HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Methanobrevibacter oralis (GCA_902384065.1)

Select a Genome:
BAKTA Annotations for GCA_902384065.1
Genome Selected: Methanobrevibacter oralis
ContigsBases CDSrRNA tmRNAtRNA
60 2083511 2268 5 0 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4615 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4615 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 CABMAB010000053.1 GCA902384065_02262 CDS open 20124-23351 _na     1075_aa hypothetical protein
4502 CABMAB010000053.1 GCA902384065_02263 CDS open 23521-23898 _na     125_aa hypothetical protein
4503 CABMAB010000053.1 GCA902384065_02238 gene open 464-1498
4504 CABMAB010000053.1 GCA902384065_02239 gene open 2114-2674
4505 CABMAB010000053.1 GCA902384065_02240 gene open 2803-4056
4506 CABMAB010000053.1 GCA902384065_02241 gene open 4189-4698
4507 CABMAB010000053.1 GCA902384065_02242 gene open 4699-5133
4508 CABMAB010000053.1 GCA902384065_02243 gene open 5170-6429
4509 CABMAB010000053.1 GCA902384065_02244 gene open 6434-6874
4510 CABMAB010000053.1 GCA902384065_02245 gene open 6947-8371
4511 CABMAB010000053.1 GCA902384065_02246 gene open 8380-9450
4512 CABMAB010000053.1 GCA902384065_02247 gene open 9518-10570
4513 CABMAB010000053.1 GCA902384065_02248 gene open 10611-10847
4514 CABMAB010000053.1 GCA902384065_02249 gene open 10969-11088
4515 CABMAB010000053.1 GCA902384065_02250 gene open 11098-11559
4516 CABMAB010000053.1 GCA902384065_02251 gene open 11571-11864
4517 CABMAB010000053.1 GCA902384065_02252 gene open 11875-12303
4518 CABMAB010000053.1 GCA902384065_02253 gene open 12449-12916
4519 CABMAB010000053.1 GCA902384065_02254 gene open 13282-13839
4520 CABMAB010000053.1 GCA902384065_02255 gene open 13839-14375
4521 CABMAB010000053.1 GCA902384065_02256 gene open 14443-14634
4522 CABMAB010000053.1 GCA902384065_02257 gene open 14698-14922
4523 CABMAB010000053.1 GCA902384065_02258 gene open 15055-16329
4524 CABMAB010000053.1 GCA902384065_02259 gene open 16308-16775
4525 CABMAB010000053.1 GCA902384065_02260 gene open 16772-18409
4526 CABMAB010000053.1 GCA902384065_02261 gene open 18877-20124
4527 CABMAB010000053.1 GCA902384065_02262 gene open 20124-23351
4528 CABMAB010000053.1 GCA902384065_02263 gene open 23521-23898
4529 CABMAB010000054.1 repeat_region open 468-1967 CRISPR array with 21 repeats of length 36%2C consensus sequence CCACAATCCTTGTTTTTATGGAATTAACTTTGCAAT and spacer length 36
4530 CABMAB010000054.1 GCA902384065_02264 CDS open 2267-3271 _na     334_aa hypothetical protein
4531 CABMAB010000054.1 GCA902384065_02265 CDS open 3268-3549 _na     93_aa hypothetical protein
4532 CABMAB010000054.1 GCA902384065_02266 CDS open 3549-4214 _na     221_aa hypothetical protein
4533 CABMAB010000054.1 GCA902384065_02267 CDS open 4216-5544 _na     442_aa hypothetical protein
4534 CABMAB010000054.1 GCA902384065_02268 CDS open 5546-6331 _na     261_aa hypothetical protein
4535 CABMAB010000054.1 GCA902384065_02269 CDS open 6532-6675 _na     47_aa hypothetical protein
4536 CABMAB010000054.1 GCA902384065_02270 CDS open 6675-7103 _na     142_aa hypothetical protein
4537 CABMAB010000054.1 GCA902384065_02271 CDS open 7160-7312 _na     50_aa hypothetical protein
4538 CABMAB010000054.1 GCA902384065_02272 CDS open 7393-7611 _na     72_aa hypothetical protein
4539 CABMAB010000054.1 GCA902384065_02273 CDS open 7624-8352 _na     242_aa hypothetical protein
4540 CABMAB010000054.1 GCA902384065_02274 CDS open 8355-8810 _na     151_aa hypothetical protein
4541 CABMAB010000054.1 GCA902384065_02275 CDS open 8815-9852 _na     345_aa hypothetical protein
4542 CABMAB010000054.1 GCA902384065_02276 CDS open 10155-11285 _na     376_aa hypothetical protein
4543 CABMAB010000054.1 GCA902384065_02277 CDS open 11368-11715 _na     115_aa hypothetical protein
4544 CABMAB010000054.1 GCA902384065_02264 gene open 2267-3271
4545 CABMAB010000054.1 GCA902384065_02265 gene open 3268-3549
4546 CABMAB010000054.1 GCA902384065_02266 gene open 3549-4214
4547 CABMAB010000054.1 GCA902384065_02267 gene open 4216-5544
4548 CABMAB010000054.1 GCA902384065_02268 gene open 5546-6331
4549 CABMAB010000054.1 GCA902384065_02269 gene open 6532-6675
4550 CABMAB010000054.1 GCA902384065_02270 gene open 6675-7103
4551 CABMAB010000054.1 GCA902384065_02271 gene open 7160-7312
4552 CABMAB010000054.1 GCA902384065_02272 gene open 7393-7611
4553 CABMAB010000054.1 GCA902384065_02273 gene open 7624-8352
4554 CABMAB010000054.1 GCA902384065_02274 gene open 8355-8810
4555 CABMAB010000054.1 GCA902384065_02275 gene open 8815-9852
4556 CABMAB010000054.1 GCA902384065_02276 gene open 10155-11285
4557 CABMAB010000054.1 GCA902384065_02277 gene open 11368-11715
4558 CABMAB010000055.1 GCA902384065_02278 CDS open 562-1407 _na     281_aa hypothetical protein
4559 CABMAB010000055.1 GCA902384065_02279 CDS open 1583-1837 _na     84_aa hypothetical protein
4560 CABMAB010000055.1 GCA902384065_02280 CDS open 1841-2341 _na     166_aa hypothetical protein
4561 CABMAB010000055.1 GCA902384065_02281 CDS open 2352-2609 _na     85_aa hypothetical protein
4562 CABMAB010000055.1 GCA902384065_02282 CDS open 2721-3215 _na     164_aa Thiamine pyrophosphate enzyme TPP-binding domain-containing protein
4563 CABMAB010000055.1 GCA902384065_02283 CDS open 3218-4363 _na     381_aa hypothetical protein
4564 CABMAB010000055.1 GCA902384065_02284 CDS open 4380-4622 _na     80_aa porD Pyruvate synthase subunit PorD
4565 CABMAB010000055.1 GCA902384065_02285 CDS open 4635-5159 _na     174_aa hypothetical protein
4566 CABMAB010000055.1 GCA902384065_02286 CDS open 5464-5700 _na     78_aa hypothetical protein
4567 CABMAB010000055.1 GCA902384065_02287 CDS open 5938-7062 _na     374_aa hypothetical protein
4568 CABMAB010000055.1 GCA902384065_02288 CDS open 7064-7426 _na     120_aa hypothetical protein
4569 CABMAB010000055.1 GCA902384065_02278 gene open 562-1407
4570 CABMAB010000055.1 GCA902384065_02279 gene open 1583-1837
4571 CABMAB010000055.1 GCA902384065_02280 gene open 1841-2341
4572 CABMAB010000055.1 GCA902384065_02281 gene open 2352-2609
4573 CABMAB010000055.1 GCA902384065_02282 gene open 2721-3215
4574 CABMAB010000055.1 GCA902384065_02283 gene open 3218-4363
4575 CABMAB010000055.1 GCA902384065_02284 gene open 4380-4622 porD
4576 CABMAB010000055.1 GCA902384065_02285 gene open 4635-5159
4577 CABMAB010000055.1 GCA902384065_02286 gene open 5464-5700
4578 CABMAB010000055.1 GCA902384065_02287 gene open 5938-7062
4579 CABMAB010000055.1 GCA902384065_02288 gene open 7064-7426
4580 CABMAB010000056.1 GCA902384065_02289 CDS open 380-1234 _na     284_aa hypothetical protein
4581 CABMAB010000056.1 GCA902384065_02290 CDS open 1246-1665 _na     139_aa hypothetical protein
4582 CABMAB010000056.1 GCA902384065_02291 CDS open 1605-2402 _na     265_aa hypothetical protein
4583 CABMAB010000056.1 GCA902384065_02292 CDS open 2629-3324 _na     231_aa hypothetical protein
4584 CABMAB010000056.1 GCA902384065_02293 CDS open 3333-3536 _na     67_aa hypothetical protein
4585 CABMAB010000056.1 GCA902384065_02294 CDS open 3537-4346 _na     269_aa hypothetical protein
4586 CABMAB010000056.1 GCA902384065_02295 CDS open 4409-5095 _na     228_aa hypothetical protein
4587 CABMAB010000056.1 GCA902384065_02296 CDS open 5254-6402 _na     382_aa hypothetical protein
4588 CABMAB010000056.1 GCA902384065_02297 CDS open 6425-6907 _na     160_aa hypothetical protein
4589 CABMAB010000056.1 GCA902384065_02298 CDS open 6947-8029 _na     360_aa hypothetical protein
4590 CABMAB010000056.1 GCA902384065_02299 CDS open 8154-9116 _na     320_aa hypothetical protein
4591 CABMAB010000056.1 GCA902384065_02289 gene open 380-1234
4592 CABMAB010000056.1 GCA902384065_02290 gene open 1246-1665
4593 CABMAB010000056.1 GCA902384065_02291 gene open 1605-2402
4594 CABMAB010000056.1 GCA902384065_02292 gene open 2629-3324
4595 CABMAB010000056.1 GCA902384065_02293 gene open 3333-3536
4596 CABMAB010000056.1 GCA902384065_02294 gene open 3537-4346
4597 CABMAB010000056.1 GCA902384065_02295 gene open 4409-5095
4598 CABMAB010000056.1 GCA902384065_02296 gene open 5254-6402
4599 CABMAB010000056.1 GCA902384065_02297 gene open 6425-6907
4600 CABMAB010000056.1 GCA902384065_02298 gene open 6947-8029
4601 CABMAB010000056.1 GCA902384065_02299 gene open 8154-9116
4602 CABMAB010000057.1 GCA902384065_02300 gene open 114-3135 rrl
4603 CABMAB010000057.1 GCA902384065_02302 gene open 3969-5453 rrs
4604 CABMAB010000057.1 GCA902384065_02300 rRNA open 114-3135 rrl 23S ribosomal RNA
4605 CABMAB010000057.1 GCA902384065_02302 rRNA open 3969-5453 rrs 16S ribosomal RNA
4606 CABMAB010000057.1 GCA902384065_02301 gene open 3493-3566 trnA
4607 CABMAB010000057.1 GCA902384065_02301 tRNA open 3493-3566 trnA tRNA-Ala(tgc)
4608 CABMAB010000059.1 GCA902384065_02303 CDS open 1645-1830 _na     61_aa hypothetical protein
4609 CABMAB010000059.1 GCA902384065_02304 CDS open 1996-2184 _na     62_aa hypothetical protein
4610 CABMAB010000059.1 GCA902384065_02303 gene open 1645-1830
4611 CABMAB010000059.1 GCA902384065_02304 gene open 1996-2184
4612 CABMAB010000060.1 GCA902384065_02305 CDS open 281-670 _na     129_aa hypothetical protein
4613 CABMAB010000060.1 GCA902384065_02306 CDS open 667-1857 _na     396_aa hypothetical protein
4614 CABMAB010000060.1 GCA902384065_02305 gene open 281-670
4615 CABMAB010000060.1 GCA902384065_02306 gene open 667-1857