HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_900157325.1)

Select a Genome:
BAKTA Annotations for GCA_900157325.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
56 2343280 2002 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4129 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4129 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 FUFC01000001.1 GCA900157325_00366 CDS open 149-385 _na     78_aa transposase
2 FUFC01000001.1 GCA900157325_00368 CDS open 781-2244 _na     487_aa trkH Potassium uptake protein TrkH
3 FUFC01000001.1 GCA900157325_00369 CDS open 2271-3611 _na     446_aa trkA Trk system potassium transporter TrkA
4 FUFC01000001.1 GCA900157325_00370 CDS open 3664-5565 _na     633_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
5 FUFC01000001.1 GCA900157325_00371 CDS open 5741-7441 _na     566_aa cTD-A GLUG domain-containing protein
6 FUFC01000001.1 GCA900157325_00372 CDS open 7545-8630 _na     361_aa cpsB Mannose-1-phosphate guanylyltransferase
7 FUFC01000001.1 GCA900157325_00373 CDS open 8665-9939 _na     424_aa DUF2851 domain-containing protein
8 FUFC01000001.1 GCA900157325_00374 CDS open 10118-10354 _na     78_aa transposase
9 FUFC01000001.1 GCA900157325_00366 gene open 149-385
10 FUFC01000001.1 GCA900157325_00368 gene open 781-2244 trkH
11 FUFC01000001.1 GCA900157325_00369 gene open 2271-3611 trkA
12 FUFC01000001.1 GCA900157325_00370 gene open 3664-5565 dxs
13 FUFC01000001.1 GCA900157325_00371 gene open 5741-7441 cTD-A
14 FUFC01000001.1 GCA900157325_00372 gene open 7545-8630 cpsB
15 FUFC01000001.1 GCA900157325_00373 gene open 8665-9939
16 FUFC01000001.1 GCA900157325_00374 gene open 10118-10354
17 FUFC01000001.1 GCA900157325_00367 gene open 519-589 trnC
18 FUFC01000001.1 GCA900157325_00367 tRNA open 519-589 trnC tRNA-Cys(gca)
19 FUFC01000002.1 GCA900157325_00916 CDS open 121-390 _na     89_aa hypothetical protein
20 FUFC01000002.1 GCA900157325_00917 CDS open 967-1368 _na     133_aa hypothetical protein
21 FUFC01000002.1 GCA900157325_00918 CDS open 1365-1814 _na     149_aa Lipoprotein
22 FUFC01000002.1 GCA900157325_00919 CDS open 1937-2605 _na     222_aa yigB HAD-superfamily hydrolase%2C subfamily IA%2C variant 1 family protein
23 FUFC01000002.1 GCA900157325_00920 CDS open 3008-4447 _na     479_aa AAA family ATPase
24 FUFC01000002.1 GCA900157325_00921 CDS open 4642-4833 _na     63_aa Helix-turn-helix domain-containing protein
25 FUFC01000002.1 GCA900157325_00922 CDS open 5001-5594 _na     197_aa serine hydrolase
26 FUFC01000002.1 GCA900157325_00923 CDS open 5605-6612 _na     335_aa Signal transduction histidine kinase internal region domain-containing protein
27 FUFC01000002.1 GCA900157325_00924 CDS open 6670-7728 _na     352_aa Two-component system sensor histidine kinase
28 FUFC01000002.1 GCA900157325_00925 CDS open 7713-8423 _na     236_aa DNA-binding response regulator
29 FUFC01000002.1 GCA900157325_00926 CDS open 8465-8716 _na     83_aa hypothetical protein
30 FUFC01000002.1 GCA900157325_00927 CDS open 8703-9065 _na     120_aa rteC RteC protein
31 FUFC01000002.1 GCA900157325_00928 CDS open 9152-9562 _na     136_aa mobA MobA protein
32 FUFC01000002.1 GCA900157325_00929 CDS open 9870-10229 _na     119_aa hypothetical protein
33 FUFC01000002.1 GCA900157325_00930 CDS open 10290-10718 _na     142_aa DUF3408 domain-containing protein
34 FUFC01000002.1 GCA900157325_00931 CDS open 11187-11393 _na     68_aa hypothetical protein
35 FUFC01000002.1 GCA900157325_00932 CDS open 11655-12203 _na     182_aa Sce7726 family protein
36 FUFC01000002.1 GCA900157325_00933 CDS open 12191-13270 _na     359_aa Beta protein
37 FUFC01000002.1 GCA900157325_00934 CDS open 13263-13817 _na     184_aa immA Metallopeptidase ImmA
38 FUFC01000002.1 GCA900157325_00935 CDS open 13820-14404 _na     194_aa Transmembrane protein
39 FUFC01000002.1 GCA900157325_00936 CDS open 14697-15758 _na     353_aa Site-specific integrase
40 FUFC01000002.1 GCA900157325_00938 CDS open 16556-17164 _na     202_aa ruvA Holliday junction branch migration protein RuvA
41 FUFC01000002.1 GCA900157325_00939 CDS open 17204-24703 _na     2499_aa sprA cell surface protein SprA
42 FUFC01000002.1 GCA900157325_00916 gene open 121-390
43 FUFC01000002.1 GCA900157325_00917 gene open 967-1368
44 FUFC01000002.1 GCA900157325_00918 gene open 1365-1814
45 FUFC01000002.1 GCA900157325_00919 gene open 1937-2605 yigB
46 FUFC01000002.1 GCA900157325_00920 gene open 3008-4447
47 FUFC01000002.1 GCA900157325_00921 gene open 4642-4833
48 FUFC01000002.1 GCA900157325_00922 gene open 5001-5594
49 FUFC01000002.1 GCA900157325_00923 gene open 5605-6612
50 FUFC01000002.1 GCA900157325_00924 gene open 6670-7728
51 FUFC01000002.1 GCA900157325_00925 gene open 7713-8423
52 FUFC01000002.1 GCA900157325_00926 gene open 8465-8716
53 FUFC01000002.1 GCA900157325_00927 gene open 8703-9065 rteC
54 FUFC01000002.1 GCA900157325_00928 gene open 9152-9562 mobA
55 FUFC01000002.1 GCA900157325_00929 gene open 9870-10229
56 FUFC01000002.1 GCA900157325_00930 gene open 10290-10718
57 FUFC01000002.1 GCA900157325_00931 gene open 11187-11393
58 FUFC01000002.1 GCA900157325_00932 gene open 11655-12203
59 FUFC01000002.1 GCA900157325_00933 gene open 12191-13270
60 FUFC01000002.1 GCA900157325_00934 gene open 13263-13817 immA
61 FUFC01000002.1 GCA900157325_00935 gene open 13820-14404
62 FUFC01000002.1 GCA900157325_00936 gene open 14697-15758
63 FUFC01000002.1 GCA900157325_00938 gene open 16556-17164 ruvA
64 FUFC01000002.1 GCA900157325_00939 gene open 17204-24703 sprA
65 FUFC01000002.1 GCA900157325_00937 gene open 16070-16154 trnS
66 FUFC01000002.1 GCA900157325_00937 tRNA open 16070-16154 trnS tRNA-Ser(tga)
67 FUFC01000003.1 repeat_region open 25402-29777 CRISPR array with 67 repeats of length 30%2C consensus sequence ATTTCAATTGCACCATACAGGAATTAAAAC and spacer length 35
68 FUFC01000003.1 GCA900157325_00808 CDS open 514-963 _na     149_aa ampD N-acetylmuramoyl-L-alanine amidase
69 FUFC01000003.1 GCA900157325_00809 CDS open 1104-1577 _na     157_aa DNA-binding protein%2C histone-like family
70 FUFC01000003.1 GCA900157325_00810 CDS open 1648-1827 _na     59_aa hypothetical protein
71 FUFC01000003.1 GCA900157325_00811 CDS open 2188-2919 _na     243_aa porT Outer membrane protein beta-barrel domain-containing protein
72 FUFC01000003.1 GCA900157325_00812 CDS open 3051-4568 _na     505_aa trxA Thioredoxin domain-containing protein
73 FUFC01000003.1 GCA900157325_00813 CDS open 5555-10669 _na     1704_aa rgpA Arg-gingipain RgpA
74 FUFC01000003.1 GCA900157325_00815 CDS open 11215-12186 _na     323_aa fmt methionyl-tRNA formyltransferase
75 FUFC01000003.1 GCA900157325_00816 CDS open 12351-14894 _na     847_aa yfhO YfhO family protein
76 FUFC01000003.1 GCA900157325_00817 CDS open 14898-16829 _na     643_aa mdoB Sulfatase N-terminal domain-containing protein
77 FUFC01000003.1 GCA900157325_00818 CDS open 17478-18143 _na     221_aa cas6 CRISPR-associated endoribonuclease Cas6
78 FUFC01000003.1 GCA900157325_00819 CDS open 18150-18755 _na     201_aa CRISPR-associated protein Cas5
79 FUFC01000003.1 GCA900157325_00820 CDS open 18748-20880 _na     710_aa CRISPR-associated helicase Cas3
80 FUFC01000003.1 GCA900157325_00821 CDS open 20892-22190 _na     432_aa hypothetical protein
81 FUFC01000003.1 GCA900157325_00822 CDS open 22199-23308 _na     369_aa CRISPR-associated protein Cas7
82 FUFC01000003.1 GCA900157325_00823 CDS open 23340-23879 _na     179_aa cas4 CRISPR-associated protein Cas4
83 FUFC01000003.1 GCA900157325_00824 CDS open 23876-24892 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
84 FUFC01000003.1 GCA900157325_00825 CDS open 24892-25155 _na     87_aa cas2 CRISPR-associated endonuclease Cas2
85 FUFC01000003.1 GCA900157325_00808 gene open 514-963 ampD
86 FUFC01000003.1 GCA900157325_00809 gene open 1104-1577
87 FUFC01000003.1 GCA900157325_00810 gene open 1648-1827
88 FUFC01000003.1 GCA900157325_00811 gene open 2188-2919 porT
89 FUFC01000003.1 GCA900157325_00812 gene open 3051-4568 trxA
90 FUFC01000003.1 GCA900157325_00813 gene open 5555-10669 rgpA
91 FUFC01000003.1 GCA900157325_00815 gene open 11215-12186 fmt
92 FUFC01000003.1 GCA900157325_00816 gene open 12351-14894 yfhO
93 FUFC01000003.1 GCA900157325_00817 gene open 14898-16829 mdoB
94 FUFC01000003.1 GCA900157325_00818 gene open 17478-18143 cas6
95 FUFC01000003.1 GCA900157325_00819 gene open 18150-18755
96 FUFC01000003.1 GCA900157325_00820 gene open 18748-20880
97 FUFC01000003.1 GCA900157325_00821 gene open 20892-22190
98 FUFC01000003.1 GCA900157325_00822 gene open 22199-23308
99 FUFC01000003.1 GCA900157325_00823 gene open 23340-23879 cas4
100 FUFC01000003.1 GCA900157325_00824 gene open 23876-24892 cas1b
101 FUFC01000003.1 GCA900157325_00825 gene open 24892-25155 cas2
102 FUFC01000003.1 GCA900157325_00814 gene open 10915-10988 trnD
103 FUFC01000003.1 GCA900157325_00814 tRNA open 10915-10988 trnD tRNA-Asp(gtc)
104 FUFC01000004.1 GCA900157325_01311 CDS open 168-404 _na     78_aa transposase
105 FUFC01000004.1 GCA900157325_01312 CDS open 401-808 _na     135_aa helix-turn-helix domain-containing protein
106 FUFC01000004.1 GCA900157325_01313 CDS open 1053-2477 _na     474_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
107 FUFC01000004.1 GCA900157325_01314 CDS open 2641-3552 _na     303_aa gldB Gliding motility protein GldB
108 FUFC01000004.1 GCA900157325_01315 CDS open 3725-3901 _na     58_aa hypothetical protein
109 FUFC01000004.1 GCA900157325_01316 CDS open 3822-4325 _na     167_aa traJ Conjugative transposon TraJ C-terminal domain-containing protein
110 FUFC01000004.1 GCA900157325_01317 CDS open 4378-4881 _na     167_aa bcp thioredoxin-dependent thiol peroxidase
111 FUFC01000004.1 GCA900157325_01318 CDS open 4902-5924 _na     340_aa recA recombinase RecA
112 FUFC01000004.1 GCA900157325_01319 CDS open 6034-6963 _na     309_aa BioF2-like acetyltransferase domain-containing protein
113 FUFC01000004.1 GCA900157325_01320 CDS open 6960-8321 _na     453_aa DUF7033 domain-containing protein
114 FUFC01000004.1 GCA900157325_01321 CDS open 8318-9568 _na     416_aa rfaB Glycosyltransferase
115 FUFC01000004.1 GCA900157325_01322 CDS open 9584-10684 _na     366_aa aroGA Chorismate mutase
116 FUFC01000004.1 GCA900157325_01323 CDS open 10681-11445 _na     254_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
117 FUFC01000004.1 GCA900157325_01324 CDS open 11945-13141 _na     398_aa pepP Peptidase M24
118 FUFC01000004.1 GCA900157325_01325 CDS open 13177-14868 _na     563_aa phoA Alkaline phosphatase%2C putative
119 FUFC01000004.1 GCA900157325_01326 CDS open 14970-15194 _na     74_aa hypothetical protein
120 FUFC01000004.1 GCA900157325_01311 gene open 168-404
121 FUFC01000004.1 GCA900157325_01312 gene open 401-808
122 FUFC01000004.1 GCA900157325_01313 gene open 1053-2477 mnmE
123 FUFC01000004.1 GCA900157325_01314 gene open 2641-3552 gldB
124 FUFC01000004.1 GCA900157325_01315 gene open 3725-3901
125 FUFC01000004.1 GCA900157325_01316 gene open 3822-4325 traJ
126 FUFC01000004.1 GCA900157325_01317 gene open 4378-4881 bcp
127 FUFC01000004.1 GCA900157325_01318 gene open 4902-5924 recA
128 FUFC01000004.1 GCA900157325_01319 gene open 6034-6963
129 FUFC01000004.1 GCA900157325_01320 gene open 6960-8321
130 FUFC01000004.1 GCA900157325_01321 gene open 8318-9568 rfaB
131 FUFC01000004.1 GCA900157325_01322 gene open 9584-10684 aroGA
132 FUFC01000004.1 GCA900157325_01323 gene open 10681-11445 folK
133 FUFC01000004.1 GCA900157325_01324 gene open 11945-13141 pepP
134 FUFC01000004.1 GCA900157325_01325 gene open 13177-14868 phoA
135 FUFC01000004.1 GCA900157325_01326 gene open 14970-15194
136 FUFC01000005.1 GCA900157325_00940 CDS open 20-664 _na     214_aa DUF998 domain-containing protein
137 FUFC01000005.1 GCA900157325_00941 CDS open 975-1193 _na     72_aa Phage protein
138 FUFC01000005.1 GCA900157325_00942 CDS open 1198-1458 _na     86_aa hypothetical protein
139 FUFC01000005.1 GCA900157325_00943 CDS open 1483-2754 _na     423_aa PcfJ-like protein
140 FUFC01000005.1 GCA900157325_00944 CDS open 2766-3188 _na     140_aa PcfK-like protein
141 FUFC01000005.1 GCA900157325_00945 CDS open 3195-3497 _na     100_aa hypothetical protein
142 FUFC01000005.1 GCA900157325_00946 CDS open 3510-3791 _na     93_aa Intein
143 FUFC01000005.1 GCA900157325_00947 CDS open 3814-4041 _na     75_aa Lipoprotein
144 FUFC01000005.1 GCA900157325_00948 CDS open 4054-4575 _na     173_aa DUF4375 domain-containing protein
145 FUFC01000005.1 GCA900157325_00949 CDS open 4582-4941 _na     119_aa hypothetical protein
146 FUFC01000005.1 GCA900157325_00950 CDS open 5300-5758 _na     152_aa DUF1896 domain-containing protein
147 FUFC01000005.1 GCA900157325_00951 CDS open 5784-6317 _na     177_aa KilA-N DNA-binding domain-containing protein
148 FUFC01000005.1 GCA900157325_00952 CDS open 6353-7585 _na     410_aa Tyr recombinase domain-containing protein
149 FUFC01000005.1 GCA900157325_00954 CDS open 8198-8866 _na     222_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
150 FUFC01000005.1 GCA900157325_00955 CDS open 8863-9057 _na     64_aa xseB exodeoxyribonuclease VII small subunit
151 FUFC01000005.1 GCA900157325_00956 CDS open 9393-11255 _na     620_aa pilF histidine kinase
152 FUFC01000005.1 GCA900157325_00957 CDS open 11268-11945 _na     225_aa citB FimR protein
153 FUFC01000005.1 GCA900157325_00958 CDS open 12059-12745 _na     228_aa cpoB TPR domain protein
154 FUFC01000005.1 GCA900157325_00959 CDS open 12837-13322 _na     161_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
155 FUFC01000005.1 GCA900157325_00960 CDS open 13462-15993 _na     843_aa cTD-A Thiol protease/hemagglutinin PrtT%2C putative
156 FUFC01000005.1 GCA900157325_00961 CDS open 17048-18718 _na     556_aa cTD-A peptidylarginine deiminase PPAD
157 FUFC01000005.1 GCA900157325_00962 CDS open 18939-20471 _na     510_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
158 FUFC01000005.1 GCA900157325_00963 CDS open 20614-20823 _na     69_aa hypothetical protein
159 FUFC01000005.1 GCA900157325_00964 CDS open 20807-20977 _na     56_aa Ferredoxin
160 FUFC01000005.1 GCA900157325_00965 CDS open 21414-23306 _na     630_aa dnaX DNA polymerase III subunit gamma/tau
161 FUFC01000005.1 GCA900157325_00966 CDS open 23345-24991 _na     548_aa ttdA Fumarate hydratase class I
162 FUFC01000005.1 GCA900157325_00967 CDS open 25288-26229 _na     313_aa yrpB Enoyl-(Acyl-carrier-protein) reductase II
163 FUFC01000005.1 GCA900157325_00968 CDS open 26664-29267 _na     867_aa btuB TonB-dependent receptor plug domain-containing protein
164 FUFC01000005.1 GCA900157325_00969 CDS open 30018-30320 _na     100_aa hypothetical protein
165 FUFC01000005.1 GCA900157325_00940 gene open 20-664
166 FUFC01000005.1 GCA900157325_00941 gene open 975-1193
167 FUFC01000005.1 GCA900157325_00942 gene open 1198-1458
168 FUFC01000005.1 GCA900157325_00943 gene open 1483-2754
169 FUFC01000005.1 GCA900157325_00944 gene open 2766-3188
170 FUFC01000005.1 GCA900157325_00945 gene open 3195-3497
171 FUFC01000005.1 GCA900157325_00946 gene open 3510-3791
172 FUFC01000005.1 GCA900157325_00947 gene open 3814-4041
173 FUFC01000005.1 GCA900157325_00948 gene open 4054-4575
174 FUFC01000005.1 GCA900157325_00949 gene open 4582-4941
175 FUFC01000005.1 GCA900157325_00950 gene open 5300-5758
176 FUFC01000005.1 GCA900157325_00951 gene open 5784-6317
177 FUFC01000005.1 GCA900157325_00952 gene open 6353-7585
178 FUFC01000005.1 GCA900157325_00954 gene open 8198-8866 ispD
179 FUFC01000005.1 GCA900157325_00955 gene open 8863-9057 xseB
180 FUFC01000005.1 GCA900157325_00956 gene open 9393-11255 pilF
181 FUFC01000005.1 GCA900157325_00957 gene open 11268-11945 citB
182 FUFC01000005.1 GCA900157325_00958 gene open 12059-12745 cpoB
183 FUFC01000005.1 GCA900157325_00959 gene open 12837-13322 ribH
184 FUFC01000005.1 GCA900157325_00960 gene open 13462-15993 cTD-A
185 FUFC01000005.1 GCA900157325_00961 gene open 17048-18718 cTD-A
186 FUFC01000005.1 GCA900157325_00962 gene open 18939-20471 dacB
187 FUFC01000005.1 GCA900157325_00963 gene open 20614-20823
188 FUFC01000005.1 GCA900157325_00964 gene open 20807-20977
189 FUFC01000005.1 GCA900157325_00965 gene open 21414-23306 dnaX
190 FUFC01000005.1 GCA900157325_00966 gene open 23345-24991 ttdA
191 FUFC01000005.1 GCA900157325_00967 gene open 25288-26229 yrpB
192 FUFC01000005.1 GCA900157325_00968 gene open 26664-29267 btuB
193 FUFC01000005.1 GCA900157325_00969 gene open 30018-30320
194 FUFC01000005.1 GCA900157325_00953 gene open 7896-7969 trnD
195 FUFC01000005.1 GCA900157325_00953 tRNA open 7896-7969 trnD tRNA-Asp(gtc)
196 FUFC01000006.1 GCA900157325_00970 CDS open 567-2117 _na     516_aa lldP L-lactate permease
197 FUFC01000006.1 GCA900157325_00971 CDS open 2192-2380 _na     62_aa hypothetical protein
198 FUFC01000006.1 GCA900157325_00972 CDS open 2443-2904 _na     153_aa Cell division protein
199 FUFC01000006.1 GCA900157325_00973 CDS open 2904-3920 _na     338_aa murB UDP-N-acetylmuramate dehydrogenase
200 FUFC01000006.1 GCA900157325_00974 CDS open 3947-5425 _na     492_aa lipB MBL fold metallo-hydrolase
201 FUFC01000006.1 GCA900157325_00975 CDS open 5909-7030 _na     373_aa rfaB Glycosyl transferase family 1 domain-containing protein
202 FUFC01000006.1 GCA900157325_00976 CDS open 7027-8298 _na     423_aa rfaB Glycosyl transferase%2C group 1 family protein
203 FUFC01000006.1 GCA900157325_00977 CDS open 8435-8899 _na     154_aa queF preQ(1) synthase
204 FUFC01000006.1 GCA900157325_00978 CDS open 8927-9808 _na     293_aa lCB5 DAGKc domain-containing protein
205 FUFC01000006.1 GCA900157325_00979 CDS open 9951-10415 _na     154_aa Rieske domain-containing protein
206 FUFC01000006.1 GCA900157325_00980 CDS open 10450-10863 _na     137_aa Polyketide cyclase
207 FUFC01000006.1 GCA900157325_00981 CDS open 10915-11547 _na     210_aa pyrE Orotate phosphoribosyltransferase
208 FUFC01000006.1 GCA900157325_00982 CDS open 11658-12479 _na     273_aa nit1 Hydrolase%2C carbon-nitrogen family
209 FUFC01000006.1 GCA900157325_00983 CDS open 12476-12991 _na     171_aa plsC Acyltransferase%2C putative
210 FUFC01000006.1 GCA900157325_00984 CDS open 13075-13476 _na     133_aa hypothetical protein
211 FUFC01000006.1 GCA900157325_00985 CDS open 13865-14044 _na     59_aa hypothetical protein
212 FUFC01000006.1 GCA900157325_00986 CDS open 14041-14172 _na     43_aa hypothetical protein
213 FUFC01000006.1 GCA900157325_00987 CDS open 14281-14706 _na     141_aa hypothetical protein
214 FUFC01000006.1 GCA900157325_00970 gene open 567-2117 lldP
215 FUFC01000006.1 GCA900157325_00971 gene open 2192-2380
216 FUFC01000006.1 GCA900157325_00972 gene open 2443-2904
217 FUFC01000006.1 GCA900157325_00973 gene open 2904-3920 murB
218 FUFC01000006.1 GCA900157325_00974 gene open 3947-5425 lipB
219 FUFC01000006.1 GCA900157325_00975 gene open 5909-7030 rfaB
220 FUFC01000006.1 GCA900157325_00976 gene open 7027-8298 rfaB
221 FUFC01000006.1 GCA900157325_00977 gene open 8435-8899 queF
222 FUFC01000006.1 GCA900157325_00978 gene open 8927-9808 lCB5
223 FUFC01000006.1 GCA900157325_00979 gene open 9951-10415
224 FUFC01000006.1 GCA900157325_00980 gene open 10450-10863
225 FUFC01000006.1 GCA900157325_00981 gene open 10915-11547 pyrE
226 FUFC01000006.1 GCA900157325_00982 gene open 11658-12479 nit1
227 FUFC01000006.1 GCA900157325_00983 gene open 12476-12991 plsC
228 FUFC01000006.1 GCA900157325_00984 gene open 13075-13476
229 FUFC01000006.1 GCA900157325_00985 gene open 13865-14044
230 FUFC01000006.1 GCA900157325_00986 gene open 14041-14172
231 FUFC01000006.1 GCA900157325_00987 gene open 14281-14706
232 FUFC01000007.1 GCA900157325_00696 gene open 669-2200 rrs
233 FUFC01000007.1 GCA900157325_00700 gene open 2951-5850 rrl
234 FUFC01000007.1 GCA900157325_00701 gene open 5945-6055 rrf
235 FUFC01000007.1 GCA900157325_00696 rRNA open 669-2200 rrs 16S ribosomal RNA
236 FUFC01000007.1 GCA900157325_00700 rRNA open 2951-5850 rrl 23S ribosomal RNA
237 FUFC01000007.1 GCA900157325_00701 rRNA open 5945-6055 rrf 5S ribosomal RNA
238 FUFC01000007.1 GCA900157325_00697 CDS open 2252-2683 _na     143_aa hypothetical protein
239 FUFC01000007.1 GCA900157325_00697 gene open 2252-2683
240 FUFC01000007.1 GCA900157325_00698 gene open 2693-2766 trnI
241 FUFC01000007.1 GCA900157325_00699 gene open 2768-2841 trnA
242 FUFC01000007.1 GCA900157325_00698 tRNA open 2693-2766 trnI tRNA-Ile(gat)
243 FUFC01000007.1 GCA900157325_00699 tRNA open 2768-2841 trnA tRNA-Ala(tgc)
244 FUFC01000008.1 rep_origin open 8421-8897
245 FUFC01000008.1 GCA900157325_01080 CDS open 8-205 _na     65_aa hypothetical protein
246 FUFC01000008.1 GCA900157325_01081 CDS open 685-849 _na     54_aa hypothetical protein
247 FUFC01000008.1 GCA900157325_01082 CDS open 929-2320 _na     463_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
248 FUFC01000008.1 GCA900157325_01083 CDS open 2317-3234 _na     305_aa lpxP Acyltransferase%2C HtrB/MsbB family
249 FUFC01000008.1 GCA900157325_01084 CDS open 3231-4241 _na     336_aa wcaE Glycosyltransferase 2-like domain-containing protein
250 FUFC01000008.1 GCA900157325_01085 CDS open 4384-4980 _na     198_aa terC TerC family integral membrane protein
251 FUFC01000008.1 GCA900157325_01086 CDS open 4973-5269 _na     98_aa marR Winged helix DNA-binding domain-containing protein
252 FUFC01000008.1 GCA900157325_01087 CDS open 5349-7571 _na     740_aa fepA Collagen-binding protein
253 FUFC01000008.1 GCA900157325_01088 CDS open 7568-8224 _na     218_aa TPR domain protein
254 FUFC01000008.1 GCA900157325_01089 CDS open 8898-10319 _na     473_aa dnaA chromosomal replication initiator protein DnaA
255 FUFC01000008.1 GCA900157325_01090 CDS open 10332-10904 _na     190_aa wbbJ Hexapeptide transferase family protein
256 FUFC01000008.1 GCA900157325_01091 CDS open 10906-11925 _na     339_aa wecH Acyltransferase 3 domain-containing protein
257 FUFC01000008.1 GCA900157325_01092 CDS open 12005-12709 _na     234_aa sIR2 NAD-dependent protein deacylase
258 FUFC01000008.1 GCA900157325_01093 CDS open 12784-13938 _na     384_aa yaeI Calcineurin-like phosphoesterase domain-containing protein
259 FUFC01000008.1 GCA900157325_01094 CDS open 13991-15370 _na     459_aa norM Multidrug export protein MepA
260 FUFC01000008.1 GCA900157325_01097 CDS open 16297-18876 _na     859_aa clpC ATP-dependent Clp protease%2C ATP-binding subunit ClpC
261 FUFC01000008.1 GCA900157325_01098 CDS open 19015-22026 _na     1003_aa ampC beta-N-acetylhexosaminidase
262 FUFC01000008.1 GCA900157325_01099 CDS open 22074-23102 _na     342_aa hisC L-threonine-O-3-phosphate decarboxylase%2C putative
263 FUFC01000008.1 GCA900157325_01100 CDS open 23112-23882 _na     256_aa comB putative 2-phosphosulfolactate phosphatase
264 FUFC01000008.1 GCA900157325_01101 CDS open 24426-25775 _na     449_aa atoC Sigma-54 dependent DNA-binding response regulator
265 FUFC01000008.1 GCA900157325_01102 CDS open 25786-27123 _na     445_aa histidine kinase
266 FUFC01000008.1 GCA900157325_01103 CDS open 27127-29373 _na     748_aa Lipoprotein
267 FUFC01000008.1 GCA900157325_01104 CDS open 29458-30162 _na     234_aa marR Transcriptional regulator%2C MarR family
268 FUFC01000008.1 GCA900157325_01105 CDS open 30148-31149 _na     333_aa dusB tRNA dihydrouridine synthase DusB
269 FUFC01000008.1 GCA900157325_01106 CDS open 31146-32822 _na     558_aa sUL1 Sulfate permease
270 FUFC01000008.1 GCA900157325_01107 CDS open 33632-33787 _na     51_aa hypothetical protein
271 FUFC01000008.1 GCA900157325_01108 CDS open 33807-34463 _na     218_aa rex redox-sensing transcriptional repressor Rex
272 FUFC01000008.1 GCA900157325_01109 CDS open 34532-35191 _na     219_aa ycgM 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase
273 FUFC01000008.1 GCA900157325_01110 CDS open 35204-38680 _na     1158_aa porU Por secretion system protein porU
274 FUFC01000008.1 GCA900157325_01111 CDS open 38756-39931 _na     391_aa porV type IX secretion system outer membrane channel protein PorV
275 FUFC01000008.1 GCA900157325_01112 CDS open 39938-40426 _na     162_aa ispF 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
276 FUFC01000008.1 GCA900157325_01113 CDS open 40529-41113 _na     194_aa spoU RNA methyltransferase%2C TrmH family
277 FUFC01000008.1 GCA900157325_01115 CDS open 41923-42399 _na     158_aa cdd cytidine deaminase
278 FUFC01000008.1 GCA900157325_01116 CDS open 43151-43939 _na     262_aa hypothetical protein
279 FUFC01000008.1 GCA900157325_01117 CDS open 43953-44735 _na     260_aa endonuclease/exonuclease/phosphatase family protein
280 FUFC01000008.1 GCA900157325_01118 CDS open 44906-45805 _na     299_aa radical SAM protein
281 FUFC01000008.1 GCA900157325_01119 CDS open 45819-46709 _na     296_aa hypothetical protein
282 FUFC01000008.1 GCA900157325_01120 CDS open 46782-47294 _na     170_aa tmk dTMP kinase
283 FUFC01000008.1 GCA900157325_01121 CDS open 47454-50039 _na     861_aa lacZ beta-mannosidase
284 FUFC01000008.1 GCA900157325_01122 CDS open 50069-51367 _na     432_aa rmuC DNA recombination protein RmuC
285 FUFC01000008.1 GCA900157325_01123 CDS open 52085-52399 _na     104_aa trxA thioredoxin
286 FUFC01000008.1 GCA900157325_01124 CDS open 52448-56134 _na     1228_aa dnaE DNA polymerase III subunit alpha
287 FUFC01000008.1 GCA900157325_01125 CDS open 56413-56778 _na     121_aa rplS 50S ribosomal protein L19
288 FUFC01000008.1 GCA900157325_01126 CDS open 58005-59285 _na     426_aa glyA Serine hydroxymethyltransferase
289 FUFC01000008.1 GCA900157325_01127 CDS open 59445-61778 _na     777_aa nahA Beta-hexosaminidase
290 FUFC01000008.1 GCA900157325_01128 CDS open 62444-64498 _na     684_aa htpG molecular chaperone HtpG
291 FUFC01000008.1 GCA900157325_01129 CDS open 64681-65535 _na     284_aa cdsA Phosphatidate cytidylyltransferase
292 FUFC01000008.1 GCA900157325_01130 CDS open 65564-67585 _na     673_aa ftsH ATP-dependent zinc metalloprotease FtsH
293 FUFC01000008.1 GCA900157325_01131 CDS open 67789-68892 _na     367_aa ychF redox-regulated ATPase YchF
294 FUFC01000008.1 GCA900157325_01132 CDS open 69372-70385 _na     337_aa lysM Peptidase M24
295 FUFC01000008.1 GCA900157325_01133 CDS open 70514-70708 _na     64_aa hypothetical protein
296 FUFC01000008.1 GCA900157325_01134 CDS open 70778-71518 _na     246_aa ftsE Cell-division ATP-binding protein
297 FUFC01000008.1 GCA900157325_01135 CDS open 71536-72876 _na     446_aa metL1 Aspartokinase
298 FUFC01000008.1 GCA900157325_01136 CDS open 72860-74050 _na     396_aa lysA diaminopimelate decarboxylase
299 FUFC01000008.1 GCA900157325_01137 CDS open 74043-74930 _na     295_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
300 FUFC01000008.1 GCA900157325_01138 CDS open 75022-75402 _na     126_aa copY Transcriptional regulator%2C putative
301 FUFC01000008.1 GCA900157325_01139 CDS open 75437-76753 _na     438_aa mecR1 Putative TonB
302 FUFC01000008.1 GCA900157325_01140 CDS open 76946-77038 _na     30_aa hypothetical protein
303 FUFC01000008.1 GCA900157325_01141 CDS open 77347-78231 _na     294_aa DUF3078 domain-containing protein
304 FUFC01000008.1 GCA900157325_01080 gene open 8-205
305 FUFC01000008.1 GCA900157325_01081 gene open 685-849
306 FUFC01000008.1 GCA900157325_01082 gene open 929-2320 mtaB
307 FUFC01000008.1 GCA900157325_01083 gene open 2317-3234 lpxP
308 FUFC01000008.1 GCA900157325_01084 gene open 3231-4241 wcaE
309 FUFC01000008.1 GCA900157325_01085 gene open 4384-4980 terC
310 FUFC01000008.1 GCA900157325_01086 gene open 4973-5269 marR
311 FUFC01000008.1 GCA900157325_01087 gene open 5349-7571 fepA
312 FUFC01000008.1 GCA900157325_01088 gene open 7568-8224
313 FUFC01000008.1 GCA900157325_01089 gene open 8898-10319 dnaA
314 FUFC01000008.1 GCA900157325_01090 gene open 10332-10904 wbbJ
315 FUFC01000008.1 GCA900157325_01091 gene open 10906-11925 wecH
316 FUFC01000008.1 GCA900157325_01092 gene open 12005-12709 sIR2
317 FUFC01000008.1 GCA900157325_01093 gene open 12784-13938 yaeI
318 FUFC01000008.1 GCA900157325_01094 gene open 13991-15370 norM
319 FUFC01000008.1 GCA900157325_01097 gene open 16297-18876 clpC
320 FUFC01000008.1 GCA900157325_01098 gene open 19015-22026 ampC
321 FUFC01000008.1 GCA900157325_01099 gene open 22074-23102 hisC
322 FUFC01000008.1 GCA900157325_01100 gene open 23112-23882 comB
323 FUFC01000008.1 GCA900157325_01101 gene open 24426-25775 atoC
324 FUFC01000008.1 GCA900157325_01102 gene open 25786-27123
325 FUFC01000008.1 GCA900157325_01103 gene open 27127-29373
326 FUFC01000008.1 GCA900157325_01104 gene open 29458-30162 marR
327 FUFC01000008.1 GCA900157325_01105 gene open 30148-31149 dusB
328 FUFC01000008.1 GCA900157325_01106 gene open 31146-32822 sUL1
329 FUFC01000008.1 GCA900157325_01107 gene open 33632-33787
330 FUFC01000008.1 GCA900157325_01108 gene open 33807-34463 rex
331 FUFC01000008.1 GCA900157325_01109 gene open 34532-35191 ycgM
332 FUFC01000008.1 GCA900157325_01110 gene open 35204-38680 porU
333 FUFC01000008.1 GCA900157325_01111 gene open 38756-39931 porV
334 FUFC01000008.1 GCA900157325_01112 gene open 39938-40426 ispF
335 FUFC01000008.1 GCA900157325_01113 gene open 40529-41113 spoU
336 FUFC01000008.1 GCA900157325_01115 gene open 41923-42399 cdd
337 FUFC01000008.1 GCA900157325_01116 gene open 43151-43939
338 FUFC01000008.1 GCA900157325_01117 gene open 43953-44735
339 FUFC01000008.1 GCA900157325_01118 gene open 44906-45805
340 FUFC01000008.1 GCA900157325_01119 gene open 45819-46709
341 FUFC01000008.1 GCA900157325_01120 gene open 46782-47294 tmk
342 FUFC01000008.1 GCA900157325_01121 gene open 47454-50039 lacZ
343 FUFC01000008.1 GCA900157325_01122 gene open 50069-51367 rmuC
344 FUFC01000008.1 GCA900157325_01123 gene open 52085-52399 trxA
345 FUFC01000008.1 GCA900157325_01124 gene open 52448-56134 dnaE
346 FUFC01000008.1 GCA900157325_01125 gene open 56413-56778 rplS
347 FUFC01000008.1 GCA900157325_01126 gene open 58005-59285 glyA
348 FUFC01000008.1 GCA900157325_01127 gene open 59445-61778 nahA
349 FUFC01000008.1 GCA900157325_01128 gene open 62444-64498 htpG
350 FUFC01000008.1 GCA900157325_01129 gene open 64681-65535 cdsA
351 FUFC01000008.1 GCA900157325_01130 gene open 65564-67585 ftsH
352 FUFC01000008.1 GCA900157325_01131 gene open 67789-68892 ychF
353 FUFC01000008.1 GCA900157325_01132 gene open 69372-70385 lysM
354 FUFC01000008.1 GCA900157325_01133 gene open 70514-70708
355 FUFC01000008.1 GCA900157325_01134 gene open 70778-71518 ftsE
356 FUFC01000008.1 GCA900157325_01135 gene open 71536-72876 metL1
357 FUFC01000008.1 GCA900157325_01136 gene open 72860-74050 lysA
358 FUFC01000008.1 GCA900157325_01137 gene open 74043-74930 menA
359 FUFC01000008.1 GCA900157325_01138 gene open 75022-75402 copY
360 FUFC01000008.1 GCA900157325_01139 gene open 75437-76753 mecR1
361 FUFC01000008.1 GCA900157325_01140 gene open 76946-77038
362 FUFC01000008.1 GCA900157325_01141 gene open 77347-78231
363 FUFC01000008.1 GCA900157325_01095 gene open 15501-15574 trnN
364 FUFC01000008.1 GCA900157325_01096 gene open 15597-15670 trnN
365 FUFC01000008.1 GCA900157325_01114 gene open 41587-41657 trnQ
366 FUFC01000008.1 GCA900157325_01142 gene open 78310-78384 trnV
367 FUFC01000008.1 GCA900157325_01143 gene open 78427-78501 trnV
368 FUFC01000008.1 GCA900157325_01095 tRNA open 15501-15574 trnN tRNA-Asn(gtt)
369 FUFC01000008.1 GCA900157325_01096 tRNA open 15597-15670 trnN tRNA-Asn(gtt)
370 FUFC01000008.1 GCA900157325_01114 tRNA open 41587-41657 trnQ tRNA-Gln(ttg)
371 FUFC01000008.1 GCA900157325_01142 tRNA open 78310-78384 trnV tRNA-Val(tac)
372 FUFC01000008.1 GCA900157325_01143 tRNA open 78427-78501 trnV tRNA-Val(tac)
373 FUFC01000009.1 GCA900157325_01783 CDS open 428-1339 _na     303_aa Ion transporter
374 FUFC01000009.1 GCA900157325_01784 CDS open 1371-2048 _na     225_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
375 FUFC01000009.1 GCA900157325_01785 CDS open 2248-3039 _na     263_aa mcr1 Ferredoxin-NADP reductase
376 FUFC01000009.1 GCA900157325_01786 CDS open 3062-4534 _na     490_aa gltA NADPH-dependent glutamate synthase
377 FUFC01000009.1 GCA900157325_01787 CDS open 4568-7081 _na     837_aa priA primosomal protein N'
378 FUFC01000009.1 GCA900157325_01788 CDS open 7108-7527 _na     139_aa START-like domain-containing protein
379 FUFC01000009.1 GCA900157325_01789 CDS open 7571-8185 _na     204_aa DUF4294 domain-containing protein
380 FUFC01000009.1 GCA900157325_01790 CDS open 8776-11355 _na     859_aa DUF5117 domain-containing protein
381 FUFC01000009.1 GCA900157325_01791 CDS open 11362-11871 _na     169_aa ybaK Cys-tRNA(Pro) deacylase
382 FUFC01000009.1 GCA900157325_01792 CDS open 11880-12341 _na     153_aa hypothetical protein
383 FUFC01000009.1 GCA900157325_01793 CDS open 12433-12966 _na     177_aa phoE phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
384 FUFC01000009.1 GCA900157325_01794 CDS open 13068-13265 _na     65_aa DUF1661 domain-containing protein
385 FUFC01000009.1 GCA900157325_01783 gene open 428-1339
386 FUFC01000009.1 GCA900157325_01784 gene open 1371-2048 trmD
387 FUFC01000009.1 GCA900157325_01785 gene open 2248-3039 mcr1
388 FUFC01000009.1 GCA900157325_01786 gene open 3062-4534 gltA
389 FUFC01000009.1 GCA900157325_01787 gene open 4568-7081 priA
390 FUFC01000009.1 GCA900157325_01788 gene open 7108-7527
391 FUFC01000009.1 GCA900157325_01789 gene open 7571-8185
392 FUFC01000009.1 GCA900157325_01790 gene open 8776-11355
393 FUFC01000009.1 GCA900157325_01791 gene open 11362-11871 ybaK
394 FUFC01000009.1 GCA900157325_01792 gene open 11880-12341
395 FUFC01000009.1 GCA900157325_01793 gene open 12433-12966 phoE
396 FUFC01000009.1 GCA900157325_01794 gene open 13068-13265
397 FUFC01000010.1 repeat_region open 110053-110560 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC and spacer length 30
398 FUFC01000010.1 GCA900157325_01339 CDS open 633-1427 _na     264_aa pgaB NodB-like y domain-containing protein
399 FUFC01000010.1 GCA900157325_01340 CDS open 1415-2125 _na     236_aa wcaA Glycosyltransferase 2-like domain-containing protein
400 FUFC01000010.1 GCA900157325_01341 CDS open 2112-3299 _na     395_aa DUF2029 domain-containing protein
401 FUFC01000010.1 GCA900157325_01342 CDS open 3341-4009 _na     222_aa udk uridine kinase
402 FUFC01000010.1 GCA900157325_01343 CDS open 4019-5206 _na     395_aa spt serine palmitoyltransferase
403 FUFC01000010.1 GCA900157325_01344 CDS open 5573-6067 _na     164_aa ymdB O-acetyl-ADP-ribose deacetylase
404 FUFC01000010.1 GCA900157325_01345 CDS open 6150-6938 _na     262_aa lpxH UDP-2%2C3-diacylglucosamine hydrolase
405 FUFC01000010.1 GCA900157325_01346 CDS open 6966-7283 _na     105_aa paaD Fe-S protein maturation auxiliary factor PG_1777
406 FUFC01000010.1 GCA900157325_01347 CDS open 7369-8520 _na     383_aa dnaJ molecular chaperone DnaJ
407 FUFC01000010.1 GCA900157325_01348 CDS open 8564-9148 _na     194_aa grpE Protein GrpE
408 FUFC01000010.1 GCA900157325_01349 CDS open 9543-12911 _na     1122_aa mfd transcription-repair coupling factor
409 FUFC01000010.1 GCA900157325_01350 CDS open 12888-14225 _na     445_aa lpxE Lipid A 1-phosphatase
410 FUFC01000010.1 GCA900157325_01351 CDS open 14287-14961 _na     224_aa nth endonuclease III
411 FUFC01000010.1 GCA900157325_01352 CDS open 14980-16002 _na     340_aa pheS phenylalanine--tRNA ligase subunit alpha
412 FUFC01000010.1 GCA900157325_01353 CDS open 16124-16720 _na     198_aa Lipoprotein
413 FUFC01000010.1 GCA900157325_01354 CDS open 17438-19027 _na     529_aa yifB Magnesium chelatase%2C subunit D/I family
414 FUFC01000010.1 GCA900157325_01355 CDS open 19005-20027 _na     340_aa bcp Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant domain-containing protein
415 FUFC01000010.1 GCA900157325_01356 CDS open 20042-20623 _na     193_aa purN Phosphoribosylglycinamide formyltransferase
416 FUFC01000010.1 GCA900157325_01357 CDS open 20792-21028 _na     78_aa acpP acyl carrier protein
417 FUFC01000010.1 GCA900157325_01358 CDS open 21038-22294 _na     418_aa fabF beta-ketoacyl-ACP synthase II
418 FUFC01000010.1 GCA900157325_01359 CDS open 22306-23091 _na     261_aa rnc ribonuclease III
419 FUFC01000010.1 GCA900157325_01360 CDS open 23218-26163 _na     981_aa secDF protein translocase subunit SecDF
420 FUFC01000010.1 GCA900157325_01361 CDS open 26401-26955 _na     184_aa rimI N-acetyltransferase domain-containing protein
421 FUFC01000010.1 GCA900157325_01362 CDS open 26903-27532 _na     209_aa znuC ABC transporter%2C ATP-binding protein
422 FUFC01000010.1 GCA900157325_01363 CDS open 27522-28469 _na     315_aa znuA putative zinc ABC transporter zinc-binding protein
423 FUFC01000010.1 GCA900157325_01364 CDS open 28585-28854 _na     89_aa rpsO 30S ribosomal protein S15
424 FUFC01000010.1 GCA900157325_01365 CDS open 29127-30158 _na     343_aa Outer membrane protein beta-barrel domain-containing protein
425 FUFC01000010.1 GCA900157325_01366 CDS open 30811-31692 _na     293_aa fda fructose bisphosphate aldolase
426 FUFC01000010.1 GCA900157325_01367 CDS open 31835-34342 _na     835_aa dAP2 Conserved domain protein
427 FUFC01000010.1 GCA900157325_01368 CDS open 34378-35424 _na     348_aa selD selenide%2C water dikinase SelD
428 FUFC01000010.1 GCA900157325_01369 CDS open 35421-35645 _na     74_aa Putative Se/S carrier protein-like domain-containing protein
429 FUFC01000010.1 GCA900157325_01370 CDS open 35629-36759 _na     376_aa csdA Aminotransferase%2C class V
430 FUFC01000010.1 GCA900157325_01371 CDS open 36896-38716 _na     606_aa afuC Alpha-1%2C3/4-fucosidase%2C putative
431 FUFC01000010.1 GCA900157325_01372 CDS open 39160-41187 _na     675_aa tktA Transketolase
432 FUFC01000010.1 GCA900157325_01373 CDS open 41274-41711 _na     145_aa rpiB ribose 5-phosphate isomerase B
433 FUFC01000010.1 GCA900157325_01374 CDS open 41746-42183 _na     145_aa Membrane protease subunit
434 FUFC01000010.1 GCA900157325_01375 CDS open 42411-44693 _na     760_aa sfcA NADP-dependent malic enzyme
435 FUFC01000010.1 GCA900157325_01376 CDS open 45034-46362 _na     442_aa salY ABC transporter%2C permease protein%2C putative
436 FUFC01000010.1 GCA900157325_01377 CDS open 46384-47760 _na     458_aa salY ABC transporter%2C permease protein%2C putative
437 FUFC01000010.1 GCA900157325_01378 CDS open 47981-48652 _na     223_aa lolD ABC transporter%2C ATP-binding protein
438 FUFC01000010.1 GCA900157325_01379 CDS open 48732-49982 _na     416_aa emrA Efflux transporter%2C MFP component%2C RND family
439 FUFC01000010.1 GCA900157325_01380 CDS open 50246-51751 _na     501_aa tolC Transporter
440 FUFC01000010.1 GCA900157325_01381 CDS open 51940-52161 _na     73_aa DUF2795 domain-containing protein
441 FUFC01000010.1 GCA900157325_01382 CDS open 52232-53185 _na     317_aa porP type IX secretion system membrane protein PorP
442 FUFC01000010.1 GCA900157325_01383 CDS open 53242-54717 _na     491_aa porK Por secretion system protein porK/gldK
443 FUFC01000010.1 GCA900157325_01384 CDS open 54758-55687 _na     309_aa porL Gliding motility protein GldL-like N-terminal domain-containing protein
444 FUFC01000010.1 GCA900157325_01385 CDS open 55691-57241 _na     516_aa porM Por secretion system protein porM/gldM
445 FUFC01000010.1 GCA900157325_01386 CDS open 57250-58329 _na     359_aa gldN Gliding motility protein GldN
446 FUFC01000010.1 GCA900157325_01387 CDS open 58490-59080 _na     196_aa chrA Chromate transporter
447 FUFC01000010.1 GCA900157325_01388 CDS open 59099-59692 _na     197_aa chrA putative chromate transport protein
448 FUFC01000010.1 GCA900157325_01389 CDS open 59830-60408 _na     192_aa zliS Secretion activator protein%2C putative
449 FUFC01000010.1 GCA900157325_01390 CDS open 61003-61893 _na     296_aa wcaE Glycosyltransferase 2-like domain-containing protein
450 FUFC01000010.1 GCA900157325_01391 CDS open 61908-63032 _na     374_aa dprA DNA-processing protein DprA
451 FUFC01000010.1 GCA900157325_01392 CDS open 63025-66729 _na     1234_aa purL phosphoribosylformylglycinamidine synthase
452 FUFC01000010.1 GCA900157325_01393 CDS open 67067-67504 _na     145_aa hypothetical protein
453 FUFC01000010.1 GCA900157325_01394 CDS open 67635-67922 _na     95_aa Partial transposase in ISPg3
454 FUFC01000010.1 GCA900157325_01395 CDS open 68137-69429 _na     430_aa cpoB TPR domain protein
455 FUFC01000010.1 GCA900157325_01396 CDS open 69479-69724 _na     81_aa hypothetical protein
456 FUFC01000010.1 GCA900157325_01397 CDS open 69786-70208 _na     140_aa rseC Positive regulator of sigma(E)%2C RseC/MucC
457 FUFC01000010.1 GCA900157325_01398 CDS open 70218-71090 _na     290_aa rnfB Fe-S cluster domain-containing protein
458 FUFC01000010.1 GCA900157325_01399 CDS open 71126-72457 _na     443_aa rsxC electron transport complex subunit RsxC
459 FUFC01000010.1 GCA900157325_01400 CDS open 72473-73456 _na     327_aa rnfD Ion-translocating oxidoreductase complex subunit D
460 FUFC01000010.1 GCA900157325_01401 CDS open 73483-74130 _na     215_aa rnfG Ion-translocating oxidoreductase complex subunit G
461 FUFC01000010.1 GCA900157325_01402 CDS open 74127-74717 _na     196_aa rnfE Ion-translocating oxidoreductase complex subunit E
462 FUFC01000010.1 GCA900157325_01403 CDS open 74742-75314 _na     190_aa rnfA Ion-translocating oxidoreductase complex subunit A
463 FUFC01000010.1 GCA900157325_01404 CDS open 75529-76542 _na     337_aa apbE FAD:protein FMN transferase
464 FUFC01000010.1 GCA900157325_01405 CDS open 76539-77078 _na     179_aa nfnB Nitroreductase family protein
465 FUFC01000010.1 GCA900157325_01406 CDS open 77078-78031 _na     317_aa wcaA Glycosyl transferase%2C group 2 family protein
466 FUFC01000010.1 GCA900157325_01407 CDS open 78028-78567 _na     179_aa DUF4199 domain-containing protein
467 FUFC01000010.1 GCA900157325_01408 CDS open 79206-79568 _na     120_aa rplU 50S ribosomal protein L21
468 FUFC01000010.1 GCA900157325_01409 CDS open 79596-79853 _na     85_aa rpmA 50S ribosomal protein L27
469 FUFC01000010.1 GCA900157325_01410 CDS open 79953-81224 _na     423_aa serS serine--tRNA ligase
470 FUFC01000010.1 GCA900157325_01411 CDS open 81237-83897 _na     886_aa Peptidase family M49
471 FUFC01000010.1 GCA900157325_01412 CDS open 84054-84302 _na     82_aa hypothetical protein
472 FUFC01000010.1 GCA900157325_01413 CDS open 84508-84891 _na     127_aa DUF1573 domain-containing protein
473 FUFC01000010.1 GCA900157325_01414 CDS open 84923-86011 _na     362_aa DUF1573 domain-containing protein
474 FUFC01000010.1 GCA900157325_01415 CDS open 86087-87193 _na     368_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
475 FUFC01000010.1 GCA900157325_01416 CDS open 87222-88400 _na     392_aa gltP Serine/threonine transporter
476 FUFC01000010.1 GCA900157325_01417 CDS open 88523-88852 _na     109_aa qdoI Cupin type-2 domain-containing protein
477 FUFC01000010.1 GCA900157325_01418 CDS open 89054-90559 _na     501_aa hutH histidine ammonia-lyase
478 FUFC01000010.1 GCA900157325_01419 CDS open 90550-91179 _na     209_aa ftcD Cyclodeaminase/cyclohydrolase domain-containing protein
479 FUFC01000010.1 GCA900157325_01420 CDS open 91204-92331 _na     375_aa lomR Porin
480 FUFC01000010.1 GCA900157325_01421 CDS open 92372-93526 _na     384_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
481 FUFC01000010.1 GCA900157325_01422 CDS open 93620-94891 _na     423_aa hutI imidazolonepropionase
482 FUFC01000010.1 GCA900157325_01423 CDS open 94992-95894 _na     300_aa ftcD glutamate formimidoyltransferase
483 FUFC01000010.1 GCA900157325_01424 CDS open 95935-96930 _na     331_aa Lipoprotein
484 FUFC01000010.1 GCA900157325_01425 CDS open 96963-97481 _na     172_aa hupA DNA-binding protein%2C histone-like family
485 FUFC01000010.1 GCA900157325_01426 CDS open 98157-100133 _na     658_aa rho transcription termination factor Rho
486 FUFC01000010.1 GCA900157325_01427 CDS open 100361-101269 _na     302_aa rhaT EamA domain-containing protein
487 FUFC01000010.1 GCA900157325_01428 CDS open 101280-102239 _na     319_aa wcaA Glycosyl transferase%2C group 2 family protein
488 FUFC01000010.1 GCA900157325_01429 CDS open 102267-103781 _na     504_aa Glycosyltransferase family 39 protein
489 FUFC01000010.1 GCA900157325_01430 CDS open 103921-104823 _na     300_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
490 FUFC01000010.1 GCA900157325_01431 CDS open 104843-105412 _na     189_aa Plasmid pRiA4b Orf3-like domain-containing protein
491 FUFC01000010.1 GCA900157325_01432 CDS open 105700-109227 _na     1175_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
492 FUFC01000010.1 GCA900157325_01433 CDS open 109241-109777 _na     178_aa csx28 CRISPR-associated protein Csx28
493 FUFC01000010.1 GCA900157325_01434 CDS open 111037-111270 _na     77_aa hypothetical protein
494 FUFC01000010.1 GCA900157325_01435 CDS open 111364-112545 _na     393_aa megL methionine gamma-lyase
495 FUFC01000010.1 GCA900157325_01436 CDS open 112726-114195 _na     489_aa cpdA Metallophosphoesterase family protein
496 FUFC01000010.1 GCA900157325_01437 CDS open 114198-114791 _na     197_aa Histidine kinase
497 FUFC01000010.1 GCA900157325_01438 CDS open 114892-115497 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
498 FUFC01000010.1 GCA900157325_01439 CDS open 115507-116535 _na     342_aa galE UDP-glucose 4-epimerase GalE
499 FUFC01000010.1 GCA900157325_01440 CDS open 116578-118674 _na     698_aa recG ATP-dependent DNA helicase RecG
500 FUFC01000010.1 GCA900157325_01441 CDS open 118692-119444 _na     250_aa ycjU Hydrolase%2C haloacid dehalogenase-like family