HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_900157255.1)

Select a Genome:
BAKTA Annotations for GCA_900157255.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
77 2424225 2105 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4332 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4332 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 FUFH01000014.1 GCA900157255_01431 CDS open 94380-95534 _na     384_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
1002 FUFH01000014.1 GCA900157255_01432 CDS open 95628-96878 _na     416_aa hutI imidazolonepropionase
1003 FUFH01000014.1 GCA900157255_01433 CDS open 97000-97902 _na     300_aa ftcD glutamate formimidoyltransferase
1004 FUFH01000014.1 GCA900157255_01434 CDS open 97951-98466 _na     171_aa hupA DNA-binding protein%2C histone-like family
1005 FUFH01000014.1 GCA900157255_01435 CDS open 100111-101220 _na     369_aa Transcription termination factor Rho
1006 FUFH01000014.1 GCA900157255_01436 CDS open 101448-102356 _na     302_aa rhaT EamA domain-containing protein
1007 FUFH01000014.1 GCA900157255_01437 CDS open 102367-103326 _na     319_aa wcaA Glycosyl transferase%2C group 2 family protein
1008 FUFH01000014.1 GCA900157255_01438 CDS open 103354-104868 _na     504_aa Glycosyltransferase family 39 protein
1009 FUFH01000014.1 GCA900157255_01439 CDS open 105008-105910 _na     300_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1010 FUFH01000014.1 GCA900157255_01440 CDS open 105931-106500 _na     189_aa Plasmid pRiA4b Orf3-like domain-containing protein
1011 FUFH01000014.1 GCA900157255_01441 CDS open 106788-110315 _na     1175_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
1012 FUFH01000014.1 GCA900157255_01442 CDS open 110323-110865 _na     180_aa csx28 CRISPR-associated protein Csx28
1013 FUFH01000014.1 GCA900157255_01443 CDS open 111802-112047 _na     81_aa hypothetical protein
1014 FUFH01000014.1 GCA900157255_01444 CDS open 112129-113310 _na     393_aa megL methionine gamma-lyase
1015 FUFH01000014.1 GCA900157255_01445 CDS open 113491-114960 _na     489_aa cpdA Metallophosphoesterase family protein
1016 FUFH01000014.1 GCA900157255_01446 CDS open 114963-115556 _na     197_aa Histidine kinase
1017 FUFH01000014.1 GCA900157255_01447 CDS open 115657-116262 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1018 FUFH01000014.1 GCA900157255_01448 CDS open 116272-117300 _na     342_aa galE UDP-glucose 4-epimerase GalE
1019 FUFH01000014.1 GCA900157255_01449 CDS open 117343-119439 _na     698_aa recG ATP-dependent DNA helicase RecG
1020 FUFH01000014.1 GCA900157255_01450 CDS open 119439-120209 _na     256_aa ycjU Hydrolase%2C haloacid dehalogenase-like family
1021 FUFH01000014.1 GCA900157255_01451 CDS open 120304-121758 _na     484_aa yopM Internalin
1022 FUFH01000014.1 GCA900157255_01452 CDS open 122186-123766 _na     526_aa nanH exo-alpha-sialidase
1023 FUFH01000014.1 GCA900157255_01346 gene open 150-422 traJ
1024 FUFH01000014.1 GCA900157255_01347 gene open 693-1577
1025 FUFH01000014.1 GCA900157255_01350 gene open 2573-3367 pgaB
1026 FUFH01000014.1 GCA900157255_01351 gene open 3355-4065 wcaA
1027 FUFH01000014.1 GCA900157255_01352 gene open 4052-5239
1028 FUFH01000014.1 GCA900157255_01353 gene open 5281-5910 udk
1029 FUFH01000014.1 GCA900157255_01354 gene open 5960-7147 spt
1030 FUFH01000014.1 GCA900157255_01355 gene open 7516-8010 ymdB
1031 FUFH01000014.1 GCA900157255_01356 gene open 8092-8922 lpxH
1032 FUFH01000014.1 GCA900157255_01357 gene open 8909-9226 paaD
1033 FUFH01000014.1 GCA900157255_01358 gene open 9312-10463 dnaJ
1034 FUFH01000014.1 GCA900157255_01359 gene open 10507-11091 grpE
1035 FUFH01000014.1 GCA900157255_01360 gene open 11459-14854 mfd
1036 FUFH01000014.1 GCA900157255_01361 gene open 14831-16168 lpxE
1037 FUFH01000014.1 GCA900157255_01362 gene open 16230-16904 nth
1038 FUFH01000014.1 GCA900157255_01363 gene open 16923-17945 pheS
1039 FUFH01000014.1 GCA900157255_01364 gene open 18067-18663
1040 FUFH01000014.1 GCA900157255_01365 gene open 19315-20856 yifB
1041 FUFH01000014.1 GCA900157255_01366 gene open 20885-21904 bcp
1042 FUFH01000014.1 GCA900157255_01367 gene open 21919-22500 purN
1043 FUFH01000014.1 GCA900157255_01368 gene open 22669-22905 acpP
1044 FUFH01000014.1 GCA900157255_01369 gene open 22915-24171 fabF
1045 FUFH01000014.1 GCA900157255_01370 gene open 24183-24968 rnc
1046 FUFH01000014.1 GCA900157255_01371 gene open 25095-28040 secDF
1047 FUFH01000014.1 GCA900157255_01372 gene open 28258-28833 rimI
1048 FUFH01000014.1 GCA900157255_01373 gene open 28781-29410 znuC
1049 FUFH01000014.1 GCA900157255_01374 gene open 29400-30347 znuA
1050 FUFH01000014.1 GCA900157255_01375 gene open 30463-30732 rpsO
1051 FUFH01000014.1 GCA900157255_01376 gene open 31005-31643
1052 FUFH01000014.1 GCA900157255_01377 gene open 31723-32043
1053 FUFH01000014.1 GCA900157255_01378 gene open 32696-33577 fda
1054 FUFH01000014.1 GCA900157255_01379 gene open 33720-36245 dAP2
1055 FUFH01000014.1 GCA900157255_01380 gene open 36263-37309 selD
1056 FUFH01000014.1 GCA900157255_01381 gene open 37306-37530
1057 FUFH01000014.1 GCA900157255_01382 gene open 37514-38644 csdA
1058 FUFH01000014.1 GCA900157255_01383 gene open 38783-40603 afuC
1059 FUFH01000014.1 GCA900157255_01384 gene open 41047-43074 tktA
1060 FUFH01000014.1 GCA900157255_01385 gene open 43161-43598 rpiB
1061 FUFH01000014.1 GCA900157255_01386 gene open 43633-44070
1062 FUFH01000014.1 GCA900157255_01387 gene open 44298-46913 sfcA
1063 FUFH01000014.1 GCA900157255_01388 gene open 46920-48248 salY
1064 FUFH01000014.1 GCA900157255_01389 gene open 48270-49646 salY
1065 FUFH01000014.1 GCA900157255_01390 gene open 49867-50538 lolD
1066 FUFH01000014.1 GCA900157255_01391 gene open 50618-51868 emrA
1067 FUFH01000014.1 GCA900157255_01392 gene open 52132-53637 tolC
1068 FUFH01000014.1 GCA900157255_01393 gene open 53826-54047
1069 FUFH01000014.1 GCA900157255_01394 gene open 54118-55071 porP
1070 FUFH01000014.1 GCA900157255_01395 gene open 55128-56603 porK
1071 FUFH01000014.1 GCA900157255_01396 gene open 56644-57573 porL
1072 FUFH01000014.1 GCA900157255_01397 gene open 57577-59127 porM
1073 FUFH01000014.1 GCA900157255_01398 gene open 59136-60215 gldN
1074 FUFH01000014.1 GCA900157255_01399 gene open 60376-60966 chrA
1075 FUFH01000014.1 GCA900157255_01400 gene open 61812-62390 zliS
1076 FUFH01000014.1 GCA900157255_01401 gene open 62988-63878 wcaE
1077 FUFH01000014.1 GCA900157255_01402 gene open 63893-65017 dprA
1078 FUFH01000014.1 GCA900157255_01403 gene open 65010-68714 purL
1079 FUFH01000014.1 GCA900157255_01404 gene open 69620-69907
1080 FUFH01000014.1 GCA900157255_01405 gene open 70123-71415 cpoB
1081 FUFH01000014.1 GCA900157255_01406 gene open 71772-72194 rseC
1082 FUFH01000014.1 GCA900157255_01407 gene open 72204-73076 rnfB
1083 FUFH01000014.1 GCA900157255_01408 gene open 73112-74443 rsxC
1084 FUFH01000014.1 GCA900157255_01409 gene open 74459-75442 rnfD
1085 FUFH01000014.1 GCA900157255_01410 gene open 75439-76116 rnfG
1086 FUFH01000014.1 GCA900157255_01411 gene open 76113-76703 rnfE
1087 FUFH01000014.1 GCA900157255_01412 gene open 76728-77300 rnfA
1088 FUFH01000014.1 GCA900157255_01413 gene open 77513-78526 apbE
1089 FUFH01000014.1 GCA900157255_01414 gene open 78523-79062 nfnB
1090 FUFH01000014.1 GCA900157255_01415 gene open 79062-80015 wcaA
1091 FUFH01000014.1 GCA900157255_01416 gene open 80012-80551
1092 FUFH01000014.1 GCA900157255_01417 gene open 80795-81007
1093 FUFH01000014.1 GCA900157255_01418 gene open 81258-81575 rplU
1094 FUFH01000014.1 GCA900157255_01419 gene open 81603-81860 rpmA
1095 FUFH01000014.1 GCA900157255_01420 gene open 81960-83231 serS
1096 FUFH01000014.1 GCA900157255_01421 gene open 83244-85904
1097 FUFH01000014.1 GCA900157255_01422 gene open 86062-86343
1098 FUFH01000014.1 GCA900157255_01423 gene open 86516-86899
1099 FUFH01000014.1 GCA900157255_01424 gene open 86931-88019
1100 FUFH01000014.1 GCA900157255_01425 gene open 88095-89201 meaB
1101 FUFH01000014.1 GCA900157255_01426 gene open 89230-90408 gltP
1102 FUFH01000014.1 GCA900157255_01427 gene open 90531-90860 qdoI
1103 FUFH01000014.1 GCA900157255_01428 gene open 91062-92555 hutH
1104 FUFH01000014.1 GCA900157255_01429 gene open 92558-93187 ftcD
1105 FUFH01000014.1 GCA900157255_01430 gene open 93212-94339 lomR
1106 FUFH01000014.1 GCA900157255_01431 gene open 94380-95534
1107 FUFH01000014.1 GCA900157255_01432 gene open 95628-96878 hutI
1108 FUFH01000014.1 GCA900157255_01433 gene open 97000-97902 ftcD
1109 FUFH01000014.1 GCA900157255_01434 gene open 97951-98466 hupA
1110 FUFH01000014.1 GCA900157255_01435 gene open 100111-101220
1111 FUFH01000014.1 GCA900157255_01436 gene open 101448-102356 rhaT
1112 FUFH01000014.1 GCA900157255_01437 gene open 102367-103326 wcaA
1113 FUFH01000014.1 GCA900157255_01438 gene open 103354-104868
1114 FUFH01000014.1 GCA900157255_01439 gene open 105008-105910 miaA
1115 FUFH01000014.1 GCA900157255_01440 gene open 105931-106500
1116 FUFH01000014.1 GCA900157255_01441 gene open 106788-110315 cas13b
1117 FUFH01000014.1 GCA900157255_01442 gene open 110323-110865 csx28
1118 FUFH01000014.1 GCA900157255_01443 gene open 111802-112047
1119 FUFH01000014.1 GCA900157255_01444 gene open 112129-113310 megL
1120 FUFH01000014.1 GCA900157255_01445 gene open 113491-114960 cpdA
1121 FUFH01000014.1 GCA900157255_01446 gene open 114963-115556
1122 FUFH01000014.1 GCA900157255_01447 gene open 115657-116262 yihA
1123 FUFH01000014.1 GCA900157255_01448 gene open 116272-117300 galE
1124 FUFH01000014.1 GCA900157255_01449 gene open 117343-119439 recG
1125 FUFH01000014.1 GCA900157255_01450 gene open 119439-120209 ycjU
1126 FUFH01000014.1 GCA900157255_01451 gene open 120304-121758 yopM
1127 FUFH01000014.1 GCA900157255_01452 gene open 122186-123766 nanH
1128 FUFH01000014.1 GCA900157255_01348 gene open 1656-1730 trnV
1129 FUFH01000014.1 GCA900157255_01349 gene open 1773-1847 trnV
1130 FUFH01000014.1 GCA900157255_01348 tRNA open 1656-1730 trnV tRNA-Val(tac)
1131 FUFH01000014.1 GCA900157255_01349 tRNA open 1773-1847 trnV tRNA-Val(tac)
1132 FUFH01000015.1 GCA900157255_00238 CDS open 72-323 _na     83_aa BlaI/MecI/CopY family transcriptional regulator
1133 FUFH01000015.1 GCA900157255_00239 CDS open 415-1302 _na     295_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
1134 FUFH01000015.1 GCA900157255_00240 CDS open 1292-2485 _na     397_aa lysA diaminopimelate decarboxylase
1135 FUFH01000015.1 GCA900157255_00241 CDS open 2469-3698 _na     409_aa metL1 Aspartokinase
1136 FUFH01000015.1 GCA900157255_00242 CDS open 3827-4567 _na     246_aa ftsE Cell-division ATP-binding protein
1137 FUFH01000015.1 GCA900157255_00243 CDS open 4949-5962 _na     337_aa lysM Peptidase M24
1138 FUFH01000015.1 GCA900157255_00238 gene open 72-323
1139 FUFH01000015.1 GCA900157255_00239 gene open 415-1302 menA
1140 FUFH01000015.1 GCA900157255_00240 gene open 1292-2485 lysA
1141 FUFH01000015.1 GCA900157255_00241 gene open 2469-3698 metL1
1142 FUFH01000015.1 GCA900157255_00242 gene open 3827-4567 ftsE
1143 FUFH01000015.1 GCA900157255_00243 gene open 4949-5962 lysM
1144 FUFH01000016.1 GCA900157255_00324 CDS open 103-240 _na     45_aa BlaI/MecI/CopY family transcriptional regulator
1145 FUFH01000016.1 GCA900157255_00325 CDS open 275-1591 _na     438_aa mecR1 Putative TonB
1146 FUFH01000016.1 GCA900157255_00326 CDS open 2372-3727 _na     451_aa nqrA NADH:ubiquinone reductase (Na(+)-transporting) subunit A
1147 FUFH01000016.1 GCA900157255_00327 CDS open 3758-4957 _na     399_aa nqrB NADH:ubiquinone reductase (Na(+)-transporting) subunit B
1148 FUFH01000016.1 GCA900157255_00328 CDS open 4981-5715 _na     244_aa nqrC Na(+)-translocating NADH-quinone reductase subunit C
1149 FUFH01000016.1 GCA900157255_00329 CDS open 5721-6350 _na     209_aa nqrD NADH:ubiquinone reductase (Na(+)-transporting) subunit D
1150 FUFH01000016.1 GCA900157255_00330 CDS open 6390-7004 _na     204_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
1151 FUFH01000016.1 GCA900157255_00331 CDS open 7023-8261 _na     412_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
1152 FUFH01000016.1 GCA900157255_00333 CDS open 8804-8947 _na     47_aa hypothetical protein
1153 FUFH01000016.1 GCA900157255_00334 CDS open 9192-9674 _na     160_aa bcp Thioredoxin domain-containing protein
1154 FUFH01000016.1 GCA900157255_00335 CDS open 9730-11475 _na     581_aa DUF5723 domain-containing protein
1155 FUFH01000016.1 GCA900157255_00336 CDS open 11495-12370 _na     291_aa omp28 outer membrane lipoprotein Omp28
1156 FUFH01000016.1 GCA900157255_00337 CDS open 12396-13118 _na     240_aa T9SS C-terminal target domain-containing protein
1157 FUFH01000016.1 GCA900157255_00338 CDS open 13337-14296 _na     319_aa ldhA D-isomer specific 2-hydroxyacid dehydrogenase family protein
1158 FUFH01000016.1 GCA900157255_00339 CDS open 14335-15624 _na     429_aa fucP Putative transmembrane glucose/galactose transporter
1159 FUFH01000016.1 GCA900157255_00340 CDS open 15898-16167 _na     89_aa DNA-binding protein
1160 FUFH01000016.1 GCA900157255_00324 gene open 103-240
1161 FUFH01000016.1 GCA900157255_00325 gene open 275-1591 mecR1
1162 FUFH01000016.1 GCA900157255_00326 gene open 2372-3727 nqrA
1163 FUFH01000016.1 GCA900157255_00327 gene open 3758-4957 nqrB
1164 FUFH01000016.1 GCA900157255_00328 gene open 4981-5715 nqrC
1165 FUFH01000016.1 GCA900157255_00329 gene open 5721-6350 nqrD
1166 FUFH01000016.1 GCA900157255_00330 gene open 6390-7004 nqrE
1167 FUFH01000016.1 GCA900157255_00331 gene open 7023-8261 nqrF
1168 FUFH01000016.1 GCA900157255_00333 gene open 8804-8947
1169 FUFH01000016.1 GCA900157255_00334 gene open 9192-9674 bcp
1170 FUFH01000016.1 GCA900157255_00335 gene open 9730-11475
1171 FUFH01000016.1 GCA900157255_00336 gene open 11495-12370 omp28
1172 FUFH01000016.1 GCA900157255_00337 gene open 12396-13118
1173 FUFH01000016.1 GCA900157255_00338 gene open 13337-14296 ldhA
1174 FUFH01000016.1 GCA900157255_00339 gene open 14335-15624 fucP
1175 FUFH01000016.1 GCA900157255_00340 gene open 15898-16167
1176 FUFH01000016.1 GCA900157255_00332 gene open 8596-8667 trnfM
1177 FUFH01000016.1 GCA900157255_00332 tRNA open 8596-8667 trnfM tRNA-fMet(cat)
1178 FUFH01000017.1 GCA900157255_00890 CDS open 456-1901 _na     481_aa tpr Thiol protease
1179 FUFH01000017.1 GCA900157255_00891 CDS open 2284-2703 _na     139_aa queD 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase
1180 FUFH01000017.1 GCA900157255_00892 CDS open 2723-3316 _na     197_aa queE 7-carboxy-7-deazaguanine synthase
1181 FUFH01000017.1 GCA900157255_00893 CDS open 3338-5356 _na     672_aa ompA OmpA family protein
1182 FUFH01000017.1 GCA900157255_00894 CDS open 5670-6143 _na     157_aa paaI Thioesterase family protein
1183 FUFH01000017.1 GCA900157255_00895 CDS open 6254-6838 _na     194_aa lutC LUD domain-containing protein
1184 FUFH01000017.1 GCA900157255_00896 CDS open 6844-8211 _na     455_aa lutB Putative electron transport protein
1185 FUFH01000017.1 GCA900157255_00897 CDS open 8208-9029 _na     273_aa glpC Oxidoreductase%2C putative
1186 FUFH01000017.1 GCA900157255_00898 CDS open 9269-10141 _na     290_aa serB phosphoserine phosphatase SerB
1187 FUFH01000017.1 GCA900157255_00899 CDS open 10173-10301 _na     42_aa hypothetical protein
1188 FUFH01000017.1 GCA900157255_00900 CDS open 10341-10439 _na     32_aa hypothetical protein
1189 FUFH01000017.1 GCA900157255_00901 CDS open 11033-12379 _na     448_aa ATPase AAA
1190 FUFH01000017.1 GCA900157255_00902 CDS open 12467-14029 _na     520_aa hsdR Type I restriction enzyme HsdR N-terminal domain-containing protein
1191 FUFH01000017.1 GCA900157255_00903 CDS open 14269-15588 _na     439_aa cobB cobyrinate a%2Cc-diamide synthase
1192 FUFH01000017.1 GCA900157255_00904 CDS open 15611-16177 _na     188_aa pduO Corrinoid adenosyltransferase
1193 FUFH01000017.1 GCA900157255_00905 CDS open 16174-17670 _na     498_aa cobyric acid synthase
1194 FUFH01000017.1 GCA900157255_00906 CDS open 17663-18670 _na     335_aa cobD threonine-phosphate decarboxylase CobD
1195 FUFH01000017.1 GCA900157255_00907 CDS open 18645-19694 _na     349_aa cbiB adenosylcobinamide-phosphate synthase CbiB
1196 FUFH01000017.1 GCA900157255_00908 CDS open 20293-20772 _na     159_aa RNA-binding S4 domain-containing protein
1197 FUFH01000017.1 GCA900157255_00909 CDS open 20976-22031 _na     351_aa rfaF ADP-heptose--LPS heptosyltransferase%2C putative
1198 FUFH01000017.1 GCA900157255_00910 CDS open 22115-22720 _na     201_aa DUF4254 domain-containing protein
1199 FUFH01000017.1 GCA900157255_00911 CDS open 22880-23296 _na     138_aa hypothetical protein
1200 FUFH01000017.1 GCA900157255_00912 CDS open 23435-24583 _na     382_aa yqdH Iron-containing alcohol dehydrogenase
1201 FUFH01000017.1 GCA900157255_00913 CDS open 24564-24821 _na     85_aa hypothetical protein
1202 FUFH01000017.1 GCA900157255_00914 CDS open 24964-26052 _na     362_aa rfaB Glycosyl transferase%2C group 1 family protein
1203 FUFH01000017.1 GCA900157255_00915 CDS open 26213-26431 _na     72_aa hypothetical protein
1204 FUFH01000017.1 GCA900157255_00916 CDS open 26438-26530 _na     30_aa hypothetical protein
1205 FUFH01000017.1 GCA900157255_00917 CDS open 27475-29301 _na     608_aa fAA1 Long-chain-fatty-acid-CoA ligase
1206 FUFH01000017.1 GCA900157255_00918 CDS open 29578-30537 _na     319_aa prfB peptide chain release factor 2
1207 FUFH01000017.1 GCA900157255_00919 CDS open 30581-32149 _na     522_aa ugd UDP-glucose 6-dehydrogenase
1208 FUFH01000017.1 GCA900157255_00920 CDS open 32165-33208 _na     347_aa Putative O-antigen polymerase Wzy
1209 FUFH01000017.1 GCA900157255_00921 CDS open 33229-33540 _na     103_aa hypothetical protein
1210 FUFH01000017.1 GCA900157255_00922 CDS open 33587-34738 _na     383_aa rfaB Glycosyl transferase
1211 FUFH01000017.1 GCA900157255_00923 CDS open 34744-35604 _na     286_aa wcaE Glycosyl transferase%2C group 2 family protein
1212 FUFH01000017.1 GCA900157255_00924 CDS open 35724-36851 _na     375_aa DUF4369 domain-containing protein
1213 FUFH01000017.1 GCA900157255_00925 CDS open 37031-38185 _na     384_aa wecE Pigmentation and extracellular proteinase regulator
1214 FUFH01000017.1 GCA900157255_00926 CDS open 38182-39489 _na     435_aa rfbX PorS protein
1215 FUFH01000017.1 GCA900157255_00927 CDS open 39452-41080 _na     542_aa asnB asparagine synthase (glutamine-hydrolyzing)
1216 FUFH01000017.1 GCA900157255_00928 CDS open 41255-41869 _na     204_aa wcaJ Bacterial sugar transferase domain-containing protein
1217 FUFH01000017.1 GCA900157255_00929 CDS open 42019-42195 _na     58_aa hypothetical protein
1218 FUFH01000017.1 GCA900157255_00930 CDS open 42436-43377 _na     313_aa trxB thioredoxin-disulfide reductase
1219 FUFH01000017.1 GCA900157255_00932 CDS open 43704-44156 _na     150_aa hypothetical protein
1220 FUFH01000017.1 GCA900157255_00933 CDS open 44185-46815 _na     876_aa valS valine--tRNA ligase
1221 FUFH01000017.1 GCA900157255_00890 gene open 456-1901 tpr
1222 FUFH01000017.1 GCA900157255_00891 gene open 2284-2703 queD
1223 FUFH01000017.1 GCA900157255_00892 gene open 2723-3316 queE
1224 FUFH01000017.1 GCA900157255_00893 gene open 3338-5356 ompA
1225 FUFH01000017.1 GCA900157255_00894 gene open 5670-6143 paaI
1226 FUFH01000017.1 GCA900157255_00895 gene open 6254-6838 lutC
1227 FUFH01000017.1 GCA900157255_00896 gene open 6844-8211 lutB
1228 FUFH01000017.1 GCA900157255_00897 gene open 8208-9029 glpC
1229 FUFH01000017.1 GCA900157255_00898 gene open 9269-10141 serB
1230 FUFH01000017.1 GCA900157255_00899 gene open 10173-10301
1231 FUFH01000017.1 GCA900157255_00900 gene open 10341-10439
1232 FUFH01000017.1 GCA900157255_00901 gene open 11033-12379
1233 FUFH01000017.1 GCA900157255_00902 gene open 12467-14029 hsdR
1234 FUFH01000017.1 GCA900157255_00903 gene open 14269-15588 cobB
1235 FUFH01000017.1 GCA900157255_00904 gene open 15611-16177 pduO
1236 FUFH01000017.1 GCA900157255_00905 gene open 16174-17670
1237 FUFH01000017.1 GCA900157255_00906 gene open 17663-18670 cobD
1238 FUFH01000017.1 GCA900157255_00907 gene open 18645-19694 cbiB
1239 FUFH01000017.1 GCA900157255_00908 gene open 20293-20772
1240 FUFH01000017.1 GCA900157255_00909 gene open 20976-22031 rfaF
1241 FUFH01000017.1 GCA900157255_00910 gene open 22115-22720
1242 FUFH01000017.1 GCA900157255_00911 gene open 22880-23296
1243 FUFH01000017.1 GCA900157255_00912 gene open 23435-24583 yqdH
1244 FUFH01000017.1 GCA900157255_00913 gene open 24564-24821
1245 FUFH01000017.1 GCA900157255_00914 gene open 24964-26052 rfaB
1246 FUFH01000017.1 GCA900157255_00915 gene open 26213-26431
1247 FUFH01000017.1 GCA900157255_00916 gene open 26438-26530
1248 FUFH01000017.1 GCA900157255_00917 gene open 27475-29301 fAA1
1249 FUFH01000017.1 GCA900157255_00918 gene open 29578-30537 prfB
1250 FUFH01000017.1 GCA900157255_00919 gene open 30581-32149 ugd
1251 FUFH01000017.1 GCA900157255_00920 gene open 32165-33208
1252 FUFH01000017.1 GCA900157255_00921 gene open 33229-33540
1253 FUFH01000017.1 GCA900157255_00922 gene open 33587-34738 rfaB
1254 FUFH01000017.1 GCA900157255_00923 gene open 34744-35604 wcaE
1255 FUFH01000017.1 GCA900157255_00924 gene open 35724-36851
1256 FUFH01000017.1 GCA900157255_00925 gene open 37031-38185 wecE
1257 FUFH01000017.1 GCA900157255_00926 gene open 38182-39489 rfbX
1258 FUFH01000017.1 GCA900157255_00927 gene open 39452-41080 asnB
1259 FUFH01000017.1 GCA900157255_00928 gene open 41255-41869 wcaJ
1260 FUFH01000017.1 GCA900157255_00929 gene open 42019-42195
1261 FUFH01000017.1 GCA900157255_00930 gene open 42436-43377 trxB
1262 FUFH01000017.1 GCA900157255_00932 gene open 43704-44156
1263 FUFH01000017.1 GCA900157255_00933 gene open 44185-46815 valS
1264 FUFH01000017.1 GCA900157255_00931 gene open 43571-43643 trnT
1265 FUFH01000017.1 GCA900157255_00931 tRNA open 43571-43643 trnT tRNA-Thr(cgt)
1266 FUFH01000018.1 GCA900157255_00244 CDS open 33-173 _na     46_aa hypothetical protein
1267 FUFH01000018.1 GCA900157255_00246 CDS open 436-1449 _na     337_aa Bro-N domain-containing protein
1268 FUFH01000018.1 GCA900157255_00247 CDS open 1508-4615 _na     1035_aa Type I restriction enzyme endonuclease subunit
1269 FUFH01000018.1 GCA900157255_00248 CDS open 4615-5724 _na     369_aa AAA family ATPase
1270 FUFH01000018.1 GCA900157255_00249 CDS open 5727-6347 _na     206_aa Restriction endonuclease subunit S
1271 FUFH01000018.1 GCA900157255_00250 CDS open 6356-6955 _na     199_aa Restriction endonuclease subunit S
1272 FUFH01000018.1 GCA900157255_00251 CDS open 6952-8499 _na     515_aa type I restriction-modification system subunit M
1273 FUFH01000018.1 GCA900157255_00252 CDS open 8861-9169 _na     102_aa DUF3853 domain-containing protein
1274 FUFH01000018.1 GCA900157255_00253 CDS open 9166-10218 _na     350_aa Mobilization protein
1275 FUFH01000018.1 GCA900157255_00254 CDS open 10401-11291 _na     296_aa Zinc finger CHC2-type domain-containing protein
1276 FUFH01000018.1 GCA900157255_00255 CDS open 11410-11757 _na     115_aa Mobilization protein
1277 FUFH01000018.1 GCA900157255_00256 CDS open 11754-11975 _na     73_aa hypothetical protein
1278 FUFH01000018.1 GCA900157255_00257 CDS open 11987-12673 _na     228_aa Relaxase/mobilization nuclease domain-containing protein
1279 FUFH01000018.1 GCA900157255_00258 CDS open 12694-13353 _na     219_aa Mobilization protein
1280 FUFH01000018.1 GCA900157255_00259 CDS open 13410-15098 _na     562_aa hypothetical protein
1281 FUFH01000018.1 GCA900157255_00260 CDS open 15098-16384 _na     428_aa yhcG YhcG PDDEXK nuclease domain-containing protein
1282 FUFH01000018.1 GCA900157255_00261 CDS open 16397-17683 _na     428_aa Tyr recombinase domain-containing protein
1283 FUFH01000018.1 GCA900157255_00262 CDS open 17961-18491 _na     176_aa Lipoprotein
1284 FUFH01000018.1 GCA900157255_00263 CDS open 18488-19063 _na     191_aa Peptidoglycan-binding domain-containing protein
1285 FUFH01000018.1 GCA900157255_00264 CDS open 19050-19520 _na     156_aa Phage holin family protein
1286 FUFH01000018.1 GCA900157255_00265 CDS open 19520-19882 _na     120_aa hypothetical protein
1287 FUFH01000018.1 GCA900157255_00266 CDS open 19952-21322 _na     456_aa tail protein
1288 FUFH01000018.1 GCA900157255_00267 CDS open 21324-21596 _na     90_aa DUF1573 domain-containing protein
1289 FUFH01000018.1 GCA900157255_00268 CDS open 21679-24621 _na     980_aa Phage tail protein
1290 FUFH01000018.1 GCA900157255_00269 CDS open 24606-25838 _na     410_aa lamG LamG domain-containing protein
1291 FUFH01000018.1 GCA900157255_00270 CDS open 25848-26366 _na     172_aa hypothetical protein
1292 FUFH01000018.1 GCA900157255_00271 CDS open 26366-30439 _na     1357_aa hypothetical protein
1293 FUFH01000018.1 GCA900157255_00272 CDS open 30641-31213 _na     190_aa hypothetical protein
1294 FUFH01000018.1 GCA900157255_00273 CDS open 31302-31811 _na     169_aa Phage tail protein
1295 FUFH01000018.1 GCA900157255_00274 CDS open 31819-32235 _na     138_aa DUF3168 domain-containing protein
1296 FUFH01000018.1 GCA900157255_00275 CDS open 32239-32694 _na     151_aa ytfJ Sporulation protein YtfJ
1297 FUFH01000018.1 GCA900157255_00276 CDS open 32685-33017 _na     110_aa hypothetical protein
1298 FUFH01000018.1 GCA900157255_00277 CDS open 33019-33333 _na     104_aa DUF6706 domain-containing protein
1299 FUFH01000018.1 GCA900157255_00278 CDS open 33532-34635 _na     367_aa Major capsid protein
1300 FUFH01000018.1 GCA900157255_00279 CDS open 34655-35218 _na     187_aa hypothetical protein
1301 FUFH01000018.1 GCA900157255_00280 CDS open 35231-35932 _na     233_aa DUF4355 domain-containing protein
1302 FUFH01000018.1 GCA900157255_00281 CDS open 36464-37276 _na     270_aa DUF1566 domain-containing protein
1303 FUFH01000018.1 GCA900157255_00282 CDS open 37666-38442 _na     258_aa Phage antirepressor KilAC domain-containing protein
1304 FUFH01000018.1 GCA900157255_00283 CDS open 38439-38699 _na     86_aa hypothetical protein
1305 FUFH01000018.1 GCA900157255_00284 CDS open 39027-39455 _na     142_aa hypothetical protein
1306 FUFH01000018.1 GCA900157255_00285 CDS open 39596-40531 _na     311_aa hypothetical protein
1307 FUFH01000018.1 GCA900157255_00286 CDS open 40528-41421 _na     297_aa Tyrosine-type recombinase/integrase
1308 FUFH01000018.1 GCA900157255_00287 CDS open 41463-41699 _na     78_aa Helix-turn-helix transcriptional regulator
1309 FUFH01000018.1 GCA900157255_00288 CDS open 41693-42475 _na     260_aa ADP-ribosylglycohydrolase family protein
1310 FUFH01000018.1 GCA900157255_00289 CDS open 42468-42794 _na     108_aa hypothetical protein
1311 FUFH01000018.1 GCA900157255_00290 CDS open 42763-44538 _na     591_aa ADP ribosyltransferase domain-containing protein
1312 FUFH01000018.1 GCA900157255_00291 CDS open 44541-44915 _na     124_aa hypothetical protein
1313 FUFH01000018.1 GCA900157255_00292 CDS open 44918-46372 _na     484_aa Phage portal protein
1314 FUFH01000018.1 GCA900157255_00293 CDS open 46391-48838 _na     815_aa Phage terminase large subunit
1315 FUFH01000018.1 GCA900157255_00294 CDS open 48840-49337 _na     165_aa PhBC6A51 family helix-turn-helix protein
1316 FUFH01000018.1 GCA900157255_00295 CDS open 49415-50356 _na     313_aa TET-Associated Glycosyltransferase domain-containing protein
1317 FUFH01000018.1 GCA900157255_00296 CDS open 50340-51197 _na     285_aa ParB/Sulfiredoxin domain-containing protein
1318 FUFH01000018.1 GCA900157255_00297 CDS open 51308-51805 _na     165_aa hypothetical protein
1319 FUFH01000018.1 GCA900157255_00298 CDS open 51824-52093 _na     89_aa hypothetical protein
1320 FUFH01000018.1 GCA900157255_00299 CDS open 52121-52786 _na     221_aa Carbohydrate-binding domain-containing protein
1321 FUFH01000018.1 GCA900157255_00300 CDS open 52794-53246 _na     150_aa yopX YopX family protein
1322 FUFH01000018.1 GCA900157255_00301 CDS open 53465-53671 _na     68_aa DNA methylase N-4/N-6 domain-containing protein
1323 FUFH01000018.1 GCA900157255_00302 CDS open 54506-54691 _na     61_aa Lacal_2735 family protein
1324 FUFH01000018.1 GCA900157255_00303 CDS open 54688-55290 _na     200_aa DUF4406 domain-containing protein
1325 FUFH01000018.1 GCA900157255_00304 CDS open 55287-55508 _na     73_aa EF-hand domain-containing protein
1326 FUFH01000018.1 GCA900157255_00305 CDS open 55505-56239 _na     244_aa IstB-like ATP-binding protein domain-containing protein
1327 FUFH01000018.1 GCA900157255_00306 CDS open 56236-56880 _na     214_aa DUF4373 domain-containing protein
1328 FUFH01000018.1 GCA900157255_00307 CDS open 57008-57436 _na     142_aa DUF4494 domain-containing protein
1329 FUFH01000018.1 GCA900157255_00308 CDS open 57441-57938 _na     165_aa Class I SAM-dependent methyltransferase
1330 FUFH01000018.1 GCA900157255_00309 CDS open 57935-58282 _na     115_aa Phage ABA sandwich domain-containing protein
1331 FUFH01000018.1 GCA900157255_00310 CDS open 58288-58755 _na     155_aa DsRNA-binding protein
1332 FUFH01000018.1 GCA900157255_00311 CDS open 58759-59502 _na     247_aa MBL fold metallo-hydrolase
1333 FUFH01000018.1 GCA900157255_00312 CDS open 59499-59762 _na     87_aa Demethylase
1334 FUFH01000018.1 GCA900157255_00313 CDS open 59764-60672 _na     302_aa recT Recombinase RecT
1335 FUFH01000018.1 GCA900157255_00314 CDS open 60679-62664 _na     661_aa Rad50/SbcC-type AAA domain-containing protein
1336 FUFH01000018.1 GCA900157255_00315 CDS open 62687-63337 _na     216_aa DUF3560 domain-containing protein
1337 FUFH01000018.1 GCA900157255_00316 CDS open 63352-63636 _na     94_aa DUF3853 domain-containing protein
1338 FUFH01000018.1 GCA900157255_00317 CDS open 63633-63809 _na     58_aa hypothetical protein
1339 FUFH01000018.1 GCA900157255_00318 CDS open 63794-64018 _na     74_aa XRE family transcriptional regulator
1340 FUFH01000018.1 GCA900157255_00319 CDS open 64165-64821 _na     218_aa Helix-turn-helix transcriptional regulator
1341 FUFH01000018.1 GCA900157255_00320 CDS open 64839-65129 _na     96_aa Transcriptional regulator
1342 FUFH01000018.1 GCA900157255_00321 CDS open 65134-66402 _na     422_aa Phage integrase SAM-like domain-containing protein
1343 FUFH01000018.1 GCA900157255_00322 CDS open 66404-66607 _na     67_aa hypothetical protein
1344 FUFH01000018.1 GCA900157255_00323 CDS open 66883-68160 _na     425_aa Site-specific recombinase%2C phage integrase family
1345 FUFH01000018.1 GCA900157255_00244 gene open 33-173
1346 FUFH01000018.1 GCA900157255_00246 gene open 436-1449
1347 FUFH01000018.1 GCA900157255_00247 gene open 1508-4615
1348 FUFH01000018.1 GCA900157255_00248 gene open 4615-5724
1349 FUFH01000018.1 GCA900157255_00249 gene open 5727-6347
1350 FUFH01000018.1 GCA900157255_00250 gene open 6356-6955
1351 FUFH01000018.1 GCA900157255_00251 gene open 6952-8499
1352 FUFH01000018.1 GCA900157255_00252 gene open 8861-9169
1353 FUFH01000018.1 GCA900157255_00253 gene open 9166-10218
1354 FUFH01000018.1 GCA900157255_00254 gene open 10401-11291
1355 FUFH01000018.1 GCA900157255_00255 gene open 11410-11757
1356 FUFH01000018.1 GCA900157255_00256 gene open 11754-11975
1357 FUFH01000018.1 GCA900157255_00257 gene open 11987-12673
1358 FUFH01000018.1 GCA900157255_00258 gene open 12694-13353
1359 FUFH01000018.1 GCA900157255_00259 gene open 13410-15098
1360 FUFH01000018.1 GCA900157255_00260 gene open 15098-16384 yhcG
1361 FUFH01000018.1 GCA900157255_00261 gene open 16397-17683
1362 FUFH01000018.1 GCA900157255_00262 gene open 17961-18491
1363 FUFH01000018.1 GCA900157255_00263 gene open 18488-19063
1364 FUFH01000018.1 GCA900157255_00264 gene open 19050-19520
1365 FUFH01000018.1 GCA900157255_00265 gene open 19520-19882
1366 FUFH01000018.1 GCA900157255_00266 gene open 19952-21322
1367 FUFH01000018.1 GCA900157255_00267 gene open 21324-21596
1368 FUFH01000018.1 GCA900157255_00268 gene open 21679-24621
1369 FUFH01000018.1 GCA900157255_00269 gene open 24606-25838 lamG
1370 FUFH01000018.1 GCA900157255_00270 gene open 25848-26366
1371 FUFH01000018.1 GCA900157255_00271 gene open 26366-30439
1372 FUFH01000018.1 GCA900157255_00272 gene open 30641-31213
1373 FUFH01000018.1 GCA900157255_00273 gene open 31302-31811
1374 FUFH01000018.1 GCA900157255_00274 gene open 31819-32235
1375 FUFH01000018.1 GCA900157255_00275 gene open 32239-32694 ytfJ
1376 FUFH01000018.1 GCA900157255_00276 gene open 32685-33017
1377 FUFH01000018.1 GCA900157255_00277 gene open 33019-33333
1378 FUFH01000018.1 GCA900157255_00278 gene open 33532-34635
1379 FUFH01000018.1 GCA900157255_00279 gene open 34655-35218
1380 FUFH01000018.1 GCA900157255_00280 gene open 35231-35932
1381 FUFH01000018.1 GCA900157255_00281 gene open 36464-37276
1382 FUFH01000018.1 GCA900157255_00282 gene open 37666-38442
1383 FUFH01000018.1 GCA900157255_00283 gene open 38439-38699
1384 FUFH01000018.1 GCA900157255_00284 gene open 39027-39455
1385 FUFH01000018.1 GCA900157255_00285 gene open 39596-40531
1386 FUFH01000018.1 GCA900157255_00286 gene open 40528-41421
1387 FUFH01000018.1 GCA900157255_00287 gene open 41463-41699
1388 FUFH01000018.1 GCA900157255_00288 gene open 41693-42475
1389 FUFH01000018.1 GCA900157255_00289 gene open 42468-42794
1390 FUFH01000018.1 GCA900157255_00290 gene open 42763-44538
1391 FUFH01000018.1 GCA900157255_00291 gene open 44541-44915
1392 FUFH01000018.1 GCA900157255_00292 gene open 44918-46372
1393 FUFH01000018.1 GCA900157255_00293 gene open 46391-48838
1394 FUFH01000018.1 GCA900157255_00294 gene open 48840-49337
1395 FUFH01000018.1 GCA900157255_00295 gene open 49415-50356
1396 FUFH01000018.1 GCA900157255_00296 gene open 50340-51197
1397 FUFH01000018.1 GCA900157255_00297 gene open 51308-51805
1398 FUFH01000018.1 GCA900157255_00298 gene open 51824-52093
1399 FUFH01000018.1 GCA900157255_00299 gene open 52121-52786
1400 FUFH01000018.1 GCA900157255_00300 gene open 52794-53246 yopX
1401 FUFH01000018.1 GCA900157255_00301 gene open 53465-53671
1402 FUFH01000018.1 GCA900157255_00302 gene open 54506-54691
1403 FUFH01000018.1 GCA900157255_00303 gene open 54688-55290
1404 FUFH01000018.1 GCA900157255_00304 gene open 55287-55508
1405 FUFH01000018.1 GCA900157255_00305 gene open 55505-56239
1406 FUFH01000018.1 GCA900157255_00306 gene open 56236-56880
1407 FUFH01000018.1 GCA900157255_00307 gene open 57008-57436
1408 FUFH01000018.1 GCA900157255_00308 gene open 57441-57938
1409 FUFH01000018.1 GCA900157255_00309 gene open 57935-58282
1410 FUFH01000018.1 GCA900157255_00310 gene open 58288-58755
1411 FUFH01000018.1 GCA900157255_00311 gene open 58759-59502
1412 FUFH01000018.1 GCA900157255_00312 gene open 59499-59762
1413 FUFH01000018.1 GCA900157255_00313 gene open 59764-60672 recT
1414 FUFH01000018.1 GCA900157255_00314 gene open 60679-62664
1415 FUFH01000018.1 GCA900157255_00315 gene open 62687-63337
1416 FUFH01000018.1 GCA900157255_00316 gene open 63352-63636
1417 FUFH01000018.1 GCA900157255_00317 gene open 63633-63809
1418 FUFH01000018.1 GCA900157255_00318 gene open 63794-64018
1419 FUFH01000018.1 GCA900157255_00319 gene open 64165-64821
1420 FUFH01000018.1 GCA900157255_00320 gene open 64839-65129
1421 FUFH01000018.1 GCA900157255_00321 gene open 65134-66402
1422 FUFH01000018.1 GCA900157255_00322 gene open 66404-66607
1423 FUFH01000018.1 GCA900157255_00323 gene open 66883-68160
1424 FUFH01000018.1 GCA900157255_00245 gene open 234-318 trnS
1425 FUFH01000018.1 GCA900157255_00245 tRNA open 234-318 trnS tRNA-Ser(tga)
1426 FUFH01000019.1 GCA900157255_01247 CDS open 1014-1580 _na     188_aa rpoE RNA polymerase sigma factor
1427 FUFH01000019.1 GCA900157255_01248 CDS open 1628-2038 _na     136_aa hypothetical protein
1428 FUFH01000019.1 GCA900157255_01249 CDS open 2011-2541 _na     176_aa Periplasmic heavy metal sensor
1429 FUFH01000019.1 GCA900157255_01250 CDS open 2616-3164 _na     182_aa slpA Peptidyl-prolyl cis-trans isomerase
1430 FUFH01000019.1 GCA900157255_01251 CDS open 3314-4420 _na     368_aa aroC chorismate synthase
1431 FUFH01000019.1 GCA900157255_01253 CDS open 4793-6451 _na     552_aa pepD Dipeptidase
1432 FUFH01000019.1 GCA900157255_01254 CDS open 7097-8227 _na     376_aa capA CapA protein%2C putative
1433 FUFH01000019.1 GCA900157255_01255 CDS open 8238-8732 _na     164_aa yfcE Phosphoesterase
1434 FUFH01000019.1 GCA900157255_01256 CDS open 8767-9429 _na     220_aa queC 7-cyano-7-deazaguanine synthase QueC
1435 FUFH01000019.1 GCA900157255_01257 CDS open 9835-10680 _na     281_aa DUF3298 domain-containing protein
1436 FUFH01000019.1 GCA900157255_01258 CDS open 10705-11379 _na     224_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1437 FUFH01000019.1 GCA900157255_01259 CDS open 11376-12020 _na     214_aa gloB Metallo-beta-lactamase family protein
1438 FUFH01000019.1 GCA900157255_01260 CDS open 12025-14892 _na     955_aa gcvP aminomethyl-transferring glycine dehydrogenase
1439 FUFH01000019.1 GCA900157255_01247 gene open 1014-1580 rpoE
1440 FUFH01000019.1 GCA900157255_01248 gene open 1628-2038
1441 FUFH01000019.1 GCA900157255_01249 gene open 2011-2541
1442 FUFH01000019.1 GCA900157255_01250 gene open 2616-3164 slpA
1443 FUFH01000019.1 GCA900157255_01251 gene open 3314-4420 aroC
1444 FUFH01000019.1 GCA900157255_01253 gene open 4793-6451 pepD
1445 FUFH01000019.1 GCA900157255_01254 gene open 7097-8227 capA
1446 FUFH01000019.1 GCA900157255_01255 gene open 8238-8732 yfcE
1447 FUFH01000019.1 GCA900157255_01256 gene open 8767-9429 queC
1448 FUFH01000019.1 GCA900157255_01257 gene open 9835-10680
1449 FUFH01000019.1 GCA900157255_01258 gene open 10705-11379 rsmG
1450 FUFH01000019.1 GCA900157255_01259 gene open 11376-12020 gloB
1451 FUFH01000019.1 GCA900157255_01260 gene open 12025-14892 gcvP
1452 FUFH01000019.1 GCA900157255_01252 gene open 4646-4720 trnR
1453 FUFH01000019.1 GCA900157255_01252 tRNA open 4646-4720 trnR tRNA-Arg(cct)
1454 FUFH01000020.1 GCA900157255_01319 CDS open 590-937 _na     115_aa rplT 50S ribosomal protein L20
1455 FUFH01000020.1 GCA900157255_01320 CDS open 1050-1247 _na     65_aa rpmI 50S ribosomal protein L35
1456 FUFH01000020.1 GCA900157255_01321 CDS open 1324-1929 _na     201_aa infC translation initiation factor IF-3
1457 FUFH01000020.1 GCA900157255_01322 CDS open 2033-3994 _na     653_aa thrS threonine--tRNA ligase
1458 FUFH01000020.1 GCA900157255_01323 CDS open 4375-4755 _na     126_aa transposase family protein
1459 FUFH01000020.1 GCA900157255_01324 CDS open 5364-5480 _na     38_aa hypothetical protein
1460 FUFH01000020.1 GCA900157255_01325 CDS open 5537-6463 _na     308_aa yfcH TIGR01777 family protein
1461 FUFH01000020.1 GCA900157255_01326 CDS open 6563-6877 _na     104_aa HTH cro/C1-type domain-containing protein
1462 FUFH01000020.1 GCA900157255_01327 CDS open 6874-6969 _na     31_aa hypothetical protein
1463 FUFH01000020.1 GCA900157255_01328 CDS open 6974-7231 _na     85_aa HXXEE domain-containing protein
1464 FUFH01000020.1 GCA900157255_01329 CDS open 7539-8171 _na     210_aa alkC DNA alkylation repair enzyme
1465 FUFH01000020.1 GCA900157255_01330 CDS open 8175-8711 _na     178_aa dfsB ClbS/DfsB family four-helix bundle protein
1466 FUFH01000020.1 GCA900157255_01331 CDS open 8884-9135 _na     83_aa hypothetical protein
1467 FUFH01000020.1 GCA900157255_01332 CDS open 9209-10201 _na     330_aa Nitroreductase domain-containing protein
1468 FUFH01000020.1 GCA900157255_01319 gene open 590-937 rplT
1469 FUFH01000020.1 GCA900157255_01320 gene open 1050-1247 rpmI
1470 FUFH01000020.1 GCA900157255_01321 gene open 1324-1929 infC
1471 FUFH01000020.1 GCA900157255_01322 gene open 2033-3994 thrS
1472 FUFH01000020.1 GCA900157255_01323 gene open 4375-4755
1473 FUFH01000020.1 GCA900157255_01324 gene open 5364-5480
1474 FUFH01000020.1 GCA900157255_01325 gene open 5537-6463 yfcH
1475 FUFH01000020.1 GCA900157255_01326 gene open 6563-6877
1476 FUFH01000020.1 GCA900157255_01327 gene open 6874-6969
1477 FUFH01000020.1 GCA900157255_01328 gene open 6974-7231
1478 FUFH01000020.1 GCA900157255_01329 gene open 7539-8171 alkC
1479 FUFH01000020.1 GCA900157255_01330 gene open 8175-8711 dfsB
1480 FUFH01000020.1 GCA900157255_01331 gene open 8884-9135
1481 FUFH01000020.1 GCA900157255_01332 gene open 9209-10201
1482 FUFH01000021.1 GCA900157255_01243 CDS open 127-1122 _na     331_aa wcaG Epimerase/reductase%2C putative
1483 FUFH01000021.1 GCA900157255_01244 CDS open 1377-1478 _na     33_aa hypothetical protein
1484 FUFH01000021.1 GCA900157255_01245 CDS open 1829-3148 _na     439_aa gdhA NADP-specific glutamate dehydrogenase
1485 FUFH01000021.1 GCA900157255_01246 CDS open 3354-5462 _na     702_aa Peptidase M3A/M3B catalytic domain-containing protein
1486 FUFH01000021.1 GCA900157255_01243 gene open 127-1122 wcaG
1487 FUFH01000021.1 GCA900157255_01244 gene open 1377-1478
1488 FUFH01000021.1 GCA900157255_01245 gene open 1829-3148 gdhA
1489 FUFH01000021.1 GCA900157255_01246 gene open 3354-5462
1490 FUFH01000022.1 regulatory_region open 4023-4082 SAM-II riboswitch aptamer (SAM-II long loop)
1491 FUFH01000022.1 regulatory_region open 9190-9303 TPP riboswitch aptamer (THI element)
1492 FUFH01000022.1 repeat_region open 70897-71241 CRISPR array with 5 repeats of length 38%2C consensus sequence GTCTTAATAGCCTTACGGACTGTGTATGTATAGTGAGT and spacer length 36
1493 FUFH01000022.1 GCA900157255_02049 CDS open 76-339 _na     87_aa Transposase
1494 FUFH01000022.1 GCA900157255_02050 CDS open 858-1043 _na     61_aa hypothetical protein
1495 FUFH01000022.1 GCA900157255_02051 CDS open 1807-2349 _na     180_aa hypothetical protein
1496 FUFH01000022.1 GCA900157255_02052 CDS open 2445-2924 _na     159_aa Immunity protein 26 of polymorphic toxin system
1497 FUFH01000022.1 GCA900157255_02053 CDS open 3047-3748 _na     233_aa hypothetical protein
1498 FUFH01000022.1 GCA900157255_02054 CDS open 4171-5460 _na     429_aa metK methionine adenosyltransferase
1499 FUFH01000022.1 GCA900157255_02055 CDS open 5589-6266 _na     225_aa thiN thiamine diphosphokinase
1500 FUFH01000022.1 GCA900157255_02056 CDS open 6263-6871 _na     202_aa pnuC nicotinamide riboside transporter PnuC