HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Schaalia dentiphila (GCA_031296675.1)

Select a Genome:
BAKTA Annotations for GCA_031296675.1
Genome Selected: Schaalia dentiphila
ContigsBases CDSrRNA tmRNAtRNA
22 2345519 1998 6 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4119 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4119 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JASPEY010000003.1 GCA031296675_00710 gene open 74571-77288 ppdK
1502 JASPEY010000003.1 GCA031296675_00711 gene open 77523-78848
1503 JASPEY010000003.1 GCA031296675_00712 gene open 78848-79720
1504 JASPEY010000003.1 GCA031296675_00713 gene open 79857-81389
1505 JASPEY010000003.1 GCA031296675_00714 gene open 81386-84061
1506 JASPEY010000003.1 GCA031296675_00715 gene open 84058-85284
1507 JASPEY010000003.1 GCA031296675_00716 gene open 85305-86270 mMP0363
1508 JASPEY010000003.1 GCA031296675_00717 gene open 86348-92209
1509 JASPEY010000003.1 GCA031296675_00718 gene open 92395-94863 clpC
1510 JASPEY010000003.1 GCA031296675_00719 gene open 95151-95678 dtd
1511 JASPEY010000003.1 GCA031296675_00720 gene open 95678-96847
1512 JASPEY010000003.1 GCA031296675_00721 gene open 96840-97499
1513 JASPEY010000003.1 GCA031296675_00722 gene open 97620-98540
1514 JASPEY010000003.1 GCA031296675_00723 gene open 98927-100207 purA
1515 JASPEY010000003.1 GCA031296675_00724 gene open 100304-100798
1516 JASPEY010000003.1 GCA031296675_00725 gene open 100884-101534
1517 JASPEY010000003.1 GCA031296675_00726 gene open 101531-101773
1518 JASPEY010000003.1 GCA031296675_00727 gene open 101909-102136
1519 JASPEY010000003.1 GCA031296675_00728 gene open 102173-103150 rlmB
1520 JASPEY010000003.1 GCA031296675_00729 gene open 103260-103802
1521 JASPEY010000003.1 GCA031296675_00730 gene open 104980-106437 cysS
1522 JASPEY010000003.1 GCA031296675_00731 gene open 106577-108034 thrC
1523 JASPEY010000003.1 GCA031296675_00732 gene open 108159-109649
1524 JASPEY010000003.1 GCA031296675_00733 gene open 109660-111213
1525 JASPEY010000003.1 GCA031296675_00734 gene open 111229-111720
1526 JASPEY010000003.1 GCA031296675_00735 gene open 111833-113182
1527 JASPEY010000003.1 GCA031296675_00736 gene open 113319-113639
1528 JASPEY010000003.1 GCA031296675_00737 gene open 113623-113928
1529 JASPEY010000003.1 GCA031296675_00738 gene open 113925-115115
1530 JASPEY010000003.1 GCA031296675_00739 gene open 115109-115888
1531 JASPEY010000003.1 GCA031296675_00740 gene open 115892-116716
1532 JASPEY010000003.1 GCA031296675_00741 gene open 116822-117610
1533 JASPEY010000003.1 GCA031296675_00742 gene open 117651-118367
1534 JASPEY010000003.1 GCA031296675_00743 gene open 118351-118869 cdnL
1535 JASPEY010000003.1 GCA031296675_00744 gene open 119144-119920 gpmA
1536 JASPEY010000003.1 GCA031296675_00745 gene open 120153-121364 ompA
1537 JASPEY010000003.1 GCA031296675_00746 gene open 121415-121879
1538 JASPEY010000003.1 GCA031296675_00747 gene open 121985-122314
1539 JASPEY010000003.1 GCA031296675_00748 gene open 122542-123003 mprA
1540 JASPEY010000003.1 GCA031296675_00749 gene open 122994-124241
1541 JASPEY010000003.1 GCA031296675_00750 gene open 124313-125515
1542 JASPEY010000003.1 GCA031296675_00751 gene open 125589-126632 hemH
1543 JASPEY010000003.1 GCA031296675_00752 gene open 126821-127291 dps
1544 JASPEY010000003.1 GCA031296675_00753 gene open 127747-129048
1545 JASPEY010000003.1 GCA031296675_00755 gene open 130826-132442
1546 JASPEY010000003.1 GCA031296675_00756 gene open 132479-133669
1547 JASPEY010000003.1 GCA031296675_00757 gene open 133669-134475 tmk
1548 JASPEY010000003.1 GCA031296675_00758 gene open 134475-137219 topA
1549 JASPEY010000003.1 GCA031296675_00759 gene open 137537-138562
1550 JASPEY010000003.1 GCA031296675_00760 gene open 138590-138859
1551 JASPEY010000003.1 GCA031296675_00761 gene open 139109-140818
1552 JASPEY010000003.1 GCA031296675_00762 gene open 140772-141029
1553 JASPEY010000003.1 GCA031296675_00763 gene open 141210-141506 yjdF
1554 JASPEY010000003.1 GCA031296675_00764 gene open 141782-143473 hemK
1555 JASPEY010000003.1 GCA031296675_00765 gene open 143552-144520
1556 JASPEY010000003.1 GCA031296675_00766 gene open 144683-145366
1557 JASPEY010000003.1 GCA031296675_00768 gene open 146313-148313
1558 JASPEY010000003.1 GCA031296675_00769 gene open 148683-150206
1559 JASPEY010000003.1 GCA031296675_00770 gene open 150345-151451
1560 JASPEY010000003.1 GCA031296675_00771 gene open 151451-151780 padR
1561 JASPEY010000003.1 GCA031296675_00772 gene open 151898-156466
1562 JASPEY010000003.1 GCA031296675_00773 gene open 156685-158655
1563 JASPEY010000003.1 GCA031296675_00774 gene open 158689-159489 modA
1564 JASPEY010000003.1 GCA031296675_00775 gene open 159832-160344
1565 JASPEY010000003.1 GCA031296675_00776 gene open 160539-162041
1566 JASPEY010000003.1 GCA031296675_00777 gene open 162154-164028
1567 JASPEY010000003.1 GCA031296675_00778 gene open 164104-164721
1568 JASPEY010000003.1 GCA031296675_00779 gene open 164727-165551 moeZ
1569 JASPEY010000003.1 GCA031296675_00780 gene open 165553-165972
1570 JASPEY010000003.1 GCA031296675_00781 gene open 166074-167069 lexA
1571 JASPEY010000003.1 GCA031296675_00782 gene open 167373-168149 narI
1572 JASPEY010000003.1 GCA031296675_00783 gene open 168155-168844 narJ
1573 JASPEY010000003.1 GCA031296675_00784 gene open 168841-170391 narH
1574 JASPEY010000003.1 GCA031296675_00785 gene open 170391-174161
1575 JASPEY010000003.1 GCA031296675_00786 gene open 174231-175583 narK
1576 JASPEY010000003.1 GCA031296675_00787 gene open 175808-176872 moaA
1577 JASPEY010000003.1 GCA031296675_00788 gene open 177049-178089
1578 JASPEY010000003.1 GCA031296675_00789 gene open 178531-179547
1579 JASPEY010000003.1 GCA031296675_00790 gene open 179905-181182 glp
1580 JASPEY010000003.1 GCA031296675_00791 gene open 181217-181699 moaC
1581 JASPEY010000003.1 GCA031296675_00792 gene open 181769-182260
1582 JASPEY010000003.1 GCA031296675_00754 gene open 130638-130710 trnT
1583 JASPEY010000003.1 GCA031296675_00767 gene open 145999-146088 trnS
1584 JASPEY010000003.1 GCA031296675_00754 tRNA open 130638-130710 trnT tRNA-Thr(cgt)
1585 JASPEY010000003.1 GCA031296675_00767 tRNA open 145999-146088 trnS tRNA-Ser(cga)
1586 JASPEY010000004.1 GCA031296675_00853 gene open 66353-66728 ssrA
1587 JASPEY010000004.1 GCA031296675_00853 tmRNA open 66353-66728 ssrA transfer-messenger RNA%2C SsrA
1588 JASPEY010000004.1 GCA031296675_00793 CDS open 54-851 _na     265_aa DUF6318 domain-containing protein
1589 JASPEY010000004.1 GCA031296675_00794 CDS open 1258-1770 _na     170_aa PKD domain-containing protein
1590 JASPEY010000004.1 GCA031296675_00795 CDS open 1791-2663 _na     290_aa Putative membrane protein
1591 JASPEY010000004.1 GCA031296675_00796 CDS open 2810-3820 _na     336_aa ecsC EcsC family protein
1592 JASPEY010000004.1 GCA031296675_00797 CDS open 3949-5442 _na     497_aa alpha-amylase
1593 JASPEY010000004.1 GCA031296675_00798 CDS open 5533-6351 _na     272_aa Histidine kinase
1594 JASPEY010000004.1 GCA031296675_00799 CDS open 6491-7549 _na     352_aa ecsC EcsC family protein
1595 JASPEY010000004.1 GCA031296675_00800 CDS open 7615-8703 _na     362_aa ecsC EcsC family protein
1596 JASPEY010000004.1 GCA031296675_00801 CDS open 8722-11283 _na     853_aa LPXTG-motif cell wall anchor domain protein
1597 JASPEY010000004.1 GCA031296675_00802 CDS open 11526-12152 _na     208_aa N-acetyltransferase domain-containing protein
1598 JASPEY010000004.1 GCA031296675_00803 CDS open 12300-12755 _na     151_aa HTH merR-type domain-containing protein
1599 JASPEY010000004.1 GCA031296675_00804 CDS open 13700-15193 _na     497_aa glutamine synthetase
1600 JASPEY010000004.1 GCA031296675_00805 CDS open 15254-16144 _na     296_aa Tat pathway signal sequence domain protein
1601 JASPEY010000004.1 GCA031296675_00806 CDS open 16141-16719 _na     192_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
1602 JASPEY010000004.1 GCA031296675_00807 CDS open 16767-17621 _na     284_aa Putative glucose-6-phosphate 1-epimerase
1603 JASPEY010000004.1 GCA031296675_00808 CDS open 17859-19778 _na     639_aa typA translational GTPase TypA
1604 JASPEY010000004.1 GCA031296675_00809 CDS open 19801-20127 _na     108_aa 2-hydroxymuconic semialdehyde dehydrogenase
1605 JASPEY010000004.1 GCA031296675_00810 CDS open 20180-20521 _na     113_aa fdxA ferredoxin
1606 JASPEY010000004.1 GCA031296675_00811 CDS open 20541-21686 _na     381_aa dapC succinyldiaminopimelate transaminase
1607 JASPEY010000004.1 GCA031296675_00812 CDS open 21765-22721 _na     318_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
1608 JASPEY010000004.1 GCA031296675_00813 CDS open 22766-23491 _na     241_aa Nucleoside triphosphate pyrophosphatase
1609 JASPEY010000004.1 GCA031296675_00814 CDS open 23700-24731 _na     343_aa acyC Guanylate cyclase domain-containing protein
1610 JASPEY010000004.1 GCA031296675_00815 CDS open 24828-25505 _na     225_aa ompR DNA-binding response regulator
1611 JASPEY010000004.1 GCA031296675_00816 CDS open 25530-26858 _na     442_aa mprB Signal transduction histidine-protein kinase/phosphatase MprB
1612 JASPEY010000004.1 GCA031296675_00817 CDS open 26892-28046 _na     384_aa 5-(carboxyamino)imidazole ribonucleotide synthase
1613 JASPEY010000004.1 GCA031296675_00818 CDS open 28114-28668 _na     184_aa N5-carboxyaminoimidazole ribonucleotide mutase
1614 JASPEY010000004.1 GCA031296675_00819 CDS open 28732-29727 _na     331_aa galE UDP-glucose 4-epimerase GalE
1615 JASPEY010000004.1 GCA031296675_00820 CDS open 29829-31211 _na     460_aa Cell envelope-related transcriptional attenuator domain-containing protein
1616 JASPEY010000004.1 GCA031296675_00821 CDS open 31208-32518 _na     436_aa Transcriptional regulator
1617 JASPEY010000004.1 GCA031296675_00822 CDS open 32508-32978 _na     156_aa PF10066 family protein
1618 JASPEY010000004.1 GCA031296675_00823 CDS open 32975-33673 _na     232_aa Glycosyltransferase%2C group 2 family protein
1619 JASPEY010000004.1 GCA031296675_00824 CDS open 33770-34435 _na     221_aa 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase
1620 JASPEY010000004.1 GCA031296675_00825 CDS open 34432-35532 _na     366_aa UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase
1621 JASPEY010000004.1 GCA031296675_00826 CDS open 35507-36517 _na     336_aa Inositol 2-dehydrogenase/D-chiro-inositol 3-dehydrogenase
1622 JASPEY010000004.1 GCA031296675_00827 CDS open 36527-37630 _na     367_aa Glycosyltransferase%2C group 1 family protein
1623 JASPEY010000004.1 GCA031296675_00828 CDS open 37724-39004 _na     426_aa Polysaccharide biosynthesis protein
1624 JASPEY010000004.1 GCA031296675_00829 CDS open 39026-40168 _na     380_aa Glycosyltransferase
1625 JASPEY010000004.1 GCA031296675_00830 CDS open 40188-41519 _na     443_aa tuaD UDP-glucose 6-dehydrogenase tuaD
1626 JASPEY010000004.1 GCA031296675_00831 CDS open 41513-42694 _na     393_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
1627 JASPEY010000004.1 GCA031296675_00832 CDS open 42907-44967 _na     686_aa N-acetylmuramoyl-L-alanine amidase
1628 JASPEY010000004.1 GCA031296675_00833 CDS open 45520-46947 _na     475_aa rfbC dTDP-4-dehydrorhamnose reductase
1629 JASPEY010000004.1 GCA031296675_00834 CDS open 47143-48015 _na     290_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1630 JASPEY010000004.1 GCA031296675_00835 CDS open 48016-48771 _na     251_aa Glycosyltransferase%2C group 2 family protein
1631 JASPEY010000004.1 GCA031296675_00836 CDS open 48768-49160 _na     130_aa PF10066 family protein
1632 JASPEY010000004.1 GCA031296675_00837 CDS open 49281-50573 _na     430_aa Aminoglycoside phosphotransferase domain-containing protein
1633 JASPEY010000004.1 GCA031296675_00838 CDS open 50606-51820 _na     404_aa Type II/IV secretion system protein
1634 JASPEY010000004.1 GCA031296675_00839 CDS open 51817-52683 _na     288_aa Type II secretion system protein F
1635 JASPEY010000004.1 GCA031296675_00840 CDS open 52680-53576 _na     298_aa Bacterial type II secretion system domain protein F
1636 JASPEY010000004.1 GCA031296675_00841 CDS open 53592-53762 _na     56_aa Pilus assembly protein
1637 JASPEY010000004.1 GCA031296675_00842 CDS open 53734-54123 _na     129_aa TadE-like protein
1638 JASPEY010000004.1 GCA031296675_00843 CDS open 54120-54518 _na     132_aa TadE-like protein
1639 JASPEY010000004.1 GCA031296675_00844 CDS open 54511-54954 _na     147_aa Flp pilus-assembly TadG-like N-terminal domain-containing protein
1640 JASPEY010000004.1 GCA031296675_00845 CDS open 55027-56388 _na     453_aa gdhA NADP-specific glutamate dehydrogenase
1641 JASPEY010000004.1 GCA031296675_00846 CDS open 56526-57647 _na     373_aa prfB peptide chain release factor 2
1642 JASPEY010000004.1 GCA031296675_00847 CDS open 57840-58529 _na     229_aa ftsE cell division ATP-binding protein FtsE
1643 JASPEY010000004.1 GCA031296675_00848 CDS open 58535-59449 _na     304_aa ftsX permease-like cell division protein FtsX
1644 JASPEY010000004.1 GCA031296675_00849 CDS open 59455-60729 _na     424_aa Glycyl-glycine endopeptidase ALE-1
1645 JASPEY010000004.1 GCA031296675_00850 CDS open 60816-61343 _na     175_aa smpB SsrA-binding protein SmpB
1646 JASPEY010000004.1 GCA031296675_00851 CDS open 61413-64052 _na     879_aa Phage infection protein
1647 JASPEY010000004.1 GCA031296675_00852 CDS open 64049-66253 _na     734_aa ABC transporter
1648 JASPEY010000004.1 GCA031296675_00854 CDS open 66967-68049 _na     360_aa Restriction endonuclease
1649 JASPEY010000004.1 GCA031296675_00855 CDS open 68290-69930 _na     546_aa FAD-dependent oxidoreductase
1650 JASPEY010000004.1 GCA031296675_00856 CDS open 70149-70328 _na     59_aa Transposase
1651 JASPEY010000004.1 GCA031296675_00857 CDS open 70452-70823 _na     123_aa iron ABC transporter
1652 JASPEY010000004.1 GCA031296675_00858 CDS open 71210-71851 _na     213_aa putative conserved protein
1653 JASPEY010000004.1 GCA031296675_00859 CDS open 71984-72301 _na     105_aa ybjQ UPF0145 protein NCTC9935_01222
1654 JASPEY010000004.1 GCA031296675_00860 CDS open 72607-79281 _na     2224_aa BIG2 domain-containing protein
1655 JASPEY010000004.1 GCA031296675_00861 CDS open 79755-82499 _na     914_aa Cell wall-binding repeat protein
1656 JASPEY010000004.1 GCA031296675_00862 CDS open 82944-86903 _na     1319_aa Peptidase%2C S8/S53 family
1657 JASPEY010000004.1 GCA031296675_00863 CDS open 87769-89709 _na     646_aa Xanthine permease
1658 JASPEY010000004.1 GCA031296675_00864 CDS open 89875-90477 _na     200_aa lacI LacI family DNA-binding transcriptional regulator
1659 JASPEY010000004.1 GCA031296675_00865 CDS open 90503-90889 _na     128_aa substrate-binding domain-containing protein
1660 JASPEY010000004.1 GCA031296675_00866 CDS open 90982-91122 _na     46_aa hypothetical protein
1661 JASPEY010000004.1 GCA031296675_00867 CDS open 91622-91903 _na     93_aa hupA DNA-binding protein HB1
1662 JASPEY010000004.1 GCA031296675_00868 CDS open 92563-94614 _na     683_aa oppF murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF
1663 JASPEY010000004.1 GCA031296675_00869 CDS open 94625-95524 _na     299_aa dppC Oligopeptide ABC superfamily ATP binding cassette transporter%2C membrane protein
1664 JASPEY010000004.1 GCA031296675_00870 CDS open 95521-96480 _na     319_aa dppB Dipeptide transport system permease protein dppB
1665 JASPEY010000004.1 GCA031296675_00871 CDS open 96560-98371 _na     603_aa appA Oligopeptide-binding protein AppA
1666 JASPEY010000004.1 GCA031296675_00872 CDS open 98621-99769 _na     382_aa nagC Making large colonies protein
1667 JASPEY010000004.1 GCA031296675_00873 CDS open 99766-101223 _na     485_aa mlrC MlrC
1668 JASPEY010000004.1 GCA031296675_00874 CDS open 101220-102152 _na     310_aa Glucokinase
1669 JASPEY010000004.1 GCA031296675_00875 CDS open 102149-102829 _na     226_aa cutC PF03932 family protein CutC
1670 JASPEY010000004.1 GCA031296675_00876 CDS open 102905-103678 _na     257_aa nagB glucosamine-6-phosphate deaminase
1671 JASPEY010000004.1 GCA031296675_00877 CDS open 103812-104144 _na     110_aa DUF3039 domain-containing protein
1672 JASPEY010000004.1 GCA031296675_00878 CDS open 104141-105883 _na     580_aa sSL2 Helicase ATP-binding domain-containing protein
1673 JASPEY010000004.1 GCA031296675_00879 CDS open 105991-107334 _na     447_aa pncB nicotinate phosphoribosyltransferase
1674 JASPEY010000004.1 GCA031296675_00880 CDS open 107416-107703 _na     95_aa clpS ATP-dependent Clp protease adapter ClpS
1675 JASPEY010000004.1 GCA031296675_00881 CDS open 107708-108280 _na     190_aa DUF2017 domain-containing protein
1676 JASPEY010000004.1 GCA031296675_00882 CDS open 108297-109127 _na     276_aa murI glutamate racemase
1677 JASPEY010000004.1 GCA031296675_00883 CDS open 109124-109921 _na     265_aa Metallo-beta-lactamase domain-containing protein
1678 JASPEY010000004.1 GCA031296675_00884 CDS open 109967-110884 _na     305_aa Morphology and auto-aggregation control protein
1679 JASPEY010000004.1 GCA031296675_00885 CDS open 110971-111303 _na     110_aa Cyclic nucleotide-binding protein
1680 JASPEY010000004.1 GCA031296675_00886 CDS open 111556-111678 _na     40_aa hypothetical protein
1681 JASPEY010000004.1 GCA031296675_00887 CDS open 111754-112368 _na     204_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
1682 JASPEY010000004.1 GCA031296675_00888 CDS open 112365-113132 _na     255_aa rph ribonuclease PH
1683 JASPEY010000004.1 GCA031296675_00889 CDS open 113169-114104 _na     311_aa nudC NAD(+) diphosphatase
1684 JASPEY010000004.1 GCA031296675_00890 CDS open 114122-116146 _na     674_aa recQ DNA 3'-5' helicase
1685 JASPEY010000004.1 GCA031296675_00891 CDS open 116148-117026 _na     292_aa Bacteriocin biosynthesis cyclodehydratase domain protein
1686 JASPEY010000004.1 GCA031296675_00892 CDS open 117137-118603 _na     488_aa putative conserved protein
1687 JASPEY010000004.1 GCA031296675_00893 CDS open 118674-119921 _na     415_aa endopeptidase La
1688 JASPEY010000004.1 GCA031296675_00894 CDS open 120027-120596 _na     189_aa DUF222 domain-containing protein
1689 JASPEY010000004.1 GCA031296675_00895 CDS open 120641-123796 _na     1051_aa UPF0182 protein HMPREF0058_2342
1690 JASPEY010000004.1 GCA031296675_00896 CDS open 123999-124766 _na     255_aa hypothetical protein
1691 JASPEY010000004.1 GCA031296675_00897 CDS open 124850-125419 _na     189_aa Tat pathway signal sequence domain protein
1692 JASPEY010000004.1 GCA031296675_00899 CDS open 125714-127588 _na     624_aa ABC transporter permease
1693 JASPEY010000004.1 GCA031296675_00900 CDS open 127661-128353 _na     230_aa sapB Methyltransferase
1694 JASPEY010000004.1 GCA031296675_00901 CDS open 128571-130073 _na     500_aa lysP Lysine-specific permease
1695 JASPEY010000004.1 GCA031296675_00902 CDS open 130189-130821 _na     210_aa DUF4232 domain-containing protein
1696 JASPEY010000004.1 GCA031296675_00903 CDS open 131114-131464 _na     116_aa DUF1499 domain-containing protein
1697 JASPEY010000004.1 GCA031296675_00904 CDS open 131628-132548 _na     306_aa PH domain-containing protein
1698 JASPEY010000004.1 GCA031296675_00905 CDS open 132470-132640 _na     56_aa hypothetical protein
1699 JASPEY010000004.1 GCA031296675_00906 CDS open 132794-134374 _na     526_aa type I restriction-modification system subunit M
1700 JASPEY010000004.1 GCA031296675_00907 CDS open 134371-135615 _na     414_aa restriction endonuclease subunit S
1701 JASPEY010000004.1 GCA031296675_00908 CDS open 136354-136740 _na     128_aa Antitoxin SocA-like Panacea domain-containing protein
1702 JASPEY010000004.1 GCA031296675_00909 CDS open 137035-140088 _na     1017_aa Type I restriction enzyme endonuclease subunit
1703 JASPEY010000004.1 GCA031296675_00910 CDS open 140188-141204 _na     338_aa hypothetical protein
1704 JASPEY010000004.1 GCA031296675_00911 CDS open 141442-141759 _na     105_aa tfoX TfoX N-terminal domain-containing protein
1705 JASPEY010000004.1 GCA031296675_00912 CDS open 141852-142370 _na     172_aa Protein CrcB-like protein
1706 JASPEY010000004.1 GCA031296675_00913 CDS open 142527-143078 _na     183_aa Flavodoxin-like protein
1707 JASPEY010000004.1 GCA031296675_00914 CDS open 143208-144008 _na     266_aa putative membrane transporter protein
1708 JASPEY010000004.1 GCA031296675_00915 CDS open 144080-145489 _na     469_aa fumC class II fumarate hydratase
1709 JASPEY010000004.1 GCA031296675_00916 CDS open 145578-146912 _na     444_aa Major facilitator transporter
1710 JASPEY010000004.1 GCA031296675_00917 CDS open 146985-147518 _na     177_aa Dihydrofolate reductase
1711 JASPEY010000004.1 GCA031296675_00918 CDS open 147515-148318 _na     267_aa thymidylate synthase
1712 JASPEY010000004.1 GCA031296675_00919 CDS open 148320-148745 _na     141_aa OsmC-like protein
1713 JASPEY010000004.1 GCA031296675_00920 CDS open 148831-149313 _na     160_aa DUF2505 domain-containing protein
1714 JASPEY010000004.1 GCA031296675_00921 CDS open 149411-150871 _na     486_aa histidine kinase
1715 JASPEY010000004.1 GCA031296675_00922 CDS open 150979-151230 _na     83_aa whiB Transcriptional regulator WhiB
1716 JASPEY010000004.1 GCA031296675_00923 CDS open 151383-153995 _na     870_aa ftsK Cell division protein FtsK
1717 JASPEY010000004.1 GCA031296675_00924 CDS open 154606-156930 _na     774_aa ligA NAD-dependent DNA ligase LigA
1718 JASPEY010000004.1 GCA031296675_00925 CDS open 156944-158209 _na     421_aa Phospholipase D domain protein
1719 JASPEY010000004.1 GCA031296675_00926 CDS open 158228-158524 _na     98_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
1720 JASPEY010000004.1 GCA031296675_00927 CDS open 158524-160029 _na     501_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
1721 JASPEY010000004.1 GCA031296675_00928 CDS open 160029-161525 _na     498_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1722 JASPEY010000004.1 GCA031296675_00929 CDS open 161804-163231 _na     475_aa sfcA NADP-dependent malate dehydrogenase (Oxaloacetate-decarboxylating)
1723 JASPEY010000004.1 GCA031296675_00793 gene open 54-851
1724 JASPEY010000004.1 GCA031296675_00794 gene open 1258-1770
1725 JASPEY010000004.1 GCA031296675_00795 gene open 1791-2663
1726 JASPEY010000004.1 GCA031296675_00796 gene open 2810-3820 ecsC
1727 JASPEY010000004.1 GCA031296675_00797 gene open 3949-5442
1728 JASPEY010000004.1 GCA031296675_00798 gene open 5533-6351
1729 JASPEY010000004.1 GCA031296675_00799 gene open 6491-7549 ecsC
1730 JASPEY010000004.1 GCA031296675_00800 gene open 7615-8703 ecsC
1731 JASPEY010000004.1 GCA031296675_00801 gene open 8722-11283
1732 JASPEY010000004.1 GCA031296675_00802 gene open 11526-12152
1733 JASPEY010000004.1 GCA031296675_00803 gene open 12300-12755
1734 JASPEY010000004.1 GCA031296675_00804 gene open 13700-15193
1735 JASPEY010000004.1 GCA031296675_00805 gene open 15254-16144
1736 JASPEY010000004.1 GCA031296675_00806 gene open 16141-16719
1737 JASPEY010000004.1 GCA031296675_00807 gene open 16767-17621
1738 JASPEY010000004.1 GCA031296675_00808 gene open 17859-19778 typA
1739 JASPEY010000004.1 GCA031296675_00809 gene open 19801-20127
1740 JASPEY010000004.1 GCA031296675_00810 gene open 20180-20521 fdxA
1741 JASPEY010000004.1 GCA031296675_00811 gene open 20541-21686 dapC
1742 JASPEY010000004.1 GCA031296675_00812 gene open 21765-22721 dapD
1743 JASPEY010000004.1 GCA031296675_00813 gene open 22766-23491
1744 JASPEY010000004.1 GCA031296675_00814 gene open 23700-24731 acyC
1745 JASPEY010000004.1 GCA031296675_00815 gene open 24828-25505 ompR
1746 JASPEY010000004.1 GCA031296675_00816 gene open 25530-26858 mprB
1747 JASPEY010000004.1 GCA031296675_00817 gene open 26892-28046
1748 JASPEY010000004.1 GCA031296675_00818 gene open 28114-28668
1749 JASPEY010000004.1 GCA031296675_00819 gene open 28732-29727 galE
1750 JASPEY010000004.1 GCA031296675_00820 gene open 29829-31211
1751 JASPEY010000004.1 GCA031296675_00821 gene open 31208-32518
1752 JASPEY010000004.1 GCA031296675_00822 gene open 32508-32978
1753 JASPEY010000004.1 GCA031296675_00823 gene open 32975-33673
1754 JASPEY010000004.1 GCA031296675_00824 gene open 33770-34435
1755 JASPEY010000004.1 GCA031296675_00825 gene open 34432-35532
1756 JASPEY010000004.1 GCA031296675_00826 gene open 35507-36517
1757 JASPEY010000004.1 GCA031296675_00827 gene open 36527-37630
1758 JASPEY010000004.1 GCA031296675_00828 gene open 37724-39004
1759 JASPEY010000004.1 GCA031296675_00829 gene open 39026-40168
1760 JASPEY010000004.1 GCA031296675_00830 gene open 40188-41519 tuaD
1761 JASPEY010000004.1 GCA031296675_00831 gene open 41513-42694
1762 JASPEY010000004.1 GCA031296675_00832 gene open 42907-44967
1763 JASPEY010000004.1 GCA031296675_00833 gene open 45520-46947 rfbC
1764 JASPEY010000004.1 GCA031296675_00834 gene open 47143-48015 rfbA
1765 JASPEY010000004.1 GCA031296675_00835 gene open 48016-48771
1766 JASPEY010000004.1 GCA031296675_00836 gene open 48768-49160
1767 JASPEY010000004.1 GCA031296675_00837 gene open 49281-50573
1768 JASPEY010000004.1 GCA031296675_00838 gene open 50606-51820
1769 JASPEY010000004.1 GCA031296675_00839 gene open 51817-52683
1770 JASPEY010000004.1 GCA031296675_00840 gene open 52680-53576
1771 JASPEY010000004.1 GCA031296675_00841 gene open 53592-53762
1772 JASPEY010000004.1 GCA031296675_00842 gene open 53734-54123
1773 JASPEY010000004.1 GCA031296675_00843 gene open 54120-54518
1774 JASPEY010000004.1 GCA031296675_00844 gene open 54511-54954
1775 JASPEY010000004.1 GCA031296675_00845 gene open 55027-56388 gdhA
1776 JASPEY010000004.1 GCA031296675_00846 gene open 56526-57647 prfB
1777 JASPEY010000004.1 GCA031296675_00847 gene open 57840-58529 ftsE
1778 JASPEY010000004.1 GCA031296675_00848 gene open 58535-59449 ftsX
1779 JASPEY010000004.1 GCA031296675_00849 gene open 59455-60729
1780 JASPEY010000004.1 GCA031296675_00850 gene open 60816-61343 smpB
1781 JASPEY010000004.1 GCA031296675_00851 gene open 61413-64052
1782 JASPEY010000004.1 GCA031296675_00852 gene open 64049-66253
1783 JASPEY010000004.1 GCA031296675_00854 gene open 66967-68049
1784 JASPEY010000004.1 GCA031296675_00855 gene open 68290-69930
1785 JASPEY010000004.1 GCA031296675_00856 gene open 70149-70328
1786 JASPEY010000004.1 GCA031296675_00857 gene open 70452-70823
1787 JASPEY010000004.1 GCA031296675_00858 gene open 71210-71851
1788 JASPEY010000004.1 GCA031296675_00859 gene open 71984-72301 ybjQ
1789 JASPEY010000004.1 GCA031296675_00860 gene open 72607-79281
1790 JASPEY010000004.1 GCA031296675_00861 gene open 79755-82499
1791 JASPEY010000004.1 GCA031296675_00862 gene open 82944-86903
1792 JASPEY010000004.1 GCA031296675_00863 gene open 87769-89709
1793 JASPEY010000004.1 GCA031296675_00864 gene open 89875-90477 lacI
1794 JASPEY010000004.1 GCA031296675_00865 gene open 90503-90889
1795 JASPEY010000004.1 GCA031296675_00866 gene open 90982-91122
1796 JASPEY010000004.1 GCA031296675_00867 gene open 91622-91903 hupA
1797 JASPEY010000004.1 GCA031296675_00868 gene open 92563-94614 oppF
1798 JASPEY010000004.1 GCA031296675_00869 gene open 94625-95524 dppC
1799 JASPEY010000004.1 GCA031296675_00870 gene open 95521-96480 dppB
1800 JASPEY010000004.1 GCA031296675_00871 gene open 96560-98371 appA
1801 JASPEY010000004.1 GCA031296675_00872 gene open 98621-99769 nagC
1802 JASPEY010000004.1 GCA031296675_00873 gene open 99766-101223 mlrC
1803 JASPEY010000004.1 GCA031296675_00874 gene open 101220-102152
1804 JASPEY010000004.1 GCA031296675_00875 gene open 102149-102829 cutC
1805 JASPEY010000004.1 GCA031296675_00876 gene open 102905-103678 nagB
1806 JASPEY010000004.1 GCA031296675_00877 gene open 103812-104144
1807 JASPEY010000004.1 GCA031296675_00878 gene open 104141-105883 sSL2
1808 JASPEY010000004.1 GCA031296675_00879 gene open 105991-107334 pncB
1809 JASPEY010000004.1 GCA031296675_00880 gene open 107416-107703 clpS
1810 JASPEY010000004.1 GCA031296675_00881 gene open 107708-108280
1811 JASPEY010000004.1 GCA031296675_00882 gene open 108297-109127 murI
1812 JASPEY010000004.1 GCA031296675_00883 gene open 109124-109921
1813 JASPEY010000004.1 GCA031296675_00884 gene open 109967-110884
1814 JASPEY010000004.1 GCA031296675_00885 gene open 110971-111303
1815 JASPEY010000004.1 GCA031296675_00886 gene open 111556-111678
1816 JASPEY010000004.1 GCA031296675_00887 gene open 111754-112368 rdgB
1817 JASPEY010000004.1 GCA031296675_00888 gene open 112365-113132 rph
1818 JASPEY010000004.1 GCA031296675_00889 gene open 113169-114104 nudC
1819 JASPEY010000004.1 GCA031296675_00890 gene open 114122-116146 recQ
1820 JASPEY010000004.1 GCA031296675_00891 gene open 116148-117026
1821 JASPEY010000004.1 GCA031296675_00892 gene open 117137-118603
1822 JASPEY010000004.1 GCA031296675_00893 gene open 118674-119921
1823 JASPEY010000004.1 GCA031296675_00894 gene open 120027-120596
1824 JASPEY010000004.1 GCA031296675_00895 gene open 120641-123796
1825 JASPEY010000004.1 GCA031296675_00896 gene open 123999-124766
1826 JASPEY010000004.1 GCA031296675_00897 gene open 124850-125419
1827 JASPEY010000004.1 GCA031296675_00899 gene open 125714-127588
1828 JASPEY010000004.1 GCA031296675_00900 gene open 127661-128353 sapB
1829 JASPEY010000004.1 GCA031296675_00901 gene open 128571-130073 lysP
1830 JASPEY010000004.1 GCA031296675_00902 gene open 130189-130821
1831 JASPEY010000004.1 GCA031296675_00903 gene open 131114-131464
1832 JASPEY010000004.1 GCA031296675_00904 gene open 131628-132548
1833 JASPEY010000004.1 GCA031296675_00905 gene open 132470-132640
1834 JASPEY010000004.1 GCA031296675_00906 gene open 132794-134374
1835 JASPEY010000004.1 GCA031296675_00907 gene open 134371-135615
1836 JASPEY010000004.1 GCA031296675_00908 gene open 136354-136740
1837 JASPEY010000004.1 GCA031296675_00909 gene open 137035-140088
1838 JASPEY010000004.1 GCA031296675_00910 gene open 140188-141204
1839 JASPEY010000004.1 GCA031296675_00911 gene open 141442-141759 tfoX
1840 JASPEY010000004.1 GCA031296675_00912 gene open 141852-142370
1841 JASPEY010000004.1 GCA031296675_00913 gene open 142527-143078
1842 JASPEY010000004.1 GCA031296675_00914 gene open 143208-144008
1843 JASPEY010000004.1 GCA031296675_00915 gene open 144080-145489 fumC
1844 JASPEY010000004.1 GCA031296675_00916 gene open 145578-146912
1845 JASPEY010000004.1 GCA031296675_00917 gene open 146985-147518
1846 JASPEY010000004.1 GCA031296675_00918 gene open 147515-148318
1847 JASPEY010000004.1 GCA031296675_00919 gene open 148320-148745
1848 JASPEY010000004.1 GCA031296675_00920 gene open 148831-149313
1849 JASPEY010000004.1 GCA031296675_00921 gene open 149411-150871
1850 JASPEY010000004.1 GCA031296675_00922 gene open 150979-151230 whiB
1851 JASPEY010000004.1 GCA031296675_00923 gene open 151383-153995 ftsK
1852 JASPEY010000004.1 GCA031296675_00924 gene open 154606-156930 ligA
1853 JASPEY010000004.1 GCA031296675_00925 gene open 156944-158209
1854 JASPEY010000004.1 GCA031296675_00926 gene open 158228-158524 gatC
1855 JASPEY010000004.1 GCA031296675_00927 gene open 158524-160029 gatA
1856 JASPEY010000004.1 GCA031296675_00928 gene open 160029-161525 gatB
1857 JASPEY010000004.1 GCA031296675_00929 gene open 161804-163231 sfcA
1858 JASPEY010000004.1 GCA031296675_00898 gene open 125490-125566 trnfM
1859 JASPEY010000004.1 GCA031296675_00898 tRNA open 125490-125566 trnfM tRNA-fMet(cat)
1860 JASPEY010000005.1 repeat_region open 13120-13305 CRISPR array with 3 repeats of length 23%2C consensus sequence GACGGTGGCTCCTGGTACTACCT and spacer length 38
1861 JASPEY010000005.1 GCA031296675_00930 CDS open 141-1313 _na     390_aa hypothetical protein
1862 JASPEY010000005.1 GCA031296675_00931 CDS open 1434-5312 _na     1292_aa PIII-type proteinase
1863 JASPEY010000005.1 GCA031296675_00932 CDS open 5544-9368 _na     1274_aa Peptidase%2C S8/S53 family
1864 JASPEY010000005.1 GCA031296675_00933 CDS open 13618-14082 _na     154_aa Lipoprotein
1865 JASPEY010000005.1 GCA031296675_00934 CDS open 14148-17162 _na     1004_aa TIGR00374 family protein
1866 JASPEY010000005.1 GCA031296675_00935 CDS open 17237-17902 _na     221_aa SNARE-like domain protein
1867 JASPEY010000005.1 GCA031296675_00936 CDS open 17906-20182 _na     758_aa Tat pathway signal sequence domain protein
1868 JASPEY010000005.1 GCA031296675_00937 CDS open 20355-21362 _na     335_aa pheA prephenate dehydratase
1869 JASPEY010000005.1 GCA031296675_00938 CDS open 21397-22230 _na     277_aa ABC transporter ATP-binding protein
1870 JASPEY010000005.1 GCA031296675_00939 CDS open 22227-23288 _na     353_aa iron ABC transporter permease
1871 JASPEY010000005.1 GCA031296675_00940 CDS open 23296-24363 _na     355_aa ABC transporter substrate-binding protein
1872 JASPEY010000005.1 GCA031296675_00941 CDS open 24748-26067 _na     439_aa Diacylglycerol kinase
1873 JASPEY010000005.1 GCA031296675_00942 CDS open 26322-27599 _na     425_aa serS serine--tRNA ligase
1874 JASPEY010000005.1 GCA031296675_00943 CDS open 27596-28513 _na     305_aa HAD hydrolase%2C family IIB
1875 JASPEY010000005.1 GCA031296675_00944 CDS open 28532-29716 _na     394_aa AB hydrolase-1 domain-containing protein
1876 JASPEY010000005.1 GCA031296675_00945 CDS open 29844-30443 _na     199_aa tetR Transcriptional regulator%2C TetR family
1877 JASPEY010000005.1 GCA031296675_00946 CDS open 30600-32204 _na     534_aa Xylulose kinase
1878 JASPEY010000005.1 GCA031296675_00947 CDS open 32286-33167 _na     293_aa DUF5926 domain-containing protein
1879 JASPEY010000005.1 GCA031296675_00948 CDS open 33259-34107 _na     282_aa Glucosyl-3-phosphoglycerate synthase
1880 JASPEY010000005.1 GCA031296675_00949 CDS open 34104-35606 _na     500_aa Tat pathway signal sequence domain protein
1881 JASPEY010000005.1 GCA031296675_00950 CDS open 35751-36293 _na     180_aa Tat pathway signal sequence domain protein
1882 JASPEY010000005.1 GCA031296675_00951 CDS open 36350-36880 _na     176_aa hypothetical protein
1883 JASPEY010000005.1 GCA031296675_00952 CDS open 36914-38413 _na     499_aa hypothetical protein
1884 JASPEY010000005.1 GCA031296675_00953 CDS open 38392-39630 _na     412_aa Alkaline protease
1885 JASPEY010000005.1 GCA031296675_00954 CDS open 39633-40865 _na     410_aa S8 family serine peptidase
1886 JASPEY010000005.1 GCA031296675_00955 CDS open 41080-41340 _na     86_aa hypothetical protein
1887 JASPEY010000005.1 GCA031296675_00956 CDS open 42032-44587 _na     851_aa Copper-exporting ATPase
1888 JASPEY010000005.1 GCA031296675_00957 CDS open 44673-44918 _na     81_aa HMA domain-containing protein
1889 JASPEY010000005.1 GCA031296675_00958 CDS open 44934-45224 _na     96_aa Copper-sensitive operon repressor
1890 JASPEY010000005.1 GCA031296675_00959 CDS open 45371-46852 _na     493_aa Alpha/beta hydrolase
1891 JASPEY010000005.1 GCA031296675_00960 CDS open 46849-47490 _na     213_aa Tat pathway signal sequence domain protein
1892 JASPEY010000005.1 GCA031296675_00961 CDS open 47623-47973 _na     116_aa hypothetical protein
1893 JASPEY010000005.1 GCA031296675_00962 CDS open 47973-49658 _na     561_aa alpha/beta hydrolase
1894 JASPEY010000005.1 GCA031296675_00963 CDS open 49658-50344 _na     228_aa Lipoprotein
1895 JASPEY010000005.1 GCA031296675_00964 CDS open 50347-51021 _na     224_aa Lipoprotein
1896 JASPEY010000005.1 GCA031296675_00965 CDS open 51026-51697 _na     223_aa DUF4853 domain-containing protein
1897 JASPEY010000005.1 GCA031296675_00966 CDS open 51703-52371 _na     222_aa Oxidoreductase
1898 JASPEY010000005.1 GCA031296675_00967 CDS open 52463-53920 _na     485_aa purB adenylosuccinate lyase
1899 JASPEY010000005.1 GCA031296675_00968 CDS open 54164-54469 _na     101_aa hypothetical protein
1900 JASPEY010000005.1 GCA031296675_00969 CDS open 54472-56157 _na     561_aa PGAP1-like protein
1901 JASPEY010000005.1 GCA031296675_00970 CDS open 56188-56622 _na     144_aa Phage holin family protein
1902 JASPEY010000005.1 GCA031296675_00971 CDS open 56640-57704 _na     354_aa hisC histidinol-phosphate transaminase
1903 JASPEY010000005.1 GCA031296675_00972 CDS open 57774-58676 _na     300_aa YwiC-like protein
1904 JASPEY010000005.1 GCA031296675_00973 CDS open 58770-59762 _na     330_aa Bile acid transporter
1905 JASPEY010000005.1 GCA031296675_00974 CDS open 59898-60419 _na     173_aa endo alpha-1%2C4 polygalactosaminidase
1906 JASPEY010000005.1 GCA031296675_00976 CDS open 60771-61751 _na     326_aa Ser/Thr phosphatase family protein
1907 JASPEY010000005.1 GCA031296675_00977 CDS open 61741-63861 _na     706_aa peptidoglycan glycosyltransferase
1908 JASPEY010000005.1 GCA031296675_00978 CDS open 64031-64381 _na     116_aa whiB Transcriptional regulator WhiB
1909 JASPEY010000005.1 GCA031296675_00979 CDS open 64391-64570 _na     59_aa DUF4177 domain-containing protein
1910 JASPEY010000005.1 GCA031296675_00980 CDS open 64714-65397 _na     227_aa crp Cyclic nucleotide-binding domain-containing protein
1911 JASPEY010000005.1 GCA031296675_00981 CDS open 65578-66483 _na     301_aa Hydrolase%2C alpha/beta domain protein
1912 JASPEY010000005.1 GCA031296675_00982 CDS open 66480-68255 _na     591_aa MFS transporter
1913 JASPEY010000005.1 GCA031296675_00983 CDS open 68310-69239 _na     309_aa ATP synthase F0%2C A subunit
1914 JASPEY010000005.1 GCA031296675_00984 CDS open 69257-70093 _na     278_aa Fido domain-containing protein
1915 JASPEY010000005.1 GCA031296675_00985 CDS open 70103-70873 _na     256_aa HAD-IB family hydrolase
1916 JASPEY010000005.1 GCA031296675_00986 CDS open 71017-72030 _na     337_aa CpaE-like protein
1917 JASPEY010000005.1 GCA031296675_00987 CDS open 72023-73135 _na     370_aa Helicase/secretion neighborhood ATPase
1918 JASPEY010000005.1 GCA031296675_00988 CDS open 73132-74379 _na     415_aa Bacterial type II secretion system domain protein F
1919 JASPEY010000005.1 GCA031296675_00989 CDS open 74512-74784 _na     90_aa DUF4244 domain-containing protein
1920 JASPEY010000005.1 GCA031296675_00990 CDS open 74781-75119 _na     112_aa TadE-like protein
1921 JASPEY010000005.1 GCA031296675_00991 CDS open 75137-75547 _na     136_aa Rv3654c family TadE-like protein
1922 JASPEY010000005.1 GCA031296675_00992 CDS open 77340-78539 _na     399_aa Alkaline protease
1923 JASPEY010000005.1 GCA031296675_00993 CDS open 78518-80065 _na     515_aa WXG100 family type VII secretion target
1924 JASPEY010000005.1 GCA031296675_00994 CDS open 80092-81090 _na     332_aa hypothetical protein
1925 JASPEY010000005.1 GCA031296675_00995 CDS open 81203-83911 _na     902_aa rhlE ATP-dependent RNA helicase rhlE
1926 JASPEY010000005.1 GCA031296675_00996 CDS open 83908-84390 _na     160_aa Histidine kinase
1927 JASPEY010000005.1 GCA031296675_00997 CDS open 84387-84845 _na     152_aa Bacterial sensory transduction regulator
1928 JASPEY010000005.1 GCA031296675_00998 CDS open 85107-86198 _na     363_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
1929 JASPEY010000005.1 GCA031296675_00999 CDS open 86218-86871 _na     217_aa hypothetical protein
1930 JASPEY010000005.1 GCA031296675_01000 CDS open 86941-87465 _na     174_aa doxX DoxX family protein
1931 JASPEY010000005.1 GCA031296675_01001 CDS open 87961-89826 _na     621_aa nrdD ribonucleoside triphosphate reductase
1932 JASPEY010000005.1 GCA031296675_01002 CDS open 89828-90640 _na     270_aa anaerobic ribonucleoside-triphosphate reductase activating protein
1933 JASPEY010000005.1 GCA031296675_01003 CDS open 90757-91998 _na     413_aa Sodium pump decarboxylase%2C gamma subunit
1934 JASPEY010000005.1 GCA031296675_01004 CDS open 92065-93261 _na     398_aa caiA Acyl-CoA dehydrogenase%2C short-chain specific
1935 JASPEY010000005.1 GCA031296675_01005 CDS open 93418-94032 _na     204_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
1936 JASPEY010000005.1 GCA031296675_01006 CDS open 94128-95375 _na     415_aa Phosphatidate phosphatase APP1 catalytic domain-containing protein
1937 JASPEY010000005.1 GCA031296675_01007 CDS open 95422-96642 _na     406_aa Transporter%2C major facilitator family protein
1938 JASPEY010000005.1 GCA031296675_01008 CDS open 96794-98314 _na     506_aa Copper-containing nitrite reductase
1939 JASPEY010000005.1 GCA031296675_01009 CDS open 98307-99605 _na     432_aa Copper oxidase
1940 JASPEY010000005.1 GCA031296675_01010 CDS open 99602-100876 _na     424_aa Tat pathway signal sequence domain protein
1941 JASPEY010000005.1 GCA031296675_01011 CDS open 101093-101812 _na     239_aa hypothetical protein
1942 JASPEY010000005.1 GCA031296675_01012 CDS open 101815-103434 _na     539_aa DUF1023 domain-containing protein
1943 JASPEY010000005.1 GCA031296675_01013 CDS open 103515-104033 _na     172_aa DUF4853 domain-containing protein
1944 JASPEY010000005.1 GCA031296675_01014 CDS open 104120-104896 _na     258_aa GIY-YIG catalytic domain
1945 JASPEY010000005.1 GCA031296675_01015 CDS open 104889-106046 _na     385_aa DNA cytosine methyltransferase
1946 JASPEY010000005.1 GCA031296675_01016 CDS open 106178-107854 _na     558_aa pgm phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent)
1947 JASPEY010000005.1 GCA031296675_01017 CDS open 108104-109444 _na     446_aa yihS putative sugar isomerase yihS
1948 JASPEY010000005.1 GCA031296675_01020 CDS open 110556-117944 _na     2462_aa Serine-aspartate repeat-containing protein D
1949 JASPEY010000005.1 GCA031296675_01021 CDS open 118162-119613 _na     483_aa Autolysin
1950 JASPEY010000005.1 GCA031296675_01022 CDS open 119849-122752 _na     967_aa DNA polymerase III subunit gamma and tau
1951 JASPEY010000005.1 GCA031296675_01023 CDS open 122754-123347 _na     197_aa recR recombination mediator RecR
1952 JASPEY010000005.1 GCA031296675_01024 CDS open 123560-124267 _na     235_aa tcrX putative transcriptional regulatory protein TcrX
1953 JASPEY010000005.1 GCA031296675_01025 CDS open 124264-125826 _na     520_aa histidine kinase
1954 JASPEY010000005.1 GCA031296675_01026 CDS open 126049-127365 _na     438_aa metL1 aspartate kinase
1955 JASPEY010000005.1 GCA031296675_01027 CDS open 127511-128557 _na     348_aa aspartate-semialdehyde dehydrogenase
1956 JASPEY010000005.1 GCA031296675_01029 CDS open 130368-130787 _na     139_aa 8-oxo-dGTP diphosphatase
1957 JASPEY010000005.1 GCA031296675_01030 CDS open 130844-131482 _na     212_aa tetR TetR family transcriptional regulator
1958 JASPEY010000005.1 GCA031296675_01031 CDS open 131577-131954 _na     125_aa trxA thioredoxin
1959 JASPEY010000005.1 GCA031296675_01032 CDS open 132016-132570 _na     184_aa GNAT family N-acetyltransferase
1960 JASPEY010000005.1 GCA031296675_01033 CDS open 132734-133810 _na     358_aa Efflux transporter%2C RND family%2C MFP subunit
1961 JASPEY010000005.1 GCA031296675_01034 CDS open 133807-134568 _na     253_aa ytrE ABC transporter ATP-binding protein YtrE
1962 JASPEY010000005.1 GCA031296675_01035 CDS open 134565-135896 _na     443_aa macB Macrolide export ATP-binding/permease protein MacB
1963 JASPEY010000005.1 GCA031296675_01036 CDS open 135974-136810 _na     278_aa Adenine DNA glycosylase
1964 JASPEY010000005.1 GCA031296675_01037 CDS open 137064-137378 _na     104_aa TM2 domain-containing protein
1965 JASPEY010000005.1 GCA031296675_01038 CDS open 137594-138088 _na     164_aa TM2 domain protein
1966 JASPEY010000005.1 GCA031296675_01039 CDS open 138135-138716 _na     193_aa dcd dCTP deaminase
1967 JASPEY010000005.1 GCA031296675_01040 CDS open 138765-140330 _na     521_aa PRTRC system protein E
1968 JASPEY010000005.1 GCA031296675_01041 CDS open 140407-140619 _na     70_aa Molybdenum-pterin-binding protein II
1969 JASPEY010000005.1 GCA031296675_01042 CDS open 140688-143195 _na     835_aa Cysteine-rich domain protein
1970 JASPEY010000005.1 GCA031296675_01043 CDS open 143372-144943 _na     523_aa purF amidophosphoribosyltransferase
1971 JASPEY010000005.1 GCA031296675_01044 CDS open 145043-146203 _na     386_aa Phosphoribosylformylglycinamidine cyclo-ligase
1972 JASPEY010000005.1 GCA031296675_01045 CDS open 146457-146735 _na     92_aa DUF3073 domain-containing protein
1973 JASPEY010000005.1 GCA031296675_01046 CDS open 146970-147398 _na     142_aa DUF3618 domain-containing protein
1974 JASPEY010000005.1 GCA031296675_01047 CDS open 147395-147841 _na     148_aa Phage holin family protein
1975 JASPEY010000005.1 GCA031296675_01048 CDS open 147934-149616 _na     560_aa ABC transporter domain-containing protein
1976 JASPEY010000005.1 GCA031296675_01049 CDS open 150702-152408 _na     568_aa hypothetical protein
1977 JASPEY010000005.1 GCA031296675_01050 CDS open 152771-153256 _na     161_aa Histidine kinase
1978 JASPEY010000005.1 GCA031296675_01054 CDS open 154519-155283 _na     254_aa hypothetical protein
1979 JASPEY010000005.1 GCA031296675_00930 gene open 141-1313
1980 JASPEY010000005.1 GCA031296675_00931 gene open 1434-5312
1981 JASPEY010000005.1 GCA031296675_00932 gene open 5544-9368
1982 JASPEY010000005.1 GCA031296675_00933 gene open 13618-14082
1983 JASPEY010000005.1 GCA031296675_00934 gene open 14148-17162
1984 JASPEY010000005.1 GCA031296675_00935 gene open 17237-17902
1985 JASPEY010000005.1 GCA031296675_00936 gene open 17906-20182
1986 JASPEY010000005.1 GCA031296675_00937 gene open 20355-21362 pheA
1987 JASPEY010000005.1 GCA031296675_00938 gene open 21397-22230
1988 JASPEY010000005.1 GCA031296675_00939 gene open 22227-23288
1989 JASPEY010000005.1 GCA031296675_00940 gene open 23296-24363
1990 JASPEY010000005.1 GCA031296675_00941 gene open 24748-26067
1991 JASPEY010000005.1 GCA031296675_00942 gene open 26322-27599 serS
1992 JASPEY010000005.1 GCA031296675_00943 gene open 27596-28513
1993 JASPEY010000005.1 GCA031296675_00944 gene open 28532-29716
1994 JASPEY010000005.1 GCA031296675_00945 gene open 29844-30443 tetR
1995 JASPEY010000005.1 GCA031296675_00946 gene open 30600-32204
1996 JASPEY010000005.1 GCA031296675_00947 gene open 32286-33167
1997 JASPEY010000005.1 GCA031296675_00948 gene open 33259-34107
1998 JASPEY010000005.1 GCA031296675_00949 gene open 34104-35606
1999 JASPEY010000005.1 GCA031296675_00950 gene open 35751-36293
2000 JASPEY010000005.1 GCA031296675_00951 gene open 36350-36880