BAKTAGenome Explorer: Phocaeicola massiliensis (GCA_902364735.1)
Select a Genome:
|
BAKTA Annotations for GCA_902364735.1
|
Search & Sort all 6746 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CABJEV010000002.1 | GCA902364735_00494 | gene | open | 260741-262330 | atpA | ||
| 1002 | CABJEV010000002.1 | GCA902364735_00495 | gene | open | 262349-262903 | |||
| 1003 | CABJEV010000002.1 | GCA902364735_00496 | gene | open | 262910-263410 | atpF | ||
| 1004 | CABJEV010000002.1 | GCA902364735_00497 | gene | open | 263426-263677 | atpE | ||
| 1005 | CABJEV010000002.1 | GCA902364735_00498 | gene | open | 263705-264793 | atpB | ||
| 1006 | CABJEV010000002.1 | GCA902364735_00499 | gene | open | 264786-265211 | |||
| 1007 | CABJEV010000002.1 | GCA902364735_00500 | gene | open | 265231-265479 | |||
| 1008 | CABJEV010000002.1 | GCA902364735_00501 | gene | open | 265486-267021 | atpD | ||
| 1009 | CABJEV010000002.1 | GCA902364735_00502 | gene | open | 267320-268870 | |||
| 1010 | CABJEV010000002.1 | GCA902364735_00503 | gene | open | 269065-270192 | |||
| 1011 | CABJEV010000002.1 | GCA902364735_00504 | gene | open | 270475-270912 | |||
| 1012 | CABJEV010000002.1 | GCA902364735_00505 | gene | open | 271112-272383 | |||
| 1013 | CABJEV010000002.1 | GCA902364735_00506 | gene | open | 272383-273060 | |||
| 1014 | CABJEV010000002.1 | GCA902364735_00507 | gene | open | 273247-273978 | |||
| 1015 | CABJEV010000002.1 | GCA902364735_00508 | gene | open | 274190-274792 | yihA | ||
| 1016 | CABJEV010000002.1 | GCA902364735_00509 | gene | open | 274773-276302 | |||
| 1017 | CABJEV010000002.1 | GCA902364735_00510 | gene | open | 276321-276938 | recR | ||
| 1018 | CABJEV010000002.1 | GCA902364735_00511 | gene | open | 276961-277425 | |||
| 1019 | CABJEV010000002.1 | GCA902364735_00512 | gene | open | 277425-277949 | |||
| 1020 | CABJEV010000002.1 | GCA902364735_00513 | gene | open | 277946-278536 | |||
| 1021 | CABJEV010000002.1 | GCA902364735_00336 | gene | open | 84894-84980 | |||
| 1022 | CABJEV010000002.1 | GCA902364735_00398 | gene | open | 150473-150543 | trnP | ||
| 1023 | CABJEV010000002.1 | GCA902364735_00406 | gene | open | 153795-153852 | |||
| 1024 | CABJEV010000002.1 | GCA902364735_00422 | gene | open | 170170-170244 | trnP | ||
| 1025 | CABJEV010000002.1 | GCA902364735_00514 | gene | open | 278780-278853 | trnD | ||
| 1026 | CABJEV010000002.1 | GCA902364735_00515 | gene | open | 278883-278956 | trnD | ||
| 1027 | CABJEV010000002.1 | GCA902364735_00336 | tRNA | open | 84894-84980 | tRNA-Xxx | ||
| 1028 | CABJEV010000002.1 | GCA902364735_00398 | tRNA | open | 150473-150543 | trnP | tRNA-Pro(tgg) | |
| 1029 | CABJEV010000002.1 | GCA902364735_00406 | tRNA | open | 153795-153852 | tRNA-Xxx | ||
| 1030 | CABJEV010000002.1 | GCA902364735_00422 | tRNA | open | 170170-170244 | trnP | tRNA-Pro(tgg) | |
| 1031 | CABJEV010000002.1 | GCA902364735_00514 | tRNA | open | 278780-278853 | trnD | tRNA-Asp(gtc) | |
| 1032 | CABJEV010000002.1 | GCA902364735_00515 | tRNA | open | 278883-278956 | trnD | tRNA-Asp(gtc) | |
| 1033 | CABJEV010000003.1 | repeat_region | open | 51649-53083 | CRISPR array with 19 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTTCAAATTAGTATCTTTGAACCATTGAAAACAAC and spacer length 29 | |||
| 1034 | CABJEV010000003.1 | GCA902364735_00516 | CDS | open | 613-2169 | _na 518_aa | Carboxypeptidase-like regulatory domain-containing protein | |
| 1035 | CABJEV010000003.1 | GCA902364735_00517 | CDS | open | 2175-3029 | _na 284_aa | fecR | FecR protein domain-containing protein |
| 1036 | CABJEV010000003.1 | GCA902364735_00518 | CDS | open | 3026-3571 | _na 181_aa | RNA polymerase sigma-70 factor | |
| 1037 | CABJEV010000003.1 | GCA902364735_00519 | CDS | open | 3593-4858 | _na 421_aa | Carboxypeptidase-like regulatory domain-containing protein | |
| 1038 | CABJEV010000003.1 | GCA902364735_00520 | CDS | open | 5173-6120 | _na 315_aa | Band 7 domain-containing protein | |
| 1039 | CABJEV010000003.1 | GCA902364735_00521 | CDS | open | 6357-8357 | _na 666_aa | AAA family ATPase | |
| 1040 | CABJEV010000003.1 | GCA902364735_00522 | CDS | open | 8364-8975 | _na 203_aa | L-threonylcarbamoyladenylate synthase | |
| 1041 | CABJEV010000003.1 | GCA902364735_00523 | CDS | open | 9026-9859 | _na 277_aa | Small-conductance mechanosensitive channel | |
| 1042 | CABJEV010000003.1 | GCA902364735_00524 | CDS | open | 10027-11262 | _na 411_aa | Flavodoxin-like domain-containing protein | |
| 1043 | CABJEV010000003.1 | GCA902364735_00525 | CDS | open | 11231-12157 | _na 308_aa | TIGR01212 family radical SAM protein | |
| 1044 | CABJEV010000003.1 | GCA902364735_00526 | CDS | open | 12245-14446 | _na 733_aa | X-Pro dipeptidyl-peptidase (S15 family) | |
| 1045 | CABJEV010000003.1 | GCA902364735_00527 | CDS | open | 14495-15349 | _na 284_aa | lipA | lipoyl synthase |
| 1046 | CABJEV010000003.1 | GCA902364735_00528 | CDS | open | 15406-16398 | _na 330_aa | Transmembrane protein | |
| 1047 | CABJEV010000003.1 | GCA902364735_00529 | CDS | open | 16408-19008 | _na 866_aa | F5/8 type C domain-containing protein | |
| 1048 | CABJEV010000003.1 | GCA902364735_00530 | CDS | open | 19508-19678 | _na 56_aa | hypothetical protein | |
| 1049 | CABJEV010000003.1 | GCA902364735_00531 | CDS | open | 19964-20287 | _na 107_aa | hypothetical protein | |
| 1050 | CABJEV010000003.1 | GCA902364735_00532 | CDS | open | 20413-21495 | _na 360_aa | Lipoprotein | |
| 1051 | CABJEV010000003.1 | GCA902364735_00533 | CDS | open | 21509-23272 | _na 587_aa | YD repeat (Two copies) | |
| 1052 | CABJEV010000003.1 | GCA902364735_00534 | CDS | open | 23443-23859 | _na 138_aa | Fibrobacter succinogenes major paralogous domain-containing protein | |
| 1053 | CABJEV010000003.1 | GCA902364735_00535 | CDS | open | 25252-25878 | _na 208_aa | pepE | Peptidase S51 |
| 1054 | CABJEV010000003.1 | GCA902364735_00536 | CDS | open | 25875-25970 | _na 31_aa | hypothetical protein | |
| 1055 | CABJEV010000003.1 | GCA902364735_00537 | CDS | open | 26172-26927 | _na 251_aa | hypothetical protein | |
| 1056 | CABJEV010000003.1 | GCA902364735_00538 | CDS | open | 26960-27910 | _na 316_aa | Relaxase/mobilization nuclease domain protein | |
| 1057 | CABJEV010000003.1 | GCA902364735_00539 | CDS | open | 27907-28320 | _na 137_aa | mobC | Plasmid mobilization relaxosome protein MobC |
| 1058 | CABJEV010000003.1 | GCA902364735_00540 | CDS | open | 28505-28987 | _na 160_aa | DUF3408 domain-containing protein | |
| 1059 | CABJEV010000003.1 | GCA902364735_00541 | CDS | open | 29001-29351 | _na 116_aa | DUF4372 domain-containing protein | |
| 1060 | CABJEV010000003.1 | GCA902364735_00542 | CDS | open | 29385-29696 | _na 103_aa | Helix-turn-helix domain-containing protein | |
| 1061 | CABJEV010000003.1 | GCA902364735_00543 | CDS | open | 29779-30087 | _na 102_aa | DNA-binding protein | |
| 1062 | CABJEV010000003.1 | GCA902364735_00544 | CDS | open | 30320-30682 | _na 120_aa | Excisionase family DNA binding domain-containing protein | |
| 1063 | CABJEV010000003.1 | GCA902364735_00545 | CDS | open | 30679-31890 | _na 403_aa | site-specific integrase | |
| 1064 | CABJEV010000003.1 | GCA902364735_00546 | CDS | open | 31955-33187 | _na 410_aa | xerD | Tyr recombinase domain-containing protein |
| 1065 | CABJEV010000003.1 | GCA902364735_00547 | CDS | open | 33515-35161 | _na 548_aa | vapE | VapE domain-containing protein |
| 1066 | CABJEV010000003.1 | GCA902364735_00548 | CDS | open | 36062-36808 | _na 248_aa | restriction endonuclease | |
| 1067 | CABJEV010000003.1 | GCA902364735_00549 | CDS | open | 36866-38827 | _na 653_aa | hypothetical protein | |
| 1068 | CABJEV010000003.1 | GCA902364735_00550 | CDS | open | 39170-39400 | _na 76_aa | hypothetical protein | |
| 1069 | CABJEV010000003.1 | GCA902364735_00551 | CDS | open | 39418-39651 | _na 77_aa | hypothetical protein | |
| 1070 | CABJEV010000003.1 | GCA902364735_00552 | CDS | open | 39663-40574 | _na 303_aa | yafY | YafY family protein |
| 1071 | CABJEV010000003.1 | GCA902364735_00553 | CDS | open | 40923-42191 | _na 422_aa | Thioredoxin domain-containing protein | |
| 1072 | CABJEV010000003.1 | GCA902364735_00554 | CDS | open | 42232-42456 | _na 74_aa | hypothetical protein | |
| 1073 | CABJEV010000003.1 | GCA902364735_00555 | CDS | open | 42507-44459 | _na 650_aa | beta-N-acetylhexosaminidase | |
| 1074 | CABJEV010000003.1 | GCA902364735_00556 | CDS | open | 44552-45256 | _na 234_aa | Ribosomal RNA small subunit methyltransferase I | |
| 1075 | CABJEV010000003.1 | GCA902364735_00557 | CDS | open | 45270-46274 | _na 334_aa | gldB | Gliding motility-associated lipoprotein GldB |
| 1076 | CABJEV010000003.1 | GCA902364735_00558 | CDS | open | 46281-47138 | _na 285_aa | fabI | Enoyl-[acyl-carrier-protein] reductase [NADH] |
| 1077 | CABJEV010000003.1 | GCA902364735_00559 | CDS | open | 47373-48608 | _na 411_aa | Sodium ion-translocating decarboxylase%2C beta subunit | |
| 1078 | CABJEV010000003.1 | GCA902364735_00560 | CDS | open | 48608-50470 | _na 620_aa | Biotin/lipoyl-containing protein | |
| 1079 | CABJEV010000003.1 | GCA902364735_00561 | CDS | open | 50498-50749 | _na 83_aa | Sodium pump decarboxylase%2C gamma subunit | |
| 1080 | CABJEV010000003.1 | GCA902364735_00562 | CDS | open | 50789-51019 | _na 76_aa | hypothetical protein | |
| 1081 | CABJEV010000003.1 | GCA902364735_00563 | CDS | open | 51003-51578 | _na 191_aa | Nitroreductase domain-containing protein | |
| 1082 | CABJEV010000003.1 | GCA902364735_00564 | CDS | open | 53183-53515 | _na 110_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1083 | CABJEV010000003.1 | GCA902364735_00565 | CDS | open | 53515-54447 | _na 310_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 1084 | CABJEV010000003.1 | GCA902364735_00566 | CDS | open | 54474-55472 | _na 332_aa | Bro-N domain-containing protein | |
| 1085 | CABJEV010000003.1 | GCA902364735_00567 | CDS | open | 55487-60001 | _na 1504_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 1086 | CABJEV010000003.1 | GCA902364735_00568 | CDS | open | 60202-60852 | _na 216_aa | Phosphoglycolate phosphatase%2C bacterial | |
| 1087 | CABJEV010000003.1 | GCA902364735_00569 | CDS | open | 61237-61626 | _na 129_aa | Small-conductance mechanosensitive channel | |
| 1088 | CABJEV010000003.1 | GCA902364735_00570 | CDS | open | 61692-62132 | _na 146_aa | doxX | DoxX family protein |
| 1089 | CABJEV010000003.1 | GCA902364735_00571 | CDS | open | 62136-63134 | _na 332_aa | DUF4435 domain-containing protein | |
| 1090 | CABJEV010000003.1 | GCA902364735_00572 | CDS | open | 63156-63977 | _na 273_aa | AAA+ ATPase domain-containing protein | |
| 1091 | CABJEV010000003.1 | GCA902364735_00573 | CDS | open | 64062-64994 | _na 310_aa | eamA | EamA domain-containing protein |
| 1092 | CABJEV010000003.1 | GCA902364735_00574 | CDS | open | 65027-65884 | _na 285_aa | SDR family oxidoreductase | |
| 1093 | CABJEV010000003.1 | GCA902364735_00575 | CDS | open | 65915-67141 | _na 408_aa | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein | |
| 1094 | CABJEV010000003.1 | GCA902364735_00576 | CDS | open | 67170-67934 | _na 254_aa | 3-oxo-5-alpha-steroid 4-dehydrogenase 1 | |
| 1095 | CABJEV010000003.1 | GCA902364735_00577 | CDS | open | 68146-69489 | _na 447_aa | gltA | Citrate synthase |
| 1096 | CABJEV010000003.1 | GCA902364735_00578 | CDS | open | 69502-70647 | _na 381_aa | icd | NADP-dependent isocitrate dehydrogenase |
| 1097 | CABJEV010000003.1 | GCA902364735_00579 | CDS | open | 70651-72894 | _na 747_aa | aconitate hydratase | |
| 1098 | CABJEV010000003.1 | GCA902364735_00580 | CDS | open | 73066-74961 | _na 631_aa | AAA domain-containing protein | |
| 1099 | CABJEV010000003.1 | GCA902364735_00581 | CDS | open | 75457-75621 | _na 54_aa | hypothetical protein | |
| 1100 | CABJEV010000003.1 | GCA902364735_00582 | CDS | open | 75686-78589 | _na 967_aa | beta-galactosidase | |
| 1101 | CABJEV010000003.1 | GCA902364735_00583 | CDS | open | 78969-81932 | _na 987_aa | beta-galactosidase | |
| 1102 | CABJEV010000003.1 | GCA902364735_00584 | CDS | open | 82097-84766 | _na 889_aa | Beta-galactosidase | |
| 1103 | CABJEV010000003.1 | GCA902364735_00585 | CDS | open | 84938-85318 | _na 126_aa | hypothetical protein | |
| 1104 | CABJEV010000003.1 | GCA902364735_00586 | CDS | open | 85299-85670 | _na 123_aa | Fluoroacetyl-CoA-specific thioesterase-like domain-containing protein | |
| 1105 | CABJEV010000003.1 | GCA902364735_00587 | CDS | open | 85793-87883 | _na 696_aa | Helicase | |
| 1106 | CABJEV010000003.1 | GCA902364735_00588 | CDS | open | 88039-88479 | _na 146_aa | DUF6078 domain-containing protein | |
| 1107 | CABJEV010000003.1 | GCA902364735_00589 | CDS | open | 88853-89887 | _na 344_aa | HTH lacI-type domain-containing protein | |
| 1108 | CABJEV010000003.1 | GCA902364735_00590 | CDS | open | 90032-90964 | _na 310_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 1109 | CABJEV010000003.1 | GCA902364735_00591 | CDS | open | 91040-92662 | _na 540_aa | CARDB domain-containing protein | |
| 1110 | CABJEV010000003.1 | GCA902364735_00592 | CDS | open | 92883-94196 | _na 437_aa | hypothetical protein | |
| 1111 | CABJEV010000003.1 | GCA902364735_00593 | CDS | open | 94208-95755 | _na 515_aa | WG repeat-containing protein | |
| 1112 | CABJEV010000003.1 | GCA902364735_00594 | CDS | open | 95764-97353 | _na 529_aa | FHA domain-containing protein | |
| 1113 | CABJEV010000003.1 | GCA902364735_00595 | CDS | open | 97377-97967 | _na 196_aa | FHA domain-containing protein | |
| 1114 | CABJEV010000003.1 | GCA902364735_00596 | CDS | open | 97985-99373 | _na 462_aa | PPM-type phosphatase domain-containing protein | |
| 1115 | CABJEV010000003.1 | GCA902364735_00597 | CDS | open | 99370-100341 | _na 323_aa | Protein kinase domain-containing protein | |
| 1116 | CABJEV010000003.1 | GCA902364735_00598 | CDS | open | 100338-102041 | _na 567_aa | Protein kinase domain-containing protein | |
| 1117 | CABJEV010000003.1 | GCA902364735_00599 | CDS | open | 102080-102781 | _na 233_aa | FHA domain-containing protein | |
| 1118 | CABJEV010000003.1 | GCA902364735_00600 | CDS | open | 102974-103336 | _na 120_aa | DUF1232 domain-containing protein | |
| 1119 | CABJEV010000003.1 | GCA902364735_00601 | CDS | open | 103453-104949 | _na 498_aa | histidine kinase | |
| 1120 | CABJEV010000003.1 | GCA902364735_00602 | CDS | open | 104955-106148 | _na 397_aa | mscS | Mechanosensitive ion channel MscS domain-containing protein |
| 1121 | CABJEV010000003.1 | GCA902364735_00603 | CDS | open | 106235-109351 | _na 1038_aa | Multidrug efflux RND transporter permease subunit | |
| 1122 | CABJEV010000003.1 | GCA902364735_00604 | CDS | open | 109355-110491 | _na 378_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 1123 | CABJEV010000003.1 | GCA902364735_00605 | CDS | open | 110537-111928 | _na 463_aa | nodT | NodT family efflux transporter%2C outer membrane factor (OMF) lipoprotein |
| 1124 | CABJEV010000003.1 | GCA902364735_00606 | CDS | open | 112025-112567 | _na 180_aa | DUF4251 domain-containing protein | |
| 1125 | CABJEV010000003.1 | GCA902364735_00607 | CDS | open | 112757-113167 | _na 136_aa | DUF4891 domain-containing protein | |
| 1126 | CABJEV010000003.1 | GCA902364735_00608 | CDS | open | 113297-114190 | _na 297_aa | Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein | |
| 1127 | CABJEV010000003.1 | GCA902364735_00609 | CDS | open | 114196-115215 | _na 339_aa | fixB | Caffeyl-CoA reductase-Etf complex subunit CarE |
| 1128 | CABJEV010000003.1 | GCA902364735_00610 | CDS | open | 115251-115631 | _na 126_aa | Four helix bundle protein | |
| 1129 | CABJEV010000003.1 | GCA902364735_00611 | CDS | open | 115674-117380 | _na 568_aa | Acyl-CoA dehydrogenase | |
| 1130 | CABJEV010000003.1 | GCA902364735_00612 | CDS | open | 117563-118171 | _na 202_aa | Histidine decarboxylase | |
| 1131 | CABJEV010000003.1 | GCA902364735_00613 | CDS | open | 118296-118706 | _na 136_aa | paaD | Phenylacetic acid degradation protein PaaD |
| 1132 | CABJEV010000003.1 | GCA902364735_00614 | CDS | open | 118708-119796 | _na 362_aa | Smr domain-containing protein | |
| 1133 | CABJEV010000003.1 | GCA902364735_00615 | CDS | open | 119970-120557 | _na 195_aa | D-ribose pyranase | |
| 1134 | CABJEV010000003.1 | GCA902364735_00616 | CDS | open | 120562-123108 | _na 848_aa | Glycosyl-hydrolase family 116 catalytic region domain-containing protein | |
| 1135 | CABJEV010000003.1 | GCA902364735_00617 | CDS | open | 123487-124755 | _na 422_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 1136 | CABJEV010000003.1 | GCA902364735_00618 | CDS | open | 125132-127108 | _na 658_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 1137 | CABJEV010000003.1 | GCA902364735_00619 | CDS | open | 127187-128503 | _na 438_aa | restriction endonuclease subunit S | |
| 1138 | CABJEV010000003.1 | GCA902364735_00620 | CDS | open | 128525-129622 | _na 365_aa | DUF1016 domain-containing protein | |
| 1139 | CABJEV010000003.1 | GCA902364735_00621 | CDS | open | 129690-133715 | _na 1341_aa | type I site-specific deoxyribonuclease | |
| 1140 | CABJEV010000003.1 | GCA902364735_00622 | CDS | open | 133743-134774 | _na 343_aa | WYL domain-containing protein | |
| 1141 | CABJEV010000003.1 | GCA902364735_00623 | CDS | open | 135021-137027 | _na 668_aa | urocanate hydratase | |
| 1142 | CABJEV010000003.1 | GCA902364735_00624 | CDS | open | 137039-137941 | _na 300_aa | ftcD | glutamate formimidoyltransferase |
| 1143 | CABJEV010000003.1 | GCA902364735_00625 | CDS | open | 137958-139202 | _na 414_aa | hutI | imidazolonepropionase |
| 1144 | CABJEV010000003.1 | GCA902364735_00626 | CDS | open | 139233-139856 | _na 207_aa | Cyclodeaminase/cyclohydrolase domain-containing protein | |
| 1145 | CABJEV010000003.1 | GCA902364735_00627 | CDS | open | 139868-141364 | _na 498_aa | hutH | histidine ammonia-lyase |
| 1146 | CABJEV010000003.1 | GCA902364735_00628 | CDS | open | 141406-141906 | _na 166_aa | Nudix hydrolase domain-containing protein | |
| 1147 | CABJEV010000003.1 | GCA902364735_00629 | CDS | open | 142756-145818 | _na 1020_aa | SusC/RagA family TonB-linked outer membrane protein | |
| 1148 | CABJEV010000003.1 | GCA902364735_00630 | CDS | open | 145834-147585 | _na 583_aa | RagB/SusD family nutrient uptake outer membrane protein | |
| 1149 | CABJEV010000003.1 | GCA902364735_00631 | CDS | open | 147916-149334 | _na 472_aa | Glycosyl hydrolase family 109 protein 1 | |
| 1150 | CABJEV010000003.1 | GCA902364735_00632 | CDS | open | 149590-150138 | _na 182_aa | Carbonate dehydratase | |
| 1151 | CABJEV010000003.1 | GCA902364735_00633 | CDS | open | 150212-150475 | _na 87_aa | hypothetical protein | |
| 1152 | CABJEV010000003.1 | GCA902364735_00634 | CDS | open | 150532-151440 | _na 302_aa | WYL domain-containing protein | |
| 1153 | CABJEV010000003.1 | GCA902364735_00635 | CDS | open | 151450-152037 | _na 195_aa | Cyclic nucleotide-binding domain-containing protein | |
| 1154 | CABJEV010000003.1 | GCA902364735_00636 | CDS | open | 152074-153426 | _na 450_aa | mepA | Multidrug export protein MepA |
| 1155 | CABJEV010000003.1 | GCA902364735_00638 | CDS | open | 154021-154434 | _na 137_aa | Transmembrane protein | |
| 1156 | CABJEV010000003.1 | GCA902364735_00639 | CDS | open | 154544-156181 | _na 545_aa | groL | chaperonin GroEL |
| 1157 | CABJEV010000003.1 | GCA902364735_00640 | CDS | open | 156222-156494 | _na 90_aa | groES | Co-chaperonin GroES |
| 1158 | CABJEV010000003.1 | GCA902364735_00641 | CDS | open | 156752-158230 | _na 492_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 1159 | CABJEV010000003.1 | GCA902364735_00642 | CDS | open | 158214-159275 | _na 353_aa | hydE | [FeFe] hydrogenase H-cluster radical SAM maturase HydE |
| 1160 | CABJEV010000003.1 | GCA902364735_00643 | CDS | open | 159292-160710 | _na 472_aa | hydG | [FeFe] hydrogenase H-cluster radical SAM maturase HydG |
| 1161 | CABJEV010000003.1 | GCA902364735_00644 | CDS | open | 160726-161910 | _na 394_aa | hydF | [FeFe] hydrogenase H-cluster maturation GTPase HydF |
| 1162 | CABJEV010000003.1 | GCA902364735_00645 | CDS | open | 161933-164476 | _na 847_aa | Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein | |
| 1163 | CABJEV010000003.1 | GCA902364735_00646 | CDS | open | 164544-165908 | _na 454_aa | hisS | histidine--tRNA ligase |
| 1164 | CABJEV010000003.1 | GCA902364735_00647 | CDS | open | 166325-167005 | _na 226_aa | Neutral zinc metallopeptidase | |
| 1165 | CABJEV010000003.1 | GCA902364735_00648 | CDS | open | 167222-168121 | _na 299_aa | HTH araC/xylS-type domain-containing protein | |
| 1166 | CABJEV010000003.1 | GCA902364735_00649 | CDS | open | 168235-172890 | _na 1551_aa | asmA | AsmA domain-containing protein |
| 1167 | CABJEV010000003.1 | GCA902364735_00650 | CDS | open | 172896-175238 | _na 780_aa | Bacterial surface antigen (D15) domain-containing protein | |
| 1168 | CABJEV010000003.1 | GCA902364735_00651 | CDS | open | 175499-176410 | _na 303_aa | Glutamate synthase [NADPH] large chain | |
| 1169 | CABJEV010000003.1 | GCA902364735_00652 | CDS | open | 176814-177038 | _na 74_aa | hypothetical protein | |
| 1170 | CABJEV010000003.1 | GCA902364735_00653 | CDS | open | 177171-177995 | _na 274_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1171 | CABJEV010000003.1 | GCA902364735_00654 | CDS | open | 178015-179274 | _na 419_aa | Peptidase M16 C-terminal domain-containing protein | |
| 1172 | CABJEV010000003.1 | GCA902364735_00655 | CDS | open | 179302-180636 | _na 444_aa | Multidrug-efflux transporter | |
| 1173 | CABJEV010000003.1 | GCA902364735_00656 | CDS | open | 180660-183140 | _na 826_aa | histidine kinase | |
| 1174 | CABJEV010000003.1 | GCA902364735_00657 | CDS | open | 183232-184578 | _na 448_aa | Sigma-54 factor interaction domain-containing protein | |
| 1175 | CABJEV010000003.1 | GCA902364735_00658 | CDS | open | 184778-185083 | _na 101_aa | Beta-lactamase-inhibitor-like PepSY-like domain-containing protein | |
| 1176 | CABJEV010000003.1 | GCA902364735_00659 | CDS | open | 185143-185814 | _na 223_aa | rluA | RluA family pseudouridine synthase |
| 1177 | CABJEV010000003.1 | GCA902364735_00660 | CDS | open | 185822-186568 | _na 248_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 1178 | CABJEV010000003.1 | GCA902364735_00661 | CDS | open | 186599-187198 | _na 199_aa | HTH tetR-type domain-containing protein | |
| 1179 | CABJEV010000003.1 | GCA902364735_00663 | CDS | open | 188481-190283 | _na 600_aa | RagB/SusD family nutrient uptake outer membrane protein | |
| 1180 | CABJEV010000003.1 | GCA902364735_00664 | CDS | open | 190297-193515 | _na 1072_aa | SusC/RagA family TonB-linked outer membrane protein | |
| 1181 | CABJEV010000003.1 | GCA902364735_00665 | CDS | open | 194415-197096 | _na 893_aa | Beta-galactosidase | |
| 1182 | CABJEV010000003.1 | GCA902364735_00666 | CDS | open | 197102-199009 | _na 635_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 1183 | CABJEV010000003.1 | GCA902364735_00667 | CDS | open | 199071-200837 | _na 588_aa | nar1 | NADH-dependent [FeFe] hydrogenase%2C group A6 |
| 1184 | CABJEV010000003.1 | GCA902364735_00668 | CDS | open | 200858-201334 | _na 158_aa | nuoE | NADH-quinone oxidoreductase subunit NuoE |
| 1185 | CABJEV010000003.1 | GCA902364735_00669 | CDS | open | 201493-203046 | _na 517_aa | DUF1566 domain-containing protein | |
| 1186 | CABJEV010000003.1 | GCA902364735_00670 | CDS | open | 203247-204524 | _na 425_aa | DEAD/DEAH box helicase | |
| 1187 | CABJEV010000003.1 | GCA902364735_00671 | CDS | open | 204763-207222 | _na 819_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 1188 | CABJEV010000003.1 | GCA902364735_00672 | CDS | open | 207254-208165 | _na 303_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 1189 | CABJEV010000003.1 | GCA902364735_00673 | CDS | open | 208342-209301 | _na 319_aa | cysK | cysteine synthase A |
| 1190 | CABJEV010000003.1 | GCA902364735_00674 | CDS | open | 209317-210402 | _na 361_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 1191 | CABJEV010000003.1 | GCA902364735_00678 | CDS | open | 211366-212460 | _na 364_aa | trpS | tryptophan--tRNA ligase |
| 1192 | CABJEV010000003.1 | GCA902364735_00679 | CDS | open | 212561-213340 | _na 259_aa | DUF4595 domain-containing protein | |
| 1193 | CABJEV010000003.1 | GCA902364735_00680 | CDS | open | 213411-213551 | _na 46_aa | hypothetical protein | |
| 1194 | CABJEV010000003.1 | GCA902364735_00681 | CDS | open | 213582-216803 | _na 1073_aa | carB | carbamoyl-phosphate synthase large subunit |
| 1195 | CABJEV010000003.1 | GCA902364735_00682 | CDS | open | 216873-217190 | _na 105_aa | Lipoprotein | |
| 1196 | CABJEV010000003.1 | GCA902364735_00683 | CDS | open | 217289-217534 | _na 81_aa | NVEALA protein | |
| 1197 | CABJEV010000003.1 | GCA902364735_00684 | CDS | open | 218066-218986 | _na 306_aa | ABC transporter domain-containing protein | |
| 1198 | CABJEV010000003.1 | GCA902364735_00685 | CDS | open | 218999-220252 | _na 417_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 1199 | CABJEV010000003.1 | GCA902364735_00686 | CDS | open | 220480-222081 | _na 533_aa | beta-N-acetylhexosaminidase | |
| 1200 | CABJEV010000003.1 | GCA902364735_00687 | CDS | open | 222122-222622 | _na 166_aa | Thioredoxin domain-containing protein | |
| 1201 | CABJEV010000003.1 | GCA902364735_00688 | CDS | open | 222710-223477 | _na 255_aa | yaaA | peroxide stress protein YaaA |
| 1202 | CABJEV010000003.1 | GCA902364735_00689 | CDS | open | 223585-224784 | _na 399_aa | OmpA-like domain-containing protein | |
| 1203 | CABJEV010000003.1 | GCA902364735_00690 | CDS | open | 225005-226885 | _na 626_aa | mutL | DNA mismatch repair endonuclease MutL |
| 1204 | CABJEV010000003.1 | GCA902364735_00691 | CDS | open | 226907-227203 | _na 98_aa | Riboflavin synthase subunit beta | |
| 1205 | CABJEV010000003.1 | GCA902364735_00692 | CDS | open | 227206-228876 | _na 556_aa | Organic solvent tolerance-like N-terminal domain-containing protein | |
| 1206 | CABJEV010000003.1 | GCA902364735_00693 | CDS | open | 228896-230257 | _na 453_aa | ppiC | PpiC domain-containing protein |
| 1207 | CABJEV010000003.1 | GCA902364735_00694 | CDS | open | 230262-231134 | _na 290_aa | ppiC | PpiC domain-containing protein |
| 1208 | CABJEV010000003.1 | GCA902364735_00695 | CDS | open | 231171-232541 | _na 456_aa | ppiC | PpiC domain-containing protein |
| 1209 | CABJEV010000003.1 | GCA902364735_00696 | CDS | open | 232554-234029 | _na 491_aa | guaB | IMP dehydrogenase |
| 1210 | CABJEV010000003.1 | GCA902364735_00697 | CDS | open | 234144-236273 | _na 709_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 1211 | CABJEV010000003.1 | GCA902364735_00698 | CDS | open | 236767-238380 | _na 537_aa | Peptidase M56 domain-containing protein | |
| 1212 | CABJEV010000003.1 | GCA902364735_00699 | CDS | open | 238398-238754 | _na 118_aa | Transcriptional regulator | |
| 1213 | CABJEV010000003.1 | GCA902364735_00700 | CDS | open | 238923-241103 | _na 726_aa | recQ | DNA helicase RecQ |
| 1214 | CABJEV010000003.1 | GCA902364735_00701 | CDS | open | 241260-242507 | _na 415_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 1215 | CABJEV010000003.1 | GCA902364735_00702 | CDS | open | 242544-243215 | _na 223_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 1216 | CABJEV010000003.1 | GCA902364735_00703 | CDS | open | 243394-244749 | _na 451_aa | tig | trigger factor |
| 1217 | CABJEV010000003.1 | GCA902364735_00704 | CDS | open | 244995-245090 | _na 31_aa | hypothetical protein | |
| 1218 | CABJEV010000003.1 | GCA902364735_00705 | CDS | open | 245133-245381 | _na 82_aa | RRM domain-containing protein | |
| 1219 | CABJEV010000003.1 | GCA902364735_00706 | CDS | open | 245478-246302 | _na 274_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 1220 | CABJEV010000003.1 | GCA902364735_00707 | CDS | open | 246473-247174 | _na 233_aa | ABC transporter permease | |
| 1221 | CABJEV010000003.1 | GCA902364735_00708 | CDS | open | 247171-247947 | _na 258_aa | ABC transporter domain-containing protein | |
| 1222 | CABJEV010000003.1 | GCA902364735_00709 | CDS | open | 248165-249478 | _na 437_aa | der | ribosome biogenesis GTPase Der |
| 1223 | CABJEV010000003.1 | GCA902364735_00710 | CDS | open | 249512-250393 | _na 293_aa | era | GTPase Era |
| 1224 | CABJEV010000003.1 | GCA902364735_00711 | CDS | open | 250476-251480 | _na 334_aa | fabH | Beta-ketoacyl-[acyl-carrier-protein] synthase III |
| 1225 | CABJEV010000003.1 | GCA902364735_00712 | CDS | open | 251585-251770 | _na 61_aa | rpmF | 50S ribosomal protein L32 |
| 1226 | CABJEV010000003.1 | GCA902364735_00713 | CDS | open | 251782-252315 | _na 177_aa | DUF177 domain-containing protein | |
| 1227 | CABJEV010000003.1 | GCA902364735_00516 | gene | open | 613-2169 | |||
| 1228 | CABJEV010000003.1 | GCA902364735_00517 | gene | open | 2175-3029 | fecR | ||
| 1229 | CABJEV010000003.1 | GCA902364735_00518 | gene | open | 3026-3571 | |||
| 1230 | CABJEV010000003.1 | GCA902364735_00519 | gene | open | 3593-4858 | |||
| 1231 | CABJEV010000003.1 | GCA902364735_00520 | gene | open | 5173-6120 | |||
| 1232 | CABJEV010000003.1 | GCA902364735_00521 | gene | open | 6357-8357 | |||
| 1233 | CABJEV010000003.1 | GCA902364735_00522 | gene | open | 8364-8975 | |||
| 1234 | CABJEV010000003.1 | GCA902364735_00523 | gene | open | 9026-9859 | |||
| 1235 | CABJEV010000003.1 | GCA902364735_00524 | gene | open | 10027-11262 | |||
| 1236 | CABJEV010000003.1 | GCA902364735_00525 | gene | open | 11231-12157 | |||
| 1237 | CABJEV010000003.1 | GCA902364735_00526 | gene | open | 12245-14446 | |||
| 1238 | CABJEV010000003.1 | GCA902364735_00527 | gene | open | 14495-15349 | lipA | ||
| 1239 | CABJEV010000003.1 | GCA902364735_00528 | gene | open | 15406-16398 | |||
| 1240 | CABJEV010000003.1 | GCA902364735_00529 | gene | open | 16408-19008 | |||
| 1241 | CABJEV010000003.1 | GCA902364735_00530 | gene | open | 19508-19678 | |||
| 1242 | CABJEV010000003.1 | GCA902364735_00531 | gene | open | 19964-20287 | |||
| 1243 | CABJEV010000003.1 | GCA902364735_00532 | gene | open | 20413-21495 | |||
| 1244 | CABJEV010000003.1 | GCA902364735_00533 | gene | open | 21509-23272 | |||
| 1245 | CABJEV010000003.1 | GCA902364735_00534 | gene | open | 23443-23859 | |||
| 1246 | CABJEV010000003.1 | GCA902364735_00535 | gene | open | 25252-25878 | pepE | ||
| 1247 | CABJEV010000003.1 | GCA902364735_00536 | gene | open | 25875-25970 | |||
| 1248 | CABJEV010000003.1 | GCA902364735_00537 | gene | open | 26172-26927 | |||
| 1249 | CABJEV010000003.1 | GCA902364735_00538 | gene | open | 26960-27910 | |||
| 1250 | CABJEV010000003.1 | GCA902364735_00539 | gene | open | 27907-28320 | mobC | ||
| 1251 | CABJEV010000003.1 | GCA902364735_00540 | gene | open | 28505-28987 | |||
| 1252 | CABJEV010000003.1 | GCA902364735_00541 | gene | open | 29001-29351 | |||
| 1253 | CABJEV010000003.1 | GCA902364735_00542 | gene | open | 29385-29696 | |||
| 1254 | CABJEV010000003.1 | GCA902364735_00543 | gene | open | 29779-30087 | |||
| 1255 | CABJEV010000003.1 | GCA902364735_00544 | gene | open | 30320-30682 | |||
| 1256 | CABJEV010000003.1 | GCA902364735_00545 | gene | open | 30679-31890 | |||
| 1257 | CABJEV010000003.1 | GCA902364735_00546 | gene | open | 31955-33187 | xerD | ||
| 1258 | CABJEV010000003.1 | GCA902364735_00547 | gene | open | 33515-35161 | vapE | ||
| 1259 | CABJEV010000003.1 | GCA902364735_00548 | gene | open | 36062-36808 | |||
| 1260 | CABJEV010000003.1 | GCA902364735_00549 | gene | open | 36866-38827 | |||
| 1261 | CABJEV010000003.1 | GCA902364735_00550 | gene | open | 39170-39400 | |||
| 1262 | CABJEV010000003.1 | GCA902364735_00551 | gene | open | 39418-39651 | |||
| 1263 | CABJEV010000003.1 | GCA902364735_00552 | gene | open | 39663-40574 | yafY | ||
| 1264 | CABJEV010000003.1 | GCA902364735_00553 | gene | open | 40923-42191 | |||
| 1265 | CABJEV010000003.1 | GCA902364735_00554 | gene | open | 42232-42456 | |||
| 1266 | CABJEV010000003.1 | GCA902364735_00555 | gene | open | 42507-44459 | |||
| 1267 | CABJEV010000003.1 | GCA902364735_00556 | gene | open | 44552-45256 | |||
| 1268 | CABJEV010000003.1 | GCA902364735_00557 | gene | open | 45270-46274 | gldB | ||
| 1269 | CABJEV010000003.1 | GCA902364735_00558 | gene | open | 46281-47138 | fabI | ||
| 1270 | CABJEV010000003.1 | GCA902364735_00559 | gene | open | 47373-48608 | |||
| 1271 | CABJEV010000003.1 | GCA902364735_00560 | gene | open | 48608-50470 | |||
| 1272 | CABJEV010000003.1 | GCA902364735_00561 | gene | open | 50498-50749 | |||
| 1273 | CABJEV010000003.1 | GCA902364735_00562 | gene | open | 50789-51019 | |||
| 1274 | CABJEV010000003.1 | GCA902364735_00563 | gene | open | 51003-51578 | |||
| 1275 | CABJEV010000003.1 | GCA902364735_00564 | gene | open | 53183-53515 | cas2 | ||
| 1276 | CABJEV010000003.1 | GCA902364735_00565 | gene | open | 53515-54447 | cas1 | ||
| 1277 | CABJEV010000003.1 | GCA902364735_00566 | gene | open | 54474-55472 | |||
| 1278 | CABJEV010000003.1 | GCA902364735_00567 | gene | open | 55487-60001 | cas9 | ||
| 1279 | CABJEV010000003.1 | GCA902364735_00568 | gene | open | 60202-60852 | |||
| 1280 | CABJEV010000003.1 | GCA902364735_00569 | gene | open | 61237-61626 | |||
| 1281 | CABJEV010000003.1 | GCA902364735_00570 | gene | open | 61692-62132 | doxX | ||
| 1282 | CABJEV010000003.1 | GCA902364735_00571 | gene | open | 62136-63134 | |||
| 1283 | CABJEV010000003.1 | GCA902364735_00572 | gene | open | 63156-63977 | |||
| 1284 | CABJEV010000003.1 | GCA902364735_00573 | gene | open | 64062-64994 | eamA | ||
| 1285 | CABJEV010000003.1 | GCA902364735_00574 | gene | open | 65027-65884 | |||
| 1286 | CABJEV010000003.1 | GCA902364735_00575 | gene | open | 65915-67141 | |||
| 1287 | CABJEV010000003.1 | GCA902364735_00576 | gene | open | 67170-67934 | |||
| 1288 | CABJEV010000003.1 | GCA902364735_00577 | gene | open | 68146-69489 | gltA | ||
| 1289 | CABJEV010000003.1 | GCA902364735_00578 | gene | open | 69502-70647 | icd | ||
| 1290 | CABJEV010000003.1 | GCA902364735_00579 | gene | open | 70651-72894 | |||
| 1291 | CABJEV010000003.1 | GCA902364735_00580 | gene | open | 73066-74961 | |||
| 1292 | CABJEV010000003.1 | GCA902364735_00581 | gene | open | 75457-75621 | |||
| 1293 | CABJEV010000003.1 | GCA902364735_00582 | gene | open | 75686-78589 | |||
| 1294 | CABJEV010000003.1 | GCA902364735_00583 | gene | open | 78969-81932 | |||
| 1295 | CABJEV010000003.1 | GCA902364735_00584 | gene | open | 82097-84766 | |||
| 1296 | CABJEV010000003.1 | GCA902364735_00585 | gene | open | 84938-85318 | |||
| 1297 | CABJEV010000003.1 | GCA902364735_00586 | gene | open | 85299-85670 | |||
| 1298 | CABJEV010000003.1 | GCA902364735_00587 | gene | open | 85793-87883 | |||
| 1299 | CABJEV010000003.1 | GCA902364735_00588 | gene | open | 88039-88479 | |||
| 1300 | CABJEV010000003.1 | GCA902364735_00589 | gene | open | 88853-89887 | |||
| 1301 | CABJEV010000003.1 | GCA902364735_00590 | gene | open | 90032-90964 | |||
| 1302 | CABJEV010000003.1 | GCA902364735_00591 | gene | open | 91040-92662 | |||
| 1303 | CABJEV010000003.1 | GCA902364735_00592 | gene | open | 92883-94196 | |||
| 1304 | CABJEV010000003.1 | GCA902364735_00593 | gene | open | 94208-95755 | |||
| 1305 | CABJEV010000003.1 | GCA902364735_00594 | gene | open | 95764-97353 | |||
| 1306 | CABJEV010000003.1 | GCA902364735_00595 | gene | open | 97377-97967 | |||
| 1307 | CABJEV010000003.1 | GCA902364735_00596 | gene | open | 97985-99373 | |||
| 1308 | CABJEV010000003.1 | GCA902364735_00597 | gene | open | 99370-100341 | |||
| 1309 | CABJEV010000003.1 | GCA902364735_00598 | gene | open | 100338-102041 | |||
| 1310 | CABJEV010000003.1 | GCA902364735_00599 | gene | open | 102080-102781 | |||
| 1311 | CABJEV010000003.1 | GCA902364735_00600 | gene | open | 102974-103336 | |||
| 1312 | CABJEV010000003.1 | GCA902364735_00601 | gene | open | 103453-104949 | |||
| 1313 | CABJEV010000003.1 | GCA902364735_00602 | gene | open | 104955-106148 | mscS | ||
| 1314 | CABJEV010000003.1 | GCA902364735_00603 | gene | open | 106235-109351 | |||
| 1315 | CABJEV010000003.1 | GCA902364735_00604 | gene | open | 109355-110491 | |||
| 1316 | CABJEV010000003.1 | GCA902364735_00605 | gene | open | 110537-111928 | nodT | ||
| 1317 | CABJEV010000003.1 | GCA902364735_00606 | gene | open | 112025-112567 | |||
| 1318 | CABJEV010000003.1 | GCA902364735_00607 | gene | open | 112757-113167 | |||
| 1319 | CABJEV010000003.1 | GCA902364735_00608 | gene | open | 113297-114190 | |||
| 1320 | CABJEV010000003.1 | GCA902364735_00609 | gene | open | 114196-115215 | fixB | ||
| 1321 | CABJEV010000003.1 | GCA902364735_00610 | gene | open | 115251-115631 | |||
| 1322 | CABJEV010000003.1 | GCA902364735_00611 | gene | open | 115674-117380 | |||
| 1323 | CABJEV010000003.1 | GCA902364735_00612 | gene | open | 117563-118171 | |||
| 1324 | CABJEV010000003.1 | GCA902364735_00613 | gene | open | 118296-118706 | paaD | ||
| 1325 | CABJEV010000003.1 | GCA902364735_00614 | gene | open | 118708-119796 | |||
| 1326 | CABJEV010000003.1 | GCA902364735_00615 | gene | open | 119970-120557 | |||
| 1327 | CABJEV010000003.1 | GCA902364735_00616 | gene | open | 120562-123108 | |||
| 1328 | CABJEV010000003.1 | GCA902364735_00617 | gene | open | 123487-124755 | queA | ||
| 1329 | CABJEV010000003.1 | GCA902364735_00618 | gene | open | 125132-127108 | |||
| 1330 | CABJEV010000003.1 | GCA902364735_00619 | gene | open | 127187-128503 | |||
| 1331 | CABJEV010000003.1 | GCA902364735_00620 | gene | open | 128525-129622 | |||
| 1332 | CABJEV010000003.1 | GCA902364735_00621 | gene | open | 129690-133715 | |||
| 1333 | CABJEV010000003.1 | GCA902364735_00622 | gene | open | 133743-134774 | |||
| 1334 | CABJEV010000003.1 | GCA902364735_00623 | gene | open | 135021-137027 | |||
| 1335 | CABJEV010000003.1 | GCA902364735_00624 | gene | open | 137039-137941 | ftcD | ||
| 1336 | CABJEV010000003.1 | GCA902364735_00625 | gene | open | 137958-139202 | hutI | ||
| 1337 | CABJEV010000003.1 | GCA902364735_00626 | gene | open | 139233-139856 | |||
| 1338 | CABJEV010000003.1 | GCA902364735_00627 | gene | open | 139868-141364 | hutH | ||
| 1339 | CABJEV010000003.1 | GCA902364735_00628 | gene | open | 141406-141906 | |||
| 1340 | CABJEV010000003.1 | GCA902364735_00629 | gene | open | 142756-145818 | |||
| 1341 | CABJEV010000003.1 | GCA902364735_00630 | gene | open | 145834-147585 | |||
| 1342 | CABJEV010000003.1 | GCA902364735_00631 | gene | open | 147916-149334 | |||
| 1343 | CABJEV010000003.1 | GCA902364735_00632 | gene | open | 149590-150138 | |||
| 1344 | CABJEV010000003.1 | GCA902364735_00633 | gene | open | 150212-150475 | |||
| 1345 | CABJEV010000003.1 | GCA902364735_00634 | gene | open | 150532-151440 | |||
| 1346 | CABJEV010000003.1 | GCA902364735_00635 | gene | open | 151450-152037 | |||
| 1347 | CABJEV010000003.1 | GCA902364735_00636 | gene | open | 152074-153426 | mepA | ||
| 1348 | CABJEV010000003.1 | GCA902364735_00638 | gene | open | 154021-154434 | |||
| 1349 | CABJEV010000003.1 | GCA902364735_00639 | gene | open | 154544-156181 | groL | ||
| 1350 | CABJEV010000003.1 | GCA902364735_00640 | gene | open | 156222-156494 | groES | ||
| 1351 | CABJEV010000003.1 | GCA902364735_00641 | gene | open | 156752-158230 | |||
| 1352 | CABJEV010000003.1 | GCA902364735_00642 | gene | open | 158214-159275 | hydE | ||
| 1353 | CABJEV010000003.1 | GCA902364735_00643 | gene | open | 159292-160710 | hydG | ||
| 1354 | CABJEV010000003.1 | GCA902364735_00644 | gene | open | 160726-161910 | hydF | ||
| 1355 | CABJEV010000003.1 | GCA902364735_00645 | gene | open | 161933-164476 | |||
| 1356 | CABJEV010000003.1 | GCA902364735_00646 | gene | open | 164544-165908 | hisS | ||
| 1357 | CABJEV010000003.1 | GCA902364735_00647 | gene | open | 166325-167005 | |||
| 1358 | CABJEV010000003.1 | GCA902364735_00648 | gene | open | 167222-168121 | |||
| 1359 | CABJEV010000003.1 | GCA902364735_00649 | gene | open | 168235-172890 | asmA | ||
| 1360 | CABJEV010000003.1 | GCA902364735_00650 | gene | open | 172896-175238 | |||
| 1361 | CABJEV010000003.1 | GCA902364735_00651 | gene | open | 175499-176410 | |||
| 1362 | CABJEV010000003.1 | GCA902364735_00652 | gene | open | 176814-177038 | |||
| 1363 | CABJEV010000003.1 | GCA902364735_00653 | gene | open | 177171-177995 | |||
| 1364 | CABJEV010000003.1 | GCA902364735_00654 | gene | open | 178015-179274 | |||
| 1365 | CABJEV010000003.1 | GCA902364735_00655 | gene | open | 179302-180636 | |||
| 1366 | CABJEV010000003.1 | GCA902364735_00656 | gene | open | 180660-183140 | |||
| 1367 | CABJEV010000003.1 | GCA902364735_00657 | gene | open | 183232-184578 | |||
| 1368 | CABJEV010000003.1 | GCA902364735_00658 | gene | open | 184778-185083 | |||
| 1369 | CABJEV010000003.1 | GCA902364735_00659 | gene | open | 185143-185814 | rluA | ||
| 1370 | CABJEV010000003.1 | GCA902364735_00660 | gene | open | 185822-186568 | fabG | ||
| 1371 | CABJEV010000003.1 | GCA902364735_00661 | gene | open | 186599-187198 | |||
| 1372 | CABJEV010000003.1 | GCA902364735_00663 | gene | open | 188481-190283 | |||
| 1373 | CABJEV010000003.1 | GCA902364735_00664 | gene | open | 190297-193515 | |||
| 1374 | CABJEV010000003.1 | GCA902364735_00665 | gene | open | 194415-197096 | |||
| 1375 | CABJEV010000003.1 | GCA902364735_00666 | gene | open | 197102-199009 | |||
| 1376 | CABJEV010000003.1 | GCA902364735_00667 | gene | open | 199071-200837 | nar1 | ||
| 1377 | CABJEV010000003.1 | GCA902364735_00668 | gene | open | 200858-201334 | nuoE | ||
| 1378 | CABJEV010000003.1 | GCA902364735_00669 | gene | open | 201493-203046 | |||
| 1379 | CABJEV010000003.1 | GCA902364735_00670 | gene | open | 203247-204524 | |||
| 1380 | CABJEV010000003.1 | GCA902364735_00671 | gene | open | 204763-207222 | |||
| 1381 | CABJEV010000003.1 | GCA902364735_00672 | gene | open | 207254-208165 | |||
| 1382 | CABJEV010000003.1 | GCA902364735_00673 | gene | open | 208342-209301 | cysK | ||
| 1383 | CABJEV010000003.1 | GCA902364735_00674 | gene | open | 209317-210402 | mnmA | ||
| 1384 | CABJEV010000003.1 | GCA902364735_00678 | gene | open | 211366-212460 | trpS | ||
| 1385 | CABJEV010000003.1 | GCA902364735_00679 | gene | open | 212561-213340 | |||
| 1386 | CABJEV010000003.1 | GCA902364735_00680 | gene | open | 213411-213551 | |||
| 1387 | CABJEV010000003.1 | GCA902364735_00681 | gene | open | 213582-216803 | carB | ||
| 1388 | CABJEV010000003.1 | GCA902364735_00682 | gene | open | 216873-217190 | |||
| 1389 | CABJEV010000003.1 | GCA902364735_00683 | gene | open | 217289-217534 | |||
| 1390 | CABJEV010000003.1 | GCA902364735_00684 | gene | open | 218066-218986 | |||
| 1391 | CABJEV010000003.1 | GCA902364735_00685 | gene | open | 218999-220252 | |||
| 1392 | CABJEV010000003.1 | GCA902364735_00686 | gene | open | 220480-222081 | |||
| 1393 | CABJEV010000003.1 | GCA902364735_00687 | gene | open | 222122-222622 | |||
| 1394 | CABJEV010000003.1 | GCA902364735_00688 | gene | open | 222710-223477 | yaaA | ||
| 1395 | CABJEV010000003.1 | GCA902364735_00689 | gene | open | 223585-224784 | |||
| 1396 | CABJEV010000003.1 | GCA902364735_00690 | gene | open | 225005-226885 | mutL | ||
| 1397 | CABJEV010000003.1 | GCA902364735_00691 | gene | open | 226907-227203 | |||
| 1398 | CABJEV010000003.1 | GCA902364735_00692 | gene | open | 227206-228876 | |||
| 1399 | CABJEV010000003.1 | GCA902364735_00693 | gene | open | 228896-230257 | ppiC | ||
| 1400 | CABJEV010000003.1 | GCA902364735_00694 | gene | open | 230262-231134 | ppiC | ||
| 1401 | CABJEV010000003.1 | GCA902364735_00695 | gene | open | 231171-232541 | ppiC | ||
| 1402 | CABJEV010000003.1 | GCA902364735_00696 | gene | open | 232554-234029 | guaB | ||
| 1403 | CABJEV010000003.1 | GCA902364735_00697 | gene | open | 234144-236273 | |||
| 1404 | CABJEV010000003.1 | GCA902364735_00698 | gene | open | 236767-238380 | |||
| 1405 | CABJEV010000003.1 | GCA902364735_00699 | gene | open | 238398-238754 | |||
| 1406 | CABJEV010000003.1 | GCA902364735_00700 | gene | open | 238923-241103 | recQ | ||
| 1407 | CABJEV010000003.1 | GCA902364735_00701 | gene | open | 241260-242507 | clpX | ||
| 1408 | CABJEV010000003.1 | GCA902364735_00702 | gene | open | 242544-243215 | clpP | ||
| 1409 | CABJEV010000003.1 | GCA902364735_00703 | gene | open | 243394-244749 | tig | ||
| 1410 | CABJEV010000003.1 | GCA902364735_00704 | gene | open | 244995-245090 | |||
| 1411 | CABJEV010000003.1 | GCA902364735_00705 | gene | open | 245133-245381 | |||
| 1412 | CABJEV010000003.1 | GCA902364735_00706 | gene | open | 245478-246302 | lptB | ||
| 1413 | CABJEV010000003.1 | GCA902364735_00707 | gene | open | 246473-247174 | |||
| 1414 | CABJEV010000003.1 | GCA902364735_00708 | gene | open | 247171-247947 | |||
| 1415 | CABJEV010000003.1 | GCA902364735_00709 | gene | open | 248165-249478 | der | ||
| 1416 | CABJEV010000003.1 | GCA902364735_00710 | gene | open | 249512-250393 | era | ||
| 1417 | CABJEV010000003.1 | GCA902364735_00711 | gene | open | 250476-251480 | fabH | ||
| 1418 | CABJEV010000003.1 | GCA902364735_00712 | gene | open | 251585-251770 | rpmF | ||
| 1419 | CABJEV010000003.1 | GCA902364735_00713 | gene | open | 251782-252315 | |||
| 1420 | CABJEV010000003.1 | GCA902364735_00637 | gene | open | 153852-153925 | trnT | ||
| 1421 | CABJEV010000003.1 | GCA902364735_00662 | gene | open | 187430-187505 | trnfM | ||
| 1422 | CABJEV010000003.1 | GCA902364735_00675 | gene | open | 210864-210938 | trnV | ||
| 1423 | CABJEV010000003.1 | GCA902364735_00676 | gene | open | 210977-211051 | trnV | ||
| 1424 | CABJEV010000003.1 | GCA902364735_00677 | gene | open | 211092-211166 | trnV | ||
| 1425 | CABJEV010000003.1 | GCA902364735_00637 | tRNA | open | 153852-153925 | trnT | tRNA-Thr(tgt) | |
| 1426 | CABJEV010000003.1 | GCA902364735_00662 | tRNA | open | 187430-187505 | trnfM | tRNA-fMet(cat) | |
| 1427 | CABJEV010000003.1 | GCA902364735_00675 | tRNA | open | 210864-210938 | trnV | tRNA-Val(tac) | |
| 1428 | CABJEV010000003.1 | GCA902364735_00676 | tRNA | open | 210977-211051 | trnV | tRNA-Val(tac) | |
| 1429 | CABJEV010000003.1 | GCA902364735_00677 | tRNA | open | 211092-211166 | trnV | tRNA-Val(tac) | |
| 1430 | CABJEV010000004.1 | regulatory_region | open | 57269-57491 | Cobalamin riboswitch aptamer | |||
| 1431 | CABJEV010000004.1 | GCA902364735_00714 | CDS | open | 499-1995 | _na 498_aa | leuA | 2-isopropylmalate synthase |
| 1432 | CABJEV010000004.1 | GCA902364735_00715 | CDS | open | 2014-3396 | _na 460_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 1433 | CABJEV010000004.1 | GCA902364735_00716 | CDS | open | 3439-3612 | _na 57_aa | hypothetical protein | |
| 1434 | CABJEV010000004.1 | GCA902364735_00717 | CDS | open | 3615-4211 | _na 198_aa | 3-isopropylmalate dehydratase | |
| 1435 | CABJEV010000004.1 | GCA902364735_00718 | CDS | open | 4190-5734 | _na 514_aa | leuA | Pyruvate carboxyltransferase domain-containing protein |
| 1436 | CABJEV010000004.1 | GCA902364735_00719 | CDS | open | 5788-6849 | _na 353_aa | leuB | 3-isopropylmalate dehydrogenase |
| 1437 | CABJEV010000004.1 | GCA902364735_00720 | CDS | open | 6931-7062 | _na 43_aa | hypothetical protein | |
| 1438 | CABJEV010000004.1 | GCA902364735_00721 | CDS | open | 7063-7884 | _na 273_aa | Tetratricopeptide repeat protein | |
| 1439 | CABJEV010000004.1 | GCA902364735_00722 | CDS | open | 7903-9720 | _na 605_aa | recQ | DNA helicase RecQ |
| 1440 | CABJEV010000004.1 | GCA902364735_00723 | CDS | open | 10041-10505 | _na 154_aa | HTH araC/xylS-type domain-containing protein | |
| 1441 | CABJEV010000004.1 | GCA902364735_00724 | CDS | open | 10652-12640 | _na 662_aa | Dihydrofolate reductase | |
| 1442 | CABJEV010000004.1 | GCA902364735_00725 | CDS | open | 12653-13321 | _na 222_aa | DNA alkylation repair enzyme | |
| 1443 | CABJEV010000004.1 | GCA902364735_00726 | CDS | open | 13328-13843 | _na 171_aa | Fur family transcriptional regulator%2C ferric uptake regulator | |
| 1444 | CABJEV010000004.1 | GCA902364735_00727 | CDS | open | 13861-15132 | _na 423_aa | purA | adenylosuccinate synthase |
| 1445 | CABJEV010000004.1 | GCA902364735_00728 | CDS | open | 15754-17697 | _na 647_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1446 | CABJEV010000004.1 | GCA902364735_00729 | CDS | open | 17753-19765 | _na 670_aa | Peptidase family M13 | |
| 1447 | CABJEV010000004.1 | GCA902364735_00730 | CDS | open | 19930-20349 | _na 139_aa | DUF6769 domain-containing protein | |
| 1448 | CABJEV010000004.1 | GCA902364735_00731 | CDS | open | 20445-21704 | _na 419_aa | Efflux RND transporter periplasmic adaptor subunit | |
| 1449 | CABJEV010000004.1 | GCA902364735_00732 | CDS | open | 21716-24799 | _na 1027_aa | AcrB/AcrD/AcrF family cation efflux system protein | |
| 1450 | CABJEV010000004.1 | GCA902364735_00733 | CDS | open | 24810-25979 | _na 389_aa | tolC | TolC family protein |
| 1451 | CABJEV010000004.1 | GCA902364735_00734 | CDS | open | 26092-26820 | _na 242_aa | Nitroreductase domain-containing protein | |
| 1452 | CABJEV010000004.1 | GCA902364735_00735 | CDS | open | 26839-27462 | _na 207_aa | HU domain-containing protein | |
| 1453 | CABJEV010000004.1 | GCA902364735_00736 | CDS | open | 27744-29327 | _na 527_aa | histidine kinase | |
| 1454 | CABJEV010000004.1 | GCA902364735_00737 | CDS | open | 29469-30386 | _na 305_aa | metA | homoserine O-succinyltransferase |
| 1455 | CABJEV010000004.1 | GCA902364735_00738 | CDS | open | 30383-32248 | _na 621_aa | Peptidase U32 collagenase domain-containing protein | |
| 1456 | CABJEV010000004.1 | GCA902364735_00739 | CDS | open | 32245-33249 | _na 334_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 1457 | CABJEV010000004.1 | GCA902364735_00740 | CDS | open | 33322-35634 | _na 770_aa | TonB-dependent receptor | |
| 1458 | CABJEV010000004.1 | GCA902364735_00741 | CDS | open | 35722-36333 | _na 203_aa | HTH luxR-type domain-containing protein | |
| 1459 | CABJEV010000004.1 | GCA902364735_00742 | CDS | open | 36719-38338 | _na 539_aa | FAD-binding domain-containing protein | |
| 1460 | CABJEV010000004.1 | GCA902364735_00743 | CDS | open | 38346-38993 | _na 215_aa | Metal-binding protein | |
| 1461 | CABJEV010000004.1 | GCA902364735_00744 | CDS | open | 39033-40397 | _na 454_aa | radA | DNA repair protein RadA |
| 1462 | CABJEV010000004.1 | GCA902364735_00745 | CDS | open | 40423-42711 | _na 762_aa | Alpha-N-acetylglucosaminidase | |
| 1463 | CABJEV010000004.1 | GCA902364735_00746 | CDS | open | 42912-44057 | _na 381_aa | 6-bladed beta-propeller | |
| 1464 | CABJEV010000004.1 | GCA902364735_00747 | CDS | open | 44540-46972 | _na 810_aa | thrA | bifunctional aspartate kinase/homoserine dehydrogenase I |
| 1465 | CABJEV010000004.1 | GCA902364735_00748 | CDS | open | 46977-48206 | _na 409_aa | cofactor-independent phosphoglycerate mutase | |
| 1466 | CABJEV010000004.1 | GCA902364735_00749 | CDS | open | 48222-49523 | _na 433_aa | thrC | threonine synthase |
| 1467 | CABJEV010000004.1 | GCA902364735_00750 | CDS | open | 50117-51124 | _na 335_aa | ABC transporter domain-containing protein | |
| 1468 | CABJEV010000004.1 | GCA902364735_00751 | CDS | open | 51124-52155 | _na 343_aa | Iron ABC transporter permease | |
| 1469 | CABJEV010000004.1 | GCA902364735_00752 | CDS | open | 52271-53398 | _na 375_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 1470 | CABJEV010000004.1 | GCA902364735_00753 | CDS | open | 53400-53840 | _na 146_aa | recG | ATP-dependent DNA helicase RecG C-terminal domain-containing protein |
| 1471 | CABJEV010000004.1 | GCA902364735_00754 | CDS | open | 54022-55155 | _na 377_aa | Surface protein | |
| 1472 | CABJEV010000004.1 | GCA902364735_00755 | CDS | open | 55182-57203 | _na 673_aa | TonB-dependent receptor | |
| 1473 | CABJEV010000004.1 | GCA902364735_00756 | CDS | open | 57562-58581 | _na 339_aa | Acyltransferase 3 domain-containing protein | |
| 1474 | CABJEV010000004.1 | GCA902364735_00757 | CDS | open | 58893-59864 | _na 323_aa | Serine aminopeptidase S33 domain-containing protein | |
| 1475 | CABJEV010000004.1 | GCA902364735_00758 | CDS | open | 59866-60147 | _na 93_aa | DUF2089 domain-containing protein | |
| 1476 | CABJEV010000004.1 | GCA902364735_00759 | CDS | open | 60147-60737 | _na 196_aa | Yip1 domain-containing protein | |
| 1477 | CABJEV010000004.1 | GCA902364735_00760 | CDS | open | 60805-61578 | _na 257_aa | Prephenate/arogenate dehydrogenase domain-containing protein | |
| 1478 | CABJEV010000004.1 | GCA902364735_00761 | CDS | open | 61583-62650 | _na 355_aa | DAHP synthetase I/KDSA | |
| 1479 | CABJEV010000004.1 | GCA902364735_00762 | CDS | open | 62670-63854 | _na 394_aa | Aminotransferase | |
| 1480 | CABJEV010000004.1 | GCA902364735_00763 | CDS | open | 63829-64671 | _na 280_aa | prephenate dehydratase | |
| 1481 | CABJEV010000004.1 | GCA902364735_00764 | CDS | open | 64754-65011 | _na 85_aa | hypothetical protein | |
| 1482 | CABJEV010000004.1 | GCA902364735_00765 | CDS | open | 65036-65329 | _na 97_aa | DUF3899 domain-containing protein | |
| 1483 | CABJEV010000004.1 | GCA902364735_00766 | CDS | open | 65373-65741 | _na 122_aa | HTH hxlR-type domain-containing protein | |
| 1484 | CABJEV010000004.1 | GCA902364735_00767 | CDS | open | 65929-66456 | _na 175_aa | DJ-1/PfpI domain-containing protein | |
| 1485 | CABJEV010000004.1 | GCA902364735_00768 | CDS | open | 66554-67729 | _na 391_aa | cysteine-S-conjugate beta-lyase | |
| 1486 | CABJEV010000004.1 | GCA902364735_00769 | CDS | open | 67948-69954 | _na 668_aa | RagB/SusD domain-containing protein | |
| 1487 | CABJEV010000004.1 | GCA902364735_00770 | CDS | open | 69976-73206 | _na 1076_aa | SusC/RagA family TonB-linked outer membrane protein | |
| 1488 | CABJEV010000004.1 | GCA902364735_00771 | CDS | open | 73788-76031 | _na 747_aa | R3H domain-containing protein | |
| 1489 | CABJEV010000004.1 | GCA902364735_00772 | CDS | open | 76079-76951 | _na 290_aa | HTH araC/xylS-type domain-containing protein | |
| 1490 | CABJEV010000004.1 | GCA902364735_00773 | CDS | open | 77097-77789 | _na 230_aa | Regulator of ribonuclease activity-like protein | |
| 1491 | CABJEV010000004.1 | GCA902364735_00774 | CDS | open | 77808-78977 | _na 389_aa | Mandelate racemase/muconate lactonizing enzyme C-terminal domain-containing protein | |
| 1492 | CABJEV010000004.1 | GCA902364735_00775 | CDS | open | 78983-79774 | _na 263_aa | Glucose 1-dehydrogenase | |
| 1493 | CABJEV010000004.1 | GCA902364735_00776 | CDS | open | 79811-80698 | _na 295_aa | SMP-30/Gluconolactonase/LRE-like region domain-containing protein | |
| 1494 | CABJEV010000004.1 | GCA902364735_00777 | CDS | open | 80711-82270 | _na 519_aa | Solute:sodium symporter (SSS) family transporter | |
| 1495 | CABJEV010000004.1 | GCA902364735_00778 | CDS | open | 82298-85294 | _na 998_aa | beta-galactosidase | |
| 1496 | CABJEV010000004.1 | GCA902364735_00779 | CDS | open | 85322-88741 | _na 1139_aa | beta-galactosidase | |
| 1497 | CABJEV010000004.1 | GCA902364735_00780 | CDS | open | 88887-91226 | _na 779_aa | F5/8 type C domain-containing protein | |
| 1498 | CABJEV010000004.1 | GCA902364735_00781 | CDS | open | 91386-92885 | _na 499_aa | PD40 domain-containing protein | |
| 1499 | CABJEV010000004.1 | GCA902364735_00782 | CDS | open | 92893-94653 | _na 586_aa | Transmembrane protein | |
| 1500 | CABJEV010000004.1 | GCA902364735_00783 | CDS | open | 94757-96505 | _na 582_aa | Glycoside hydrolase 123 C-terminal domain-containing protein |

