BAKTAGenome Explorer: Neisseria macacae (GCA_902374455.1)
Select a Genome:
|
BAKTA Annotations for GCA_902374455.1
|
Search & Sort all 5010 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CABKQF010000003.1 | GCA902374455_01331 | CDS | open | 154217-155128 | _na 303_aa | Nucleotidyl transferase%2C PF08843 family | |
| 2502 | CABKQF010000003.1 | GCA902374455_01332 | CDS | open | 155327-155914 | _na 195_aa | hypothetical protein | |
| 2503 | CABKQF010000003.1 | GCA902374455_01333 | CDS | open | 155937-156668 | _na 243_aa | hypothetical protein | |
| 2504 | CABKQF010000003.1 | GCA902374455_01334 | CDS | open | 157630-158307 | _na 225_aa | DUF2441 domain-containing protein | |
| 2505 | CABKQF010000003.1 | GCA902374455_01335 | CDS | open | 158600-159016 | _na 138_aa | DUF2441 domain-containing protein | |
| 2506 | CABKQF010000003.1 | GCA902374455_01336 | CDS | open | 159253-159780 | _na 175_aa | hypothetical protein | |
| 2507 | CABKQF010000003.1 | GCA902374455_01337 | CDS | open | 160810-161142 | _na 110_aa | hypothetical protein | |
| 2508 | CABKQF010000003.1 | GCA902374455_01338 | CDS | open | 161532-162158 | _na 208_aa | tmk | dTMP kinase |
| 2509 | CABKQF010000003.1 | GCA902374455_01339 | CDS | open | 162378-163658 | _na 426_aa | sfcA | Malic enzyme |
| 2510 | CABKQF010000003.1 | GCA902374455_01340 | CDS | open | 163744-165078 | _na 444_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 2511 | CABKQF010000003.1 | GCA902374455_01341 | CDS | open | 165411-165737 | _na 108_aa | Low molecular weight phosphotyrosine protein phosphatase domain protein | |
| 2512 | CABKQF010000003.1 | GCA902374455_01342 | CDS | open | 165810-166025 | _na 71_aa | DEAD/DEAH box helicase | |
| 2513 | CABKQF010000003.1 | GCA902374455_01343 | CDS | open | 166188-167501 | _na 437_aa | rarA | Replication-associated recombination protein A |
| 2514 | CABKQF010000003.1 | GCA902374455_01344 | CDS | open | 167841-168401 | _na 186_aa | hypothetical protein | |
| 2515 | CABKQF010000003.1 | GCA902374455_01345 | CDS | open | 168558-168935 | _na 125_aa | Lipoprotein | |
| 2516 | CABKQF010000003.1 | GCA902374455_01346 | CDS | open | 169079-170491 | _na 470_aa | thrC | threonine synthase |
| 2517 | CABKQF010000003.1 | GCA902374455_01347 | CDS | open | 170701-171477 | _na 258_aa | fpr | ferredoxin--NADP(+) reductase |
| 2518 | CABKQF010000003.1 | GCA902374455_01348 | CDS | open | 171594-172082 | _na 162_aa | DUF1841 domain-containing protein | |
| 2519 | CABKQF010000003.1 | GCA902374455_01349 | CDS | open | 172440-172808 | _na 122_aa | hypothetical protein | |
| 2520 | CABKQF010000003.1 | GCA902374455_01350 | CDS | open | 173716-174774 | _na 352_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 2521 | CABKQF010000003.1 | GCA902374455_01351 | CDS | open | 174919-175395 | _na 158_aa | IS1016C2 transposase | |
| 2522 | CABKQF010000003.1 | GCA902374455_01352 | CDS | open | 175337-175573 | _na 78_aa | IS1016C2 transposase | |
| 2523 | CABKQF010000003.1 | GCA902374455_01353 | CDS | open | 175661-177526 | _na 621_aa | uvrB | excinuclease ABC subunit UvrB |
| 2524 | CABKQF010000003.1 | GCA902374455_01354 | CDS | open | 177550-177687 | _na 45_aa | hypothetical protein | |
| 2525 | CABKQF010000003.1 | GCA902374455_01355 | CDS | open | 177864-179270 | _na 468_aa | dnaB | replicative DNA helicase |
| 2526 | CABKQF010000003.1 | GCA902374455_01356 | CDS | open | 179428-179961 | _na 177_aa | Type II secretion system protein H | |
| 2527 | CABKQF010000003.1 | GCA902374455_01357 | CDS | open | 180229-180831 | _na 200_aa | pilV | Type IV pilus modification protein PilV |
| 2528 | CABKQF010000003.1 | GCA902374455_01358 | CDS | open | 180831-181808 | _na 325_aa | pilW | Prepilin-type N-terminal cleavage/methylation domain protein |
| 2529 | CABKQF010000003.1 | GCA902374455_01359 | CDS | open | 181787-182401 | _na 204_aa | PilX/PilW C-terminal domain-containing protein | |
| 2530 | CABKQF010000003.1 | GCA902374455_01360 | CDS | open | 182414-182905 | _na 163_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 2531 | CABKQF010000003.1 | GCA902374455_01361 | CDS | open | 183072-184541 | _na 489_aa | DUF6892 domain-containing protein | |
| 2532 | CABKQF010000003.1 | GCA902374455_01362 | CDS | open | 184831-186438 | _na 535_aa | Type I secretion protein | |
| 2533 | CABKQF010000003.1 | GCA902374455_01363 | CDS | open | 186774-188435 | _na 553_aa | Type I secretion protein | |
| 2534 | CABKQF010000003.1 | GCA902374455_01364 | CDS | open | 188708-189778 | _na 356_aa | ttcA | tRNA 2-thiocytidine(32) synthetase TtcA |
| 2535 | CABKQF010000003.1 | GCA902374455_01365 | CDS | open | 190162-190440 | _na 92_aa | ftsB | cell division protein FtsB |
| 2536 | CABKQF010000003.1 | GCA902374455_01366 | CDS | open | 190457-191743 | _na 428_aa | eno | phosphopyruvate hydratase |
| 2537 | CABKQF010000003.1 | GCA902374455_01367 | CDS | open | 192105-193097 | _na 330_aa | KWG Leptospira | |
| 2538 | CABKQF010000003.1 | GCA902374455_01368 | CDS | open | 193164-194627 | _na 487_aa | guaB | IMP dehydrogenase |
| 2539 | CABKQF010000003.1 | GCA902374455_01369 | CDS | open | 194881-195261 | _na 126_aa | DUF4124 domain-containing protein | |
| 2540 | CABKQF010000003.1 | GCA902374455_01370 | CDS | open | 195539-196399 | _na 286_aa | Sel1 repeat protein | |
| 2541 | CABKQF010000003.1 | GCA902374455_01371 | CDS | open | 196579-197427 | _na 282_aa | hpnD | presqualene diphosphate synthase HpnD |
| 2542 | CABKQF010000003.1 | GCA902374455_01372 | CDS | open | 197424-198767 | _na 447_aa | hpnE | hydroxysqualene dehydroxylase HpnE |
| 2543 | CABKQF010000003.1 | GCA902374455_01373 | CDS | open | 199243-200424 | _na 393_aa | argD | Acetylornithine aminotransferase |
| 2544 | CABKQF010000003.1 | GCA902374455_01374 | CDS | open | 200857-203520 | _na 887_aa | aceE | pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type |
| 2545 | CABKQF010000003.1 | GCA902374455_01375 | CDS | open | 203761-205380 | _na 539_aa | aceF | dihydrolipoyllysine-residue acetyltransferase |
| 2546 | CABKQF010000003.1 | GCA902374455_01376 | CDS | open | 205468-207255 | _na 595_aa | lpdA | dihydrolipoyl dehydrogenase |
| 2547 | CABKQF010000003.1 | GCA902374455_01377 | CDS | open | 207774-208481 | _na 235_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 2548 | CABKQF010000003.1 | GCA902374455_01378 | CDS | open | 208501-209130 | _na 209_aa | ribC | riboflavin synthase subunit alpha |
| 2549 | CABKQF010000003.1 | GCA902374455_01379 | CDS | open | 209139-210005 | _na 288_aa | atu1564 | Type I restriction-modification system |
| 2550 | CABKQF010000003.1 | GCA902374455_01380 | CDS | open | 210183-210611 | _na 142_aa | cpxP | Periplasmic protein |
| 2551 | CABKQF010000003.1 | GCA902374455_01381 | CDS | open | 210867-211550 | _na 227_aa | rpe | ribulose-phosphate 3-epimerase |
| 2552 | CABKQF010000003.1 | GCA902374455_01382 | CDS | open | 211819-212850 | _na 343_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 2553 | CABKQF010000003.1 | GCA902374455_01383 | CDS | open | 212922-213230 | _na 102_aa | Phage associated protein | |
| 2554 | CABKQF010000003.1 | GCA902374455_01384 | CDS | open | 213294-213932 | _na 212_aa | hypothetical protein | |
| 2555 | CABKQF010000003.1 | GCA902374455_01385 | CDS | open | 213943-215199 | _na 418_aa | cca | multifunctional CCA addition/repair protein |
| 2556 | CABKQF010000003.1 | GCA902374455_01386 | CDS | open | 215527-216486 | _na 319_aa | hflC | SPFH/Band 7/PHB domain protein |
| 2557 | CABKQF010000003.1 | GCA902374455_01387 | CDS | open | 216589-216996 | _na 135_aa | ybbJ | Nodulation efficiency protein D |
| 2558 | CABKQF010000003.1 | GCA902374455_01388 | CDS | open | 217177-217836 | _na 219_aa | ung | uracil-DNA glycosylase |
| 2559 | CABKQF010000003.1 | GCA902374455_01389 | CDS | open | 217946-218443 | _na 165_aa | ybhB | YbhB/YbcL family Raf kinase inhibitor-like protein |
| 2560 | CABKQF010000003.1 | GCA902374455_01390 | CDS | open | 218503-219489 | _na 328_aa | lipA | lipoyl synthase |
| 2561 | CABKQF010000003.1 | GCA902374455_01391 | CDS | open | 219489-220106 | _na 205_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 2562 | CABKQF010000003.1 | GCA902374455_01392 | CDS | open | 220108-220374 | _na 88_aa | ybeD | UPF0250 protein MCC93_17350 |
| 2563 | CABKQF010000003.1 | GCA902374455_01393 | CDS | open | 220575-223037 | _na 820_aa | lon | endopeptidase La |
| 2564 | CABKQF010000003.1 | GCA902374455_01394 | CDS | open | 223222-223491 | _na 89_aa | hupB | DNA-binding protein HU-beta |
| 2565 | CABKQF010000003.1 | GCA902374455_01395 | CDS | open | 223771-224304 | _na 177_aa | Inorganic pyrophosphatase | |
| 2566 | CABKQF010000003.1 | GCA902374455_01396 | CDS | open | 224456-225373 | _na 305_aa | thrB | homoserine kinase |
| 2567 | CABKQF010000003.1 | GCA902374455_01397 | CDS | open | 225658-226473 | _na 271_aa | trmJ | RNA methyltransferase%2C TrmH family%2C group 1 |
| 2568 | CABKQF010000003.1 | GCA902374455_01398 | CDS | open | 226650-227435 | _na 261_aa | suhB | Putative Nus factor SuhB |
| 2569 | CABKQF010000003.1 | GCA902374455_01399 | CDS | open | 227797-228936 | _na 379_aa | tolC | Outer membrane efflux protein |
| 2570 | CABKQF010000003.1 | GCA902374455_01400 | CDS | open | 228976-231159 | _na 727_aa | sunT | Type I secretion system ATPase |
| 2571 | CABKQF010000003.1 | GCA902374455_01401 | CDS | open | 231252-232478 | _na 408_aa | emrA | Membrane fusion protein (MFP) family protein |
| 2572 | CABKQF010000003.1 | GCA902374455_01402 | CDS | open | 232880-233209 | _na 109_aa | Stress response protein | |
| 2573 | CABKQF010000003.1 | GCA902374455_01403 | CDS | open | 233698-235977 | _na 759_aa | nrdA | class 1a ribonucleoside-diphosphate reductase subunit alpha |
| 2574 | CABKQF010000003.1 | GCA902374455_01404 | CDS | open | 236821-237975 | _na 384_aa | nrdB | class Ia ribonucleoside-diphosphate reductase subunit beta |
| 2575 | CABKQF010000003.1 | GCA902374455_01405 | CDS | open | 238094-238396 | _na 100_aa | yfaE | class I ribonucleotide reductase maintenance protein YfaE |
| 2576 | CABKQF010000003.1 | GCA902374455_01406 | CDS | open | 238649-238897 | _na 82_aa | hypothetical protein | |
| 2577 | CABKQF010000003.1 | GCA902374455_01407 | CDS | open | 238972-240807 | _na 611_aa | uvrC | excinuclease ABC subunit UvrC |
| 2578 | CABKQF010000003.1 | GCA902374455_01408 | CDS | open | 241005-242573 | _na 522_aa | DUF945 domain-containing protein | |
| 2579 | CABKQF010000003.1 | GCA902374455_01409 | CDS | open | 242739-243221 | _na 160_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 2580 | CABKQF010000003.1 | GCA902374455_01410 | CDS | open | 243578-244327 | _na 249_aa | dnaQ | DNA polymerase III subunit epsilon |
| 2581 | CABKQF010000003.1 | GCA902374455_01411 | CDS | open | 244324-245010 | _na 228_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 2582 | CABKQF010000003.1 | GCA902374455_01412 | CDS | open | 245054-245533 | _na 159_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 2583 | CABKQF010000003.1 | GCA902374455_01413 | CDS | open | 245603-245782 | _na 59_aa | ribose-5-phosphate isomerase | |
| 2584 | CABKQF010000003.1 | GCA902374455_01414 | CDS | open | 245782-246273 | _na 163_aa | rpiA | ribose-5-phosphate isomerase RpiA |
| 2585 | CABKQF010000003.1 | GCA902374455_01415 | CDS | open | 246455-247336 | _na 293_aa | yicC | Stress-induced protein |
| 2586 | CABKQF010000003.1 | GCA902374455_01416 | CDS | open | 247689-248819 | _na 376_aa | potD | Putrescine-binding periplasmic protein |
| 2587 | CABKQF010000003.1 | GCA902374455_01417 | CDS | open | 249048-251672 | _na 874_aa | alaS | alanine--tRNA ligase |
| 2588 | CABKQF010000003.1 | GCA902374455_01418 | CDS | open | 251743-252051 | _na 102_aa | DNA-sulfur modification-associated | |
| 2589 | CABKQF010000003.1 | GCA902374455_01419 | CDS | open | 253705-254553 | _na 282_aa | CAAX amino terminal protease family protein | |
| 2590 | CABKQF010000003.1 | GCA902374455_01420 | CDS | open | 254731-255336 | _na 201_aa | putative S-adenosylmethionine-dependent methyltransferase MSMEG_2350 | |
| 2591 | CABKQF010000003.1 | GCA902374455_01421 | CDS | open | 255607-255984 | _na 125_aa | Lipoprotein | |
| 2592 | CABKQF010000003.1 | GCA902374455_01422 | CDS | open | 256830-258458 | _na 542_aa | uup | ABC-F family ATPase |
| 2593 | CABKQF010000003.1 | GCA902374455_01423 | CDS | open | 258557-258751 | _na 64_aa | Amino acid permease | |
| 2594 | CABKQF010000003.1 | GCA902374455_01424 | CDS | open | 258774-259232 | _na 152_aa | Lipoic acid synthetase | |
| 2595 | CABKQF010000003.1 | GCA902374455_01425 | CDS | open | 259298-260017 | _na 239_aa | trmR | Class I SAM-dependent methyltransferase |
| 2596 | CABKQF010000003.1 | GCA902374455_01426 | CDS | open | 260152-261528 | _na 458_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 2597 | CABKQF010000003.1 | GCA902374455_01427 | CDS | open | 261877-262362 | _na 161_aa | phosphatase PAP2 family protein | |
| 2598 | CABKQF010000003.1 | GCA902374455_01428 | CDS | open | 262481-262609 | _na 42_aa | FeoB-associated Cys-rich membrane protein | |
| 2599 | CABKQF010000003.1 | GCA902374455_01429 | CDS | open | 262606-264474 | _na 622_aa | Ferrous iron transport protein B | |
| 2600 | CABKQF010000003.1 | GCA902374455_01430 | CDS | open | 264645-264911 | _na 88_aa | feoA | FeoA domain protein |
| 2601 | CABKQF010000003.1 | GCA902374455_01431 | CDS | open | 265228-265854 | _na 208_aa | nnr1 | NAD(P)H-hydrate epimerase |
| 2602 | CABKQF010000003.1 | GCA902374455_01432 | CDS | open | 265886-266248 | _na 120_aa | crcB | fluoride efflux transporter CrcB |
| 2603 | CABKQF010000003.1 | GCA902374455_01433 | CDS | open | 266589-267524 | _na 311_aa | pyrD | dihydroorotate oxidase |
| 2604 | CABKQF010000003.1 | GCA902374455_01434 | CDS | open | 267872-269014 | _na 380_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 2605 | CABKQF010000003.1 | GCA902374455_01435 | CDS | open | 269121-269603 | _na 160_aa | Acetyltransferase%2C GNAT family | |
| 2606 | CABKQF010000003.1 | GCA902374455_01436 | CDS | open | 269685-270305 | _na 206_aa | Smr domain protein | |
| 2607 | CABKQF010000003.1 | GCA902374455_01437 | CDS | open | 270436-271803 | _na 455_aa | glcD | D-lactate dehydrogenase (Cytochrome) |
| 2608 | CABKQF010000003.1 | GCA902374455_01438 | CDS | open | 272806-273285 | _na 159_aa | Peptidyl-prolyl cis-trans isomerase | |
| 2609 | CABKQF010000003.1 | GCA902374455_01439 | CDS | open | 273291-273413 | _na 40_aa | hypothetical protein | |
| 2610 | CABKQF010000003.1 | GCA902374455_01440 | CDS | open | 273453-274355 | _na 300_aa | DUF4299 domain-containing protein | |
| 2611 | CABKQF010000003.1 | GCA902374455_01441 | CDS | open | 274457-275233 | _na 258_aa | RHS repeat-associated core domain protein | |
| 2612 | CABKQF010000003.1 | GCA902374455_01442 | CDS | open | 275393-276016 | _na 207_aa | FMN dependent NADH:quinone oxidoreductase | |
| 2613 | CABKQF010000003.1 | GCA902374455_01443 | CDS | open | 276112-277971 | _na 619_aa | ilvD | dihydroxy-acid dehydratase |
| 2614 | CABKQF010000003.1 | GCA902374455_01444 | CDS | open | 278364-278789 | _na 141_aa | hypothetical protein | |
| 2615 | CABKQF010000003.1 | GCA902374455_01445 | CDS | open | 279235-280065 | _na 276_aa | symmetrical bis(5'-nucleosyl)-tetraphosphatase | |
| 2616 | CABKQF010000003.1 | GCA902374455_01446 | CDS | open | 280146-280535 | _na 129_aa | ridA | Ribonuclease%2C putative |
| 2617 | CABKQF010000003.1 | GCA902374455_01447 | CDS | open | 280714-281892 | _na 392_aa | hemW | radical SAM family heme chaperone HemW |
| 2618 | CABKQF010000003.1 | GCA902374455_01448 | CDS | open | 281914-282441 | _na 175_aa | RiboL-PSP-HEPN domain-containing protein | |
| 2619 | CABKQF010000003.1 | GCA902374455_01449 | CDS | open | 282454-283341 | _na 295_aa | GmrSD restriction endonucleases N-terminal domain-containing protein | |
| 2620 | CABKQF010000003.1 | GCA902374455_01175 | gene | open | 268-732 | bfr | ||
| 2621 | CABKQF010000003.1 | GCA902374455_01176 | gene | open | 755-1228 | bfr | ||
| 2622 | CABKQF010000003.1 | GCA902374455_01177 | gene | open | 1866-2369 | |||
| 2623 | CABKQF010000003.1 | GCA902374455_01178 | gene | open | 2495-3049 | |||
| 2624 | CABKQF010000003.1 | GCA902374455_01179 | gene | open | 3341-4291 | trxB | ||
| 2625 | CABKQF010000003.1 | GCA902374455_01180 | gene | open | 4500-5570 | corA | ||
| 2626 | CABKQF010000003.1 | GCA902374455_01181 | gene | open | 5700-6182 | yciA | ||
| 2627 | CABKQF010000003.1 | GCA902374455_01182 | gene | open | 6335-6799 | uspA | ||
| 2628 | CABKQF010000003.1 | GCA902374455_01183 | gene | open | 6992-7768 | tcdA | ||
| 2629 | CABKQF010000003.1 | GCA902374455_01184 | gene | open | 7770-8240 | |||
| 2630 | CABKQF010000003.1 | GCA902374455_01185 | gene | open | 8292-8750 | |||
| 2631 | CABKQF010000003.1 | GCA902374455_01186 | gene | open | 8856-9743 | scpA | ||
| 2632 | CABKQF010000003.1 | GCA902374455_01187 | gene | open | 9971-11308 | brnQ | ||
| 2633 | CABKQF010000003.1 | GCA902374455_01188 | gene | open | 11450-12583 | |||
| 2634 | CABKQF010000003.1 | GCA902374455_01189 | gene | open | 12616-13422 | |||
| 2635 | CABKQF010000003.1 | GCA902374455_01190 | gene | open | 13476-14777 | mpfA | ||
| 2636 | CABKQF010000003.1 | GCA902374455_01191 | gene | open | 14863-15216 | |||
| 2637 | CABKQF010000003.1 | GCA902374455_01192 | gene | open | 15363-16547 | labA | ||
| 2638 | CABKQF010000003.1 | GCA902374455_01193 | gene | open | 16615-17601 | mdh | ||
| 2639 | CABKQF010000003.1 | GCA902374455_01194 | gene | open | 17727-19106 | radA | ||
| 2640 | CABKQF010000003.1 | GCA902374455_01195 | gene | open | 19201-20703 | ctpA | ||
| 2641 | CABKQF010000003.1 | GCA902374455_01196 | gene | open | 20968-22722 | envC | ||
| 2642 | CABKQF010000003.1 | GCA902374455_01197 | gene | open | 22906-23550 | |||
| 2643 | CABKQF010000003.1 | GCA902374455_01198 | gene | open | 23653-24444 | speE | ||
| 2644 | CABKQF010000003.1 | GCA902374455_01201 | gene | open | 25007-25795 | panB | ||
| 2645 | CABKQF010000003.1 | GCA902374455_01202 | gene | open | 25967-26803 | panC | ||
| 2646 | CABKQF010000003.1 | GCA902374455_01203 | gene | open | 26874-27599 | |||
| 2647 | CABKQF010000003.1 | GCA902374455_01204 | gene | open | 27738-29150 | trkA | ||
| 2648 | CABKQF010000003.1 | GCA902374455_01205 | gene | open | 29543-30838 | hisS | ||
| 2649 | CABKQF010000003.1 | GCA902374455_01206 | gene | open | 30839-31468 | yfgM | ||
| 2650 | CABKQF010000003.1 | GCA902374455_01207 | gene | open | 31734-31910 | |||
| 2651 | CABKQF010000003.1 | GCA902374455_01208 | gene | open | 32156-33613 | der | ||
| 2652 | CABKQF010000003.1 | GCA902374455_01209 | gene | open | 33982-34272 | hfq | ||
| 2653 | CABKQF010000003.1 | GCA902374455_01210 | gene | open | 34363-34917 | ubiE | ||
| 2654 | CABKQF010000003.1 | GCA902374455_01211 | gene | open | 34970-35344 | sirB | ||
| 2655 | CABKQF010000003.1 | GCA902374455_01212 | gene | open | 35360-35854 | folK | ||
| 2656 | CABKQF010000003.1 | GCA902374455_01213 | gene | open | 36088-36723 | dck | ||
| 2657 | CABKQF010000003.1 | GCA902374455_01214 | gene | open | 36828-37265 | bcp | ||
| 2658 | CABKQF010000003.1 | GCA902374455_01215 | gene | open | 37434-38309 | xerD | ||
| 2659 | CABKQF010000003.1 | GCA902374455_01216 | gene | open | 38379-40664 | clpA | ||
| 2660 | CABKQF010000003.1 | GCA902374455_01217 | gene | open | 40666-40977 | clpS | ||
| 2661 | CABKQF010000003.1 | GCA902374455_01218 | gene | open | 41290-41493 | cspC | ||
| 2662 | CABKQF010000003.1 | GCA902374455_01219 | gene | open | 41576-41803 | |||
| 2663 | CABKQF010000003.1 | GCA902374455_01220 | gene | open | 42018-44243 | comEC | ||
| 2664 | CABKQF010000003.1 | GCA902374455_01221 | gene | open | 44402-45310 | efeB | ||
| 2665 | CABKQF010000003.1 | GCA902374455_01222 | gene | open | 45443-46528 | yaeI | ||
| 2666 | CABKQF010000003.1 | GCA902374455_01223 | gene | open | 46809-47009 | |||
| 2667 | CABKQF010000003.1 | GCA902374455_01224 | gene | open | 47134-47391 | |||
| 2668 | CABKQF010000003.1 | GCA902374455_01225 | gene | open | 47500-47934 | |||
| 2669 | CABKQF010000003.1 | GCA902374455_01226 | gene | open | 47927-49234 | |||
| 2670 | CABKQF010000003.1 | GCA902374455_01227 | gene | open | 49583-49957 | rodA | ||
| 2671 | CABKQF010000003.1 | GCA902374455_01228 | gene | open | 50031-50465 | |||
| 2672 | CABKQF010000003.1 | GCA902374455_01229 | gene | open | 50550-51086 | paaY | ||
| 2673 | CABKQF010000003.1 | GCA902374455_01230 | gene | open | 51560-51985 | |||
| 2674 | CABKQF010000003.1 | GCA902374455_01231 | gene | open | 52346-52807 | |||
| 2675 | CABKQF010000003.1 | GCA902374455_01232 | gene | open | 52899-53297 | |||
| 2676 | CABKQF010000003.1 | GCA902374455_01233 | gene | open | 53657-55150 | cls | ||
| 2677 | CABKQF010000003.1 | GCA902374455_01234 | gene | open | 55533-56123 | |||
| 2678 | CABKQF010000003.1 | GCA902374455_01235 | gene | open | 57141-58202 | hemE | ||
| 2679 | CABKQF010000003.1 | GCA902374455_01236 | gene | open | 58357-58797 | |||
| 2680 | CABKQF010000003.1 | GCA902374455_01237 | gene | open | 58830-60053 | hemYx | ||
| 2681 | CABKQF010000003.1 | GCA902374455_01238 | gene | open | 60050-61582 | hemX | ||
| 2682 | CABKQF010000003.1 | GCA902374455_01239 | gene | open | 61817-62299 | |||
| 2683 | CABKQF010000003.1 | GCA902374455_01240 | gene | open | 62490-62909 | |||
| 2684 | CABKQF010000003.1 | GCA902374455_01241 | gene | open | 63107-63853 | |||
| 2685 | CABKQF010000003.1 | GCA902374455_01242 | gene | open | 63927-64967 | lytS | ||
| 2686 | CABKQF010000003.1 | GCA902374455_01243 | gene | open | 65045-66424 | argH | ||
| 2687 | CABKQF010000003.1 | GCA902374455_01244 | gene | open | 66496-66726 | |||
| 2688 | CABKQF010000003.1 | GCA902374455_01245 | gene | open | 67330-67521 | |||
| 2689 | CABKQF010000003.1 | GCA902374455_01246 | gene | open | 67438-67704 | |||
| 2690 | CABKQF010000003.1 | GCA902374455_01247 | gene | open | 67769-69922 | |||
| 2691 | CABKQF010000003.1 | GCA902374455_01248 | gene | open | 70271-71587 | |||
| 2692 | CABKQF010000003.1 | GCA902374455_01249 | gene | open | 71670-72677 | iS5 | ||
| 2693 | CABKQF010000003.1 | GCA902374455_01250 | gene | open | 72929-73138 | |||
| 2694 | CABKQF010000003.1 | GCA902374455_01251 | gene | open | 73151-73777 | |||
| 2695 | CABKQF010000003.1 | GCA902374455_01252 | gene | open | 73882-74757 | lysR | ||
| 2696 | CABKQF010000003.1 | GCA902374455_01253 | gene | open | 74772-74927 | lysR | ||
| 2697 | CABKQF010000003.1 | GCA902374455_01254 | gene | open | 75019-76383 | |||
| 2698 | CABKQF010000003.1 | GCA902374455_01255 | gene | open | 76427-76606 | recX | ||
| 2699 | CABKQF010000003.1 | GCA902374455_01256 | gene | open | 76644-77015 | |||
| 2700 | CABKQF010000003.1 | GCA902374455_01257 | gene | open | 77026-77562 | |||
| 2701 | CABKQF010000003.1 | GCA902374455_01258 | gene | open | 77704-78150 | |||
| 2702 | CABKQF010000003.1 | GCA902374455_01259 | gene | open | 78190-80751 | glnD | ||
| 2703 | CABKQF010000003.1 | GCA902374455_01260 | gene | open | 80801-81118 | hipB | ||
| 2704 | CABKQF010000003.1 | GCA902374455_01263 | gene | open | 81891-83255 | yocR | ||
| 2705 | CABKQF010000003.1 | GCA902374455_01264 | gene | open | 83608-85491 | |||
| 2706 | CABKQF010000003.1 | GCA902374455_01265 | gene | open | 85572-86174 | lolB | ||
| 2707 | CABKQF010000003.1 | GCA902374455_01266 | gene | open | 86176-87024 | ispE | ||
| 2708 | CABKQF010000003.1 | GCA902374455_01270 | gene | open | 87479-88507 | prs | ||
| 2709 | CABKQF010000003.1 | GCA902374455_01271 | gene | open | 88574-89146 | rplY | ||
| 2710 | CABKQF010000003.1 | GCA902374455_01272 | gene | open | 89512-90267 | |||
| 2711 | CABKQF010000003.1 | GCA902374455_01273 | gene | open | 90692-91366 | |||
| 2712 | CABKQF010000003.1 | GCA902374455_01274 | gene | open | 91485-91928 | |||
| 2713 | CABKQF010000003.1 | GCA902374455_01275 | gene | open | 92111-92671 | |||
| 2714 | CABKQF010000003.1 | GCA902374455_01276 | gene | open | 92763-94241 | |||
| 2715 | CABKQF010000003.1 | GCA902374455_01277 | gene | open | 94332-94490 | |||
| 2716 | CABKQF010000003.1 | GCA902374455_01278 | gene | open | 94615-96183 | |||
| 2717 | CABKQF010000003.1 | GCA902374455_01279 | gene | open | 96707-97048 | |||
| 2718 | CABKQF010000003.1 | GCA902374455_01280 | gene | open | 97058-97528 | |||
| 2719 | CABKQF010000003.1 | GCA902374455_01283 | gene | open | 98440-99195 | |||
| 2720 | CABKQF010000003.1 | GCA902374455_01284 | gene | open | 99209-100843 | rtcR | ||
| 2721 | CABKQF010000003.1 | GCA902374455_01285 | gene | open | 101016-101471 | |||
| 2722 | CABKQF010000003.1 | GCA902374455_01286 | gene | open | 101752-103038 | |||
| 2723 | CABKQF010000003.1 | GCA902374455_01287 | gene | open | 103097-103921 | |||
| 2724 | CABKQF010000003.1 | GCA902374455_01288 | gene | open | 103926-104906 | |||
| 2725 | CABKQF010000003.1 | GCA902374455_01289 | gene | open | 104903-105907 | |||
| 2726 | CABKQF010000003.1 | GCA902374455_01290 | gene | open | 106059-106670 | lrgB | ||
| 2727 | CABKQF010000003.1 | GCA902374455_01291 | gene | open | 106766-107218 | lrgA | ||
| 2728 | CABKQF010000003.1 | GCA902374455_01292 | gene | open | 107260-108144 | lysR | ||
| 2729 | CABKQF010000003.1 | GCA902374455_01293 | gene | open | 108183-110084 | |||
| 2730 | CABKQF010000003.1 | GCA902374455_01294 | gene | open | 110476-111603 | mviM | ||
| 2731 | CABKQF010000003.1 | GCA902374455_01295 | gene | open | 111600-112259 | nfnB | ||
| 2732 | CABKQF010000003.1 | GCA902374455_01296 | gene | open | 112372-113691 | uhpC | ||
| 2733 | CABKQF010000003.1 | GCA902374455_01297 | gene | open | 114005-115519 | trkG | ||
| 2734 | CABKQF010000003.1 | GCA902374455_01298 | gene | open | 115788-117107 | yjiN | ||
| 2735 | CABKQF010000003.1 | GCA902374455_01299 | gene | open | 117549-119240 | dld | ||
| 2736 | CABKQF010000003.1 | GCA902374455_01300 | gene | open | 119390-119752 | |||
| 2737 | CABKQF010000003.1 | GCA902374455_01303 | gene | open | 120173-120766 | ribA | ||
| 2738 | CABKQF010000003.1 | GCA902374455_01304 | gene | open | 120759-121427 | |||
| 2739 | CABKQF010000003.1 | GCA902374455_01306 | gene | open | 121675-121896 | |||
| 2740 | CABKQF010000003.1 | GCA902374455_01307 | gene | open | 122013-122669 | citB | ||
| 2741 | CABKQF010000003.1 | GCA902374455_01308 | gene | open | 122659-124521 | |||
| 2742 | CABKQF010000003.1 | GCA902374455_01309 | gene | open | 124789-125370 | |||
| 2743 | CABKQF010000003.1 | GCA902374455_01310 | gene | open | 125624-126493 | galU | ||
| 2744 | CABKQF010000003.1 | GCA902374455_01311 | gene | open | 126726-129197 | ligA | ||
| 2745 | CABKQF010000003.1 | GCA902374455_01312 | gene | open | 129335-130591 | zipA | ||
| 2746 | CABKQF010000003.1 | GCA902374455_01313 | gene | open | 130827-131399 | ampD | ||
| 2747 | CABKQF010000003.1 | GCA902374455_01314 | gene | open | 131528-132523 | mltG | ||
| 2748 | CABKQF010000003.1 | GCA902374455_01315 | gene | open | 132723-133466 | |||
| 2749 | CABKQF010000003.1 | GCA902374455_01316 | gene | open | 133999-134262 | |||
| 2750 | CABKQF010000003.1 | GCA902374455_01317 | gene | open | 134540-135973 | |||
| 2751 | CABKQF010000003.1 | GCA902374455_01318 | gene | open | 136055-136294 | |||
| 2752 | CABKQF010000003.1 | GCA902374455_01319 | gene | open | 136570-137478 | |||
| 2753 | CABKQF010000003.1 | GCA902374455_01320 | gene | open | 137481-140324 | |||
| 2754 | CABKQF010000003.1 | GCA902374455_01321 | gene | open | 141957-142649 | |||
| 2755 | CABKQF010000003.1 | GCA902374455_01322 | gene | open | 143087-144241 | emrA | ||
| 2756 | CABKQF010000003.1 | GCA902374455_01323 | gene | open | 144331-145992 | |||
| 2757 | CABKQF010000003.1 | GCA902374455_01324 | gene | open | 146261-147691 | tolC | ||
| 2758 | CABKQF010000003.1 | GCA902374455_01325 | gene | open | 148025-148285 | |||
| 2759 | CABKQF010000003.1 | GCA902374455_01326 | gene | open | 148847-149362 | ssb | ||
| 2760 | CABKQF010000003.1 | GCA902374455_01327 | gene | open | 149366-150748 | araJ | ||
| 2761 | CABKQF010000003.1 | GCA902374455_01328 | gene | open | 150877-151506 | mltE | ||
| 2762 | CABKQF010000003.1 | GCA902374455_01329 | gene | open | 151787-153295 | ppx | ||
| 2763 | CABKQF010000003.1 | GCA902374455_01330 | gene | open | 153687-154160 | |||
| 2764 | CABKQF010000003.1 | GCA902374455_01331 | gene | open | 154217-155128 | |||
| 2765 | CABKQF010000003.1 | GCA902374455_01332 | gene | open | 155327-155914 | |||
| 2766 | CABKQF010000003.1 | GCA902374455_01333 | gene | open | 155937-156668 | |||
| 2767 | CABKQF010000003.1 | GCA902374455_01334 | gene | open | 157630-158307 | |||
| 2768 | CABKQF010000003.1 | GCA902374455_01335 | gene | open | 158600-159016 | |||
| 2769 | CABKQF010000003.1 | GCA902374455_01336 | gene | open | 159253-159780 | |||
| 2770 | CABKQF010000003.1 | GCA902374455_01337 | gene | open | 160810-161142 | |||
| 2771 | CABKQF010000003.1 | GCA902374455_01338 | gene | open | 161532-162158 | tmk | ||
| 2772 | CABKQF010000003.1 | GCA902374455_01339 | gene | open | 162378-163658 | sfcA | ||
| 2773 | CABKQF010000003.1 | GCA902374455_01340 | gene | open | 163744-165078 | aroA | ||
| 2774 | CABKQF010000003.1 | GCA902374455_01341 | gene | open | 165411-165737 | |||
| 2775 | CABKQF010000003.1 | GCA902374455_01342 | gene | open | 165810-166025 | |||
| 2776 | CABKQF010000003.1 | GCA902374455_01343 | gene | open | 166188-167501 | rarA | ||
| 2777 | CABKQF010000003.1 | GCA902374455_01344 | gene | open | 167841-168401 | |||
| 2778 | CABKQF010000003.1 | GCA902374455_01345 | gene | open | 168558-168935 | |||
| 2779 | CABKQF010000003.1 | GCA902374455_01346 | gene | open | 169079-170491 | thrC | ||
| 2780 | CABKQF010000003.1 | GCA902374455_01347 | gene | open | 170701-171477 | fpr | ||
| 2781 | CABKQF010000003.1 | GCA902374455_01348 | gene | open | 171594-172082 | |||
| 2782 | CABKQF010000003.1 | GCA902374455_01349 | gene | open | 172440-172808 | |||
| 2783 | CABKQF010000003.1 | GCA902374455_01350 | gene | open | 173716-174774 | |||
| 2784 | CABKQF010000003.1 | GCA902374455_01351 | gene | open | 174919-175395 | |||
| 2785 | CABKQF010000003.1 | GCA902374455_01352 | gene | open | 175337-175573 | |||
| 2786 | CABKQF010000003.1 | GCA902374455_01353 | gene | open | 175661-177526 | uvrB | ||
| 2787 | CABKQF010000003.1 | GCA902374455_01354 | gene | open | 177550-177687 | |||
| 2788 | CABKQF010000003.1 | GCA902374455_01355 | gene | open | 177864-179270 | dnaB | ||
| 2789 | CABKQF010000003.1 | GCA902374455_01356 | gene | open | 179428-179961 | |||
| 2790 | CABKQF010000003.1 | GCA902374455_01357 | gene | open | 180229-180831 | pilV | ||
| 2791 | CABKQF010000003.1 | GCA902374455_01358 | gene | open | 180831-181808 | pilW | ||
| 2792 | CABKQF010000003.1 | GCA902374455_01359 | gene | open | 181787-182401 | |||
| 2793 | CABKQF010000003.1 | GCA902374455_01360 | gene | open | 182414-182905 | |||
| 2794 | CABKQF010000003.1 | GCA902374455_01361 | gene | open | 183072-184541 | |||
| 2795 | CABKQF010000003.1 | GCA902374455_01362 | gene | open | 184831-186438 | |||
| 2796 | CABKQF010000003.1 | GCA902374455_01363 | gene | open | 186774-188435 | |||
| 2797 | CABKQF010000003.1 | GCA902374455_01364 | gene | open | 188708-189778 | ttcA | ||
| 2798 | CABKQF010000003.1 | GCA902374455_01365 | gene | open | 190162-190440 | ftsB | ||
| 2799 | CABKQF010000003.1 | GCA902374455_01366 | gene | open | 190457-191743 | eno | ||
| 2800 | CABKQF010000003.1 | GCA902374455_01367 | gene | open | 192105-193097 | |||
| 2801 | CABKQF010000003.1 | GCA902374455_01368 | gene | open | 193164-194627 | guaB | ||
| 2802 | CABKQF010000003.1 | GCA902374455_01369 | gene | open | 194881-195261 | |||
| 2803 | CABKQF010000003.1 | GCA902374455_01370 | gene | open | 195539-196399 | |||
| 2804 | CABKQF010000003.1 | GCA902374455_01371 | gene | open | 196579-197427 | hpnD | ||
| 2805 | CABKQF010000003.1 | GCA902374455_01372 | gene | open | 197424-198767 | hpnE | ||
| 2806 | CABKQF010000003.1 | GCA902374455_01373 | gene | open | 199243-200424 | argD | ||
| 2807 | CABKQF010000003.1 | GCA902374455_01374 | gene | open | 200857-203520 | aceE | ||
| 2808 | CABKQF010000003.1 | GCA902374455_01375 | gene | open | 203761-205380 | aceF | ||
| 2809 | CABKQF010000003.1 | GCA902374455_01376 | gene | open | 205468-207255 | lpdA | ||
| 2810 | CABKQF010000003.1 | GCA902374455_01377 | gene | open | 207774-208481 | trmB | ||
| 2811 | CABKQF010000003.1 | GCA902374455_01378 | gene | open | 208501-209130 | ribC | ||
| 2812 | CABKQF010000003.1 | GCA902374455_01379 | gene | open | 209139-210005 | atu1564 | ||
| 2813 | CABKQF010000003.1 | GCA902374455_01380 | gene | open | 210183-210611 | cpxP | ||
| 2814 | CABKQF010000003.1 | GCA902374455_01381 | gene | open | 210867-211550 | rpe | ||
| 2815 | CABKQF010000003.1 | GCA902374455_01382 | gene | open | 211819-212850 | ruvB | ||
| 2816 | CABKQF010000003.1 | GCA902374455_01383 | gene | open | 212922-213230 | |||
| 2817 | CABKQF010000003.1 | GCA902374455_01384 | gene | open | 213294-213932 | |||
| 2818 | CABKQF010000003.1 | GCA902374455_01385 | gene | open | 213943-215199 | cca | ||
| 2819 | CABKQF010000003.1 | GCA902374455_01386 | gene | open | 215527-216486 | hflC | ||
| 2820 | CABKQF010000003.1 | GCA902374455_01387 | gene | open | 216589-216996 | ybbJ | ||
| 2821 | CABKQF010000003.1 | GCA902374455_01388 | gene | open | 217177-217836 | ung | ||
| 2822 | CABKQF010000003.1 | GCA902374455_01389 | gene | open | 217946-218443 | ybhB | ||
| 2823 | CABKQF010000003.1 | GCA902374455_01390 | gene | open | 218503-219489 | lipA | ||
| 2824 | CABKQF010000003.1 | GCA902374455_01391 | gene | open | 219489-220106 | lipB | ||
| 2825 | CABKQF010000003.1 | GCA902374455_01392 | gene | open | 220108-220374 | ybeD | ||
| 2826 | CABKQF010000003.1 | GCA902374455_01393 | gene | open | 220575-223037 | lon | ||
| 2827 | CABKQF010000003.1 | GCA902374455_01394 | gene | open | 223222-223491 | hupB | ||
| 2828 | CABKQF010000003.1 | GCA902374455_01395 | gene | open | 223771-224304 | |||
| 2829 | CABKQF010000003.1 | GCA902374455_01396 | gene | open | 224456-225373 | thrB | ||
| 2830 | CABKQF010000003.1 | GCA902374455_01397 | gene | open | 225658-226473 | trmJ | ||
| 2831 | CABKQF010000003.1 | GCA902374455_01398 | gene | open | 226650-227435 | suhB | ||
| 2832 | CABKQF010000003.1 | GCA902374455_01399 | gene | open | 227797-228936 | tolC | ||
| 2833 | CABKQF010000003.1 | GCA902374455_01400 | gene | open | 228976-231159 | sunT | ||
| 2834 | CABKQF010000003.1 | GCA902374455_01401 | gene | open | 231252-232478 | emrA | ||
| 2835 | CABKQF010000003.1 | GCA902374455_01402 | gene | open | 232880-233209 | |||
| 2836 | CABKQF010000003.1 | GCA902374455_01403 | gene | open | 233698-235977 | nrdA | ||
| 2837 | CABKQF010000003.1 | GCA902374455_01404 | gene | open | 236821-237975 | nrdB | ||
| 2838 | CABKQF010000003.1 | GCA902374455_01405 | gene | open | 238094-238396 | yfaE | ||
| 2839 | CABKQF010000003.1 | GCA902374455_01406 | gene | open | 238649-238897 | |||
| 2840 | CABKQF010000003.1 | GCA902374455_01407 | gene | open | 238972-240807 | uvrC | ||
| 2841 | CABKQF010000003.1 | GCA902374455_01408 | gene | open | 241005-242573 | |||
| 2842 | CABKQF010000003.1 | GCA902374455_01409 | gene | open | 242739-243221 | |||
| 2843 | CABKQF010000003.1 | GCA902374455_01410 | gene | open | 243578-244327 | dnaQ | ||
| 2844 | CABKQF010000003.1 | GCA902374455_01411 | gene | open | 244324-245010 | |||
| 2845 | CABKQF010000003.1 | GCA902374455_01412 | gene | open | 245054-245533 | ispF | ||
| 2846 | CABKQF010000003.1 | GCA902374455_01413 | gene | open | 245603-245782 | |||
| 2847 | CABKQF010000003.1 | GCA902374455_01414 | gene | open | 245782-246273 | rpiA | ||
| 2848 | CABKQF010000003.1 | GCA902374455_01415 | gene | open | 246455-247336 | yicC | ||
| 2849 | CABKQF010000003.1 | GCA902374455_01416 | gene | open | 247689-248819 | potD | ||
| 2850 | CABKQF010000003.1 | GCA902374455_01417 | gene | open | 249048-251672 | alaS | ||
| 2851 | CABKQF010000003.1 | GCA902374455_01418 | gene | open | 251743-252051 | |||
| 2852 | CABKQF010000003.1 | GCA902374455_01419 | gene | open | 253705-254553 | |||
| 2853 | CABKQF010000003.1 | GCA902374455_01420 | gene | open | 254731-255336 | |||
| 2854 | CABKQF010000003.1 | GCA902374455_01421 | gene | open | 255607-255984 | |||
| 2855 | CABKQF010000003.1 | GCA902374455_01422 | gene | open | 256830-258458 | uup | ||
| 2856 | CABKQF010000003.1 | GCA902374455_01423 | gene | open | 258557-258751 | |||
| 2857 | CABKQF010000003.1 | GCA902374455_01424 | gene | open | 258774-259232 | |||
| 2858 | CABKQF010000003.1 | GCA902374455_01425 | gene | open | 259298-260017 | trmR | ||
| 2859 | CABKQF010000003.1 | GCA902374455_01426 | gene | open | 260152-261528 | mpl | ||
| 2860 | CABKQF010000003.1 | GCA902374455_01427 | gene | open | 261877-262362 | |||
| 2861 | CABKQF010000003.1 | GCA902374455_01428 | gene | open | 262481-262609 | |||
| 2862 | CABKQF010000003.1 | GCA902374455_01429 | gene | open | 262606-264474 | |||
| 2863 | CABKQF010000003.1 | GCA902374455_01430 | gene | open | 264645-264911 | feoA | ||
| 2864 | CABKQF010000003.1 | GCA902374455_01431 | gene | open | 265228-265854 | nnr1 | ||
| 2865 | CABKQF010000003.1 | GCA902374455_01432 | gene | open | 265886-266248 | crcB | ||
| 2866 | CABKQF010000003.1 | GCA902374455_01433 | gene | open | 266589-267524 | pyrD | ||
| 2867 | CABKQF010000003.1 | GCA902374455_01434 | gene | open | 267872-269014 | purK | ||
| 2868 | CABKQF010000003.1 | GCA902374455_01435 | gene | open | 269121-269603 | |||
| 2869 | CABKQF010000003.1 | GCA902374455_01436 | gene | open | 269685-270305 | |||
| 2870 | CABKQF010000003.1 | GCA902374455_01437 | gene | open | 270436-271803 | glcD | ||
| 2871 | CABKQF010000003.1 | GCA902374455_01438 | gene | open | 272806-273285 | |||
| 2872 | CABKQF010000003.1 | GCA902374455_01439 | gene | open | 273291-273413 | |||
| 2873 | CABKQF010000003.1 | GCA902374455_01440 | gene | open | 273453-274355 | |||
| 2874 | CABKQF010000003.1 | GCA902374455_01441 | gene | open | 274457-275233 | |||
| 2875 | CABKQF010000003.1 | GCA902374455_01442 | gene | open | 275393-276016 | |||
| 2876 | CABKQF010000003.1 | GCA902374455_01443 | gene | open | 276112-277971 | ilvD | ||
| 2877 | CABKQF010000003.1 | GCA902374455_01444 | gene | open | 278364-278789 | |||
| 2878 | CABKQF010000003.1 | GCA902374455_01445 | gene | open | 279235-280065 | |||
| 2879 | CABKQF010000003.1 | GCA902374455_01446 | gene | open | 280146-280535 | ridA | ||
| 2880 | CABKQF010000003.1 | GCA902374455_01447 | gene | open | 280714-281892 | hemW | ||
| 2881 | CABKQF010000003.1 | GCA902374455_01448 | gene | open | 281914-282441 | |||
| 2882 | CABKQF010000003.1 | GCA902374455_01449 | gene | open | 282454-283341 | |||
| 2883 | CABKQF010000003.1 | GCA902374455_01199 | gene | open | 24688-24763 | trnT | ||
| 2884 | CABKQF010000003.1 | GCA902374455_01200 | gene | open | 24800-24875 | trnT | ||
| 2885 | CABKQF010000003.1 | GCA902374455_01262 | gene | open | 81527-81603 | trnP | ||
| 2886 | CABKQF010000003.1 | GCA902374455_01267 | gene | open | 87031-87106 | trnQ | ||
| 2887 | CABKQF010000003.1 | GCA902374455_01268 | gene | open | 87118-87193 | trnQ | ||
| 2888 | CABKQF010000003.1 | GCA902374455_01269 | gene | open | 87205-87280 | trnQ | ||
| 2889 | CABKQF010000003.1 | GCA902374455_01282 | gene | open | 97879-97948 | trnS | ||
| 2890 | CABKQF010000003.1 | GCA902374455_01301 | gene | open | 119885-119961 | trnD | ||
| 2891 | CABKQF010000003.1 | GCA902374455_01302 | gene | open | 119994-120069 | trnV | ||
| 2892 | CABKQF010000003.1 | GCA902374455_01305 | gene | open | 121561-121645 | trnL | ||
| 2893 | CABKQF010000003.1 | GCA902374455_01199 | tRNA | open | 24688-24763 | trnT | tRNA-Thr(tgt) | |
| 2894 | CABKQF010000003.1 | GCA902374455_01200 | tRNA | open | 24800-24875 | trnT | tRNA-Thr(tgt) | |
| 2895 | CABKQF010000003.1 | GCA902374455_01262 | tRNA | open | 81527-81603 | trnP | tRNA-Pro(cgg) | |
| 2896 | CABKQF010000003.1 | GCA902374455_01267 | tRNA | open | 87031-87106 | trnQ | tRNA-Gln(ttg) | |
| 2897 | CABKQF010000003.1 | GCA902374455_01268 | tRNA | open | 87118-87193 | trnQ | tRNA-Gln(ttg) | |
| 2898 | CABKQF010000003.1 | GCA902374455_01269 | tRNA | open | 87205-87280 | trnQ | tRNA-Gln(ttg) | |
| 2899 | CABKQF010000003.1 | GCA902374455_01282 | tRNA | open | 97879-97948 | trnS | tRNA-Ser(cga) | |
| 2900 | CABKQF010000003.1 | GCA902374455_01301 | tRNA | open | 119885-119961 | trnD | tRNA-Asp(gtc) | |
| 2901 | CABKQF010000003.1 | GCA902374455_01302 | tRNA | open | 119994-120069 | trnV | tRNA-Val(tac) | |
| 2902 | CABKQF010000003.1 | GCA902374455_01305 | tRNA | open | 121561-121645 | trnL | tRNA-Leu(tag) | |
| 2903 | CABKQF010000004.1 | GCA902374455_01578 | gene | open | 145850-146212 | ssrA | ||
| 2904 | CABKQF010000004.1 | GCA902374455_01578 | tmRNA | open | 145850-146212 | ssrA | transfer-messenger RNA%2C SsrA | |
| 2905 | CABKQF010000004.1 | repeat_region | open | 134118-134845 | CRISPR array with 11 repeats of length 18%2C consensus sequence GTGGGGCAAGTCTTCCGA and spacer length 51 | |||
| 2906 | CABKQF010000004.1 | repeat_region | open | 135661-136127 | CRISPR array with 7 repeats of length 36%2C consensus sequence GTCTTAATCCCCGATTCGTGGGGCAAGTCTTCCGAC and spacer length 34 | |||
| 2907 | CABKQF010000004.1 | GCA902374455_01450 | CDS | open | 353-697 | _na 114_aa | TonB-dependent receptor | |
| 2908 | CABKQF010000004.1 | GCA902374455_01451 | CDS | open | 1100-2566 | _na 488_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 2909 | CABKQF010000004.1 | GCA902374455_01452 | CDS | open | 2667-3593 | _na 308_aa | Slam-dependent surface lipoprotein | |
| 2910 | CABKQF010000004.1 | GCA902374455_01453 | CDS | open | 3904-4827 | _na 307_aa | TonB-dependent receptor-like beta-barrel domain-containing protein | |
| 2911 | CABKQF010000004.1 | GCA902374455_01454 | CDS | open | 4904-5557 | _na 217_aa | TonB-dependent receptor-like beta-barrel domain-containing protein | |
| 2912 | CABKQF010000004.1 | GCA902374455_01455 | CDS | open | 5554-7197 | _na 547_aa | TonB-dependent receptor plug domain-containing protein | |
| 2913 | CABKQF010000004.1 | GCA902374455_01456 | CDS | open | 7466-8059 | _na 197_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 2914 | CABKQF010000004.1 | GCA902374455_01457 | CDS | open | 8069-8299 | _na 76_aa | YiaA/B two helix domain | |
| 2915 | CABKQF010000004.1 | GCA902374455_01458 | CDS | open | 8456-9346 | _na 296_aa | nadK | NAD(+) kinase |
| 2916 | CABKQF010000004.1 | GCA902374455_01459 | CDS | open | 9368-9940 | _na 190_aa | ubiJ | SCP2 domain-containing protein |
| 2917 | CABKQF010000004.1 | GCA902374455_01460 | CDS | open | 10051-10857 | _na 268_aa | wcaG | NAD-dependent epimerase/dehydratase domain-containing protein |
| 2918 | CABKQF010000004.1 | GCA902374455_01461 | CDS | open | 10905-11549 | _na 214_aa | acrR | TetR family transcriptional regulator |
| 2919 | CABKQF010000004.1 | GCA902374455_01462 | CDS | open | 11567-12607 | _na 346_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 2920 | CABKQF010000004.1 | GCA902374455_01463 | CDS | open | 12842-14278 | _na 478_aa | Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein | |
| 2921 | CABKQF010000004.1 | GCA902374455_01464 | CDS | open | 14427-15806 | _na 459_aa | norM | sodium-coupled multidrug efflux MATE transporter NorM |
| 2922 | CABKQF010000004.1 | GCA902374455_01465 | CDS | open | 15962-17578 | _na 538_aa | dadA | FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC |
| 2923 | CABKQF010000004.1 | GCA902374455_01466 | CDS | open | 17739-19835 | _na 698_aa | Site-specific recombinase | |
| 2924 | CABKQF010000004.1 | GCA902374455_01467 | CDS | open | 19905-20696 | _na 263_aa | nadE | NH(3)-dependent NAD(+) synthetase |
| 2925 | CABKQF010000004.1 | GCA902374455_01468 | CDS | open | 20871-21641 | _na 256_aa | Lipoprotein | |
| 2926 | CABKQF010000004.1 | GCA902374455_01469 | CDS | open | 21798-22565 | _na 255_aa | Lipoprotein | |
| 2927 | CABKQF010000004.1 | GCA902374455_01470 | CDS | open | 22617-23399 | _na 260_aa | Lipoprotein | |
| 2928 | CABKQF010000004.1 | GCA902374455_01471 | CDS | open | 23735-25510 | _na 591_aa | cysJ | assimilatory sulfite reductase (NADPH) flavoprotein subunit |
| 2929 | CABKQF010000004.1 | GCA902374455_01472 | CDS | open | 25803-26726 | _na 307_aa | yddG | aromatic amino acid DMT transporter YddG |
| 2930 | CABKQF010000004.1 | GCA902374455_01473 | CDS | open | 27079-27756 | _na 225_aa | frpC | RTX iron-regulated FrpC family protein |
| 2931 | CABKQF010000004.1 | GCA902374455_01474 | CDS | open | 27955-29298 | _na 447_aa | adhE | Aldehyde dehydrogenase family protein |
| 2932 | CABKQF010000004.1 | GCA902374455_01475 | CDS | open | 29501-30355 | _na 284_aa | Aminomethyltransferase folate-binding domain-containing protein | |
| 2933 | CABKQF010000004.1 | GCA902374455_01476 | CDS | open | 30552-30902 | _na 116_aa | arsC | ArsC family reductase |
| 2934 | CABKQF010000004.1 | GCA902374455_01477 | CDS | open | 31028-32368 | _na 446_aa | ppiD | Periplasmic chaperone PpiD |
| 2935 | CABKQF010000004.1 | GCA902374455_01478 | CDS | open | 32374-32877 | _na 167_aa | Peptidyl-prolyl cis-trans isomerase | |
| 2936 | CABKQF010000004.1 | GCA902374455_01479 | CDS | open | 33074-33679 | _na 201_aa | recR | recombination mediator RecR |
| 2937 | CABKQF010000004.1 | GCA902374455_01480 | CDS | open | 33751-34038 | _na 95_aa | Periplasmic protein | |
| 2938 | CABKQF010000004.1 | GCA902374455_01481 | CDS | open | 34263-35513 | _na 416_aa | lipoprotein-releasing ABC transporter permease subunit | |
| 2939 | CABKQF010000004.1 | GCA902374455_01482 | CDS | open | 35506-36186 | _na 226_aa | lolD | lipoprotein-releasing ABC transporter ATP-binding protein LolD |
| 2940 | CABKQF010000004.1 | GCA902374455_01485 | CDS | open | 37047-37826 | _na 259_aa | yaaA | peroxide stress protein YaaA |
| 2941 | CABKQF010000004.1 | GCA902374455_01486 | CDS | open | 38004-39191 | _na 395_aa | dapC | succinyldiaminopimelate transaminase |
| 2942 | CABKQF010000004.1 | GCA902374455_01487 | CDS | open | 39472-40641 | _na 389_aa | yrpB | Nitronate monooxygenase domain-containing protein |
| 2943 | CABKQF010000004.1 | GCA902374455_01488 | CDS | open | 41368-41835 | _na 155_aa | Sel1 repeat family protein | |
| 2944 | CABKQF010000004.1 | GCA902374455_01489 | CDS | open | 42060-43370 | _na 436_aa | DUF2130 domain-containing protein | |
| 2945 | CABKQF010000004.1 | GCA902374455_01490 | CDS | open | 43501-45270 | _na 589_aa | yddA | ABC superfamily ATP binding cassette transporter%2C membrane protein |
| 2946 | CABKQF010000004.1 | GCA902374455_01491 | CDS | open | 45521-46081 | _na 186_aa | OMR family outer membrane cobalamin receptor | |
| 2947 | CABKQF010000004.1 | GCA902374455_01492 | CDS | open | 46101-47780 | _na 559_aa | OMR family outer membrane cobalamin receptor | |
| 2948 | CABKQF010000004.1 | GCA902374455_01493 | CDS | open | 48097-49677 | _na 526_aa | Sel1 repeat protein | |
| 2949 | CABKQF010000004.1 | GCA902374455_01494 | CDS | open | 49690-50691 | _na 333_aa | hemB | porphobilinogen synthase |
| 2950 | CABKQF010000004.1 | GCA902374455_01495 | CDS | open | 50843-51574 | _na 243_aa | DUF6973 domain-containing protein | |
| 2951 | CABKQF010000004.1 | GCA902374455_01496 | CDS | open | 51770-52609 | _na 279_aa | ybjT | NAD-dependent epimerase/dehydratase domain-containing protein |
| 2952 | CABKQF010000004.1 | GCA902374455_01497 | CDS | open | 52650-53132 | _na 160_aa | DUF2269 domain-containing protein | |
| 2953 | CABKQF010000004.1 | GCA902374455_01498 | CDS | open | 53129-53518 | _na 129_aa | doxX | DoxX family protein |
| 2954 | CABKQF010000004.1 | GCA902374455_01499 | CDS | open | 53609-53968 | _na 119_aa | NADH dehydrogenase | |
| 2955 | CABKQF010000004.1 | GCA902374455_01500 | CDS | open | 54032-54550 | _na 172_aa | gbsR | HTH-type transcriptional regulator |
| 2956 | CABKQF010000004.1 | GCA902374455_01501 | CDS | open | 54681-54941 | _na 86_aa | Thiol-activated cytolysin C-terminal domain-containing protein | |
| 2957 | CABKQF010000004.1 | GCA902374455_01502 | CDS | open | 55439-56254 | _na 271_aa | hpnC | squalene synthase HpnC |
| 2958 | CABKQF010000004.1 | GCA902374455_01503 | CDS | open | 56310-57170 | _na 286_aa | rhaT | Carboxylate/Amino Acid/Amine Transporter |
| 2959 | CABKQF010000004.1 | GCA902374455_01504 | CDS | open | 57300-57833 | _na 177_aa | tetR | TetR family transcriptional regulator |
| 2960 | CABKQF010000004.1 | GCA902374455_01505 | CDS | open | 57921-58427 | _na 168_aa | HPP domain protein | |
| 2961 | CABKQF010000004.1 | GCA902374455_01506 | CDS | open | 58477-59283 | _na 268_aa | Sel1 repeat protein | |
| 2962 | CABKQF010000004.1 | GCA902374455_01507 | CDS | open | 60061-61200 | _na 379_aa | rtcB | RNA ligase RtcB family protein |
| 2963 | CABKQF010000004.1 | GCA902374455_01508 | CDS | open | 61203-61847 | _na 214_aa | prfH | peptide chain release factor H |
| 2964 | CABKQF010000004.1 | GCA902374455_01509 | CDS | open | 62450-62650 | _na 66_aa | protein MIGRI | |
| 2965 | CABKQF010000004.1 | GCA902374455_01510 | CDS | open | 62808-63947 | _na 379_aa | metXS | homoserine O-acetyltransferase |
| 2966 | CABKQF010000004.1 | GCA902374455_01511 | CDS | open | 63944-64525 | _na 193_aa | metW | methionine biosynthesis protein MetW |
| 2967 | CABKQF010000004.1 | GCA902374455_01512 | CDS | open | 64594-65478 | _na 294_aa | NMB0938 family lipoprotein | |
| 2968 | CABKQF010000004.1 | GCA902374455_01513 | CDS | open | 65636-66232 | _na 198_aa | dadA | FAD-binding oxidoreductase |
| 2969 | CABKQF010000004.1 | GCA902374455_01514 | CDS | open | 66253-66720 | _na 155_aa | hypothetical protein | |
| 2970 | CABKQF010000004.1 | GCA902374455_01515 | CDS | open | 67061-67951 | _na 296_aa | potC | Spermidine/putrescine ABC transporter%2C permease protein |
| 2971 | CABKQF010000004.1 | GCA902374455_01516 | CDS | open | 67951-68916 | _na 321_aa | potB | ABC transporter permease%2C polyamine |
| 2972 | CABKQF010000004.1 | GCA902374455_01517 | CDS | open | 68932-70056 | _na 374_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 2973 | CABKQF010000004.1 | GCA902374455_01518 | CDS | open | 70598-71278 | _na 226_aa | radC | DNA repair protein RadC |
| 2974 | CABKQF010000004.1 | GCA902374455_01519 | CDS | open | 71665-74238 | _na 857_aa | clpB | ATP-dependent chaperone ClpB |
| 2975 | CABKQF010000004.1 | GCA902374455_01520 | CDS | open | 74594-75859 | _na 421_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 2976 | CABKQF010000004.1 | GCA902374455_01521 | CDS | open | 75862-76734 | _na 290_aa | rodZ | Cytoskeleton protein RodZ-like C-terminal domain-containing protein |
| 2977 | CABKQF010000004.1 | GCA902374455_01522 | CDS | open | 76739-77494 | _na 251_aa | pilW | type IV pilus biogenesis/stability protein PilW |
| 2978 | CABKQF010000004.1 | GCA902374455_01523 | CDS | open | 77497-78591 | _na 364_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 2979 | CABKQF010000004.1 | GCA902374455_01524 | CDS | open | 78852-79277 | _na 141_aa | ndk | nucleoside-diphosphate kinase |
| 2980 | CABKQF010000004.1 | GCA902374455_01525 | CDS | open | 79396-80532 | _na 378_aa | zapE | cell division protein ZapE |
| 2981 | CABKQF010000004.1 | GCA902374455_01526 | CDS | open | 80887-81201 | _na 104_aa | ihfB | integration host factor subunit beta |
| 2982 | CABKQF010000004.1 | GCA902374455_01527 | CDS | open | 81212-82897 | _na 561_aa | rpsA | 30S ribosomal protein S1 |
| 2983 | CABKQF010000004.1 | GCA902374455_01528 | CDS | open | 83053-83712 | _na 219_aa | cmk | (d)CMP kinase |
| 2984 | CABKQF010000004.1 | GCA902374455_01529 | CDS | open | 84048-85262 | _na 404_aa | Uracil permease | |
| 2985 | CABKQF010000004.1 | GCA902374455_01530 | CDS | open | 85573-85854 | _na 93_aa | hypothetical protein | |
| 2986 | CABKQF010000004.1 | GCA902374455_01531 | CDS | open | 86620-87564 | _na 314_aa | Curved DNA-binding protein | |
| 2987 | CABKQF010000004.1 | GCA902374455_01532 | CDS | open | 87576-87869 | _na 97_aa | merR | MerR family transcriptional regulator |
| 2988 | CABKQF010000004.1 | GCA902374455_01533 | CDS | open | 87938-89695 | _na 585_aa | recD | exodeoxyribonuclease V subunit alpha |
| 2989 | CABKQF010000004.1 | GCA902374455_01534 | CDS | open | 89940-91058 | _na 372_aa | Porin | |
| 2990 | CABKQF010000004.1 | GCA902374455_01535 | CDS | open | 91192-91716 | _na 174_aa | Cysteine-rich CPCC domain-containing protein | |
| 2991 | CABKQF010000004.1 | GCA902374455_01536 | CDS | open | 91902-92975 | _na 357_aa | cysA | Sulfate/thiosulfate import ATP-binding protein CysA |
| 2992 | CABKQF010000004.1 | GCA902374455_01537 | CDS | open | 92972-93832 | _na 286_aa | cysW | sulfate ABC transporter permease subunit CysW |
| 2993 | CABKQF010000004.1 | GCA902374455_01538 | CDS | open | 94095-94931 | _na 278_aa | cysT | sulfate ABC transporter permease subunit CysT |
| 2994 | CABKQF010000004.1 | GCA902374455_01539 | CDS | open | 95106-95534 | _na 142_aa | ATP-dependent DNA helicase Rep | |
| 2995 | CABKQF010000004.1 | GCA902374455_01540 | CDS | open | 95531-97105 | _na 524_aa | DNA 3'-5' helicase | |
| 2996 | CABKQF010000004.1 | GCA902374455_01541 | CDS | open | 98129-98542 | _na 137_aa | Integral membrane protein | |
| 2997 | CABKQF010000004.1 | GCA902374455_01542 | CDS | open | 98705-100180 | _na 491_aa | trpE | anthranilate synthase component I |
| 2998 | CABKQF010000004.1 | GCA902374455_01543 | CDS | open | 100242-100811 | _na 189_aa | RNA 2'-phosphotransferase | |
| 2999 | CABKQF010000004.1 | GCA902374455_01544 | CDS | open | 100862-101176 | _na 104_aa | Lipoprotein | |
| 3000 | CABKQF010000004.1 | GCA902374455_01545 | CDS | open | 101403-102665 | _na 420_aa | ABC superfamily ATP binding cassette transporter%2C ABC protein |

