA030825475_00338 gene open 46542-46775
850 JAPJPW010000006.1 GCA030825475_00339 gene open 46825-47646
851 JAPJPW010000006.1 GCA030825475_00340 gene open 47679-47951
852 JAPJPW010000006.1 GCA030825475_00341 gene open 48036-48743
853 JAPJPW010000006.1 GCA030825475_00342 gene open 48740-49249
854 JAPJPW010000006.1 GCA030825475_00343 gene open 49242-49550
855 JAPJPW010000006.1 GCA030825475_00344 gene open 49612-50262 queH
856 JAPJPW010000006.1 GCA030825475_00345 gene open 50337-50729 rpsI
857 JAPJPW010000006.1 GCA030825475_00346 gene open 50740-51180 rplM
858 JAPJPW010000006.1 GCA030825475_00293 gene open 2361-2434 trnC
859 JAPJPW010000006.1 GCA030825475_00294 gene open 2627-2701 trnG
860 JAPJPW010000006.1 GCA030825475_00293 tRNA open 2361-2434 trnC tRNA-Cys(gca)
861 JAPJPW010000006.1 GCA030825475_00294 tRNA open 2627-2701 trnG tRNA-Gly(gcc)
862 JAPJPW010000007.1 GCA030825475_00356 CDS open 564-3092 _na     842_aa ribonucleoside-diphosphate reductase subunit alpha
863 JAPJPW010000007.1 GCA030825475_00357 CDS open 3300-3773 _na     157_aa RDD family
864 JAPJPW010000007.1 GCA030825475_00358 CDS open 3748-4755 _na     335_aa Protease 4
865 JAPJPW010000007.1 GCA030825475_00359 CDS open 4974-6983 _na     669_aa ftsH ATP-dependent zinc metalloprotease FtsH
866 JAPJPW010000007.1 GCA030825475_00360 CDS open 6984-7454 _na     156_aa marR MarR family transcriptional regulator
867 JAPJPW010000007.1 GCA030825475_00361 CDS open 7580-8464 _na     294_aa Thioredoxin reductase
868 JAPJPW010000007.1 GCA030825475_00362 CDS open 8464-8772 _na     102_aa trxA thioredoxin
869 JAPJPW010000007.1 GCA030825475_00363 CDS open 8864-8998 _na     44_aa hypothetical protein
870 JAPJPW010000007.1 GCA030825475_00364 CDS open 9033-9461 _na     142_aa transcriptional regulator
871 JAPJPW010000007.1 GCA030825475_00365 CDS open 9461-9862 _na     133_aa DUF1538 domain-containing protein
872 JAPJPW010000007.1 GCA030825475_00366 CDS open 9874-10359 _na     161_aa DUF1538 domain-containing protein
873 JAPJPW010000007.1 GCA030825475_00367 CDS open 10572-10811 _na     79_aa hypothetical protein
874 JAPJPW010000007.1 GCA030825475_00368 CDS open 10906-11904 _na     332_aa pta phosphate acetyltransferase
875 JAPJPW010000007.1 GCA030825475_00369 CDS open 12039-12512 _na     157_aa DUF4446 domain-containing protein
876 JAPJPW010000007.1 GCA030825475_00370 CDS open 12512-13069 _na     185_aa Cyclodeaminase/cyclohydrolase domain-containing protein
877 JAPJPW010000007.1 GCA030825475_00371 CDS open 13044-14027 _na     327_aa parB putative chromosome-partitioning protein parB
878 JAPJPW010000007.1 GCA030825475_00372 CDS open 14028-14996 _na     322_aa Sporulation initiation inhibitor protein soj
879 JAPJPW010000007.1 GCA030825475_00373 CDS open 14974-16194 _na     406_aa Putative competence-damage inducible protein
880 JAPJPW010000007.1 GCA030825475_00374 CDS open 16209-17039 _na     276_aa Exosortase E/protease%2C VPEID-CTERM system
881 JAPJPW010000007.1 GCA030825475_00375 CDS open 17138-17761 _na     207_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
882 JAPJPW010000007.1 GCA030825475_00376 CDS open 17769-19667 _na     632_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
883 JAPJPW010000007.1 GCA030825475_00377 CDS open 19657-21024 _na     455_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
884 JAPJPW010000007.1 GCA030825475_00378 CDS open 21187-21639 _na     150_aa OsmC-like protein
885 JAPJPW010000007.1 GCA030825475_00379 CDS open 21611-22807 _na     398_aa 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
886 JAPJPW010000007.1 GCA030825475_00380 CDS open 22797-23624 _na     275_aa phnD Phosphate-import protein phnD
887 JAPJPW010000007.1 GCA030825475_00381 CDS open 23662-24792 _na     376_aa Crotonobetainyl-CoA dehydrogenase
888 JAPJPW010000007.1 GCA030825475_00382 CDS open 24972-26276 _na     434_aa jag RNA-binding cell elongation regulator Jag/EloR
889 JAPJPW010000007.1 GCA030825475_00383 CDS open 26242-27000 _na     252_aa Oxa1Ec
890 JAPJPW010000007.1 GCA030825475_00384 CDS open 27253-27603 _na     116_aa rnpA ribonuclease P protein component
891 JAPJPW010000007.1 GCA030825475_00385 CDS open 27662-27796 _na     44_aa rpmH 50S ribosomal protein L34
892 JAPJPW010000007.1 GCA030825475_00386 CDS open 28489-29889 _na     466_aa dnaA chromosomal replication initiator protein DnaA
893 JAPJPW010000007.1 GCA030825475_00387 CDS open 30113-31225 _na     370_aa dnaN DNA polymerase III subunit beta
894 JAPJPW010000007.1 GCA030825475_00388 CDS open 31241-31447 _na     68_aa putative conserved protein
895 JAPJPW010000007.1 GCA030825475_00389 CDS open 31447-34443 _na     998_aa hypothetical protein
896 JAPJPW010000007.1 GCA030825475_00390 CDS open 34452-36917 _na     821_aa gyrA DNA gyrase subunit A
897 JAPJPW010000007.1 GCA030825475_00391 CDS open 36907-37209 _na     100_aa Anti-sigma factor antagonist
898 JAPJPW010000007.1 GCA030825475_00392 CDS open 37213-37548 _na     111_aa rsbW Serine-protein kinase RsbW
899 JAPJPW010000007.1 GCA030825475_00393 CDS open 37548-38336 _na     262_aa Sigma-37
900 JAPJPW010000007.1 GCA030825475_00394 CDS open 38484-39956 _na     490_aa aldA Aldehyde dehydrogenase AldA
901 JAPJPW010000007.1 GCA030825475_00395 CDS open 39953-40378 _na     141_aa type II toxin-antitoxin system death-on-curing family toxin
902 JAPJPW010000007.1 GCA030825475_00396 CDS open 40351-40617 _na     88_aa type II toxin-antitoxin system Phd/YefM family antitoxin
903 JAPJPW010000007.1 GCA030825475_00397 CDS open 40722-43490 _na     922_aa DNA methyltransferase
904 JAPJPW010000007.1 GCA030825475_00398 CDS open 43534-44202 _na     222_aa deoxynucleoside kinase
905 JAPJPW010000007.1 GCA030825475_00399 CDS open 45150-46121 _na     323_aa Lipoprotein
906 JAPJPW010000007.1 GCA030825475_00400 CDS open 46349-48379 _na     676_aa Toxin A
907 JAPJPW010000007.1 GCA030825475_00356 gene open 564-3092
908 JAPJPW010000007.1 GCA030825475_00357 gene open 3300-3773
909 JAPJPW010000007.1 GCA030825475_00358 gene open 3748-4755
910 JAPJPW010000007.1 GCA030825475_00359 gene open 4974-6983 ftsH
911 JAPJPW010000007.1 GCA030825475_00360 gene open 6984-7454 marR
912 JAPJPW010000007.1 GCA030825475_00361 gene open 7580-8464
913 JAPJPW010000007.1 GCA030825475_00362 gene open 8464-8772 trxA
914 JAPJPW010000007.1 GCA030825475_00363 gene open 8864-8998
915 JAPJPW010000007.1 GCA030825475_00364 gene open 9033-9461
916 JAPJPW010000007.1 GCA030825475_00365 gene open 9461-9862
917 JAPJPW010000007.1 GCA030825475_00366 gene open 9874-10359
918 JAPJPW010000007.1 GCA030825475_00367 gene open 10572-10811
919 JAPJPW010000007.1 GCA030825475_00368 gene open 10906-11904 pta
920 JAPJPW010000007.1 GCA030825475_00369 gene open 12039-12512
921 JAPJPW010000007.1 GCA030825475_00370 gene open 12512-13069
922 JAPJPW010000007.1 GCA030825475_00371 gene open 13044-14027 parB
923 JAPJPW010000007.1 GCA030825475_00372 gene open 14028-14996
924 JAPJPW010000007.1 GCA030825475_00373 gene open 14974-16194
925 JAPJPW010000007.1 GCA030825475_00374 gene open 16209-17039
926 JAPJPW010000007.1 GCA030825475_00375 gene open 17138-17761 rsmG
927 JAPJPW010000007.1 GCA030825475_00376 gene open 17769-19667 mnmG
928 JAPJPW010000007.1 GCA030825475_00377 gene open 19657-21024 mnmE
929 JAPJPW010000007.1 GCA030825475_00378 gene open 21187-21639
930 JAPJPW010000007.1 GCA030825475_00379 gene open 21611-22807
931 JAPJPW010000007.1 GCA030825475_00380 gene open 22797-23624 phnD
932 JAPJPW010000007.1 GCA030825475_00381 gene open 23662-24792
933 JAPJPW010000007.1 GCA030825475_00382 gene open 24972-26276 jag
934 JAPJPW010000007.1 GCA030825475_00383 gene open 26242-27000
935 JAPJPW010000007.1 GCA030825475_00384 gene open 27253-27603 rnpA
936 JAPJPW010000007.1 GCA030825475_00385 gene open 27662-27796 rpmH
937 JAPJPW010000007.1 GCA030825475_00386 gene open 28489-29889 dnaA
938 JAPJPW010000007.1 GCA030825475_00387 gene open 30113-31225 dnaN
939 JAPJPW010000007.1 GCA030825475_00388 gene open 31241-31447
940 JAPJPW010000007.1 GCA030825475_00389 gene open 31447-34443
941 JAPJPW010000007.1 GCA030825475_00390 gene open 34452-36917 gyrA
942 JAPJPW010000007.1 GCA030825475_00391 gene open 36907-37209
943 JAPJPW010000007.1 GCA030825475_00392 gene open 37213-37548 rsbW
944 JAPJPW010000007.1 GCA030825475_00393 gene open 37548-38336
945 JAPJPW010000007.1 GCA030825475_00394 gene open 38484-39956 aldA
946 JAPJPW010000007.1 GCA030825475_00395 gene open 39953-40378
947 JAPJPW010000007.1 GCA030825475_00396 gene open 40351-40617
948 JAPJPW010000007.1 GCA030825475_00397 gene open 40722-43490
949 JAPJPW010000007.1 GCA030825475_00398 gene open 43534-44202
950 JAPJPW010000007.1 GCA030825475_00399 gene open 45150-46121
951 JAPJPW010000007.1 GCA030825475_00400 gene open 46349-48379
952 JAPJPW010000008.1 regulatory_region open 42129-42357 T-box leader
953 JAPJPW010000008.1 GCA030825475_00405 CDS open 1-1002 _na     333_aa ornithine cyclodeaminase family protein
954 JAPJPW010000008.1 GCA030825475_00406 CDS open 1255-1437 _na     60_aa hypothetical protein
955 JAPJPW010000008.1 GCA030825475_00407 CDS open 1534-1707 _na     57_aa hypothetical protein
956 JAPJPW010000008.1 GCA030825475_00408 CDS open 1782-1943 _na     53_aa hypothetical protein
957 JAPJPW010000008.1 GCA030825475_00409 CDS open 1982-2626 _na     214_aa PepSY domain-containing protein
958 JAPJPW010000008.1 GCA030825475_00410 CDS open 2714-3103 _na     129_aa phosphoenolpyruvate--glycerone phosphotransferase
959 JAPJPW010000008.1 GCA030825475_00411 CDS open 3096-3695 _na     199_aa dhaL dihydroxyacetone kinase subunit DhaL
960 JAPJPW010000008.1 GCA030825475_00412 CDS open 3703-4680 _na     325_aa dhaK dihydroxyacetone kinase subunit DhaK
961 JAPJPW010000008.1 GCA030825475_00413 CDS open 4893-7067 _na     724_aa uvrB excinuclease ABC subunit UvrB
962 JAPJPW010000008.1 GCA030825475_00414 CDS open 7060-9690 _na     876_aa uvrA excinuclease ABC subunit UvrA
963 JAPJPW010000008.1 GCA030825475_00415 CDS open 9700-9990 _na     96_aa hypothetical protein
964 JAPJPW010000008.1 GCA030825475_00416 CDS open 10125-11015 _na     296_aa lptB Lipopolysaccharide export system ATP-binding protein LptB
965 JAPJPW010000008.1 GCA030825475_00417 CDS open 11008-12177 _na     389_aa ABC transporter permease
966 JAPJPW010000008.1 GCA030825475_00418 CDS open 12254-13174 _na     306_aa XRE family transcriptional regulator
967 JAPJPW010000008.1 GCA030825475_00419 CDS open 13377-14456 _na     359_aa Lipoprotein
968 JAPJPW010000008.1 GCA030825475_00420 CDS open 14456-15229 _na     257_aa hypothetical protein
969 JAPJPW010000008.1 GCA030825475_00421 CDS open 15374-16219 _na     281_aa DNA-directed RNA polymerase subunit delta
970 JAPJPW010000008.1 GCA030825475_00422 CDS open 16222-16773 _na     183_aa ECF-type riboflavin transporter substrate-binding protein
971 JAPJPW010000008.1 GCA030825475_00423 CDS open 16777-18498 _na     573_aa energy-coupling factor transporter ATPase
972 JAPJPW010000008.1 GCA030825475_00424 CDS open 18480-19307 _na     275_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
973 JAPJPW010000008.1 GCA030825475_00425 CDS open 19476-21344 _na     622_aa hypothetical protein
974 JAPJPW010000008.1 GCA030825475_00426 CDS open 22145-22582 _na     145_aa sortase
975 JAPJPW010000008.1 GCA030825475_00427 CDS open 22850-23773 _na     307_aa hypothetical protein
976 JAPJPW010000008.1 GCA030825475_00428 CDS open 23755-24087 _na     110_aa hypothetical protein
977 JAPJPW010000008.1 GCA030825475_00429 CDS open 24688-26319 _na     543_aa inlB InlB B-repeat-containing protein
978 JAPJPW010000008.1 GCA030825475_00430 CDS open 26484-27092 _na     202_aa hypothetical protein
979 JAPJPW010000008.1 GCA030825475_00431 CDS open 27093-27401 _na     102_aa hypothetical protein
980 JAPJPW010000008.1 GCA030825475_00432 CDS open 27358-27600 _na     80_aa hypothetical protein
981 JAPJPW010000008.1 GCA030825475_00433 CDS open 27566-28171 _na     201_aa lepB signal peptidase I
982 JAPJPW010000008.1 GCA030825475_00434 CDS open 28208-29260 _na     350_aa Pilus backbone structural protein
983 JAPJPW010000008.1 GCA030825475_00435 CDS open 29439-30080 _na     213_aa srtB class B sortase
984 JAPJPW010000008.1 GCA030825475_00436 CDS open 30080-30853 _na     257_aa Streptococcal pilin isopeptide linker domain-containing protein
985 JAPJPW010000008.1 GCA030825475_00437 CDS open 31048-34065 _na     1005_aa GA module
986 JAPJPW010000008.1 GCA030825475_00438 CDS open 34052-34555 _na     167_aa Lipoprotein
987 JAPJPW010000008.1 GCA030825475_00439 CDS open 34652-35701 _na     349_aa GA module
988 JAPJPW010000008.1 GCA030825475_00440 CDS open 35727-36434 _na     235_aa hypothetical protein
989 JAPJPW010000008.1 GCA030825475_00441 CDS open 36550-37671 _na     373_aa Transglutaminase-like domain-containing protein
990 JAPJPW010000008.1 GCA030825475_00442 CDS open 37742-39247 _na     501_aa murJ murein biosynthesis integral membrane protein MurJ
991 JAPJPW010000008.1 GCA030825475_00443 CDS open 39232-39756 _na     174_aa hypothetical protein
992 JAPJPW010000008.1 GCA030825475_00444 CDS open 39765-40499 _na     244_aa tcyN L-cystine import ATP-binding protein TcyN
993 JAPJPW010000008.1 GCA030825475_00445 CDS open 40480-42072 _na     530_aa yecS Inner membrane amino-acid ABC transporter permease protein yecS
994 JAPJPW010000008.1 GCA030825475_00446 CDS open 42426-42923 _na     165_aa niaR putative transcription repressor NiaR
995 JAPJPW010000008.1 GCA030825475_00447 CDS open 42994-44013 _na     339_aa PTS sugar transporter subunit IIC
996 JAPJPW010000008.1 GCA030825475_00448 CDS open 44127-44912 _na     261_aa Iron-sulfur cluster carrier protein
997 JAPJPW010000008.1 GCA030825475_00449 CDS open 44921-45904 _na     327_aa putative secreted protein
998 JAPJPW010000008.1 GCA030825475_00405 gene open 1-1002
999 JAPJPW010000008.1 GCA030825475_00406 gene open 1255-1437
1000 JAPJPW010000008.1 GCA030825475_00407 gene open 1534-1707