BAKTAGenome Explorer: Bacteroides pyogenes (GCA_900445575.1)
Select a Genome:
|
BAKTA Annotations for GCA_900445575.1
|
Search & Sort all 5945 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | UFTB01000001.1 | GCA900445575_02608 | gene | open | 2930957-2931351 | ssrA | ||
| 2 | UFTB01000001.1 | GCA900445575_02608 | tmRNA | open | 2930957-2931351 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | UFTB01000001.1 | GCA900445575_00469 | gene | open | 349454-349564 | rrf | ||
| 4 | UFTB01000001.1 | GCA900445575_00470 | gene | open | 349684-352591 | rrl | ||
| 5 | UFTB01000001.1 | GCA900445575_00473 | gene | open | 353099-354628 | rrs | ||
| 6 | UFTB01000001.1 | GCA900445575_01120 | gene | open | 1187405-1188934 | rrs | ||
| 7 | UFTB01000001.1 | GCA900445575_01123 | gene | open | 1189442-1192349 | rrl | ||
| 8 | UFTB01000001.1 | GCA900445575_01124 | gene | open | 1192469-1192579 | rrf | ||
| 9 | UFTB01000001.1 | GCA900445575_01179 | gene | open | 1251034-1252563 | rrs | ||
| 10 | UFTB01000001.1 | GCA900445575_01182 | gene | open | 1253071-1255978 | rrl | ||
| 11 | UFTB01000001.1 | GCA900445575_01183 | gene | open | 1256098-1256208 | rrf | ||
| 12 | UFTB01000001.1 | GCA900445575_01827 | gene | open | 2023137-2024666 | rrs | ||
| 13 | UFTB01000001.1 | GCA900445575_01830 | gene | open | 2025174-2028081 | rrl | ||
| 14 | UFTB01000001.1 | GCA900445575_01831 | gene | open | 2028201-2028311 | rrf | ||
| 15 | UFTB01000001.1 | GCA900445575_01934 | gene | open | 2150420-2150598 | Bacteroidales-1 | ||
| 16 | UFTB01000001.1 | GCA900445575_01962 | gene | open | 2173216-2173252 | abiF | ||
| 17 | UFTB01000001.1 | GCA900445575_02538 | gene | open | 2850754-2850836 | rteR | ||
| 18 | UFTB01000001.1 | GCA900445575_02749 | gene | open | 3078463-3078536 | rteR | ||
| 19 | UFTB01000001.1 | GCA900445575_02833 | gene | open | 3158113-3158481 | RNaseP_bact_a | ||
| 20 | UFTB01000001.1 | GCA900445575_02888 | gene | open | 3218458-3218568 | rrf | ||
| 21 | UFTB01000001.1 | GCA900445575_02889 | gene | open | 3218688-3221595 | rrl | ||
| 22 | UFTB01000001.1 | GCA900445575_02892 | gene | open | 3222103-3223632 | rrs | ||
| 23 | UFTB01000001.1 | GCA900445575_02932 | gene | open | 3273471-3273577 | Bacteroidales_small_SRP | ||
| 24 | UFTB01000001.1 | GCA900445575_01934 | ncRNA | open | 2150420-2150598 | Bacteroidales-1 6S-Bacteroidales RNA suggested | ||
| 25 | UFTB01000001.1 | GCA900445575_01962 | ncRNA | open | 2173216-2173252 | abiF | abiF RNA | |
| 26 | UFTB01000001.1 | GCA900445575_02538 | ncRNA | open | 2850754-2850836 | rteR | rteR sRNA | |
| 27 | UFTB01000001.1 | GCA900445575_02749 | ncRNA | open | 3078463-3078536 | rteR | rteR sRNA | |
| 28 | UFTB01000001.1 | GCA900445575_02833 | ncRNA | open | 3158113-3158481 | Bacterial RNase P class A | ||
| 29 | UFTB01000001.1 | GCA900445575_02932 | ncRNA | open | 3273471-3273577 | Bacteroidales small SRP | ||
| 30 | UFTB01000001.1 | regulatory_region | open | 209440-209620 | Cobalamin riboswitch aptamer | |||
| 31 | UFTB01000001.1 | regulatory_region | open | 385301-385333 | S4-Bacteroidia ribosomal protein leader | |||
| 32 | UFTB01000001.1 | regulatory_region | open | 899605-899664 | SAM-II riboswitch aptamer (SAM-II long loop) | |||
| 33 | UFTB01000001.1 | regulatory_region | open | 1282015-1282205 | Cobalamin riboswitch aptamer | |||
| 34 | UFTB01000001.1 | regulatory_region | open | 1503139-1503235 | TPP riboswitch aptamer (THI element) | |||
| 35 | UFTB01000001.1 | regulatory_region | open | 1593354-1593563 | Cobalamin riboswitch aptamer | |||
| 36 | UFTB01000001.1 | regulatory_region | open | 1753069-1753278 | Cobalamin riboswitch aptamer | |||
| 37 | UFTB01000001.1 | regulatory_region | open | 1798361-1798573 | Cobalamin riboswitch aptamer | |||
| 38 | UFTB01000001.1 | regulatory_region | open | 1915229-1915438 | Cobalamin riboswitch aptamer | |||
| 39 | UFTB01000001.1 | regulatory_region | open | 2432144-2432362 | Cobalamin riboswitch aptamer | |||
| 40 | UFTB01000001.1 | regulatory_region | open | 2473693-2473785 | TPP riboswitch aptamer (THI element) | |||
| 41 | UFTB01000001.1 | GCA900445575_00469 | rRNA | open | 349454-349564 | rrf | 5S ribosomal RNA | |
| 42 | UFTB01000001.1 | GCA900445575_00470 | rRNA | open | 349684-352591 | rrl | 23S ribosomal RNA | |
| 43 | UFTB01000001.1 | GCA900445575_00473 | rRNA | open | 353099-354628 | rrs | 16S ribosomal RNA | |
| 44 | UFTB01000001.1 | GCA900445575_01120 | rRNA | open | 1187405-1188934 | rrs | 16S ribosomal RNA | |
| 45 | UFTB01000001.1 | GCA900445575_01123 | rRNA | open | 1189442-1192349 | rrl | 23S ribosomal RNA | |
| 46 | UFTB01000001.1 | GCA900445575_01124 | rRNA | open | 1192469-1192579 | rrf | 5S ribosomal RNA | |
| 47 | UFTB01000001.1 | GCA900445575_01179 | rRNA | open | 1251034-1252563 | rrs | 16S ribosomal RNA | |
| 48 | UFTB01000001.1 | GCA900445575_01182 | rRNA | open | 1253071-1255978 | rrl | 23S ribosomal RNA | |
| 49 | UFTB01000001.1 | GCA900445575_01183 | rRNA | open | 1256098-1256208 | rrf | 5S ribosomal RNA | |
| 50 | UFTB01000001.1 | GCA900445575_01827 | rRNA | open | 2023137-2024666 | rrs | 16S ribosomal RNA | |
| 51 | UFTB01000001.1 | GCA900445575_01830 | rRNA | open | 2025174-2028081 | rrl | 23S ribosomal RNA | |
| 52 | UFTB01000001.1 | GCA900445575_01831 | rRNA | open | 2028201-2028311 | rrf | 5S ribosomal RNA | |
| 53 | UFTB01000001.1 | GCA900445575_02888 | rRNA | open | 3218458-3218568 | rrf | 5S ribosomal RNA | |
| 54 | UFTB01000001.1 | GCA900445575_02889 | rRNA | open | 3218688-3221595 | rrl | 23S ribosomal RNA | |
| 55 | UFTB01000001.1 | GCA900445575_02892 | rRNA | open | 3222103-3223632 | rrs | 16S ribosomal RNA | |
| 56 | UFTB01000001.1 | repeat_region | open | 81792-82692 | CRISPR array with 12 repeats of length 47%2C consensus sequence GCTGTGATTTACTTTCAATTTAGTATCTTTGAGCCATTGAGTACAGC and spacer length 29 | |||
| 57 | UFTB01000001.1 | repeat_region | open | 442749-443979 | CRISPR array with 19 repeats of length 36%2C consensus sequence GTTGTCTATACCACTCAAACTAGTGGCATCCACAAC and spacer length 29 | |||
| 58 | UFTB01000001.1 | repeat_region | open | 946388-946564 | CRISPR array with 3 repeats of length 36%2C consensus sequence GCTGTCGCCCGCTTGCAAATCAAGACGGAATAAAAC and spacer length 30 | |||
| 59 | UFTB01000001.1 | repeat_region | open | 2972365-2972720 | CRISPR array with 6 repeats of length 17%2C consensus sequence CAGCACCGGAGCAGGGA and spacer length 48 | |||
| 60 | UFTB01000001.1 | GCA900445575_00163 | CDS | open | 1-1413 | _na 470_aa | dnaA | chromosomal replication initiator protein DnaA |
| 61 | UFTB01000001.1 | GCA900445575_00164 | CDS | open | 1633-2376 | _na 247_aa | Nitroreductase family protein | |
| 62 | UFTB01000001.1 | GCA900445575_00165 | CDS | open | 2663-5206 | _na 847_aa | adenosylcobalamin-dependent ribonucleoside-diphosphate reductase | |
| 63 | UFTB01000001.1 | GCA900445575_00166 | CDS | open | 5447-8128 | _na 893_aa | malQ | 4-alpha-glucanotransferase |
| 64 | UFTB01000001.1 | GCA900445575_00167 | CDS | open | 8416-9147 | _na 243_aa | hypothetical protein | |
| 65 | UFTB01000001.1 | GCA900445575_00168 | CDS | open | 9181-10239 | _na 352_aa | hypothetical protein | |
| 66 | UFTB01000001.1 | GCA900445575_00169 | CDS | open | 10418-10582 | _na 54_aa | Transposase DDE domain-containing protein | |
| 67 | UFTB01000001.1 | GCA900445575_00170 | CDS | open | 11090-11257 | _na 55_aa | hypothetical protein | |
| 68 | UFTB01000001.1 | GCA900445575_00171 | CDS | open | 11363-12421 | _na 352_aa | N-acetylmuramoyl-L-alanine amidase | |
| 69 | UFTB01000001.1 | GCA900445575_00172 | CDS | open | 12547-13827 | _na 426_aa | O-acetylhomoserine aminocarboxypropyltransferase | |
| 70 | UFTB01000001.1 | GCA900445575_00173 | CDS | open | 14398-16692 | _na 764_aa | NADP-dependent malic enzyme | |
| 71 | UFTB01000001.1 | GCA900445575_00174 | CDS | open | 16689-16865 | _na 58_aa | Lipoprotein | |
| 72 | UFTB01000001.1 | GCA900445575_00175 | CDS | open | 17241-18575 | _na 444_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 73 | UFTB01000001.1 | GCA900445575_00176 | CDS | open | 18873-21851 | _na 992_aa | ppsA | Response regulatory domain-containing protein |
| 74 | UFTB01000001.1 | GCA900445575_00177 | CDS | open | 21916-22404 | _na 162_aa | hypothetical protein | |
| 75 | UFTB01000001.1 | GCA900445575_00178 | CDS | open | 22587-22883 | _na 98_aa | hypothetical protein | |
| 76 | UFTB01000001.1 | GCA900445575_00179 | CDS | open | 22947-25058 | _na 703_aa | prolyl oligopeptidase | |
| 77 | UFTB01000001.1 | GCA900445575_00180 | CDS | open | 25155-25388 | _na 77_aa | hypothetical protein | |
| 78 | UFTB01000001.1 | GCA900445575_00181 | CDS | open | 25483-26820 | _na 445_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 79 | UFTB01000001.1 | GCA900445575_00182 | CDS | open | 27068-28234 | _na 388_aa | Aminopeptidase P family protein | |
| 80 | UFTB01000001.1 | GCA900445575_00183 | CDS | open | 28278-29714 | _na 478_aa | pcnB | HD/PDEase domain-containing protein |
| 81 | UFTB01000001.1 | GCA900445575_00184 | CDS | open | 29835-30677 | _na 280_aa | Lipoprotein | |
| 82 | UFTB01000001.1 | GCA900445575_00185 | CDS | open | 30913-31749 | _na 278_aa | Tetratricopeptide repeat protein | |
| 83 | UFTB01000001.1 | GCA900445575_00186 | CDS | open | 31780-32730 | _na 316_aa | cysK | cysteine synthase A |
| 84 | UFTB01000001.1 | GCA900445575_00187 | CDS | open | 32821-34653 | _na 610_aa | Sulfatase-like hydrolase/transferase | |
| 85 | UFTB01000001.1 | GCA900445575_00188 | CDS | open | 34676-35356 | _na 226_aa | PAP2 family protein | |
| 86 | UFTB01000001.1 | GCA900445575_00189 | CDS | open | 35487-36557 | _na 356_aa | leuB | 3-isopropylmalate dehydrogenase |
| 87 | UFTB01000001.1 | GCA900445575_00190 | CDS | open | 36590-38119 | _na 509_aa | leuA | LeuA allosteric domain protein |
| 88 | UFTB01000001.1 | GCA900445575_00191 | CDS | open | 38095-38688 | _na 197_aa | 3-isopropylmalate dehydratase small subunit | |
| 89 | UFTB01000001.1 | GCA900445575_00192 | CDS | open | 38710-40104 | _na 464_aa | 3-isopropylmalate dehydratase large subunit | |
| 90 | UFTB01000001.1 | GCA900445575_00193 | CDS | open | 40109-41605 | _na 498_aa | leuA | 2-isopropylmalate synthase |
| 91 | UFTB01000001.1 | GCA900445575_00194 | CDS | open | 42040-43503 | _na 487_aa | Glycosyl hydrolase-like 10 domain-containing protein | |
| 92 | UFTB01000001.1 | GCA900445575_00195 | CDS | open | 43619-45037 | _na 472_aa | DUF4623 domain-containing protein | |
| 93 | UFTB01000001.1 | GCA900445575_00196 | CDS | open | 45089-46954 | _na 621_aa | susD | SusD family protein |
| 94 | UFTB01000001.1 | GCA900445575_00197 | CDS | open | 46968-50447 | _na 1159_aa | TonB-dependent receptor plug domain protein | |
| 95 | UFTB01000001.1 | GCA900445575_00198 | CDS | open | 50752-51465 | _na 237_aa | TIGR02757 family protein | |
| 96 | UFTB01000001.1 | GCA900445575_00199 | CDS | open | 51670-52533 | _na 287_aa | Oxidoreductase%2C short chain dehydrogenase/reductase family protein | |
| 97 | UFTB01000001.1 | GCA900445575_00200 | CDS | open | 53374-53724 | _na 116_aa | panD | aspartate 1-decarboxylase |
| 98 | UFTB01000001.1 | GCA900445575_00201 | CDS | open | 53759-54601 | _na 280_aa | panC | pantoate--beta-alanine ligase |
| 99 | UFTB01000001.1 | GCA900445575_00202 | CDS | open | 54691-55578 | _na 295_aa | starch synthase | |
| 100 | UFTB01000001.1 | GCA900445575_00203 | CDS | open | 55606-57219 | _na 537_aa | DUF4270 domain-containing protein | |
| 101 | UFTB01000001.1 | GCA900445575_00204 | CDS | open | 57501-57968 | _na 155_aa | hypothetical protein | |
| 102 | UFTB01000001.1 | GCA900445575_00205 | CDS | open | 57788-59194 | _na 468_aa | Glycosyl hydrolase%2C family 57 | |
| 103 | UFTB01000001.1 | GCA900445575_00206 | CDS | open | 59214-60482 | _na 422_aa | rfaB | Glycosyl transferase family 1 domain-containing protein |
| 104 | UFTB01000001.1 | GCA900445575_00207 | CDS | open | 60500-62437 | _na 645_aa | araC | DNA-binding response regulator%2C AraC family |
| 105 | UFTB01000001.1 | GCA900445575_00208 | CDS | open | 62614-63324 | _na 236_aa | Peptidase%2C S54 family | |
| 106 | UFTB01000001.1 | GCA900445575_00209 | CDS | open | 63284-63877 | _na 197_aa | UPF0056 membrane protein | |
| 107 | UFTB01000001.1 | GCA900445575_00210 | CDS | open | 64004-64687 | _na 227_aa | Cyclic nucleotide-binding domain protein | |
| 108 | UFTB01000001.1 | GCA900445575_00211 | CDS | open | 65019-66542 | _na 507_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 109 | UFTB01000001.1 | GCA900445575_00212 | CDS | open | 67116-67541 | _na 141_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 110 | UFTB01000001.1 | GCA900445575_00213 | CDS | open | 67680-68690 | _na 336_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 111 | UFTB01000001.1 | GCA900445575_00214 | CDS | open | 68797-70890 | _na 697_aa | Putative peptidyl-dipeptidase dcp | |
| 112 | UFTB01000001.1 | GCA900445575_00215 | CDS | open | 70903-71418 | _na 171_aa | DUF4847 domain-containing protein | |
| 113 | UFTB01000001.1 | GCA900445575_00216 | CDS | open | 71424-71870 | _na 148_aa | Cytidine and deoxycytidylate deaminase zinc-binding region | |
| 114 | UFTB01000001.1 | GCA900445575_00217 | CDS | open | 71962-73650 | _na 562_aa | Peptidase%2C S41 family | |
| 115 | UFTB01000001.1 | GCA900445575_00218 | CDS | open | 73625-74164 | _na 179_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 116 | UFTB01000001.1 | GCA900445575_00219 | CDS | open | 74175-74462 | _na 95_aa | DUF721 domain-containing protein | |
| 117 | UFTB01000001.1 | GCA900445575_00220 | CDS | open | 74462-75568 | _na 368_aa | recF | DNA replication/repair protein RecF |
| 118 | UFTB01000001.1 | GCA900445575_00221 | CDS | open | 75730-76413 | _na 227_aa | cpoB | Ancillary SecYEG translocon subunit/Cell division coordinator CpoB TPR domain-containing protein |
| 119 | UFTB01000001.1 | GCA900445575_00222 | CDS | open | 76585-77079 | _na 164_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 120 | UFTB01000001.1 | GCA900445575_00225 | CDS | open | 77360-78619 | _na 419_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 121 | UFTB01000001.1 | GCA900445575_00226 | CDS | open | 78624-78875 | _na 83_aa | hypothetical protein | |
| 122 | UFTB01000001.1 | GCA900445575_00227 | CDS | open | 80380-81567 | _na 395_aa | cls | cardiolipin synthase |
| 123 | UFTB01000001.1 | GCA900445575_00228 | CDS | open | 83123-84055 | _na 310_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 124 | UFTB01000001.1 | GCA900445575_00229 | CDS | open | 84106-88692 | _na 1528_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 125 | UFTB01000001.1 | GCA900445575_00230 | CDS | open | 88954-89748 | _na 264_aa | thymidylate synthase | |
| 126 | UFTB01000001.1 | GCA900445575_00231 | CDS | open | 89755-90249 | _na 164_aa | Dihydrofolate reductase | |
| 127 | UFTB01000001.1 | GCA900445575_00232 | CDS | open | 90277-90756 | _na 159_aa | asnC | Transcriptional regulator%2C AsnC family |
| 128 | UFTB01000001.1 | GCA900445575_00233 | CDS | open | 90907-92184 | _na 425_aa | IgA Peptidase M64 | |
| 129 | UFTB01000001.1 | GCA900445575_00234 | CDS | open | 92290-92823 | _na 177_aa | N-acetyltransferase domain-containing protein | |
| 130 | UFTB01000001.1 | GCA900445575_00235 | CDS | open | 92908-94104 | _na 398_aa | Transposase IS4-like domain-containing protein | |
| 131 | UFTB01000001.1 | GCA900445575_00236 | CDS | open | 94683-95123 | _na 146_aa | exbD | Biopolymer transporter ExbD |
| 132 | UFTB01000001.1 | GCA900445575_00237 | CDS | open | 95156-95749 | _na 197_aa | Transport energizing protein%2C ExbD/TolR family | |
| 133 | UFTB01000001.1 | GCA900445575_00238 | CDS | open | 95788-96273 | _na 161_aa | Transmembrane protein | |
| 134 | UFTB01000001.1 | GCA900445575_00239 | CDS | open | 96280-97071 | _na 263_aa | MotA/TolQ/ExbB proton channel domain-containing protein | |
| 135 | UFTB01000001.1 | GCA900445575_00241 | CDS | open | 97351-98127 | _na 258_aa | tatD | Hydrolase%2C TatD family |
| 136 | UFTB01000001.1 | GCA900445575_00242 | CDS | open | 98147-98836 | _na 229_aa | HEPN domain-containing protein | |
| 137 | UFTB01000001.1 | GCA900445575_00243 | CDS | open | 98852-99826 | _na 324_aa | Polyprenyl synthetase | |
| 138 | UFTB01000001.1 | GCA900445575_00244 | CDS | open | 99913-100596 | _na 227_aa | tonB | Energy transducer TonB |
| 139 | UFTB01000001.1 | GCA900445575_00245 | CDS | open | 100978-101112 | _na 44_aa | hypothetical protein | |
| 140 | UFTB01000001.1 | GCA900445575_00246 | CDS | open | 101245-101949 | _na 234_aa | cmk | (d)CMP kinase |
| 141 | UFTB01000001.1 | GCA900445575_00247 | CDS | open | 101946-102815 | _na 289_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 142 | UFTB01000001.1 | GCA900445575_00248 | CDS | open | 102950-103930 | _na 326_aa | pfkA | 6-phosphofructokinase |
| 143 | UFTB01000001.1 | GCA900445575_00249 | CDS | open | 104313-104459 | _na 48_aa | Mutator family transposase | |
| 144 | UFTB01000001.1 | GCA900445575_00250 | CDS | open | 104614-104811 | _na 65_aa | hypothetical protein | |
| 145 | UFTB01000001.1 | GCA900445575_00251 | CDS | open | 105049-105435 | _na 128_aa | hypothetical protein | |
| 146 | UFTB01000001.1 | GCA900445575_00252 | CDS | open | 105905-106951 | _na 348_aa | ilvC | ketol-acid reductoisomerase |
| 147 | UFTB01000001.1 | GCA900445575_00253 | CDS | open | 106959-107726 | _na 255_aa | Acyl-ACP thioesterase | |
| 148 | UFTB01000001.1 | GCA900445575_00254 | CDS | open | 107847-108407 | _na 186_aa | ilvN | acetolactate synthase small subunit |
| 149 | UFTB01000001.1 | GCA900445575_00255 | CDS | open | 108435-110129 | _na 564_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 150 | UFTB01000001.1 | GCA900445575_00256 | CDS | open | 110244-112046 | _na 600_aa | ilvD | dihydroxy-acid dehydratase |
| 151 | UFTB01000001.1 | GCA900445575_00257 | CDS | open | 112527-113135 | _na 202_aa | Peptidyl-prolyl cis-trans isomerase | |
| 152 | UFTB01000001.1 | GCA900445575_00258 | CDS | open | 113319-114599 | _na 426_aa | UPF0597 protein HMPREF1981_03514 | |
| 153 | UFTB01000001.1 | GCA900445575_00259 | CDS | open | 115020-115676 | _na 218_aa | satD | SatD family protein |
| 154 | UFTB01000001.1 | GCA900445575_00260 | CDS | open | 115664-116395 | _na 243_aa | DUF3307 domain-containing protein | |
| 155 | UFTB01000001.1 | GCA900445575_00262 | CDS | open | 116801-117838 | _na 345_aa | asnA | aspartate--ammonia ligase |
| 156 | UFTB01000001.1 | GCA900445575_00263 | CDS | open | 117841-118503 | _na 220_aa | ung | uracil-DNA glycosylase |
| 157 | UFTB01000001.1 | GCA900445575_00264 | CDS | open | 118980-120146 | _na 388_aa | purM | Phosphoribosylformylglycinamidine cyclo-ligase |
| 158 | UFTB01000001.1 | GCA900445575_00265 | CDS | open | 120160-121134 | _na 324_aa | HTH HARE-type domain-containing protein | |
| 159 | UFTB01000001.1 | GCA900445575_00266 | CDS | open | 121158-122267 | _na 369_aa | prfA | peptide chain release factor 1 |
| 160 | UFTB01000001.1 | GCA900445575_00267 | CDS | open | 122287-123114 | _na 275_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 161 | UFTB01000001.1 | GCA900445575_00268 | CDS | open | 123164-124393 | _na 409_aa | HD domain protein | |
| 162 | UFTB01000001.1 | GCA900445575_00269 | CDS | open | 124476-125516 | _na 346_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 163 | UFTB01000001.1 | GCA900445575_00270 | CDS | open | 125520-126905 | _na 461_aa | lpxC | bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase |
| 164 | UFTB01000001.1 | GCA900445575_00271 | CDS | open | 126923-127690 | _na 255_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 165 | UFTB01000001.1 | GCA900445575_00272 | CDS | open | 127713-128267 | _na 184_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 166 | UFTB01000001.1 | GCA900445575_00273 | CDS | open | 128301-129197 | _na 298_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 167 | UFTB01000001.1 | GCA900445575_00274 | CDS | open | 129864-130166 | _na 100_aa | Transmembrane protein | |
| 168 | UFTB01000001.1 | GCA900445575_00275 | CDS | open | 130321-132531 | _na 736_aa | Peptidase%2C S9A/B/C family%2C catalytic domain protein | |
| 169 | UFTB01000001.1 | GCA900445575_00276 | CDS | open | 132531-133379 | _na 282_aa | lipA | lipoyl synthase |
| 170 | UFTB01000001.1 | GCA900445575_00277 | CDS | open | 133436-134554 | _na 372_aa | Isopentenyl-diphosphate delta-isomerase | |
| 171 | UFTB01000001.1 | GCA900445575_00278 | CDS | open | 134520-135224 | _na 234_aa | Tetrapyrrole methylase family protein | |
| 172 | UFTB01000001.1 | GCA900445575_00279 | CDS | open | 135257-136264 | _na 335_aa | gldB | Gliding motility-associated lipoprotein GldB |
| 173 | UFTB01000001.1 | GCA900445575_00280 | CDS | open | 136271-137128 | _na 285_aa | Enoyl-[acyl-carrier-protein] reductase [NADH] | |
| 174 | UFTB01000001.1 | GCA900445575_00281 | CDS | open | 137352-137933 | _na 193_aa | Bacterial group 2 Ig-like protein | |
| 175 | UFTB01000001.1 | GCA900445575_00282 | CDS | open | 138089-138736 | _na 215_aa | Putative phosphoglycolate phosphatase%2C bacterial | |
| 176 | UFTB01000001.1 | GCA900445575_00283 | CDS | open | 138857-139237 | _na 126_aa | hypothetical protein | |
| 177 | UFTB01000001.1 | GCA900445575_00284 | CDS | open | 139309-140220 | _na 303_aa | Thioredoxin domain-containing protein | |
| 178 | UFTB01000001.1 | GCA900445575_00285 | CDS | open | 140526-141023 | _na 165_aa | Putative non-specific DNA-binding protein | |
| 179 | UFTB01000001.1 | GCA900445575_00286 | CDS | open | 141351-144110 | _na 919_aa | BACON domain-containing protein | |
| 180 | UFTB01000001.1 | GCA900445575_00287 | CDS | open | 144193-146589 | _na 798_aa | fimbrial protein | |
| 181 | UFTB01000001.1 | GCA900445575_00288 | CDS | open | 146637-147551 | _na 304_aa | FimB/Mfa2 family fimbrial subunit | |
| 182 | UFTB01000001.1 | GCA900445575_00289 | CDS | open | 147904-149070 | _na 388_aa | Major fimbrial subunit protein N-terminal domain-containing protein | |
| 183 | UFTB01000001.1 | GCA900445575_00290 | CDS | open | 149149-150885 | _na 578_aa | Tetratricopeptide repeat protein | |
| 184 | UFTB01000001.1 | GCA900445575_00291 | CDS | open | 150955-151509 | _na 184_aa | DUF3575 domain-containing protein | |
| 185 | UFTB01000001.1 | GCA900445575_00292 | CDS | open | 151929-152873 | _na 314_aa | Site-specific recombinase%2C phage integrase family | |
| 186 | UFTB01000001.1 | GCA900445575_00293 | CDS | open | 153457-153657 | _na 66_aa | Site-specific integrase | |
| 187 | UFTB01000001.1 | GCA900445575_00294 | CDS | open | 153686-155104 | _na 472_aa | UvrD-like helicase C-terminal domain-containing protein | |
| 188 | UFTB01000001.1 | GCA900445575_00295 | CDS | open | 155201-155887 | _na 228_aa | GLPGLI family protein | |
| 189 | UFTB01000001.1 | GCA900445575_00296 | CDS | open | 155887-156657 | _na 256_aa | DUF3822 domain-containing protein | |
| 190 | UFTB01000001.1 | GCA900445575_00297 | CDS | open | 156648-157181 | _na 177_aa | UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase | |
| 191 | UFTB01000001.1 | GCA900445575_00298 | CDS | open | 157227-158666 | _na 479_aa | cls | cardiolipin synthase |
| 192 | UFTB01000001.1 | GCA900445575_00299 | CDS | open | 158866-161796 | _na 976_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 193 | UFTB01000001.1 | GCA900445575_00300 | CDS | open | 162239-162643 | _na 134_aa | Transmembrane protein | |
| 194 | UFTB01000001.1 | GCA900445575_00301 | CDS | open | 162768-163832 | _na 354_aa | aroB | 3-dehydroquinate synthase |
| 195 | UFTB01000001.1 | GCA900445575_00303 | CDS | open | 164814-166034 | _na 406_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 196 | UFTB01000001.1 | GCA900445575_00304 | CDS | open | 166049-166558 | _na 169_aa | Putative isopentenyl-diphosphate delta-isomerase | |
| 197 | UFTB01000001.1 | GCA900445575_00305 | CDS | open | 166739-167281 | _na 180_aa | Glutathione peroxidase | |
| 198 | UFTB01000001.1 | GCA900445575_00306 | CDS | open | 167551-168939 | _na 462_aa | glmM | phosphoglucosamine mutase |
| 199 | UFTB01000001.1 | GCA900445575_00307 | CDS | open | 168975-169631 | _na 218_aa | DUF4827 domain-containing protein | |
| 200 | UFTB01000001.1 | GCA900445575_00308 | CDS | open | 169751-170788 | _na 345_aa | DHH family protein | |
| 201 | UFTB01000001.1 | GCA900445575_00309 | CDS | open | 171003-173099 | _na 698_aa | DNA internalization-related competence protein ComEC/Rec2 | |
| 202 | UFTB01000001.1 | GCA900445575_00310 | CDS | open | 173784-174434 | _na 216_aa | rpe | ribulose-phosphate 3-epimerase |
| 203 | UFTB01000001.1 | GCA900445575_00311 | CDS | open | 174533-175501 | _na 322_aa | fmt | methionyl-tRNA formyltransferase |
| 204 | UFTB01000001.1 | GCA900445575_00312 | CDS | open | 175575-177368 | _na 597_aa | CBS domain-containing protein | |
| 205 | UFTB01000001.1 | GCA900445575_00313 | CDS | open | 177369-177899 | _na 176_aa | L-threonylcarbamoyladenylate synthase | |
| 206 | UFTB01000001.1 | GCA900445575_00314 | CDS | open | 178270-178473 | _na 67_aa | hypothetical protein | |
| 207 | UFTB01000001.1 | GCA900445575_00315 | CDS | open | 178389-178769 | _na 126_aa | hypothetical protein | |
| 208 | UFTB01000001.1 | GCA900445575_00316 | CDS | open | 178861-180024 | _na 387_aa | Outer membrane porin F | |
| 209 | UFTB01000001.1 | GCA900445575_00317 | CDS | open | 180174-180998 | _na 274_aa | fecR | FecR protein domain-containing protein |
| 210 | UFTB01000001.1 | GCA900445575_00318 | CDS | open | 181035-181613 | _na 192_aa | RNA polymerase sigma factor%2C sigma-70 family | |
| 211 | UFTB01000001.1 | GCA900445575_00319 | CDS | open | 181679-183283 | _na 534_aa | prfC | peptide chain release factor 3 |
| 212 | UFTB01000001.1 | GCA900445575_00320 | CDS | open | 183303-184169 | _na 288_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 213 | UFTB01000001.1 | GCA900445575_00321 | CDS | open | 184170-184715 | _na 181_aa | DUF4924 domain-containing protein | |
| 214 | UFTB01000001.1 | GCA900445575_00322 | CDS | open | 184728-185381 | _na 217_aa | rhtB | His/Glu/Gln/Arg/opine family amino ABC transporter%2C permease%2C 3-TM region |
| 215 | UFTB01000001.1 | GCA900445575_00323 | CDS | open | 185441-185623 | _na 60_aa | hypothetical protein | |
| 216 | UFTB01000001.1 | GCA900445575_00324 | CDS | open | 185802-189506 | _na 1234_aa | purL | phosphoribosylformylglycinamidine synthase |
| 217 | UFTB01000001.1 | GCA900445575_00325 | CDS | open | 189844-190185 | _na 113_aa | hypothetical protein | |
| 218 | UFTB01000001.1 | GCA900445575_00326 | CDS | open | 190207-190671 | _na 154_aa | araC | Transcriptional regulator%2C AraC family |
| 219 | UFTB01000001.1 | GCA900445575_00327 | CDS | open | 190691-191269 | _na 192_aa | Chromate transport protein | |
| 220 | UFTB01000001.1 | GCA900445575_00328 | CDS | open | 191325-191873 | _na 182_aa | Chromate transport protein | |
| 221 | UFTB01000001.1 | GCA900445575_00329 | CDS | open | 191877-193385 | _na 502_aa | putative glycoside hydrolase | |
| 222 | UFTB01000001.1 | GCA900445575_00330 | CDS | open | 193516-195354 | _na 612_aa | recQ | DNA helicase RecQ |
| 223 | UFTB01000001.1 | GCA900445575_00331 | CDS | open | 195813-196808 | _na 331_aa | IS110 family transposase | |
| 224 | UFTB01000001.1 | GCA900445575_00332 | CDS | open | 197028-197630 | _na 200_aa | ruvA | Holliday junction branch migration protein RuvA |
| 225 | UFTB01000001.1 | GCA900445575_00333 | CDS | open | 197777-198676 | _na 299_aa | ddh | diaminopimelate dehydrogenase |
| 226 | UFTB01000001.1 | GCA900445575_00334 | CDS | open | 200092-201429 | _na 445_aa | alpha-L-fucosidase | |
| 227 | UFTB01000001.1 | GCA900445575_00335 | CDS | open | 201661-202236 | _na 191_aa | RNA polymerase sigma factor | |
| 228 | UFTB01000001.1 | GCA900445575_00336 | CDS | open | 202293-203303 | _na 336_aa | fecR | FecR family protein |
| 229 | UFTB01000001.1 | GCA900445575_00337 | CDS | open | 203487-206927 | _na 1146_aa | TonB-dependent receptor | |
| 230 | UFTB01000001.1 | GCA900445575_00338 | CDS | open | 206938-208908 | _na 656_aa | RagB/SusD family nutrient uptake outer membrane protein | |
| 231 | UFTB01000001.1 | GCA900445575_00339 | CDS | open | 209655-212048 | _na 797_aa | nrdD | anaerobic ribonucleoside triphosphate reductase |
| 232 | UFTB01000001.1 | GCA900445575_00340 | CDS | open | 212059-212550 | _na 163_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 233 | UFTB01000001.1 | GCA900445575_00341 | CDS | open | 212732-214087 | _na 451_aa | rseP | RIP metalloprotease RseP |
| 234 | UFTB01000001.1 | GCA900445575_00342 | CDS | open | 214126-215310 | _na 394_aa | 1-deoxy-D-xylulose-5-phosphate reductoisomerase | |
| 235 | UFTB01000001.1 | GCA900445575_00343 | CDS | open | 215330-216190 | _na 286_aa | Peptidase%2C M23 family | |
| 236 | UFTB01000001.1 | GCA900445575_00344 | CDS | open | 216266-216802 | _na 178_aa | rimM | ribosome maturation factor RimM |
| 237 | UFTB01000001.1 | GCA900445575_00345 | CDS | open | 216799-218103 | _na 434_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 238 | UFTB01000001.1 | GCA900445575_00346 | CDS | open | 218121-218735 | _na 204_aa | DUF4290 domain-containing protein | |
| 239 | UFTB01000001.1 | GCA900445575_00347 | CDS | open | 218738-219427 | _na 229_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 240 | UFTB01000001.1 | GCA900445575_00348 | CDS | open | 219448-220395 | _na 315_aa | TIGR00255 family protein | |
| 241 | UFTB01000001.1 | GCA900445575_00349 | CDS | open | 220427-220993 | _na 188_aa | gmk | guanylate kinase |
| 242 | UFTB01000001.1 | GCA900445575_00350 | CDS | open | 221010-221606 | _na 198_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 243 | UFTB01000001.1 | GCA900445575_00351 | CDS | open | 221563-222480 | _na 305_aa | Metallophosphoesterase | |
| 244 | UFTB01000001.1 | GCA900445575_00352 | CDS | open | 222573-223490 | _na 305_aa | 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase | |
| 245 | UFTB01000001.1 | GCA900445575_00353 | CDS | open | 223534-224667 | _na 377_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 246 | UFTB01000001.1 | GCA900445575_00354 | CDS | open | 224676-225563 | _na 295_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 247 | UFTB01000001.1 | GCA900445575_00355 | CDS | open | 226394-226645 | _na 83_aa | hypothetical protein | |
| 248 | UFTB01000001.1 | GCA900445575_00356 | CDS | open | 226821-228059 | _na 412_aa | Site-specific recombinase%2C phage integrase family | |
| 249 | UFTB01000001.1 | GCA900445575_00357 | CDS | open | 228151-228933 | _na 260_aa | 4Fe-4S binding domain protein | |
| 250 | UFTB01000001.1 | GCA900445575_00358 | CDS | open | 228923-229774 | _na 283_aa | Putative esterase | |
| 251 | UFTB01000001.1 | GCA900445575_00359 | CDS | open | 229784-230368 | _na 194_aa | UDP-N-acetylmuramoylalanyl-D-glutamyl-2%2C 6-diaminopimelate-D-alanyl-D-alanine ligase | |
| 252 | UFTB01000001.1 | GCA900445575_00360 | CDS | open | 230361-230645 | _na 94_aa | Winged helix DNA-binding domain-containing protein | |
| 253 | UFTB01000001.1 | GCA900445575_00361 | CDS | open | 230757-231308 | _na 183_aa | rteC | RteC protein |
| 254 | UFTB01000001.1 | GCA900445575_00362 | CDS | open | 231481-231795 | _na 104_aa | Helix-turn-helix domain-containing protein | |
| 255 | UFTB01000001.1 | GCA900445575_00363 | CDS | open | 232127-232714 | _na 195_aa | btgA | Clindamycin resistance transfer factor BtgA |
| 256 | UFTB01000001.1 | GCA900445575_00364 | CDS | open | 232726-233604 | _na 292_aa | btgB | Clindamycin resistance transfer factor BtgB |
| 257 | UFTB01000001.1 | GCA900445575_00365 | CDS | open | 233898-234125 | _na 75_aa | helix-turn-helix domain-containing protein | |
| 258 | UFTB01000001.1 | GCA900445575_00366 | CDS | open | 234180-234299 | _na 39_aa | hypothetical protein | |
| 259 | UFTB01000001.1 | GCA900445575_00367 | CDS | open | 234299-234862 | _na 187_aa | Transposase | |
| 260 | UFTB01000001.1 | GCA900445575_00368 | CDS | open | 235633-236553 | _na 306_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 261 | UFTB01000001.1 | GCA900445575_00369 | CDS | open | 236589-237515 | _na 308_aa | Lipid kinase%2C YegS/Rv2252/BmrU family | |
| 262 | UFTB01000001.1 | GCA900445575_00370 | CDS | open | 237561-238361 | _na 266_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 263 | UFTB01000001.1 | GCA900445575_00371 | CDS | open | 238514-241357 | _na 947_aa | Insulinase family protein | |
| 264 | UFTB01000001.1 | GCA900445575_00372 | CDS | open | 241384-242877 | _na 497_aa | Transmembrane protein | |
| 265 | UFTB01000001.1 | GCA900445575_00373 | CDS | open | 242915-243619 | _na 234_aa | ABC transporter%2C ATP-binding protein | |
| 266 | UFTB01000001.1 | GCA900445575_00374 | CDS | open | 243629-244138 | _na 169_aa | NlpC/P60 family protein | |
| 267 | UFTB01000001.1 | GCA900445575_00375 | CDS | open | 244146-245588 | _na 480_aa | NOL1/NOP2/sun family protein | |
| 268 | UFTB01000001.1 | GCA900445575_00376 | CDS | open | 245699-246448 | _na 249_aa | DUF6249 domain-containing protein | |
| 269 | UFTB01000001.1 | GCA900445575_00377 | CDS | open | 246445-246993 | _na 182_aa | RNA polymerase sigma factor | |
| 270 | UFTB01000001.1 | GCA900445575_00378 | CDS | open | 246977-247306 | _na 109_aa | DUF5056 domain-containing protein | |
| 271 | UFTB01000001.1 | GCA900445575_00379 | CDS | open | 247337-247708 | _na 123_aa | folB | dihydroneopterin aldolase |
| 272 | UFTB01000001.1 | GCA900445575_00380 | CDS | open | 247747-248403 | _na 218_aa | hypothetical protein | |
| 273 | UFTB01000001.1 | GCA900445575_00381 | CDS | open | 248436-248957 | _na 173_aa | mgsA | methylglyoxal synthase |
| 274 | UFTB01000001.1 | GCA900445575_00382 | CDS | open | 248963-249991 | _na 342_aa | Glycosyltransferase%2C group 2 family protein | |
| 275 | UFTB01000001.1 | GCA900445575_00383 | CDS | open | 250092-250976 | _na 294_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 276 | UFTB01000001.1 | GCA900445575_00384 | CDS | open | 250966-252297 | _na 443_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 277 | UFTB01000001.1 | GCA900445575_00385 | CDS | open | 252408-254081 | _na 557_aa | fAA1 | AMP-dependent synthetase/ligase domain-containing protein |
| 278 | UFTB01000001.1 | GCA900445575_00386 | CDS | open | 254236-254442 | _na 68_aa | Lipoprotein | |
| 279 | UFTB01000001.1 | GCA900445575_00387 | CDS | open | 254808-255251 | _na 147_aa | rplI | 50S ribosomal protein L9 |
| 280 | UFTB01000001.1 | GCA900445575_00388 | CDS | open | 255266-255538 | _na 90_aa | rpsR | 30S ribosomal protein S18 |
| 281 | UFTB01000001.1 | GCA900445575_00389 | CDS | open | 255541-255885 | _na 114_aa | rpsF | 30S ribosomal protein S6 |
| 282 | UFTB01000001.1 | GCA900445575_00390 | CDS | open | 255839-256012 | _na 57_aa | hypothetical protein | |
| 283 | UFTB01000001.1 | GCA900445575_00391 | CDS | open | 256379-256825 | _na 148_aa | marR | Transcriptional regulator%2C MarR family |
| 284 | UFTB01000001.1 | GCA900445575_00392 | CDS | open | 256967-257143 | _na 58_aa | Lipoprotein | |
| 285 | UFTB01000001.1 | GCA900445575_00393 | CDS | open | 257351-258052 | _na 233_aa | rprY | Transcriptional regulatory protein RprY |
| 286 | UFTB01000001.1 | GCA900445575_00394 | CDS | open | 258054-259610 | _na 518_aa | histidine kinase | |
| 287 | UFTB01000001.1 | GCA900445575_00395 | CDS | open | 260723-261988 | _na 421_aa | Peptidase A2 domain-containing protein | |
| 288 | UFTB01000001.1 | GCA900445575_00396 | CDS | open | 262155-262403 | _na 82_aa | methyltransferase family protein | |
| 289 | UFTB01000001.1 | GCA900445575_00397 | CDS | open | 262526-262942 | _na 138_aa | Lipocalin-like domain-containing protein | |
| 290 | UFTB01000001.1 | GCA900445575_00398 | CDS | open | 263598-265754 | _na 718_aa | fusA | Tetracycline resistance protein TetQ |
| 291 | UFTB01000001.1 | GCA900445575_00399 | CDS | open | 266119-266892 | _na 257_aa | N-acetylmuramidase domain-containing protein | |
| 292 | UFTB01000001.1 | GCA900445575_00400 | CDS | open | 266973-268109 | _na 378_aa | hemW | radical SAM family heme chaperone HemW |
| 293 | UFTB01000001.1 | GCA900445575_00401 | CDS | open | 268126-268671 | _na 181_aa | RNA polymerase sigma-70 factor | |
| 294 | UFTB01000001.1 | GCA900445575_00402 | CDS | open | 268832-269266 | _na 144_aa | Lipoprotein | |
| 295 | UFTB01000001.1 | GCA900445575_00403 | CDS | open | 269293-270177 | _na 294_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 296 | UFTB01000001.1 | GCA900445575_00404 | CDS | open | 270174-272867 | _na 897_aa | TonB-dependent receptor | |
| 297 | UFTB01000001.1 | GCA900445575_00405 | CDS | open | 272873-273931 | _na 352_aa | DUF4249 domain-containing protein | |
| 298 | UFTB01000001.1 | GCA900445575_00406 | CDS | open | 274480-274833 | _na 117_aa | DUF3347 domain-containing protein | |
| 299 | UFTB01000001.1 | GCA900445575_00407 | CDS | open | 275520-275885 | _na 121_aa | hypothetical protein | |
| 300 | UFTB01000001.1 | GCA900445575_00408 | CDS | open | 275878-276246 | _na 122_aa | tnpB | IS66 family insertion sequence element accessory protein TnpB |
| 301 | UFTB01000001.1 | GCA900445575_00409 | CDS | open | 276327-277877 | _na 516_aa | tnpC | IS66 family transposase |
| 302 | UFTB01000001.1 | GCA900445575_00410 | CDS | open | 278193-279254 | _na 353_aa | Putative ABC transporter ATP-binding protein | |
| 303 | UFTB01000001.1 | GCA900445575_00411 | CDS | open | 279343-280194 | _na 283_aa | AAA+ ATPase domain-containing protein | |
| 304 | UFTB01000001.1 | GCA900445575_00412 | CDS | open | 280503-281597 | _na 364_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 305 | UFTB01000001.1 | GCA900445575_00413 | CDS | open | 281609-282760 | _na 383_aa | HYDIN/VesB/CFA65-like Ig-like domain-containing protein | |
| 306 | UFTB01000001.1 | GCA900445575_00414 | CDS | open | 282903-284444 | _na 513_aa | BACON domain-containing protein | |
| 307 | UFTB01000001.1 | GCA900445575_00415 | CDS | open | 284458-285330 | _na 290_aa | Calx-beta domain-containing protein | |
| 308 | UFTB01000001.1 | GCA900445575_00416 | CDS | open | 285361-286833 | _na 490_aa | DUF4302 domain-containing protein | |
| 309 | UFTB01000001.1 | GCA900445575_00417 | CDS | open | 286847-287794 | _na 315_aa | Substrate import-associated zinc metallohydrolase lipoprotein | |
| 310 | UFTB01000001.1 | GCA900445575_00418 | CDS | open | 287803-289305 | _na 500_aa | susD | SusD family protein |
| 311 | UFTB01000001.1 | GCA900445575_00419 | CDS | open | 289317-292898 | _na 1193_aa | SusC/RagA family TonB-linked outer membrane protein | |
| 312 | UFTB01000001.1 | GCA900445575_00420 | CDS | open | 293052-294218 | _na 388_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 313 | UFTB01000001.1 | GCA900445575_00421 | CDS | open | 294482-295018 | _na 178_aa | RNA polymerase sigma-70 factor | |
| 314 | UFTB01000001.1 | GCA900445575_00422 | CDS | open | 295447-296442 | _na 331_aa | IS110 family transposase | |
| 315 | UFTB01000001.1 | GCA900445575_00423 | CDS | open | 296635-302346 | _na 1903_aa | Alpha-2-macroglobulin domain-containing protein | |
| 316 | UFTB01000001.1 | GCA900445575_00424 | CDS | open | 304433-305017 | _na 194_aa | IS3 family transposase | |
| 317 | UFTB01000001.1 | GCA900445575_00425 | CDS | open | 305168-305275 | _na 35_aa | hypothetical protein | |
| 318 | UFTB01000001.1 | GCA900445575_00426 | CDS | open | 305272-305550 | _na 92_aa | Transposase | |
| 319 | UFTB01000001.1 | GCA900445575_00427 | CDS | open | 305729-306571 | _na 280_aa | Aspartyl protease | |
| 320 | UFTB01000001.1 | GCA900445575_00428 | CDS | open | 306594-306752 | _na 52_aa | Bacteriocin-type signal sequence | |
| 321 | UFTB01000001.1 | GCA900445575_00429 | CDS | open | 307096-307704 | _na 202_aa | Insertion element IS402-like domain-containing protein | |
| 322 | UFTB01000001.1 | GCA900445575_00430 | CDS | open | 307842-310133 | _na 763_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 323 | UFTB01000001.1 | GCA900445575_00431 | CDS | open | 310761-311522 | _na 253_aa | luxR | Transcriptional regulator%2C LuxR family |
| 324 | UFTB01000001.1 | GCA900445575_00432 | CDS | open | 311558-312328 | _na 256_aa | thiF | ThiF family protein |
| 325 | UFTB01000001.1 | GCA900445575_00433 | CDS | open | 312642-313721 | _na 359_aa | hipA | HipA domain protein |
| 326 | UFTB01000001.1 | GCA900445575_00434 | CDS | open | 313714-314031 | _na 105_aa | Transcriptional regulator%2C y4mF family | |
| 327 | UFTB01000001.1 | GCA900445575_00435 | CDS | open | 314400-315221 | _na 273_aa | hypothetical protein | |
| 328 | UFTB01000001.1 | GCA900445575_00436 | CDS | open | 315252-316121 | _na 289_aa | DUF4249 domain-containing protein | |
| 329 | UFTB01000001.1 | GCA900445575_00437 | CDS | open | 316123-318450 | _na 775_aa | TonB-dependent receptor | |
| 330 | UFTB01000001.1 | GCA900445575_00438 | CDS | open | 318390-318491 | _na 33_aa | hypothetical protein | |
| 331 | UFTB01000001.1 | GCA900445575_00439 | CDS | open | 318488-318586 | _na 32_aa | hypothetical protein | |
| 332 | UFTB01000001.1 | GCA900445575_00440 | CDS | open | 318691-319815 | _na 374_aa | Rossmann fold nucleotide-binding protein | |
| 333 | UFTB01000001.1 | GCA900445575_00441 | CDS | open | 320065-321522 | _na 485_aa | pepD2 | Aminoacyl-histidine dipeptidase |
| 334 | UFTB01000001.1 | GCA900445575_00442 | CDS | open | 321529-322506 | _na 325_aa | Dolichol-P-glucose synthetase | |
| 335 | UFTB01000001.1 | GCA900445575_00443 | CDS | open | 322577-323362 | _na 261_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 336 | UFTB01000001.1 | GCA900445575_00444 | CDS | open | 323369-324712 | _na 447_aa | mgtE | magnesium transporter |
| 337 | UFTB01000001.1 | GCA900445575_00445 | CDS | open | 324797-326647 | _na 616_aa | DUF349 domain-containing protein | |
| 338 | UFTB01000001.1 | GCA900445575_00446 | CDS | open | 326922-327440 | _na 172_aa | cobU | bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase |
| 339 | UFTB01000001.1 | GCA900445575_00447 | CDS | open | 327478-328515 | _na 345_aa | cobT | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase |
| 340 | UFTB01000001.1 | GCA900445575_00448 | CDS | open | 328539-329288 | _na 249_aa | Adenosylcobinamide-GDP ribazoletransferase | |
| 341 | UFTB01000001.1 | GCA900445575_00449 | CDS | open | 329292-329819 | _na 175_aa | cobC | alpha-ribazole phosphatase |
| 342 | UFTB01000001.1 | GCA900445575_00450 | CDS | open | 329960-330886 | _na 308_aa | cbiB | adenosylcobinamide-phosphate synthase CbiB |
| 343 | UFTB01000001.1 | GCA900445575_00451 | CDS | open | 330905-331324 | _na 139_aa | hypothetical protein | |
| 344 | UFTB01000001.1 | GCA900445575_00452 | CDS | open | 331132-332145 | _na 337_aa | Aminotransferase | |
| 345 | UFTB01000001.1 | GCA900445575_00453 | CDS | open | 332142-333602 | _na 486_aa | cobyric acid synthase | |
| 346 | UFTB01000001.1 | GCA900445575_00454 | CDS | open | 334183-334791 | _na 202_aa | Corrinoid adenosyltransferase | |
| 347 | UFTB01000001.1 | GCA900445575_00455 | CDS | open | 334788-336443 | _na 551_aa | cobyrinate a%2Cc-diamide synthase | |
| 348 | UFTB01000001.1 | GCA900445575_00456 | CDS | open | 336440-337627 | _na 395_aa | cbiE | Precorrin-6y C5%2C15-methyltransferase (Decarboxylating) subunit CbiE |
| 349 | UFTB01000001.1 | GCA900445575_00457 | CDS | open | 337666-339072 | _na 468_aa | Precorrin-3B C(17)-methyltransferase | |
| 350 | UFTB01000001.1 | GCA900445575_00458 | CDS | open | 339230-339694 | _na 154_aa | DUF6078 domain-containing protein | |
| 351 | UFTB01000001.1 | GCA900445575_00459 | CDS | open | 340187-340432 | _na 81_aa | RRM domain-containing protein | |
| 352 | UFTB01000001.1 | GCA900445575_00460 | CDS | open | 340775-341545 | _na 256_aa | ABC transporter%2C ATP-binding protein | |
| 353 | UFTB01000001.1 | GCA900445575_00461 | CDS | open | 341542-342285 | _na 247_aa | mlaE | ABC transporter permease |
| 354 | UFTB01000001.1 | GCA900445575_00462 | CDS | open | 342362-343141 | _na 259_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 355 | UFTB01000001.1 | GCA900445575_00463 | CDS | open | 343472-344785 | _na 437_aa | der | ribosome biogenesis GTPase Der |
| 356 | UFTB01000001.1 | GCA900445575_00464 | CDS | open | 344837-345718 | _na 293_aa | era | GTPase Era |
| 357 | UFTB01000001.1 | GCA900445575_00465 | CDS | open | 345811-346815 | _na 334_aa | fabH2 | Beta-ketoacyl-[acyl-carrier-protein] synthase III 2 |
| 358 | UFTB01000001.1 | GCA900445575_00466 | CDS | open | 346905-347090 | _na 61_aa | rpmF | 50S ribosomal protein L32 |
| 359 | UFTB01000001.1 | GCA900445575_00467 | CDS | open | 347104-347643 | _na 179_aa | ACR | |
| 360 | UFTB01000001.1 | GCA900445575_00468 | CDS | open | 348337-348570 | _na 77_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 361 | UFTB01000001.1 | GCA900445575_00474 | CDS | open | 355255-355545 | _na 96_aa | hypothetical protein | |
| 362 | UFTB01000001.1 | GCA900445575_00475 | CDS | open | 355902-357530 | _na 542_aa | algI | Alginate O-acetyltransferase AlgI domain protein |
| 363 | UFTB01000001.1 | GCA900445575_00476 | CDS | open | 357511-358815 | _na 434_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 364 | UFTB01000001.1 | GCA900445575_00477 | CDS | open | 358799-360175 | _na 458_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 365 | UFTB01000001.1 | GCA900445575_00478 | CDS | open | 360172-360330 | _na 52_aa | hypothetical protein | |
| 366 | UFTB01000001.1 | GCA900445575_00479 | CDS | open | 360906-361199 | _na 97_aa | PG0541 family transporter-associated protein | |
| 367 | UFTB01000001.1 | GCA900445575_00480 | CDS | open | 361228-364371 | _na 1047_aa | czcA | Heavy metal efflux pump%2C CzcA family |
| 368 | UFTB01000001.1 | GCA900445575_00481 | CDS | open | 364508-365521 | _na 337_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 369 | UFTB01000001.1 | GCA900445575_00482 | CDS | open | 365542-366909 | _na 455_aa | Outer membrane efflux protein | |
| 370 | UFTB01000001.1 | GCA900445575_00483 | CDS | open | 367013-367657 | _na 214_aa | HTH tetR-type domain-containing protein | |
| 371 | UFTB01000001.1 | GCA900445575_00484 | CDS | open | 368118-369617 | _na 499_aa | hutH | histidine ammonia-lyase |
| 372 | UFTB01000001.1 | GCA900445575_00485 | CDS | open | 369614-370243 | _na 209_aa | Putative methenyltetrahydrofolate cyclohydrolase | |
| 373 | UFTB01000001.1 | GCA900445575_00486 | CDS | open | 370264-371517 | _na 417_aa | hutI | imidazolonepropionase |
| 374 | UFTB01000001.1 | GCA900445575_00487 | CDS | open | 371528-372430 | _na 300_aa | ftcD | glutamate formimidoyltransferase |
| 375 | UFTB01000001.1 | GCA900445575_00488 | CDS | open | 372603-374585 | _na 660_aa | urocanate hydratase | |
| 376 | UFTB01000001.1 | GCA900445575_00489 | CDS | open | 374881-375390 | _na 169_aa | hypothetical protein | |
| 377 | UFTB01000001.1 | GCA900445575_00490 | CDS | open | 375407-375514 | _na 35_aa | hypothetical protein | |
| 378 | UFTB01000001.1 | GCA900445575_00491 | CDS | open | 375495-376190 | _na 231_aa | fecR | FecR protein domain-containing protein |
| 379 | UFTB01000001.1 | GCA900445575_00492 | CDS | open | 377063-377782 | _na 239_aa | Integrase | |
| 380 | UFTB01000001.1 | GCA900445575_00493 | CDS | open | 377779-378102 | _na 107_aa | Tyr recombinase domain-containing protein | |
| 381 | UFTB01000001.1 | GCA900445575_00494 | CDS | open | 378252-378722 | _na 156_aa | Acetyltransferase%2C GNAT family | |
| 382 | UFTB01000001.1 | GCA900445575_00495 | CDS | open | 378784-379308 | _na 174_aa | Putative DNA-binding protein | |
| 383 | UFTB01000001.1 | GCA900445575_00496 | CDS | open | 379898-380065 | _na 55_aa | hypothetical protein | |
| 384 | UFTB01000001.1 | GCA900445575_00497 | CDS | open | 380916-382763 | _na 615_aa | mutS | DNA mismatch repair proteins mutS family domain-containing protein |
| 385 | UFTB01000001.1 | GCA900445575_00498 | CDS | open | 382634-382888 | _na 84_aa | hypothetical protein | |
| 386 | UFTB01000001.1 | GCA900445575_00499 | CDS | open | 383137-383643 | _na 168_aa | rplQ | 50S ribosomal protein L17 |
| 387 | UFTB01000001.1 | GCA900445575_00500 | CDS | open | 383647-384639 | _na 330_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 388 | UFTB01000001.1 | GCA900445575_00501 | CDS | open | 384651-385256 | _na 201_aa | rpsD | 30S ribosomal protein S4 |
| 389 | UFTB01000001.1 | GCA900445575_00502 | CDS | open | 385373-385762 | _na 129_aa | rpsK | 30S ribosomal protein S11 |
| 390 | UFTB01000001.1 | GCA900445575_00503 | CDS | open | 385774-386154 | _na 126_aa | rpsM | 30S ribosomal protein S13 |
| 391 | UFTB01000001.1 | GCA900445575_00504 | CDS | open | 386188-386304 | _na 38_aa | ykgO | type B 50S ribosomal protein L36 |
| 392 | UFTB01000001.1 | GCA900445575_00505 | CDS | open | 386313-386531 | _na 72_aa | infA | translation initiation factor IF-1 |
| 393 | UFTB01000001.1 | GCA900445575_00506 | CDS | open | 386533-387330 | _na 265_aa | map | type I methionyl aminopeptidase |
| 394 | UFTB01000001.1 | GCA900445575_00507 | CDS | open | 387346-388686 | _na 446_aa | secY | preprotein translocase subunit SecY |
| 395 | UFTB01000001.1 | GCA900445575_00508 | CDS | open | 388691-389137 | _na 148_aa | rplO | 50S ribosomal protein L15 |
| 396 | UFTB01000001.1 | GCA900445575_00509 | CDS | open | 389353-389871 | _na 172_aa | rpsE | 30S ribosomal protein S5 |
| 397 | UFTB01000001.1 | GCA900445575_00510 | CDS | open | 389877-390221 | _na 114_aa | rplR | 50S ribosomal protein L18 |
| 398 | UFTB01000001.1 | GCA900445575_00511 | CDS | open | 390243-390812 | _na 189_aa | rplF | 50S ribosomal protein L6 |
| 399 | UFTB01000001.1 | GCA900445575_00512 | CDS | open | 390829-391224 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 400 | UFTB01000001.1 | GCA900445575_00513 | CDS | open | 391278-391547 | _na 89_aa | rpsN | 30S ribosomal protein S14 |
| 401 | UFTB01000001.1 | GCA900445575_00514 | CDS | open | 391554-392111 | _na 185_aa | rplE | 50S ribosomal protein L5 |
| 402 | UFTB01000001.1 | GCA900445575_00515 | CDS | open | 392111-392431 | _na 106_aa | rplX | 50S ribosomal protein L24 |
| 403 | UFTB01000001.1 | GCA900445575_00516 | CDS | open | 392452-392817 | _na 121_aa | rplN | 50S ribosomal protein L14 |
| 404 | UFTB01000001.1 | GCA900445575_00517 | CDS | open | 392820-393077 | _na 85_aa | rpsQ | 30S ribosomal protein S17 |
| 405 | UFTB01000001.1 | GCA900445575_00518 | CDS | open | 393086-393283 | _na 65_aa | rpmC | 50S ribosomal protein L29 |
| 406 | UFTB01000001.1 | GCA900445575_00519 | CDS | open | 393289-393723 | _na 144_aa | rplP | 50S ribosomal protein L16 |
| 407 | UFTB01000001.1 | GCA900445575_00520 | CDS | open | 393747-394478 | _na 243_aa | rpsC | 30S ribosomal protein S3 |
| 408 | UFTB01000001.1 | GCA900445575_00521 | CDS | open | 394484-394894 | _na 136_aa | rplV | 50S ribosomal protein L22 |
| 409 | UFTB01000001.1 | GCA900445575_00522 | CDS | open | 394930-395199 | _na 89_aa | rpsS | 30S ribosomal protein S19 |
| 410 | UFTB01000001.1 | GCA900445575_00523 | CDS | open | 395220-396044 | _na 274_aa | rplB | 50S ribosomal protein L2 |
| 411 | UFTB01000001.1 | GCA900445575_00524 | CDS | open | 396050-396340 | _na 96_aa | rplW | 50S ribosomal protein L23 |
| 412 | UFTB01000001.1 | GCA900445575_00525 | CDS | open | 396357-396983 | _na 208_aa | rplD | 50S ribosomal protein L4 |
| 413 | UFTB01000001.1 | GCA900445575_00526 | CDS | open | 396983-397600 | _na 205_aa | rplC | 50S ribosomal protein L3 |
| 414 | UFTB01000001.1 | GCA900445575_00527 | CDS | open | 397619-397924 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 415 | UFTB01000001.1 | GCA900445575_00528 | CDS | open | 398005-400122 | _na 705_aa | fusA | elongation factor G |
| 416 | UFTB01000001.1 | GCA900445575_00529 | CDS | open | 400168-400644 | _na 158_aa | rpsG | 30S ribosomal protein S7 |
| 417 | UFTB01000001.1 | GCA900445575_00530 | CDS | open | 400789-401190 | _na 133_aa | rpsL | 30S ribosomal protein S12 |
| 418 | UFTB01000001.1 | GCA900445575_00531 | CDS | open | 401327-401635 | _na 102_aa | DUF3467 domain-containing protein | |
| 419 | UFTB01000001.1 | GCA900445575_00532 | CDS | open | 402091-406374 | _na 1427_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 420 | UFTB01000001.1 | GCA900445575_00533 | CDS | open | 406432-410244 | _na 1270_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 421 | UFTB01000001.1 | GCA900445575_00534 | CDS | open | 410349-410723 | _na 124_aa | rplL | 50S ribosomal protein L7/L12 |
| 422 | UFTB01000001.1 | GCA900445575_00535 | CDS | open | 410770-411288 | _na 172_aa | rplJ | 50S ribosomal protein L10 |
| 423 | UFTB01000001.1 | GCA900445575_00536 | CDS | open | 411304-412002 | _na 232_aa | rplA | 50S ribosomal protein L1 |
| 424 | UFTB01000001.1 | GCA900445575_00537 | CDS | open | 412015-412461 | _na 148_aa | rplK | 50S ribosomal protein L11 |
| 425 | UFTB01000001.1 | GCA900445575_00538 | CDS | open | 412525-413067 | _na 180_aa | nusG | transcription termination/antitermination protein NusG |
| 426 | UFTB01000001.1 | GCA900445575_00540 | CDS | open | 413419-414603 | _na 394_aa | tuf | elongation factor Tu |
| 427 | UFTB01000001.1 | GCA900445575_00545 | CDS | open | 415153-415452 | _na 99_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 428 | UFTB01000001.1 | GCA900445575_00546 | CDS | open | 415469-416350 | _na 293_aa | xerC | Tyrosine recombinase XerC |
| 429 | UFTB01000001.1 | GCA900445575_00547 | CDS | open | 416424-416615 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 430 | UFTB01000001.1 | GCA900445575_00548 | CDS | open | 416811-418592 | _na 593_aa | Creatinase | |
| 431 | UFTB01000001.1 | GCA900445575_00549 | CDS | open | 418617-419129 | _na 170_aa | paaY | Gamma carbonic anhydrase family protein |
| 432 | UFTB01000001.1 | GCA900445575_00550 | CDS | open | 419296-420462 | _na 388_aa | LamG-like jellyroll fold domain-containing protein | |
| 433 | UFTB01000001.1 | GCA900445575_00551 | CDS | open | 420502-421626 | _na 374_aa | Endoglycosidase | |
| 434 | UFTB01000001.1 | GCA900445575_00552 | CDS | open | 421659-423308 | _na 549_aa | SusD/RagB family nutrient-binding outer membrane lipoprotein | |
| 435 | UFTB01000001.1 | GCA900445575_00553 | CDS | open | 423333-426611 | _na 1092_aa | TonB-dependent receptor | |
| 436 | UFTB01000001.1 | GCA900445575_00554 | CDS | open | 426866-427807 | _na 313_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 437 | UFTB01000001.1 | GCA900445575_00555 | CDS | open | 427830-427946 | _na 38_aa | hypothetical protein | |
| 438 | UFTB01000001.1 | GCA900445575_00556 | CDS | open | 428324-428890 | _na 188_aa | RNA polymerase sigma-70 factor | |
| 439 | UFTB01000001.1 | GCA900445575_00557 | CDS | open | 429110-430333 | _na 407_aa | kdtA | 3-deoxy-D-manno-octulosonic acid transferase |
| 440 | UFTB01000001.1 | GCA900445575_00558 | CDS | open | 430348-431865 | _na 505_aa | gltX | glutamate--tRNA ligase |
| 441 | UFTB01000001.1 | GCA900445575_00559 | CDS | open | 431963-434038 | _na 691_aa | 7TM receptor with intracellular HD hydrolase | |
| 442 | UFTB01000001.1 | GCA900445575_00560 | CDS | open | 434013-434483 | _na 156_aa | wzb | Low molecular weight phosphotyrosine protein phosphatase |
| 443 | UFTB01000001.1 | GCA900445575_00561 | CDS | open | 434480-434716 | _na 78_aa | hypothetical protein | |
| 444 | UFTB01000001.1 | GCA900445575_00562 | CDS | open | 434733-437198 | _na 821_aa | priA | primosomal protein N' |
| 445 | UFTB01000001.1 | GCA900445575_00563 | CDS | open | 437568-438170 | _na 200_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 446 | UFTB01000001.1 | GCA900445575_00564 | CDS | open | 438400-438621 | _na 73_aa | DUF2795 domain-containing protein | |
| 447 | UFTB01000001.1 | GCA900445575_00565 | CDS | open | 438694-439257 | _na 187_aa | Corrinoid adenosyltransferase | |
| 448 | UFTB01000001.1 | GCA900445575_00566 | CDS | open | 439310-439933 | _na 207_aa | O-methyltransferase | |
| 449 | UFTB01000001.1 | GCA900445575_00567 | CDS | open | 440074-440334 | _na 86_aa | hypothetical protein | |
| 450 | UFTB01000001.1 | GCA900445575_00568 | CDS | open | 440406-441602 | _na 398_aa | Transposase IS4-like domain-containing protein | |
| 451 | UFTB01000001.1 | GCA900445575_00569 | CDS | open | 441928-442095 | _na 55_aa | hypothetical protein | |
| 452 | UFTB01000001.1 | GCA900445575_00570 | CDS | open | 442122-442358 | _na 78_aa | Putative metal-binding protein | |
| 453 | UFTB01000001.1 | GCA900445575_00571 | CDS | open | 443998-447345 | _na 1115_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 454 | UFTB01000001.1 | GCA900445575_00572 | CDS | open | 447361-448068 | _na 235_aa | csx27 | CRISPR-associated protein Csx27 |
| 455 | UFTB01000001.1 | GCA900445575_00573 | CDS | open | 448748-449584 | _na 278_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 456 | UFTB01000001.1 | GCA900445575_00574 | CDS | open | 449674-451140 | _na 488_aa | Thioredoxin domain-containing protein | |
| 457 | UFTB01000001.1 | GCA900445575_00575 | CDS | open | 451777-453000 | _na 407_aa | xerD | Tyr recombinase domain-containing protein |
| 458 | UFTB01000001.1 | GCA900445575_00576 | CDS | open | 453026-453394 | _na 122_aa | DUF1016 domain-containing protein | |
| 459 | UFTB01000001.1 | GCA900445575_00577 | CDS | open | 453518-454144 | _na 208_aa | yhcG | YhcG PDDEXK nuclease domain-containing protein |
| 460 | UFTB01000001.1 | GCA900445575_00578 | CDS | open | 454361-454807 | _na 148_aa | marR | MarR family protein |
| 461 | UFTB01000001.1 | GCA900445575_00579 | CDS | open | 454907-455623 | _na 238_aa | ArcR-like transcriptional regulator | |
| 462 | UFTB01000001.1 | GCA900445575_00580 | CDS | open | 455779-456498 | _na 239_aa | Four helix bundle sensory module for signal transduction | |
| 463 | UFTB01000001.1 | GCA900445575_00581 | CDS | open | 456503-457423 | _na 306_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 464 | UFTB01000001.1 | GCA900445575_00582 | CDS | open | 457389-457772 | _na 127_aa | Bacterial mobilisation domain-containing protein | |
| 465 | UFTB01000001.1 | GCA900445575_00583 | CDS | open | 457919-458884 | _na 321_aa | Zinc finger CHC2-type domain-containing protein | |
| 466 | UFTB01000001.1 | GCA900445575_00584 | CDS | open | 459048-460121 | _na 357_aa | AAA domain | |
| 467 | UFTB01000001.1 | GCA900445575_00585 | CDS | open | 460127-460414 | _na 95_aa | Helix-turn-helix domain-containing protein | |
| 468 | UFTB01000001.1 | GCA900445575_00586 | CDS | open | 460540-461448 | _na 302_aa | hypothetical protein | |
| 469 | UFTB01000001.1 | GCA900445575_00588 | CDS | open | 461935-463014 | _na 359_aa | Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase | |
| 470 | UFTB01000001.1 | GCA900445575_00589 | CDS | open | 463692-464174 | _na 160_aa | Pyruvate ferredoxin oxidoreductase | |
| 471 | UFTB01000001.1 | GCA900445575_00590 | CDS | open | 464158-464667 | _na 169_aa | Sigma-70 region 2 | |
| 472 | UFTB01000001.1 | GCA900445575_00591 | CDS | open | 464728-465534 | _na 268_aa | Acetylglutamate kinase | |
| 473 | UFTB01000001.1 | GCA900445575_00592 | CDS | open | 465551-467443 | _na 630_aa | speA | biosynthetic arginine decarboxylase |
| 474 | UFTB01000001.1 | GCA900445575_00593 | CDS | open | 467538-468065 | _na 175_aa | shikimate kinase | |
| 475 | UFTB01000001.1 | GCA900445575_00594 | CDS | open | 468165-468800 | _na 211_aa | Ribonuclease H | |
| 476 | UFTB01000001.1 | GCA900445575_00595 | CDS | open | 469068-470456 | _na 462_aa | Thioredoxin | |
| 477 | UFTB01000001.1 | GCA900445575_00596 | CDS | open | 470483-471604 | _na 373_aa | Antioxidant%2C AhpC/TSA family | |
| 478 | UFTB01000001.1 | GCA900445575_00597 | CDS | open | 471635-472903 | _na 422_aa | Thioredoxin | |
| 479 | UFTB01000001.1 | GCA900445575_00598 | CDS | open | 472903-473886 | _na 327_aa | Lipoprotein | |
| 480 | UFTB01000001.1 | GCA900445575_00599 | CDS | open | 473908-475434 | _na 508_aa | susD | SusD family protein |
| 481 | UFTB01000001.1 | GCA900445575_00600 | CDS | open | 475450-479043 | _na 1197_aa | TonB-dependent receptor | |
| 482 | UFTB01000001.1 | GCA900445575_00601 | CDS | open | 479357-480505 | _na 382_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 483 | UFTB01000001.1 | GCA900445575_00602 | CDS | open | 480576-480728 | _na 50_aa | hypothetical protein | |
| 484 | UFTB01000001.1 | GCA900445575_00603 | CDS | open | 480715-481233 | _na 172_aa | RNA polymerase sigma-70 factor | |
| 485 | UFTB01000001.1 | GCA900445575_00604 | CDS | open | 481854-483689 | _na 611_aa | Phage tail component protein | |
| 486 | UFTB01000001.1 | GCA900445575_00605 | CDS | open | 484067-487945 | _na 1292_aa | histidine kinase | |
| 487 | UFTB01000001.1 | GCA900445575_00606 | CDS | open | 488183-488686 | _na 167_aa | RNA polymerase sigma-70 factor | |
| 488 | UFTB01000001.1 | GCA900445575_00607 | CDS | open | 488741-489967 | _na 408_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 489 | UFTB01000001.1 | GCA900445575_00608 | CDS | open | 490166-493582 | _na 1138_aa | TonB-dependent receptor plug domain protein | |
| 490 | UFTB01000001.1 | GCA900445575_00609 | CDS | open | 493595-495535 | _na 646_aa | susD | SusD family protein |
| 491 | UFTB01000001.1 | GCA900445575_00610 | CDS | open | 495566-496969 | _na 467_aa | DUF4959 domain-containing protein | |
| 492 | UFTB01000001.1 | GCA900445575_00611 | CDS | open | 496986-498479 | _na 497_aa | Fibronectin type III domain protein | |
| 493 | UFTB01000001.1 | GCA900445575_00612 | CDS | open | 498810-500390 | _na 526_aa | Sulfatase | |
| 494 | UFTB01000001.1 | GCA900445575_00613 | CDS | open | 500418-502232 | _na 604_aa | susD | SusD family protein |
| 495 | UFTB01000001.1 | GCA900445575_00614 | CDS | open | 502246-505509 | _na 1087_aa | TonB-dependent receptor | |
| 496 | UFTB01000001.1 | GCA900445575_00615 | CDS | open | 505909-507837 | _na 642_aa | Alpha%2Calpha-trehalase | |
| 497 | UFTB01000001.1 | GCA900445575_00616 | CDS | open | 507856-511017 | _na 1053_aa | beta-galactosidase | |
| 498 | UFTB01000001.1 | GCA900445575_00617 | CDS | open | 511038-511640 | _na 200_aa | lysO | Lysine exporter LysO family protein |
| 499 | UFTB01000001.1 | GCA900445575_00618 | CDS | open | 511637-511915 | _na 92_aa | DUF340 domain-containing protein | |
| 500 | UFTB01000001.1 | GCA900445575_00619 | CDS | open | 512020-513531 | _na 503_aa | susD | SusD family protein |

