BAKTAGenome Explorer: Fusobacterium sp. HMT-248 (GCA_902376175.1)
Select a Genome:
|
BAKTA Annotations for GCA_902376175.1
|
Search & Sort all 3434 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CABKWM010000005.1 | GCA902376175_00603 | gene | open | 126273-127163 | pyrB | ||
| 1502 | CABKWM010000005.1 | GCA902376175_00604 | gene | open | 127249-127770 | pyrR | ||
| 1503 | CABKWM010000005.1 | GCA902376175_00605 | gene | open | 128067-128525 | |||
| 1504 | CABKWM010000005.1 | GCA902376175_00606 | gene | open | 129234-130172 | nikB | ||
| 1505 | CABKWM010000005.1 | GCA902376175_00607 | gene | open | 130172-130984 | nikC | ||
| 1506 | CABKWM010000005.1 | GCA902376175_00608 | gene | open | 131020-132570 | |||
| 1507 | CABKWM010000005.1 | GCA902376175_00609 | gene | open | 132583-133362 | |||
| 1508 | CABKWM010000005.1 | GCA902376175_00610 | gene | open | 133379-134143 | |||
| 1509 | CABKWM010000005.1 | GCA902376175_00611 | gene | open | 134317-135069 | yaaA | ||
| 1510 | CABKWM010000005.1 | GCA902376175_00612 | gene | open | 135072-135626 | hutD | ||
| 1511 | CABKWM010000005.1 | GCA902376175_00616 | gene | open | 136086-136937 | |||
| 1512 | CABKWM010000005.1 | GCA902376175_00617 | gene | open | 137225-137401 | |||
| 1513 | CABKWM010000005.1 | GCA902376175_00618 | gene | open | 137668-138846 | |||
| 1514 | CABKWM010000005.1 | GCA902376175_00619 | gene | open | 138904-139329 | nfeD | ||
| 1515 | CABKWM010000005.1 | GCA902376175_00620 | gene | open | 139459-140343 | |||
| 1516 | CABKWM010000005.1 | GCA902376175_00621 | gene | open | 140579-140959 | fadA | ||
| 1517 | CABKWM010000005.1 | GCA902376175_00622 | gene | open | 141128-142483 | |||
| 1518 | CABKWM010000005.1 | GCA902376175_00623 | gene | open | 142712-144070 | trkA | ||
| 1519 | CABKWM010000005.1 | GCA902376175_00624 | gene | open | 144406-144909 | |||
| 1520 | CABKWM010000005.1 | GCA902376175_00625 | gene | open | 144909-145736 | thyA | ||
| 1521 | CABKWM010000005.1 | GCA902376175_00626 | gene | open | 145943-147484 | gltX | ||
| 1522 | CABKWM010000005.1 | GCA902376175_00627 | gene | open | 147700-147945 | |||
| 1523 | CABKWM010000005.1 | GCA902376175_00628 | gene | open | 147964-149202 | |||
| 1524 | CABKWM010000005.1 | GCA902376175_00629 | gene | open | 149532-150575 | |||
| 1525 | CABKWM010000005.1 | GCA902376175_00630 | gene | open | 150604-151056 | yopX | ||
| 1526 | CABKWM010000005.1 | GCA902376175_00631 | gene | open | 151073-151357 | |||
| 1527 | CABKWM010000005.1 | GCA902376175_00632 | gene | open | 151416-152090 | |||
| 1528 | CABKWM010000005.1 | GCA902376175_00633 | gene | open | 152041-152499 | |||
| 1529 | CABKWM010000005.1 | GCA902376175_00634 | gene | open | 152612-153256 | |||
| 1530 | CABKWM010000005.1 | GCA902376175_00635 | gene | open | 153329-154441 | |||
| 1531 | CABKWM010000005.1 | GCA902376175_00636 | gene | open | 154582-155217 | |||
| 1532 | CABKWM010000005.1 | GCA902376175_00637 | gene | open | 155243-155872 | |||
| 1533 | CABKWM010000005.1 | GCA902376175_00638 | gene | open | 156065-157306 | |||
| 1534 | CABKWM010000005.1 | GCA902376175_00639 | gene | open | 157575-158300 | |||
| 1535 | CABKWM010000005.1 | GCA902376175_00640 | gene | open | 158300-159295 | |||
| 1536 | CABKWM010000005.1 | GCA902376175_00641 | gene | open | 159305-159568 | |||
| 1537 | CABKWM010000005.1 | GCA902376175_00642 | gene | open | 159584-160450 | |||
| 1538 | CABKWM010000005.1 | GCA902376175_00643 | gene | open | 160450-161478 | mreB | ||
| 1539 | CABKWM010000005.1 | GCA902376175_00644 | gene | open | 161465-161863 | |||
| 1540 | CABKWM010000005.1 | GCA902376175_00645 | gene | open | 161851-163266 | cysS | ||
| 1541 | CABKWM010000005.1 | GCA902376175_00646 | gene | open | 163288-163989 | |||
| 1542 | CABKWM010000005.1 | GCA902376175_00647 | gene | open | 163965-166301 | mutS2 | ||
| 1543 | CABKWM010000005.1 | GCA902376175_00648 | gene | open | 166609-166878 | |||
| 1544 | CABKWM010000005.1 | GCA902376175_00649 | gene | open | 166891-167721 | eutJ | ||
| 1545 | CABKWM010000005.1 | GCA902376175_00650 | gene | open | 167730-168629 | |||
| 1546 | CABKWM010000005.1 | GCA902376175_00651 | gene | open | 168879-169469 | |||
| 1547 | CABKWM010000005.1 | GCA902376175_00652 | gene | open | 169583-170914 | mgtE | ||
| 1548 | CABKWM010000005.1 | GCA902376175_00653 | gene | open | 170949-172070 | tgt | ||
| 1549 | CABKWM010000005.1 | GCA902376175_00654 | gene | open | 172088-174262 | |||
| 1550 | CABKWM010000005.1 | GCA902376175_00655 | gene | open | 174288-174809 | |||
| 1551 | CABKWM010000005.1 | GCA902376175_00656 | gene | open | 174864-175661 | |||
| 1552 | CABKWM010000005.1 | GCA902376175_00657 | gene | open | 175691-176365 | |||
| 1553 | CABKWM010000005.1 | GCA902376175_00658 | gene | open | 176369-177631 | |||
| 1554 | CABKWM010000005.1 | GCA902376175_00659 | gene | open | 177678-178127 | |||
| 1555 | CABKWM010000005.1 | GCA902376175_00660 | gene | open | 178143-178994 | |||
| 1556 | CABKWM010000005.1 | GCA902376175_00661 | gene | open | 178988-179920 | fmt | ||
| 1557 | CABKWM010000005.1 | GCA902376175_00662 | gene | open | 179938-180387 | nrdR | ||
| 1558 | CABKWM010000005.1 | GCA902376175_00663 | gene | open | 180400-180870 | |||
| 1559 | CABKWM010000005.1 | GCA902376175_00664 | gene | open | 180864-181547 | recO | ||
| 1560 | CABKWM010000005.1 | GCA902376175_00665 | gene | open | 181564-182139 | |||
| 1561 | CABKWM010000005.1 | GCA902376175_00666 | gene | open | 182149-182964 | mreC | ||
| 1562 | CABKWM010000005.1 | GCA902376175_00667 | gene | open | 183133-183801 | |||
| 1563 | CABKWM010000005.1 | GCA902376175_00668 | gene | open | 184032-185213 | |||
| 1564 | CABKWM010000005.1 | GCA902376175_00669 | gene | open | 185229-186749 | abgT | ||
| 1565 | CABKWM010000005.1 | GCA902376175_00670 | gene | open | 186860-188002 | mtnK | ||
| 1566 | CABKWM010000005.1 | GCA902376175_00671 | gene | open | 188014-189063 | |||
| 1567 | CABKWM010000005.1 | GCA902376175_00672 | gene | open | 189086-190381 | nhaC | ||
| 1568 | CABKWM010000005.1 | GCA902376175_00673 | gene | open | 190394-191551 | |||
| 1569 | CABKWM010000005.1 | GCA902376175_00674 | gene | open | 191713-193086 | |||
| 1570 | CABKWM010000005.1 | GCA902376175_00675 | gene | open | 193076-193744 | |||
| 1571 | CABKWM010000005.1 | GCA902376175_00676 | gene | open | 193886-195376 | |||
| 1572 | CABKWM010000005.1 | GCA902376175_00677 | gene | open | 195591-196880 | |||
| 1573 | CABKWM010000005.1 | GCA902376175_00678 | gene | open | 197259-197636 | nifU | ||
| 1574 | CABKWM010000005.1 | GCA902376175_00679 | gene | open | 197699-198874 | nifS | ||
| 1575 | CABKWM010000005.1 | GCA902376175_00680 | gene | open | 198946-199602 | nth | ||
| 1576 | CABKWM010000005.1 | GCA902376175_00681 | gene | open | 199786-200280 | |||
| 1577 | CABKWM010000005.1 | GCA902376175_00682 | gene | open | 200289-201497 | tyrS | ||
| 1578 | CABKWM010000005.1 | GCA902376175_00683 | gene | open | 201562-202842 | brnQ | ||
| 1579 | CABKWM010000005.1 | GCA902376175_00684 | gene | open | 202873-204051 | |||
| 1580 | CABKWM010000005.1 | GCA902376175_00685 | gene | open | 204066-204500 | aroQ | ||
| 1581 | CABKWM010000005.1 | GCA902376175_00686 | gene | open | 204481-205284 | |||
| 1582 | CABKWM010000005.1 | GCA902376175_00687 | gene | open | 205277-205537 | |||
| 1583 | CABKWM010000005.1 | GCA902376175_00688 | gene | open | 205577-206116 | ywqK | ||
| 1584 | CABKWM010000005.1 | GCA902376175_00689 | gene | open | 206407-207342 | |||
| 1585 | CABKWM010000005.1 | GCA902376175_00690 | gene | open | 207365-208195 | |||
| 1586 | CABKWM010000005.1 | GCA902376175_00691 | gene | open | 208202-208978 | |||
| 1587 | CABKWM010000005.1 | GCA902376175_00694 | gene | open | 209727-210188 | ribE | ||
| 1588 | CABKWM010000005.1 | GCA902376175_00695 | gene | open | 210190-211275 | ribD | ||
| 1589 | CABKWM010000005.1 | GCA902376175_00696 | gene | open | 211307-211963 | ribE | ||
| 1590 | CABKWM010000005.1 | GCA902376175_00697 | gene | open | 211972-213171 | |||
| 1591 | CABKWM010000005.1 | GCA902376175_00698 | gene | open | 213202-216006 | ppc | ||
| 1592 | CABKWM010000005.1 | GCA902376175_00699 | gene | open | 216251-216619 | |||
| 1593 | CABKWM010000005.1 | GCA902376175_00700 | gene | open | 216629-216889 | |||
| 1594 | CABKWM010000005.1 | GCA902376175_00712 | gene | open | 218111-218416 | |||
| 1595 | CABKWM010000005.1 | GCA902376175_00713 | gene | open | 218459-219451 | |||
| 1596 | CABKWM010000005.1 | GCA902376175_00714 | gene | open | 219817-220983 | |||
| 1597 | CABKWM010000005.1 | GCA902376175_00715 | gene | open | 221008-221592 | rsxA | ||
| 1598 | CABKWM010000005.1 | GCA902376175_00716 | gene | open | 221589-222206 | rnfE | ||
| 1599 | CABKWM010000005.1 | GCA902376175_00717 | gene | open | 222206-222739 | |||
| 1600 | CABKWM010000005.1 | GCA902376175_00718 | gene | open | 222729-223676 | |||
| 1601 | CABKWM010000005.1 | GCA902376175_00719 | gene | open | 223702-225015 | rsxC | ||
| 1602 | CABKWM010000005.1 | GCA902376175_00720 | gene | open | 225090-225665 | pth | ||
| 1603 | CABKWM010000005.1 | GCA902376175_00721 | gene | open | 225972-227129 | |||
| 1604 | CABKWM010000005.1 | GCA902376175_00722 | gene | open | 227344-228843 | yfcC | ||
| 1605 | CABKWM010000005.1 | GCA902376175_00723 | gene | open | 228997-230568 | |||
| 1606 | CABKWM010000005.1 | GCA902376175_00724 | gene | open | 230668-231432 | |||
| 1607 | CABKWM010000005.1 | GCA902376175_00725 | gene | open | 231742-232107 | ybaN | ||
| 1608 | CABKWM010000005.1 | GCA902376175_00726 | gene | open | 232286-233071 | |||
| 1609 | CABKWM010000005.1 | GCA902376175_00727 | gene | open | 233094-233762 | |||
| 1610 | CABKWM010000005.1 | GCA902376175_00728 | gene | open | 234296-234895 | |||
| 1611 | CABKWM010000005.1 | GCA902376175_00729 | gene | open | 234902-235087 | |||
| 1612 | CABKWM010000005.1 | GCA902376175_00730 | gene | open | 235095-236321 | |||
| 1613 | CABKWM010000005.1 | GCA902376175_00731 | gene | open | 236318-237355 | |||
| 1614 | CABKWM010000005.1 | GCA902376175_00732 | gene | open | 237371-237844 | |||
| 1615 | CABKWM010000005.1 | GCA902376175_00733 | gene | open | 237829-238320 | |||
| 1616 | CABKWM010000005.1 | GCA902376175_00734 | gene | open | 238317-238727 | |||
| 1617 | CABKWM010000005.1 | GCA902376175_00735 | gene | open | 238729-239286 | |||
| 1618 | CABKWM010000005.1 | GCA902376175_00736 | gene | open | 239261-239818 | |||
| 1619 | CABKWM010000005.1 | GCA902376175_00737 | gene | open | 239811-241001 | pilN | ||
| 1620 | CABKWM010000005.1 | GCA902376175_00738 | gene | open | 241011-241769 | |||
| 1621 | CABKWM010000005.1 | GCA902376175_00739 | gene | open | 241766-243334 | |||
| 1622 | CABKWM010000005.1 | GCA902376175_00742 | gene | open | 243944-245116 | dnaJ | ||
| 1623 | CABKWM010000005.1 | GCA902376175_00743 | gene | open | 245162-245674 | |||
| 1624 | CABKWM010000005.1 | GCA902376175_00744 | gene | open | 245810-247633 | dnaK | ||
| 1625 | CABKWM010000005.1 | GCA902376175_00745 | gene | open | 247680-248279 | grpE | ||
| 1626 | CABKWM010000005.1 | GCA902376175_00746 | gene | open | 248295-249308 | hrcA | ||
| 1627 | CABKWM010000005.1 | GCA902376175_00747 | gene | open | 249410-249973 | |||
| 1628 | CABKWM010000005.1 | GCA902376175_00748 | gene | open | 250127-250585 | |||
| 1629 | CABKWM010000005.1 | GCA902376175_00749 | gene | open | 250582-251217 | |||
| 1630 | CABKWM010000005.1 | GCA902376175_00750 | gene | open | 251458-253095 | fhs | ||
| 1631 | CABKWM010000005.1 | GCA902376175_00751 | gene | open | 253447-254145 | yoaK | ||
| 1632 | CABKWM010000005.1 | GCA902376175_00752 | gene | open | 254349-255200 | lolD | ||
| 1633 | CABKWM010000005.1 | GCA902376175_00753 | gene | open | 255264-255959 | hypB | ||
| 1634 | CABKWM010000005.1 | GCA902376175_00754 | gene | open | 255959-257131 | |||
| 1635 | CABKWM010000005.1 | GCA902376175_00760 | gene | open | 262855-264366 | yfcC | ||
| 1636 | CABKWM010000005.1 | GCA902376175_00761 | gene | open | 264737-265012 | |||
| 1637 | CABKWM010000005.1 | GCA902376175_00762 | gene | open | 265028-265894 | ispE | ||
| 1638 | CABKWM010000005.1 | GCA902376175_00763 | gene | open | 265887-266186 | |||
| 1639 | CABKWM010000005.1 | GCA902376175_00764 | gene | open | 266308-269250 | mfd | ||
| 1640 | CABKWM010000005.1 | GCA902376175_00765 | gene | open | 269362-269838 | |||
| 1641 | CABKWM010000005.1 | GCA902376175_00766 | gene | open | 270031-270540 | |||
| 1642 | CABKWM010000005.1 | GCA902376175_00767 | gene | open | 270554-272437 | mnmG | ||
| 1643 | CABKWM010000005.1 | GCA902376175_00768 | gene | open | 272467-273837 | mnmE | ||
| 1644 | CABKWM010000005.1 | GCA902376175_00769 | gene | open | 273847-274596 | |||
| 1645 | CABKWM010000005.1 | GCA902376175_00770 | gene | open | 274599-275216 | |||
| 1646 | CABKWM010000005.1 | GCA902376175_00771 | gene | open | 275216-275461 | yidD | ||
| 1647 | CABKWM010000005.1 | GCA902376175_00772 | gene | open | 275458-275814 | rnpA | ||
| 1648 | CABKWM010000005.1 | GCA902376175_00773 | gene | open | 275874-276008 | rpmH | ||
| 1649 | CABKWM010000005.1 | GCA902376175_00774 | gene | open | 276687-278585 | |||
| 1650 | CABKWM010000005.1 | GCA902376175_00775 | gene | open | 278609-280171 | |||
| 1651 | CABKWM010000005.1 | GCA902376175_00776 | gene | open | 280182-281612 | |||
| 1652 | CABKWM010000005.1 | GCA902376175_00777 | gene | open | 282224-283435 | |||
| 1653 | CABKWM010000005.1 | GCA902376175_00778 | gene | open | 283521-284054 | |||
| 1654 | CABKWM010000005.1 | GCA902376175_00779 | gene | open | 284291-285553 | |||
| 1655 | CABKWM010000005.1 | GCA902376175_00780 | gene | open | 285550-286056 | rloB | ||
| 1656 | CABKWM010000005.1 | GCA902376175_00781 | gene | open | 286166-289216 | |||
| 1657 | CABKWM010000005.1 | GCA902376175_00782 | gene | open | 289323-289700 | ridA | ||
| 1658 | CABKWM010000005.1 | GCA902376175_00783 | gene | open | 290044-290259 | |||
| 1659 | CABKWM010000005.1 | GCA902376175_00784 | gene | open | 290286-291383 | recF | ||
| 1660 | CABKWM010000005.1 | GCA902376175_00785 | gene | open | 291380-291661 | |||
| 1661 | CABKWM010000005.1 | GCA902376175_00786 | gene | open | 291688-293595 | gyrB | ||
| 1662 | CABKWM010000005.1 | GCA902376175_00787 | gene | open | 293668-296106 | gyrA | ||
| 1663 | CABKWM010000005.1 | GCA902376175_00788 | gene | open | 296120-296581 | yfcE | ||
| 1664 | CABKWM010000005.1 | GCA902376175_00789 | gene | open | 296599-297615 | pheS | ||
| 1665 | CABKWM010000005.1 | GCA902376175_00790 | gene | open | 297743-300139 | pheT | ||
| 1666 | CABKWM010000005.1 | GCA902376175_00791 | gene | open | 300245-300730 | |||
| 1667 | CABKWM010000005.1 | GCA902376175_00792 | gene | open | 301073-301639 | ahpC | ||
| 1668 | CABKWM010000005.1 | GCA902376175_00793 | gene | open | 301873-303510 | |||
| 1669 | CABKWM010000005.1 | GCA902376175_00794 | gene | open | 303953-304849 | nadA | ||
| 1670 | CABKWM010000005.1 | GCA902376175_00795 | gene | open | 304851-306143 | |||
| 1671 | CABKWM010000005.1 | GCA902376175_00796 | gene | open | 306121-306981 | nadC | ||
| 1672 | CABKWM010000005.1 | GCA902376175_00797 | gene | open | 306974-307483 | nadR | ||
| 1673 | CABKWM010000005.1 | GCA902376175_00798 | gene | open | 307558-308724 | |||
| 1674 | CABKWM010000005.1 | GCA902376175_00799 | gene | open | 308737-309726 | galE | ||
| 1675 | CABKWM010000005.1 | GCA902376175_00800 | gene | open | 309728-311260 | galT | ||
| 1676 | CABKWM010000005.1 | GCA902376175_00801 | gene | open | 311303-312469 | |||
| 1677 | CABKWM010000005.1 | GCA902376175_00802 | gene | open | 312682-313551 | ywqK | ||
| 1678 | CABKWM010000005.1 | GCA902376175_00803 | gene | open | 314100-315479 | |||
| 1679 | CABKWM010000005.1 | GCA902376175_00804 | gene | open | 315626-316279 | |||
| 1680 | CABKWM010000005.1 | GCA902376175_00805 | gene | open | 316294-316947 | atoA | ||
| 1681 | CABKWM010000005.1 | GCA902376175_00806 | gene | open | 316951-317604 | |||
| 1682 | CABKWM010000005.1 | GCA902376175_00807 | gene | open | 317764-319227 | |||
| 1683 | CABKWM010000005.1 | GCA902376175_00808 | gene | open | 319667-320614 | |||
| 1684 | CABKWM010000005.1 | GCA902376175_00809 | gene | open | 320814-321317 | |||
| 1685 | CABKWM010000005.1 | GCA902376175_00810 | gene | open | 321867-323921 | |||
| 1686 | CABKWM010000005.1 | GCA902376175_00811 | gene | open | 324327-325901 | |||
| 1687 | CABKWM010000005.1 | GCA902376175_00812 | gene | open | 325925-327271 | trkH | ||
| 1688 | CABKWM010000005.1 | GCA902376175_00813 | gene | open | 327281-327937 | trkA | ||
| 1689 | CABKWM010000005.1 | GCA902376175_00814 | gene | open | 327946-329847 | mnmG | ||
| 1690 | CABKWM010000005.1 | GCA902376175_00815 | gene | open | 329844-330542 | rsmG | ||
| 1691 | CABKWM010000005.1 | GCA902376175_00816 | gene | open | 330544-331344 | |||
| 1692 | CABKWM010000005.1 | GCA902376175_00817 | gene | open | 331479-331928 | |||
| 1693 | CABKWM010000005.1 | GCA902376175_00818 | gene | open | 332147-332458 | rpsJ | ||
| 1694 | CABKWM010000005.1 | GCA902376175_00819 | gene | open | 332605-333240 | rplC | ||
| 1695 | CABKWM010000005.1 | GCA902376175_00820 | gene | open | 333260-333892 | rplD | ||
| 1696 | CABKWM010000005.1 | GCA902376175_00821 | gene | open | 333892-334179 | rplW | ||
| 1697 | CABKWM010000005.1 | GCA902376175_00822 | gene | open | 334219-335049 | rplB | ||
| 1698 | CABKWM010000005.1 | GCA902376175_00823 | gene | open | 335074-335349 | rpsS | ||
| 1699 | CABKWM010000005.1 | GCA902376175_00824 | gene | open | 335383-335715 | rplV | ||
| 1700 | CABKWM010000005.1 | GCA902376175_00825 | gene | open | 335734-336393 | rpsC | ||
| 1701 | CABKWM010000005.1 | GCA902376175_00826 | gene | open | 336396-336821 | rplP | ||
| 1702 | CABKWM010000005.1 | GCA902376175_00827 | gene | open | 336821-337003 | rpmC | ||
| 1703 | CABKWM010000005.1 | GCA902376175_00828 | gene | open | 337059-337310 | rpsQ | ||
| 1704 | CABKWM010000005.1 | GCA902376175_00829 | gene | open | 337339-337707 | rplN | ||
| 1705 | CABKWM010000005.1 | GCA902376175_00830 | gene | open | 337732-338073 | rplX | ||
| 1706 | CABKWM010000005.1 | GCA902376175_00831 | gene | open | 338092-338643 | rplE | ||
| 1707 | CABKWM010000005.1 | GCA902376175_00832 | gene | open | 338664-338951 | rpsN | ||
| 1708 | CABKWM010000005.1 | GCA902376175_00833 | gene | open | 338981-339379 | rpsH | ||
| 1709 | CABKWM010000005.1 | GCA902376175_00834 | gene | open | 339404-339937 | rplF | ||
| 1710 | CABKWM010000005.1 | GCA902376175_00835 | gene | open | 339964-340332 | rplR | ||
| 1711 | CABKWM010000005.1 | GCA902376175_00836 | gene | open | 340356-340850 | rpsE | ||
| 1712 | CABKWM010000005.1 | GCA902376175_00837 | gene | open | 340864-341049 | rpmD | ||
| 1713 | CABKWM010000005.1 | GCA902376175_00838 | gene | open | 341049-341528 | rplO | ||
| 1714 | CABKWM010000005.1 | GCA902376175_00839 | gene | open | 341553-342833 | secY | ||
| 1715 | CABKWM010000005.1 | GCA902376175_00840 | gene | open | 343072-344562 | |||
| 1716 | CABKWM010000005.1 | GCA902376175_00841 | gene | open | 344572-345486 | |||
| 1717 | CABKWM010000005.1 | GCA902376175_00842 | gene | open | 345499-347400 | abc-f | ||
| 1718 | CABKWM010000005.1 | GCA902376175_00843 | gene | open | 347542-348516 | tctC | ||
| 1719 | CABKWM010000005.1 | GCA902376175_00844 | gene | open | 348846-349280 | tctB | ||
| 1720 | CABKWM010000005.1 | GCA902376175_00845 | gene | open | 349298-350782 | |||
| 1721 | CABKWM010000005.1 | GCA902376175_00846 | gene | open | 350942-351949 | ilvC | ||
| 1722 | CABKWM010000005.1 | GCA902376175_00847 | gene | open | 352092-352877 | |||
| 1723 | CABKWM010000005.1 | GCA902376175_00848 | gene | open | 352886-353944 | leuB | ||
| 1724 | CABKWM010000005.1 | GCA902376175_00849 | gene | open | 354144-354719 | |||
| 1725 | CABKWM010000005.1 | GCA902376175_00850 | gene | open | 354719-356110 | |||
| 1726 | CABKWM010000005.1 | GCA902376175_00851 | gene | open | 356121-357629 | |||
| 1727 | CABKWM010000005.1 | GCA902376175_00852 | gene | open | 357649-358137 | ilvN | ||
| 1728 | CABKWM010000005.1 | GCA902376175_00853 | gene | open | 358130-359848 | ilvB | ||
| 1729 | CABKWM010000005.1 | GCA902376175_00854 | gene | open | 359869-361080 | ilvA | ||
| 1730 | CABKWM010000005.1 | GCA902376175_00855 | gene | open | 361157-362818 | ilvD | ||
| 1731 | CABKWM010000005.1 | GCA902376175_00856 | gene | open | 363066-363182 | |||
| 1732 | CABKWM010000005.1 | GCA902376175_00857 | gene | open | 363429-364187 | |||
| 1733 | CABKWM010000005.1 | GCA902376175_00858 | gene | open | 364353-365249 | |||
| 1734 | CABKWM010000005.1 | GCA902376175_00859 | gene | open | 365480-366388 | |||
| 1735 | CABKWM010000005.1 | GCA902376175_00860 | gene | open | 366401-367495 | |||
| 1736 | CABKWM010000005.1 | GCA902376175_00861 | gene | open | 367492-368349 | |||
| 1737 | CABKWM010000005.1 | GCA902376175_00862 | gene | open | 368360-369076 | rfaY | ||
| 1738 | CABKWM010000005.1 | GCA902376175_00863 | gene | open | 369077-369745 | |||
| 1739 | CABKWM010000005.1 | GCA902376175_00864 | gene | open | 369738-370496 | |||
| 1740 | CABKWM010000005.1 | GCA902376175_00865 | gene | open | 370521-371711 | |||
| 1741 | CABKWM010000005.1 | GCA902376175_00866 | gene | open | 371713-372783 | |||
| 1742 | CABKWM010000005.1 | GCA902376175_00867 | gene | open | 372777-373967 | |||
| 1743 | CABKWM010000005.1 | GCA902376175_00868 | gene | open | 374053-374409 | |||
| 1744 | CABKWM010000005.1 | GCA902376175_00869 | gene | open | 374712-375008 | |||
| 1745 | CABKWM010000005.1 | GCA902376175_00870 | gene | open | 375261-378089 | |||
| 1746 | CABKWM010000005.1 | GCA902376175_00871 | gene | open | 378303-379718 | |||
| 1747 | CABKWM010000005.1 | GCA902376175_00872 | gene | open | 379787-380701 | glsA | ||
| 1748 | CABKWM010000005.1 | GCA902376175_00873 | gene | open | 381228-381779 | rnmV | ||
| 1749 | CABKWM010000005.1 | GCA902376175_00874 | gene | open | 381789-383177 | asnS | ||
| 1750 | CABKWM010000005.1 | GCA902376175_00875 | gene | open | 383189-383377 | |||
| 1751 | CABKWM010000005.1 | GCA902376175_00876 | gene | open | 383430-384683 | |||
| 1752 | CABKWM010000005.1 | GCA902376175_00877 | gene | open | 384878-386116 | |||
| 1753 | CABKWM010000005.1 | GCA902376175_00878 | gene | open | 386558-387790 | |||
| 1754 | CABKWM010000005.1 | GCA902376175_00879 | gene | open | 387973-389562 | |||
| 1755 | CABKWM010000005.1 | GCA902376175_00880 | gene | open | 389555-390583 | |||
| 1756 | CABKWM010000005.1 | GCA902376175_00881 | gene | open | 390576-391658 | |||
| 1757 | CABKWM010000005.1 | GCA902376175_00882 | gene | open | 391676-391975 | |||
| 1758 | CABKWM010000005.1 | GCA902376175_00883 | gene | open | 392006-392791 | |||
| 1759 | CABKWM010000005.1 | GCA902376175_00884 | gene | open | 393084-393629 | hpf | ||
| 1760 | CABKWM010000005.1 | GCA902376175_00885 | gene | open | 393914-394969 | corA | ||
| 1761 | CABKWM010000005.1 | GCA902376175_00886 | gene | open | 395258-395824 | |||
| 1762 | CABKWM010000005.1 | GCA902376175_00887 | gene | open | 395855-397060 | |||
| 1763 | CABKWM010000005.1 | GCA902376175_00888 | gene | open | 397108-398538 | |||
| 1764 | CABKWM010000005.1 | GCA902376175_00889 | gene | open | 398726-399265 | |||
| 1765 | CABKWM010000005.1 | GCA902376175_00890 | gene | open | 399354-400631 | |||
| 1766 | CABKWM010000005.1 | GCA902376175_00891 | gene | open | 400803-401048 | |||
| 1767 | CABKWM010000005.1 | GCA902376175_00892 | gene | open | 402333-402779 | |||
| 1768 | CABKWM010000005.1 | GCA902376175_00893 | gene | open | 403028-403966 | ywqK | ||
| 1769 | CABKWM010000005.1 | GCA902376175_00894 | gene | open | 404038-404718 | |||
| 1770 | CABKWM010000005.1 | GCA902376175_00895 | gene | open | 405143-405409 | |||
| 1771 | CABKWM010000005.1 | GCA902376175_00896 | gene | open | 405409-405675 | |||
| 1772 | CABKWM010000005.1 | GCA902376175_00897 | gene | open | 406194-407420 | ywqK | ||
| 1773 | CABKWM010000005.1 | GCA902376175_00898 | gene | open | 407442-407531 | |||
| 1774 | CABKWM010000005.1 | GCA902376175_00899 | gene | open | 407865-408194 | |||
| 1775 | CABKWM010000005.1 | GCA902376175_00900 | gene | open | 408296-409567 | serS | ||
| 1776 | CABKWM010000005.1 | GCA902376175_00901 | gene | open | 409698-410036 | |||
| 1777 | CABKWM010000005.1 | GCA902376175_00902 | gene | open | 410066-414610 | ubiD | ||
| 1778 | CABKWM010000005.1 | GCA902376175_00903 | gene | open | 414708-416813 | |||
| 1779 | CABKWM010000005.1 | GCA902376175_00904 | gene | open | 416849-417325 | ompH | ||
| 1780 | CABKWM010000005.1 | GCA902376175_00905 | gene | open | 417351-418346 | lpxD | ||
| 1781 | CABKWM010000005.1 | GCA902376175_00906 | gene | open | 418672-420516 | |||
| 1782 | CABKWM010000005.1 | GCA902376175_00580 | gene | open | 103547-103622 | trnW | ||
| 1783 | CABKWM010000005.1 | GCA902376175_00613 | gene | open | 135760-135844 | trnY | ||
| 1784 | CABKWM010000005.1 | GCA902376175_00614 | gene | open | 135861-135935 | trnE | ||
| 1785 | CABKWM010000005.1 | GCA902376175_00615 | gene | open | 135938-136013 | trnT | ||
| 1786 | CABKWM010000005.1 | GCA902376175_00692 | gene | open | 209013-209087 | trnQ | ||
| 1787 | CABKWM010000005.1 | GCA902376175_00693 | gene | open | 209095-209171 | trnP | ||
| 1788 | CABKWM010000005.1 | GCA902376175_00701 | gene | open | 217066-217142 | trnD | ||
| 1789 | CABKWM010000005.1 | GCA902376175_00702 | gene | open | 217154-217229 | trnV | ||
| 1790 | CABKWM010000005.1 | GCA902376175_00703 | gene | open | 217235-217310 | trnF | ||
| 1791 | CABKWM010000005.1 | GCA902376175_00704 | gene | open | 217321-217404 | trnS | ||
| 1792 | CABKWM010000005.1 | GCA902376175_00705 | gene | open | 217406-217480 | trnE | ||
| 1793 | CABKWM010000005.1 | GCA902376175_00706 | gene | open | 217498-217575 | trnI | ||
| 1794 | CABKWM010000005.1 | GCA902376175_00707 | gene | open | 217583-217659 | trnR | ||
| 1795 | CABKWM010000005.1 | GCA902376175_00708 | gene | open | 217668-217743 | trnK | ||
| 1796 | CABKWM010000005.1 | GCA902376175_00709 | gene | open | 217754-217829 | trnG | ||
| 1797 | CABKWM010000005.1 | GCA902376175_00710 | gene | open | 217852-217928 | trnfM | ||
| 1798 | CABKWM010000005.1 | GCA902376175_00711 | gene | open | 217939-218026 | trnL | ||
| 1799 | CABKWM010000005.1 | GCA902376175_00757 | gene | open | 260708-260784 | trnA | ||
| 1800 | CABKWM010000005.1 | GCA902376175_00758 | gene | open | 260788-260864 | trnI | ||
| 1801 | CABKWM010000005.1 | GCA902376175_00580 | tRNA | open | 103547-103622 | trnW | tRNA-Trp(cca) | |
| 1802 | CABKWM010000005.1 | GCA902376175_00613 | tRNA | open | 135760-135844 | trnY | tRNA-Tyr(gta) | |
| 1803 | CABKWM010000005.1 | GCA902376175_00614 | tRNA | open | 135861-135935 | trnE | tRNA-Glu(ttc) | |
| 1804 | CABKWM010000005.1 | GCA902376175_00615 | tRNA | open | 135938-136013 | trnT | tRNA-Thr(tgt) | |
| 1805 | CABKWM010000005.1 | GCA902376175_00692 | tRNA | open | 209013-209087 | trnQ | tRNA-Gln(ttg) | |
| 1806 | CABKWM010000005.1 | GCA902376175_00693 | tRNA | open | 209095-209171 | trnP | tRNA-Pro(tgg) | |
| 1807 | CABKWM010000005.1 | GCA902376175_00701 | tRNA | open | 217066-217142 | trnD | tRNA-Asp(gtc) | |
| 1808 | CABKWM010000005.1 | GCA902376175_00702 | tRNA | open | 217154-217229 | trnV | tRNA-Val(tac) | |
| 1809 | CABKWM010000005.1 | GCA902376175_00703 | tRNA | open | 217235-217310 | trnF | tRNA-Phe(gaa) | |
| 1810 | CABKWM010000005.1 | GCA902376175_00704 | tRNA | open | 217321-217404 | trnS | tRNA-Ser(tga) | |
| 1811 | CABKWM010000005.1 | GCA902376175_00705 | tRNA | open | 217406-217480 | trnE | tRNA-Glu(ttc) | |
| 1812 | CABKWM010000005.1 | GCA902376175_00706 | tRNA | open | 217498-217575 | trnI | tRNA-Ile2(cat) | |
| 1813 | CABKWM010000005.1 | GCA902376175_00707 | tRNA | open | 217583-217659 | trnR | tRNA-Arg(tct) | |
| 1814 | CABKWM010000005.1 | GCA902376175_00708 | tRNA | open | 217668-217743 | trnK | tRNA-Lys(ttt) | |
| 1815 | CABKWM010000005.1 | GCA902376175_00709 | tRNA | open | 217754-217829 | trnG | tRNA-Gly(tcc) | |
| 1816 | CABKWM010000005.1 | GCA902376175_00710 | tRNA | open | 217852-217928 | trnfM | tRNA-fMet(cat) | |
| 1817 | CABKWM010000005.1 | GCA902376175_00711 | tRNA | open | 217939-218026 | trnL | tRNA-Leu(taa) | |
| 1818 | CABKWM010000005.1 | GCA902376175_00757 | tRNA | open | 260708-260784 | trnA | tRNA-Ala(tgc) | |
| 1819 | CABKWM010000005.1 | GCA902376175_00758 | tRNA | open | 260788-260864 | trnI | tRNA-Ile(gat) | |
| 1820 | CABKWM010000006.1 | GCA902376175_00907 | gene | open | 11-127 | rrf | ||
| 1821 | CABKWM010000006.1 | GCA902376175_00965 | gene | open | 67582-67634 | 6A | ||
| 1822 | CABKWM010000006.1 | GCA902376175_01709 | gene | open | 880908-881024 | rrf | ||
| 1823 | CABKWM010000006.1 | GCA902376175_01710 | gene | open | 881091-884001 | rrl | ||
| 1824 | CABKWM010000006.1 | GCA902376175_00965 | ncRNA | open | 67582-67634 | 6A RNA | ||
| 1825 | CABKWM010000006.1 | regulatory_region | open | 249190-249275 | SAM riboswitch aptamer (S box leader) | |||
| 1826 | CABKWM010000006.1 | regulatory_region | open | 405254-405352 | Purine riboswitch aptamer | |||
| 1827 | CABKWM010000006.1 | regulatory_region | open | 743506-743680 | Lysine riboswitch aptamer | |||
| 1828 | CABKWM010000006.1 | regulatory_region | open | 752412-752593 | Lysine riboswitch aptamer | |||
| 1829 | CABKWM010000006.1 | regulatory_region | open | 854700-854762 | S4-Fusobacteriales ribosomal protein leader | |||
| 1830 | CABKWM010000006.1 | regulatory_region | open | 880555-880660 | TPP riboswitch aptamer (THI element) | |||
| 1831 | CABKWM010000006.1 | GCA902376175_00907 | rRNA | open | 11-127 | rrf | 5S ribosomal RNA | |
| 1832 | CABKWM010000006.1 | GCA902376175_01709 | rRNA | open | 880908-881024 | rrf | 5S ribosomal RNA | |
| 1833 | CABKWM010000006.1 | GCA902376175_01710 | rRNA | open | 881091-884001 | rrl | 23S ribosomal RNA | |
| 1834 | CABKWM010000006.1 | repeat_region | open | 508868-510294 | CRISPR array with 22 repeats of length 29%2C consensus sequence TTTAAATTCCAATATGGTTTTACATAAAT and spacer length 37 | |||
| 1835 | CABKWM010000006.1 | GCA902376175_00909 | CDS | open | 337-1875 | _na 512_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1836 | CABKWM010000006.1 | GCA902376175_00910 | CDS | open | 2258-3265 | _na 335_aa | ldhA | 4-phosphoerythronate dehydrogenase |
| 1837 | CABKWM010000006.1 | GCA902376175_00911 | CDS | open | 3652-4929 | _na 425_aa | gdhA | Glutamate dehydrogenase |
| 1838 | CABKWM010000006.1 | GCA902376175_00912 | CDS | open | 5170-6090 | _na 306_aa | TIGR01212 family radical SAM protein | |
| 1839 | CABKWM010000006.1 | GCA902376175_00913 | CDS | open | 6122-6940 | _na 272_aa | nagB | glucosamine-6-phosphate deaminase |
| 1840 | CABKWM010000006.1 | GCA902376175_00914 | CDS | open | 7003-7416 | _na 137_aa | glmS | methylaspartate mutase subunit S |
| 1841 | CABKWM010000006.1 | GCA902376175_00915 | CDS | open | 7423-8829 | _na 468_aa | glmL | methylaspartate mutase accessory protein GlmL |
| 1842 | CABKWM010000006.1 | GCA902376175_00916 | CDS | open | 8840-10291 | _na 483_aa | methylaspartate mutase subunit E | |
| 1843 | CABKWM010000006.1 | GCA902376175_00917 | CDS | open | 10487-11401 | _na 304_aa | branched-chain amino acid transaminase | |
| 1844 | CABKWM010000006.1 | GCA902376175_00918 | CDS | open | 11923-12642 | _na 239_aa | NAD-dependent protein deacylase | |
| 1845 | CABKWM010000006.1 | GCA902376175_00919 | CDS | open | 12897-14360 | _na 487_aa | guaB | IMP dehydrogenase |
| 1846 | CABKWM010000006.1 | GCA902376175_00920 | CDS | open | 14375-15199 | _na 274_aa | ywqK | toxin-antitoxin system YwqK family antitoxin |
| 1847 | CABKWM010000006.1 | GCA902376175_00921 | CDS | open | 15201-15623 | _na 140_aa | HD domain-containing protein | |
| 1848 | CABKWM010000006.1 | GCA902376175_00922 | CDS | open | 15783-16184 | _na 133_aa | fadA | adhesion protein FadA |
| 1849 | CABKWM010000006.1 | GCA902376175_00923 | CDS | open | 16218-16844 | _na 208_aa | hypothetical protein | |
| 1850 | CABKWM010000006.1 | GCA902376175_00924 | CDS | open | 16860-17456 | _na 198_aa | FAD-I family protein | |
| 1851 | CABKWM010000006.1 | GCA902376175_00925 | CDS | open | 17458-17715 | _na 85_aa | Lipoprotein | |
| 1852 | CABKWM010000006.1 | GCA902376175_00926 | CDS | open | 17676-18215 | _na 179_aa | ompA | OmpA family protein |
| 1853 | CABKWM010000006.1 | GCA902376175_00927 | CDS | open | 18234-25739 | _na 2501_aa | autotransporter-associated N-terminal domain-containing protein | |
| 1854 | CABKWM010000006.1 | GCA902376175_00928 | CDS | open | 26034-26708 | _na 224_aa | uracil-DNA glycosylase | |
| 1855 | CABKWM010000006.1 | GCA902376175_00929 | CDS | open | 26724-28181 | _na 485_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 1856 | CABKWM010000006.1 | GCA902376175_00930 | CDS | open | 28171-29007 | _na 278_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 1857 | CABKWM010000006.1 | GCA902376175_00931 | CDS | open | 29628-31334 | _na 568_aa | argS | arginine--tRNA ligase |
| 1858 | CABKWM010000006.1 | GCA902376175_00932 | CDS | open | 31740-33098 | _na 452_aa | gntT | Gluconate:H+ symporter (GntP) family transporter |
| 1859 | CABKWM010000006.1 | GCA902376175_00933 | CDS | open | 33115-34113 | _na 332_aa | pdxA | 4-hydroxythreonine-4-phosphate dehydrogenase PdxA |
| 1860 | CABKWM010000006.1 | GCA902376175_00934 | CDS | open | 34138-35415 | _na 425_aa | otnK | Four-carbon acid sugar kinase family protein |
| 1861 | CABKWM010000006.1 | GCA902376175_00935 | CDS | open | 35431-36198 | _na 255_aa | glpR | HTH deoR-type domain-containing protein |
| 1862 | CABKWM010000006.1 | GCA902376175_00936 | CDS | open | 36910-38289 | _na 459_aa | NAD(P)/FAD-dependent oxidoreductase | |
| 1863 | CABKWM010000006.1 | GCA902376175_00937 | CDS | open | 38443-38775 | _na 110_aa | helix-turn-helix domain-containing protein | |
| 1864 | CABKWM010000006.1 | GCA902376175_00938 | CDS | open | 38985-39956 | _na 323_aa | SIS domain-containing protein | |
| 1865 | CABKWM010000006.1 | GCA902376175_00939 | CDS | open | 39967-40506 | _na 179_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 1866 | CABKWM010000006.1 | GCA902376175_00940 | CDS | open | 40499-41086 | _na 195_aa | uracil-DNA glycosylase family protein | |
| 1867 | CABKWM010000006.1 | GCA902376175_00941 | CDS | open | 41095-41877 | _na 260_aa | MBL fold metallo-hydrolase | |
| 1868 | CABKWM010000006.1 | GCA902376175_00942 | CDS | open | 41874-42593 | _na 239_aa | SDR family oxidoreductase | |
| 1869 | CABKWM010000006.1 | GCA902376175_00943 | CDS | open | 42695-44575 | _na 626_aa | spore photoproduct lyase family protein | |
| 1870 | CABKWM010000006.1 | GCA902376175_00944 | CDS | open | 44932-45609 | _na 225_aa | TetR/AcrR family transcriptional regulator | |
| 1871 | CABKWM010000006.1 | GCA902376175_00945 | CDS | open | 45629-46903 | _na 424_aa | tolC | TolC family protein |
| 1872 | CABKWM010000006.1 | GCA902376175_00946 | CDS | open | 46932-47999 | _na 355_aa | efflux RND transporter periplasmic adaptor subunit | |
| 1873 | CABKWM010000006.1 | GCA902376175_00947 | CDS | open | 47999-51070 | _na 1023_aa | efflux RND transporter permease subunit | |
| 1874 | CABKWM010000006.1 | GCA902376175_00948 | CDS | open | 51063-51470 | _na 135_aa | hypothetical protein | |
| 1875 | CABKWM010000006.1 | GCA902376175_00949 | CDS | open | 51775-53709 | _na 644_aa | glycogen-debranching protein | |
| 1876 | CABKWM010000006.1 | GCA902376175_00950 | CDS | open | 54118-54924 | _na 268_aa | hypothetical protein | |
| 1877 | CABKWM010000006.1 | GCA902376175_00951 | CDS | open | 54926-55504 | _na 192_aa | nucleoside triphosphate pyrophosphatase | |
| 1878 | CABKWM010000006.1 | GCA902376175_00952 | CDS | open | 55525-56580 | _na 351_aa | rod shape-determining protein | |
| 1879 | CABKWM010000006.1 | GCA902376175_00953 | CDS | open | 56598-57143 | _na 181_aa | scpB | SMC-Scp complex subunit ScpB |
| 1880 | CABKWM010000006.1 | GCA902376175_00954 | CDS | open | 57133-57837 | _na 234_aa | pseudouridine synthase | |
| 1881 | CABKWM010000006.1 | GCA902376175_00955 | CDS | open | 57847-58137 | _na 96_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 1882 | CABKWM010000006.1 | GCA902376175_00956 | CDS | open | 58146-59606 | _na 486_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 1883 | CABKWM010000006.1 | GCA902376175_00957 | CDS | open | 59621-61066 | _na 481_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 1884 | CABKWM010000006.1 | GCA902376175_00958 | CDS | open | 61394-62353 | _na 319_aa | pip | prolyl aminopeptidase |
| 1885 | CABKWM010000006.1 | GCA902376175_00959 | CDS | open | 62343-63353 | _na 336_aa | asparaginase | |
| 1886 | CABKWM010000006.1 | GCA902376175_00960 | CDS | open | 63366-64049 | _na 227_aa | substrate-binding domain-containing protein | |
| 1887 | CABKWM010000006.1 | GCA902376175_00961 | CDS | open | 64075-65181 | _na 368_aa | murein L%2CD-transpeptidase catalytic domain family protein | |
| 1888 | CABKWM010000006.1 | GCA902376175_00962 | CDS | open | 65272-66045 | _na 257_aa | gamma-glutamyl-gamma-aminobutyrate hydrolase family protein | |
| 1889 | CABKWM010000006.1 | GCA902376175_00963 | CDS | open | 66077-66706 | _na 209_aa | Crp/Fnr family transcriptional regulator | |
| 1890 | CABKWM010000006.1 | GCA902376175_00964 | CDS | open | 66959-67396 | _na 145_aa | tenpIN | type III toxin-antitoxin system TenpIN family toxin |
| 1891 | CABKWM010000006.1 | GCA902376175_00966 | CDS | open | 68024-68773 | _na 249_aa | MgtC/SapB family protein | |
| 1892 | CABKWM010000006.1 | GCA902376175_00967 | CDS | open | 68775-69347 | _na 190_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 1893 | CABKWM010000006.1 | GCA902376175_00968 | CDS | open | 69356-69862 | _na 168_aa | HAD-IIIA family hydrolase | |
| 1894 | CABKWM010000006.1 | GCA902376175_00969 | CDS | open | 70122-70601 | _na 159_aa | DUF523 domain-containing protein | |
| 1895 | CABKWM010000006.1 | GCA902376175_00970 | CDS | open | 70618-71895 | _na 425_aa | purA | adenylosuccinate synthase |
| 1896 | CABKWM010000006.1 | GCA902376175_00971 | CDS | open | 71911-73845 | _na 644_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 1897 | CABKWM010000006.1 | GCA902376175_00972 | CDS | open | 73865-74518 | _na 217_aa | cmk | (d)CMP kinase |
| 1898 | CABKWM010000006.1 | GCA902376175_00973 | CDS | open | 74573-75505 | _na 310_aa | prmA | 50S ribosomal protein L11 methyltransferase |
| 1899 | CABKWM010000006.1 | GCA902376175_00974 | CDS | open | 75486-76277 | _na 263_aa | TIGR00282 family metallophosphoesterase | |
| 1900 | CABKWM010000006.1 | GCA902376175_00975 | CDS | open | 76404-77384 | _na 326_aa | trpS | tryptophan--tRNA ligase |
| 1901 | CABKWM010000006.1 | GCA902376175_00976 | CDS | open | 77632-77922 | _na 96_aa | hypothetical protein | |
| 1902 | CABKWM010000006.1 | GCA902376175_00977 | CDS | open | 78052-78675 | _na 207_aa | DJ-1/PfpI family protein | |
| 1903 | CABKWM010000006.1 | GCA902376175_00978 | CDS | open | 78733-79224 | _na 163_aa | peptidylprolyl isomerase | |
| 1904 | CABKWM010000006.1 | GCA902376175_00979 | CDS | open | 79229-79672 | _na 147_aa | rpiB | ribose 5-phosphate isomerase B |
| 1905 | CABKWM010000006.1 | GCA902376175_00980 | CDS | open | 79696-80034 | _na 112_aa | hinT | Bis(5'-nucleosyl)-tetraphosphatase |
| 1906 | CABKWM010000006.1 | GCA902376175_00981 | CDS | open | 80263-82245 | _na 660_aa | S9 family peptidase | |
| 1907 | CABKWM010000006.1 | GCA902376175_00982 | CDS | open | 82426-82620 | _na 64_aa | DUF1858 domain-containing protein | |
| 1908 | CABKWM010000006.1 | GCA902376175_00983 | CDS | open | 82851-83636 | _na 261_aa | TSUP family transporter | |
| 1909 | CABKWM010000006.1 | GCA902376175_00984 | CDS | open | 83717-86008 | _na 763_aa | patatin-like phospholipase family protein | |
| 1910 | CABKWM010000006.1 | GCA902376175_00985 | CDS | open | 86158-87156 | _na 332_aa | rfaD | ADP-glyceromanno-heptose 6-epimerase |
| 1911 | CABKWM010000006.1 | GCA902376175_00986 | CDS | open | 87169-87987 | _na 272_aa | undecaprenyl-diphosphate phosphatase | |
| 1912 | CABKWM010000006.1 | GCA902376175_00987 | CDS | open | 88217-88795 | _na 192_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 1913 | CABKWM010000006.1 | GCA902376175_00988 | CDS | open | 88804-89703 | _na 299_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 1914 | CABKWM010000006.1 | GCA902376175_00989 | CDS | open | 89706-90683 | _na 325_aa | Polysaccharide chain length determinant N-terminal domain-containing protein | |
| 1915 | CABKWM010000006.1 | GCA902376175_00990 | CDS | open | 90707-92497 | _na 596_aa | nucleoside-diphosphate sugar epimerase/dehydratase | |
| 1916 | CABKWM010000006.1 | GCA902376175_00991 | CDS | open | 92501-93088 | _na 195_aa | Bacterial sugar transferase domain-containing protein | |
| 1917 | CABKWM010000006.1 | GCA902376175_00992 | CDS | open | 93108-94319 | _na 403_aa | Capsular biosynthesis protein | |
| 1918 | CABKWM010000006.1 | GCA902376175_00993 | CDS | open | 94329-94949 | _na 206_aa | GNAT family N-acetyltransferase | |
| 1919 | CABKWM010000006.1 | GCA902376175_00994 | CDS | open | 94946-96121 | _na 391_aa | glycosyltransferase family 4 protein | |
| 1920 | CABKWM010000006.1 | GCA902376175_00995 | CDS | open | 96133-97155 | _na 340_aa | UDP-glucose 4-epimerase | |
| 1921 | CABKWM010000006.1 | GCA902376175_00996 | CDS | open | 97155-98261 | _na 368_aa | NAD-dependent epimerase/dehydratase domain-containing protein | |
| 1922 | CABKWM010000006.1 | GCA902376175_00997 | CDS | open | 98269-99300 | _na 343_aa | acyltransferase | |
| 1923 | CABKWM010000006.1 | GCA902376175_00998 | CDS | open | 99300-100427 | _na 375_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 1924 | CABKWM010000006.1 | GCA902376175_00999 | CDS | open | 100443-101465 | _na 340_aa | glycosyltransferase family 9 protein | |
| 1925 | CABKWM010000006.1 | GCA902376175_01000 | CDS | open | 101469-102512 | _na 347_aa | epsG | EpsG family protein |
| 1926 | CABKWM010000006.1 | GCA902376175_01001 | CDS | open | 102527-104014 | _na 495_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 1927 | CABKWM010000006.1 | GCA902376175_01002 | CDS | open | 104088-105038 | _na 316_aa | rfaE | Bifunctional protein RfaE%2C domain I |
| 1928 | CABKWM010000006.1 | GCA902376175_01003 | CDS | open | 105060-106199 | _na 379_aa | DUF2971 domain-containing protein | |
| 1929 | CABKWM010000006.1 | GCA902376175_01004 | CDS | open | 106758-107060 | _na 100_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 1930 | CABKWM010000006.1 | GCA902376175_01005 | CDS | open | 107076-107369 | _na 97_aa | relE | Addiction module toxin RelE |
| 1931 | CABKWM010000006.1 | GCA902376175_01006 | CDS | open | 107616-108593 | _na 325_aa | MBL fold metallo-hydrolase | |
| 1932 | CABKWM010000006.1 | GCA902376175_01007 | CDS | open | 108606-109061 | _na 151_aa | YcxB-like protein domain-containing protein | |
| 1933 | CABKWM010000006.1 | GCA902376175_01008 | CDS | open | 109081-110178 | _na 365_aa | Metallo-beta-lactamase domain-containing protein | |
| 1934 | CABKWM010000006.1 | GCA902376175_01009 | CDS | open | 110168-110686 | _na 172_aa | TLC domain-containing protein | |
| 1935 | CABKWM010000006.1 | GCA902376175_01010 | CDS | open | 110844-111545 | _na 233_aa | HTH cro/C1-type domain-containing protein | |
| 1936 | CABKWM010000006.1 | GCA902376175_01011 | CDS | open | 111561-111773 | _na 70_aa | hypothetical protein | |
| 1937 | CABKWM010000006.1 | GCA902376175_01012 | CDS | open | 111851-113635 | _na 594_aa | DUF4435 domain-containing protein | |
| 1938 | CABKWM010000006.1 | GCA902376175_01013 | CDS | open | 113652-114317 | _na 221_aa | DUF4760 domain-containing protein | |
| 1939 | CABKWM010000006.1 | GCA902376175_01014 | CDS | open | 114801-115427 | _na 208_aa | hypothetical protein | |
| 1940 | CABKWM010000006.1 | GCA902376175_01015 | CDS | open | 115533-116774 | _na 413_aa | autotransporter domain-containing protein | |
| 1941 | CABKWM010000006.1 | GCA902376175_01016 | CDS | open | 117031-117258 | _na 75_aa | transposase | |
| 1942 | CABKWM010000006.1 | GCA902376175_01017 | CDS | open | 117383-118216 | _na 277_aa | hypothetical protein | |
| 1943 | CABKWM010000006.1 | GCA902376175_01018 | CDS | open | 118213-118515 | _na 100_aa | STAS-like domain-containing protein | |
| 1944 | CABKWM010000006.1 | GCA902376175_01019 | CDS | open | 118484-119044 | _na 186_aa | PIN domain-containing protein | |
| 1945 | CABKWM010000006.1 | GCA902376175_01020 | CDS | open | 119280-119714 | _na 144_aa | DNA starvation/stationary phase protection protein | |
| 1946 | CABKWM010000006.1 | GCA902376175_01021 | CDS | open | 119859-120404 | _na 181_aa | ywqK | toxin-antitoxin system YwqK family antitoxin |
| 1947 | CABKWM010000006.1 | GCA902376175_01022 | CDS | open | 120608-121954 | _na 448_aa | HAMP domain-containing sensor histidine kinase | |
| 1948 | CABKWM010000006.1 | GCA902376175_01023 | CDS | open | 121935-122606 | _na 223_aa | response regulator transcription factor | |
| 1949 | CABKWM010000006.1 | GCA902376175_01024 | CDS | open | 122637-123314 | _na 225_aa | ABC transporter ATP-binding protein | |
| 1950 | CABKWM010000006.1 | GCA902376175_01025 | CDS | open | 123307-124476 | _na 389_aa | ABC transporter permease | |
| 1951 | CABKWM010000006.1 | GCA902376175_01026 | CDS | open | 124572-126380 | _na 602_aa | recQ | DNA helicase RecQ |
| 1952 | CABKWM010000006.1 | GCA902376175_01027 | CDS | open | 126597-127526 | _na 309_aa | dprA | DNA-processing protein DprA |
| 1953 | CABKWM010000006.1 | GCA902376175_01028 | CDS | open | 127779-129353 | _na 524_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 1954 | CABKWM010000006.1 | GCA902376175_01029 | CDS | open | 129313-130062 | _na 249_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 1955 | CABKWM010000006.1 | GCA902376175_01030 | CDS | open | 130156-131037 | _na 293_aa | phosphate/phosphite/phosphonate ABC transporter substrate-binding protein | |
| 1956 | CABKWM010000006.1 | GCA902376175_01031 | CDS | open | 131235-131696 | _na 153_aa | YhcH/YjgK/YiaL family protein | |
| 1957 | CABKWM010000006.1 | GCA902376175_01032 | CDS | open | 131815-132978 | _na 387_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 1958 | CABKWM010000006.1 | GCA902376175_01033 | CDS | open | 133123-134160 | _na 345_aa | bioB | biotin synthase BioB |
| 1959 | CABKWM010000006.1 | GCA902376175_01034 | CDS | open | 134150-134812 | _na 220_aa | bioD | dethiobiotin synthase |
| 1960 | CABKWM010000006.1 | GCA902376175_01035 | CDS | open | 134962-136296 | _na 444_aa | bioA | adenosylmethionine--8-amino-7-oxononanoate transaminase |
| 1961 | CABKWM010000006.1 | GCA902376175_01036 | CDS | open | 136527-137126 | _na 199_aa | DUF4125 domain-containing protein | |
| 1962 | CABKWM010000006.1 | GCA902376175_01037 | CDS | open | 137149-138966 | _na 605_aa | DUF4037 domain-containing protein | |
| 1963 | CABKWM010000006.1 | GCA902376175_01038 | CDS | open | 139091-140893 | _na 600_aa | lepA | translation elongation factor 4 |
| 1964 | CABKWM010000006.1 | GCA902376175_01039 | CDS | open | 141174-141965 | _na 263_aa | nickel/cobalt transporter | |
| 1965 | CABKWM010000006.1 | GCA902376175_01040 | CDS | open | 141962-142513 | _na 183_aa | DUF1007 domain-containing protein | |
| 1966 | CABKWM010000006.1 | GCA902376175_01041 | CDS | open | 142780-144801 | _na 673_aa | hutU | urocanate hydratase |
| 1967 | CABKWM010000006.1 | GCA902376175_01042 | CDS | open | 145168-146703 | _na 511_aa | hutH | histidine ammonia-lyase |
| 1968 | CABKWM010000006.1 | GCA902376175_01043 | CDS | open | 147025-148143 | _na 372_aa | ROK family protein | |
| 1969 | CABKWM010000006.1 | GCA902376175_01044 | CDS | open | 148161-148580 | _na 139_aa | hypothetical protein | |
| 1970 | CABKWM010000006.1 | GCA902376175_01045 | CDS | open | 148883-150700 | _na 605_aa | typA | translational GTPase TypA |
| 1971 | CABKWM010000006.1 | GCA902376175_01046 | CDS | open | 150715-151578 | _na 287_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 1972 | CABKWM010000006.1 | GCA902376175_01047 | CDS | open | 151775-152197 | _na 140_aa | Pyridoxamine 5'-phosphate oxidase | |
| 1973 | CABKWM010000006.1 | GCA902376175_01048 | CDS | open | 152494-153828 | _na 444_aa | cobyrinate a%2Cc-diamide synthase | |
| 1974 | CABKWM010000006.1 | GCA902376175_01049 | CDS | open | 153869-154165 | _na 98_aa | deoR | DeoR family transcriptional regulator |
| 1975 | CABKWM010000006.1 | GCA902376175_01050 | CDS | open | 154192-154842 | _na 216_aa | cobH | Cobalamin biosynthesis precorrin-8X methylmutase CobH/CbiC domain-containing protein |
| 1976 | CABKWM010000006.1 | GCA902376175_01051 | CDS | open | 154938-156065 | _na 375_aa | cbiD | cobalt-precorrin-5B (C(1))-methyltransferase CbiD |
| 1977 | CABKWM010000006.1 | GCA902376175_01052 | CDS | open | 156052-156708 | _na 218_aa | cbiE | precorrin-6y C5%2C15-methyltransferase (decarboxylating) subunit CbiE |
| 1978 | CABKWM010000006.1 | GCA902376175_01053 | CDS | open | 156695-157660 | _na 321_aa | NAD(P)-dependent oxidoreductase | |
| 1979 | CABKWM010000006.1 | GCA902376175_01054 | CDS | open | 157681-158250 | _na 189_aa | cbiT | precorrin-6Y C5%2C15-methyltransferase (decarboxylating) subunit CbiT |
| 1980 | CABKWM010000006.1 | GCA902376175_01055 | CDS | open | 158442-159680 | _na 412_aa | ATPase | |
| 1981 | CABKWM010000006.1 | GCA902376175_01056 | CDS | open | 159700-160587 | _na 295_aa | GIY-YIG domain-containing protein | |
| 1982 | CABKWM010000006.1 | GCA902376175_01057 | CDS | open | 160611-161924 | _na 437_aa | FRG domain-containing protein | |
| 1983 | CABKWM010000006.1 | GCA902376175_01058 | CDS | open | 161943-162665 | _na 240_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 1984 | CABKWM010000006.1 | GCA902376175_01059 | CDS | open | 162680-163363 | _na 227_aa | GLPGLI family protein | |
| 1985 | CABKWM010000006.1 | GCA902376175_01060 | CDS | open | 163401-164171 | _na 256_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 1986 | CABKWM010000006.1 | GCA902376175_01061 | CDS | open | 164214-165215 | _na 333_aa | cbiG | cobalt-precorrin 5A hydrolase |
| 1987 | CABKWM010000006.1 | GCA902376175_01062 | CDS | open | 165215-165964 | _na 249_aa | Precorrin-3B C(17)-methyltransferase | |
| 1988 | CABKWM010000006.1 | GCA902376175_01063 | CDS | open | 165978-166721 | _na 247_aa | cobK | precorrin-6A reductase |
| 1989 | CABKWM010000006.1 | GCA902376175_01064 | CDS | open | 166745-167857 | _na 370_aa | cation diffusion facilitator family transporter | |
| 1990 | CABKWM010000006.1 | GCA902376175_01065 | CDS | open | 167975-168232 | _na 85_aa | rpsO | 30S ribosomal protein S15 |
| 1991 | CABKWM010000006.1 | GCA902376175_01066 | CDS | open | 168588-169664 | _na 358_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 1992 | CABKWM010000006.1 | GCA902376175_01067 | CDS | open | 169667-171817 | _na 716_aa | transglycosylase domain-containing protein | |
| 1993 | CABKWM010000006.1 | GCA902376175_01068 | CDS | open | 171819-174656 | _na 945_aa | ATP-dependent DNA helicase | |
| 1994 | CABKWM010000006.1 | GCA902376175_01069 | CDS | open | 174656-175888 | _na 410_aa | exonuclease SbcCD subunit D | |
| 1995 | CABKWM010000006.1 | GCA902376175_01070 | CDS | open | 175891-178671 | _na 926_aa | AAA family ATPase | |
| 1996 | CABKWM010000006.1 | GCA902376175_01071 | CDS | open | 178680-179348 | _na 222_aa | queH | epoxyqueuosine reductase QueH |
| 1997 | CABKWM010000006.1 | GCA902376175_01072 | CDS | open | 179341-179958 | _na 205_aa | DUF2179 domain-containing protein | |
| 1998 | CABKWM010000006.1 | GCA902376175_01073 | CDS | open | 179971-180567 | _na 198_aa | ruvA | Holliday junction branch migration protein RuvA |
| 1999 | CABKWM010000006.1 | GCA902376175_01074 | CDS | open | 180571-181071 | _na 166_aa | thioredoxin family protein | |
| 2000 | CABKWM010000006.1 | GCA902376175_01075 | CDS | open | 181250-182485 | _na 411_aa | sdaA | L-serine ammonia-lyase |

