BAKTAGenome Explorer: Methanobrevibacter oralis (GCA_902384065.1)
Select a Genome:
|
BAKTA Annotations for GCA_902384065.1
|
Search & Sort all 4615 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CABMAB010000003.1 | GCA902384065_00489 | gene | open | 108932-109309 | |||
| 1002 | CABMAB010000003.1 | GCA902384065_00490 | gene | open | 109311-109622 | |||
| 1003 | CABMAB010000003.1 | GCA902384065_00491 | gene | open | 109697-109948 | |||
| 1004 | CABMAB010000003.1 | GCA902384065_00492 | gene | open | 110125-113193 | |||
| 1005 | CABMAB010000003.1 | GCA902384065_00493 | gene | open | 113243-113536 | |||
| 1006 | CABMAB010000003.1 | GCA902384065_00494 | gene | open | 113573-114580 | |||
| 1007 | CABMAB010000003.1 | GCA902384065_00495 | gene | open | 114761-115438 | |||
| 1008 | CABMAB010000003.1 | GCA902384065_00496 | gene | open | 115559-118414 | |||
| 1009 | CABMAB010000003.1 | GCA902384065_00497 | gene | open | 118435-119160 | |||
| 1010 | CABMAB010000003.1 | GCA902384065_00498 | gene | open | 119176-119943 | |||
| 1011 | CABMAB010000003.1 | GCA902384065_00499 | gene | open | 120006-120131 | |||
| 1012 | CABMAB010000003.1 | GCA902384065_00500 | gene | open | 120721-121668 | |||
| 1013 | CABMAB010000003.1 | GCA902384065_00501 | gene | open | 121678-122928 | |||
| 1014 | CABMAB010000003.1 | GCA902384065_00502 | gene | open | 122925-123083 | |||
| 1015 | CABMAB010000003.1 | GCA902384065_00503 | gene | open | 123066-123749 | |||
| 1016 | CABMAB010000003.1 | GCA902384065_00504 | gene | open | 123757-124605 | |||
| 1017 | CABMAB010000003.1 | GCA902384065_00505 | gene | open | 124691-125998 | |||
| 1018 | CABMAB010000003.1 | GCA902384065_00506 | gene | open | 125988-126395 | |||
| 1019 | CABMAB010000003.1 | GCA902384065_00507 | gene | open | 126385-128238 | |||
| 1020 | CABMAB010000003.1 | GCA902384065_00508 | gene | open | 128246-128938 | |||
| 1021 | CABMAB010000003.1 | GCA902384065_00509 | gene | open | 128988-130580 | |||
| 1022 | CABMAB010000003.1 | GCA902384065_00510 | gene | open | 130607-131302 | |||
| 1023 | CABMAB010000003.1 | GCA902384065_00511 | gene | open | 131611-132033 | |||
| 1024 | CABMAB010000003.1 | GCA902384065_00512 | gene | open | 132023-132265 | |||
| 1025 | CABMAB010000003.1 | GCA902384065_00513 | gene | open | 132789-133160 | |||
| 1026 | CABMAB010000003.1 | GCA902384065_00514 | gene | open | 133801-135855 | |||
| 1027 | CABMAB010000003.1 | GCA902384065_00515 | gene | open | 136090-139140 | |||
| 1028 | CABMAB010000003.1 | GCA902384065_00516 | gene | open | 139292-140728 | |||
| 1029 | CABMAB010000003.1 | GCA902384065_00517 | gene | open | 140721-142103 | |||
| 1030 | CABMAB010000003.1 | GCA902384065_00518 | gene | open | 142242-143627 | |||
| 1031 | CABMAB010000003.1 | GCA902384065_00519 | gene | open | 143868-145064 | |||
| 1032 | CABMAB010000003.1 | GCA902384065_00520 | gene | open | 145057-146391 | |||
| 1033 | CABMAB010000003.1 | GCA902384065_00521 | gene | open | 146381-146779 | |||
| 1034 | CABMAB010000003.1 | GCA902384065_00522 | gene | open | 146846-147397 | |||
| 1035 | CABMAB010000003.1 | GCA902384065_00523 | gene | open | 147442-149034 | |||
| 1036 | CABMAB010000003.1 | GCA902384065_00524 | gene | open | 149124-149582 | |||
| 1037 | CABMAB010000003.1 | GCA902384065_00525 | gene | open | 149601-150650 | |||
| 1038 | CABMAB010000003.1 | GCA902384065_00526 | gene | open | 150694-151539 | |||
| 1039 | CABMAB010000003.1 | GCA902384065_00527 | gene | open | 151539-152462 | |||
| 1040 | CABMAB010000003.1 | GCA902384065_00529 | gene | open | 152920-153747 | |||
| 1041 | CABMAB010000003.1 | GCA902384065_00530 | gene | open | 153787-154365 | |||
| 1042 | CABMAB010000003.1 | GCA902384065_00531 | gene | open | 154619-155311 | |||
| 1043 | CABMAB010000003.1 | GCA902384065_00409 | gene | open | 32378-32453 | trnH | ||
| 1044 | CABMAB010000003.1 | GCA902384065_00410 | gene | open | 32492-32574 | trnL | ||
| 1045 | CABMAB010000003.1 | GCA902384065_00411 | gene | open | 32629-32703 | trnE | ||
| 1046 | CABMAB010000003.1 | GCA902384065_00412 | gene | open | 32733-32806 | trnI | ||
| 1047 | CABMAB010000003.1 | GCA902384065_00413 | gene | open | 32812-32884 | trnN | ||
| 1048 | CABMAB010000003.1 | GCA902384065_00437 | gene | open | 59374-59448 | trnfM | ||
| 1049 | CABMAB010000003.1 | GCA902384065_00446 | gene | open | 65877-65950 | trnR | ||
| 1050 | CABMAB010000003.1 | GCA902384065_00447 | gene | open | 66004-66077 | trnR | ||
| 1051 | CABMAB010000003.1 | GCA902384065_00472 | gene | open | 82416-82489 | trnR | ||
| 1052 | CABMAB010000003.1 | GCA902384065_00528 | gene | open | 152594-152665 | trnV | ||
| 1053 | CABMAB010000003.1 | GCA902384065_00409 | tRNA | open | 32378-32453 | trnH | tRNA-His(gtg) | |
| 1054 | CABMAB010000003.1 | GCA902384065_00410 | tRNA | open | 32492-32574 | trnL | tRNA-Leu(tag) | |
| 1055 | CABMAB010000003.1 | GCA902384065_00411 | tRNA | open | 32629-32703 | trnE | tRNA-Glu(ttc) | |
| 1056 | CABMAB010000003.1 | GCA902384065_00412 | tRNA | open | 32733-32806 | trnI | tRNA-Ile2(cat) | |
| 1057 | CABMAB010000003.1 | GCA902384065_00413 | tRNA | open | 32812-32884 | trnN | tRNA-Asn(gtt) | |
| 1058 | CABMAB010000003.1 | GCA902384065_00437 | tRNA | open | 59374-59448 | trnfM | tRNA-fMet(cat) | |
| 1059 | CABMAB010000003.1 | GCA902384065_00446 | tRNA | open | 65877-65950 | trnR | tRNA-Arg(tct) | |
| 1060 | CABMAB010000003.1 | GCA902384065_00447 | tRNA | open | 66004-66077 | trnR | tRNA-Arg(cct) | |
| 1061 | CABMAB010000003.1 | GCA902384065_00472 | tRNA | open | 82416-82489 | trnR | tRNA-Arg(gcg) | |
| 1062 | CABMAB010000003.1 | GCA902384065_00528 | tRNA | open | 152594-152665 | trnV | tRNA-Val(tac) | |
| 1063 | CABMAB010000004.1 | GCA902384065_00532 | CDS | open | 223-597 | _na 124_aa | hypothetical protein | |
| 1064 | CABMAB010000004.1 | GCA902384065_00533 | CDS | open | 711-3986 | _na 1091_aa | hypothetical protein | |
| 1065 | CABMAB010000004.1 | GCA902384065_00534 | CDS | open | 3986-5176 | _na 396_aa | hypothetical protein | |
| 1066 | CABMAB010000004.1 | GCA902384065_00535 | CDS | open | 5360-5533 | _na 57_aa | hypothetical protein | |
| 1067 | CABMAB010000004.1 | GCA902384065_00536 | CDS | open | 5672-6442 | _na 256_aa | hypothetical protein | |
| 1068 | CABMAB010000004.1 | GCA902384065_00537 | CDS | open | 6871-7083 | _na 70_aa | hypothetical protein | |
| 1069 | CABMAB010000004.1 | GCA902384065_00538 | CDS | open | 7207-7650 | _na 147_aa | hypothetical protein | |
| 1070 | CABMAB010000004.1 | GCA902384065_00539 | CDS | open | 8013-8420 | _na 135_aa | hypothetical protein | |
| 1071 | CABMAB010000004.1 | GCA902384065_00540 | CDS | open | 8433-9335 | _na 300_aa | hypothetical protein | |
| 1072 | CABMAB010000004.1 | GCA902384065_00541 | CDS | open | 10229-10996 | _na 255_aa | hypothetical protein | |
| 1073 | CABMAB010000004.1 | GCA902384065_00542 | CDS | open | 11430-11960 | _na 176_aa | hypothetical protein | |
| 1074 | CABMAB010000004.1 | GCA902384065_00543 | CDS | open | 11957-12721 | _na 254_aa | hypothetical protein | |
| 1075 | CABMAB010000004.1 | GCA902384065_00544 | CDS | open | 13155-14039 | _na 294_aa | hypothetical protein | |
| 1076 | CABMAB010000004.1 | GCA902384065_00532 | gene | open | 223-597 | |||
| 1077 | CABMAB010000004.1 | GCA902384065_00533 | gene | open | 711-3986 | |||
| 1078 | CABMAB010000004.1 | GCA902384065_00534 | gene | open | 3986-5176 | |||
| 1079 | CABMAB010000004.1 | GCA902384065_00535 | gene | open | 5360-5533 | |||
| 1080 | CABMAB010000004.1 | GCA902384065_00536 | gene | open | 5672-6442 | |||
| 1081 | CABMAB010000004.1 | GCA902384065_00537 | gene | open | 6871-7083 | |||
| 1082 | CABMAB010000004.1 | GCA902384065_00538 | gene | open | 7207-7650 | |||
| 1083 | CABMAB010000004.1 | GCA902384065_00539 | gene | open | 8013-8420 | |||
| 1084 | CABMAB010000004.1 | GCA902384065_00540 | gene | open | 8433-9335 | |||
| 1085 | CABMAB010000004.1 | GCA902384065_00541 | gene | open | 10229-10996 | |||
| 1086 | CABMAB010000004.1 | GCA902384065_00542 | gene | open | 11430-11960 | |||
| 1087 | CABMAB010000004.1 | GCA902384065_00543 | gene | open | 11957-12721 | |||
| 1088 | CABMAB010000004.1 | GCA902384065_00544 | gene | open | 13155-14039 | |||
| 1089 | CABMAB010000005.1 | GCA902384065_00545 | CDS | open | 1469-2170 | _na 233_aa | hypothetical protein | |
| 1090 | CABMAB010000005.1 | GCA902384065_00546 | CDS | open | 2263-2670 | _na 135_aa | ABC transporter ATP-binding protein | |
| 1091 | CABMAB010000005.1 | GCA902384065_00547 | CDS | open | 2673-3191 | _na 172_aa | hypothetical protein | |
| 1092 | CABMAB010000005.1 | GCA902384065_00548 | CDS | open | 3208-3948 | _na 246_aa | hypothetical protein | |
| 1093 | CABMAB010000005.1 | GCA902384065_00549 | CDS | open | 4028-4135 | _na 35_aa | hypothetical protein | |
| 1094 | CABMAB010000005.1 | GCA902384065_00550 | CDS | open | 4132-4569 | _na 145_aa | hypothetical protein | |
| 1095 | CABMAB010000005.1 | GCA902384065_00551 | CDS | open | 4927-5685 | _na 252_aa | hypothetical protein | |
| 1096 | CABMAB010000005.1 | GCA902384065_00545 | gene | open | 1469-2170 | |||
| 1097 | CABMAB010000005.1 | GCA902384065_00546 | gene | open | 2263-2670 | |||
| 1098 | CABMAB010000005.1 | GCA902384065_00547 | gene | open | 2673-3191 | |||
| 1099 | CABMAB010000005.1 | GCA902384065_00548 | gene | open | 3208-3948 | |||
| 1100 | CABMAB010000005.1 | GCA902384065_00549 | gene | open | 4028-4135 | |||
| 1101 | CABMAB010000005.1 | GCA902384065_00550 | gene | open | 4132-4569 | |||
| 1102 | CABMAB010000005.1 | GCA902384065_00551 | gene | open | 4927-5685 | |||
| 1103 | CABMAB010000006.1 | GCA902384065_00552 | CDS | open | 429-890 | _na 153_aa | hypothetical protein | |
| 1104 | CABMAB010000006.1 | GCA902384065_00553 | CDS | open | 1034-1483 | _na 149_aa | hypothetical protein | |
| 1105 | CABMAB010000006.1 | GCA902384065_00554 | CDS | open | 1911-2744 | _na 277_aa | Glyoxal reductase | |
| 1106 | CABMAB010000006.1 | GCA902384065_00555 | CDS | open | 2804-3250 | _na 148_aa | Cupin type-2 domain-containing protein | |
| 1107 | CABMAB010000006.1 | GCA902384065_00556 | CDS | open | 3392-3955 | _na 187_aa | Aldo/keto reductase | |
| 1108 | CABMAB010000006.1 | GCA902384065_00557 | CDS | open | 3934-4254 | _na 106_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 1109 | CABMAB010000006.1 | GCA902384065_00558 | CDS | open | 4433-4783 | _na 116_aa | hypothetical protein | |
| 1110 | CABMAB010000006.1 | GCA902384065_00559 | CDS | open | 4839-5120 | _na 93_aa | hypothetical protein | |
| 1111 | CABMAB010000006.1 | GCA902384065_00560 | CDS | open | 5155-5634 | _na 159_aa | hypothetical protein | |
| 1112 | CABMAB010000006.1 | GCA902384065_00561 | CDS | open | 6228-6584 | _na 118_aa | hypothetical protein | |
| 1113 | CABMAB010000006.1 | GCA902384065_00562 | CDS | open | 6581-6832 | _na 83_aa | hypothetical protein | |
| 1114 | CABMAB010000006.1 | GCA902384065_00563 | CDS | open | 6940-7065 | _na 41_aa | hypothetical protein | |
| 1115 | CABMAB010000006.1 | GCA902384065_00564 | CDS | open | 7997-8356 | _na 119_aa | Glycosyltransferase 2-like domain-containing protein | |
| 1116 | CABMAB010000006.1 | GCA902384065_00565 | CDS | open | 8569-8982 | _na 137_aa | hypothetical protein | |
| 1117 | CABMAB010000006.1 | GCA902384065_00566 | CDS | open | 9097-9333 | _na 78_aa | hypothetical protein | |
| 1118 | CABMAB010000006.1 | GCA902384065_00567 | CDS | open | 9330-9731 | _na 133_aa | hypothetical protein | |
| 1119 | CABMAB010000006.1 | GCA902384065_00568 | CDS | open | 11298-11765 | _na 155_aa | hypothetical protein | |
| 1120 | CABMAB010000006.1 | GCA902384065_00569 | CDS | open | 12002-12154 | _na 50_aa | hypothetical protein | |
| 1121 | CABMAB010000006.1 | GCA902384065_00570 | CDS | open | 12237-12962 | _na 241_aa | hypothetical protein | |
| 1122 | CABMAB010000006.1 | GCA902384065_00571 | CDS | open | 13079-13423 | _na 114_aa | hypothetical protein | |
| 1123 | CABMAB010000006.1 | GCA902384065_00572 | CDS | open | 13510-14088 | _na 192_aa | hypothetical protein | |
| 1124 | CABMAB010000006.1 | GCA902384065_00573 | CDS | open | 14438-15472 | _na 344_aa | hypothetical protein | |
| 1125 | CABMAB010000006.1 | GCA902384065_00574 | CDS | open | 15540-15797 | _na 85_aa | hypothetical protein | |
| 1126 | CABMAB010000006.1 | GCA902384065_00575 | CDS | open | 15922-16575 | _na 217_aa | hypothetical protein | |
| 1127 | CABMAB010000006.1 | GCA902384065_00576 | CDS | open | 16614-17231 | _na 205_aa | hypothetical protein | |
| 1128 | CABMAB010000006.1 | GCA902384065_00577 | CDS | open | 17357-17851 | _na 164_aa | hypothetical protein | |
| 1129 | CABMAB010000006.1 | GCA902384065_00578 | CDS | open | 17881-18087 | _na 68_aa | hypothetical protein | |
| 1130 | CABMAB010000006.1 | GCA902384065_00579 | CDS | open | 18084-18275 | _na 63_aa | hypothetical protein | |
| 1131 | CABMAB010000006.1 | GCA902384065_00580 | CDS | open | 18272-19663 | _na 463_aa | hypothetical protein | |
| 1132 | CABMAB010000006.1 | GCA902384065_00581 | CDS | open | 19677-20237 | _na 186_aa | hypothetical protein | |
| 1133 | CABMAB010000006.1 | GCA902384065_00582 | CDS | open | 20742-23150 | _na 802_aa | hypothetical protein | |
| 1134 | CABMAB010000006.1 | GCA902384065_00583 | CDS | open | 23476-23955 | _na 159_aa | hypothetical protein | |
| 1135 | CABMAB010000006.1 | GCA902384065_00584 | CDS | open | 24030-24143 | _na 37_aa | hypothetical protein | |
| 1136 | CABMAB010000006.1 | GCA902384065_00585 | CDS | open | 24210-24596 | _na 128_aa | hypothetical protein | |
| 1137 | CABMAB010000006.1 | GCA902384065_00586 | CDS | open | 24621-24740 | _na 39_aa | hypothetical protein | |
| 1138 | CABMAB010000006.1 | GCA902384065_00587 | CDS | open | 24737-25270 | _na 177_aa | hypothetical protein | |
| 1139 | CABMAB010000006.1 | GCA902384065_00588 | CDS | open | 25276-25758 | _na 160_aa | hypothetical protein | |
| 1140 | CABMAB010000006.1 | GCA902384065_00589 | CDS | open | 25809-27014 | _na 401_aa | putative hydrolase or acyltransferase of alpha/beta superfamily | |
| 1141 | CABMAB010000006.1 | GCA902384065_00552 | gene | open | 429-890 | |||
| 1142 | CABMAB010000006.1 | GCA902384065_00553 | gene | open | 1034-1483 | |||
| 1143 | CABMAB010000006.1 | GCA902384065_00554 | gene | open | 1911-2744 | |||
| 1144 | CABMAB010000006.1 | GCA902384065_00555 | gene | open | 2804-3250 | |||
| 1145 | CABMAB010000006.1 | GCA902384065_00556 | gene | open | 3392-3955 | |||
| 1146 | CABMAB010000006.1 | GCA902384065_00557 | gene | open | 3934-4254 | |||
| 1147 | CABMAB010000006.1 | GCA902384065_00558 | gene | open | 4433-4783 | |||
| 1148 | CABMAB010000006.1 | GCA902384065_00559 | gene | open | 4839-5120 | |||
| 1149 | CABMAB010000006.1 | GCA902384065_00560 | gene | open | 5155-5634 | |||
| 1150 | CABMAB010000006.1 | GCA902384065_00561 | gene | open | 6228-6584 | |||
| 1151 | CABMAB010000006.1 | GCA902384065_00562 | gene | open | 6581-6832 | |||
| 1152 | CABMAB010000006.1 | GCA902384065_00563 | gene | open | 6940-7065 | |||
| 1153 | CABMAB010000006.1 | GCA902384065_00564 | gene | open | 7997-8356 | |||
| 1154 | CABMAB010000006.1 | GCA902384065_00565 | gene | open | 8569-8982 | |||
| 1155 | CABMAB010000006.1 | GCA902384065_00566 | gene | open | 9097-9333 | |||
| 1156 | CABMAB010000006.1 | GCA902384065_00567 | gene | open | 9330-9731 | |||
| 1157 | CABMAB010000006.1 | GCA902384065_00568 | gene | open | 11298-11765 | |||
| 1158 | CABMAB010000006.1 | GCA902384065_00569 | gene | open | 12002-12154 | |||
| 1159 | CABMAB010000006.1 | GCA902384065_00570 | gene | open | 12237-12962 | |||
| 1160 | CABMAB010000006.1 | GCA902384065_00571 | gene | open | 13079-13423 | |||
| 1161 | CABMAB010000006.1 | GCA902384065_00572 | gene | open | 13510-14088 | |||
| 1162 | CABMAB010000006.1 | GCA902384065_00573 | gene | open | 14438-15472 | |||
| 1163 | CABMAB010000006.1 | GCA902384065_00574 | gene | open | 15540-15797 | |||
| 1164 | CABMAB010000006.1 | GCA902384065_00575 | gene | open | 15922-16575 | |||
| 1165 | CABMAB010000006.1 | GCA902384065_00576 | gene | open | 16614-17231 | |||
| 1166 | CABMAB010000006.1 | GCA902384065_00577 | gene | open | 17357-17851 | |||
| 1167 | CABMAB010000006.1 | GCA902384065_00578 | gene | open | 17881-18087 | |||
| 1168 | CABMAB010000006.1 | GCA902384065_00579 | gene | open | 18084-18275 | |||
| 1169 | CABMAB010000006.1 | GCA902384065_00580 | gene | open | 18272-19663 | |||
| 1170 | CABMAB010000006.1 | GCA902384065_00581 | gene | open | 19677-20237 | |||
| 1171 | CABMAB010000006.1 | GCA902384065_00582 | gene | open | 20742-23150 | |||
| 1172 | CABMAB010000006.1 | GCA902384065_00583 | gene | open | 23476-23955 | |||
| 1173 | CABMAB010000006.1 | GCA902384065_00584 | gene | open | 24030-24143 | |||
| 1174 | CABMAB010000006.1 | GCA902384065_00585 | gene | open | 24210-24596 | |||
| 1175 | CABMAB010000006.1 | GCA902384065_00586 | gene | open | 24621-24740 | |||
| 1176 | CABMAB010000006.1 | GCA902384065_00587 | gene | open | 24737-25270 | |||
| 1177 | CABMAB010000006.1 | GCA902384065_00588 | gene | open | 25276-25758 | |||
| 1178 | CABMAB010000006.1 | GCA902384065_00589 | gene | open | 25809-27014 | |||
| 1179 | CABMAB010000007.1 | GCA902384065_00590 | CDS | open | 470-748 | _na 92_aa | hypothetical protein | |
| 1180 | CABMAB010000007.1 | GCA902384065_00591 | CDS | open | 942-1295 | _na 117_aa | hypothetical protein | |
| 1181 | CABMAB010000007.1 | GCA902384065_00592 | CDS | open | 1480-2619 | _na 379_aa | Toxic anion resistance protein | |
| 1182 | CABMAB010000007.1 | GCA902384065_00593 | CDS | open | 2638-3558 | _na 306_aa | hypothetical protein | |
| 1183 | CABMAB010000007.1 | GCA902384065_00594 | CDS | open | 3894-4100 | _na 68_aa | hypothetical protein | |
| 1184 | CABMAB010000007.1 | GCA902384065_00595 | CDS | open | 4183-4512 | _na 109_aa | hypothetical protein | |
| 1185 | CABMAB010000007.1 | GCA902384065_00596 | CDS | open | 5118-5558 | _na 146_aa | D-aminoacyl-tRNA deacylase | |
| 1186 | CABMAB010000007.1 | GCA902384065_00597 | CDS | open | 5802-6464 | _na 220_aa | hypothetical protein | |
| 1187 | CABMAB010000007.1 | GCA902384065_00598 | CDS | open | 6578-8098 | _na 506_aa | hypothetical protein | |
| 1188 | CABMAB010000007.1 | GCA902384065_00599 | CDS | open | 8129-9742 | _na 537_aa | hypothetical protein | |
| 1189 | CABMAB010000007.1 | GCA902384065_00600 | CDS | open | 9764-11137 | _na 457_aa | hypothetical protein | |
| 1190 | CABMAB010000007.1 | GCA902384065_00601 | CDS | open | 11159-11770 | _na 203_aa | hypothetical protein | |
| 1191 | CABMAB010000007.1 | GCA902384065_00602 | CDS | open | 11800-13872 | _na 690_aa | hypothetical protein | |
| 1192 | CABMAB010000007.1 | GCA902384065_00603 | CDS | open | 14019-14312 | _na 97_aa | hypothetical protein | |
| 1193 | CABMAB010000007.1 | GCA902384065_00604 | CDS | open | 14333-15097 | _na 254_aa | hypothetical protein | |
| 1194 | CABMAB010000007.1 | GCA902384065_00605 | CDS | open | 15106-15423 | _na 105_aa | hypothetical protein | |
| 1195 | CABMAB010000007.1 | GCA902384065_00606 | CDS | open | 15451-15597 | _na 48_aa | hypothetical protein | |
| 1196 | CABMAB010000007.1 | GCA902384065_00607 | CDS | open | 15570-16121 | _na 183_aa | hypothetical protein | |
| 1197 | CABMAB010000007.1 | GCA902384065_00608 | CDS | open | 16331-16714 | _na 127_aa | hypothetical protein | |
| 1198 | CABMAB010000007.1 | GCA902384065_00609 | CDS | open | 16814-17755 | _na 313_aa | hypothetical protein | |
| 1199 | CABMAB010000007.1 | GCA902384065_00610 | CDS | open | 17996-18340 | _na 114_aa | hypothetical protein | |
| 1200 | CABMAB010000007.1 | GCA902384065_00611 | CDS | open | 18552-18650 | _na 32_aa | hypothetical protein | |
| 1201 | CABMAB010000007.1 | GCA902384065_00612 | CDS | open | 18774-19574 | _na 266_aa | hypothetical protein | |
| 1202 | CABMAB010000007.1 | GCA902384065_00613 | CDS | open | 19594-20100 | _na 168_aa | Amidohydrolase | |
| 1203 | CABMAB010000007.1 | GCA902384065_00614 | CDS | open | 20094-20387 | _na 97_aa | hypothetical protein | |
| 1204 | CABMAB010000007.1 | GCA902384065_00615 | CDS | open | 20384-21391 | _na 335_aa | hypothetical protein | |
| 1205 | CABMAB010000007.1 | GCA902384065_00616 | CDS | open | 21657-22247 | _na 196_aa | hypothetical protein | |
| 1206 | CABMAB010000007.1 | GCA902384065_00617 | CDS | open | 22406-22618 | _na 70_aa | hypothetical protein | |
| 1207 | CABMAB010000007.1 | GCA902384065_00618 | CDS | open | 22641-23300 | _na 219_aa | hypothetical protein | |
| 1208 | CABMAB010000007.1 | GCA902384065_00619 | CDS | open | 23462-23641 | _na 59_aa | hypothetical protein | |
| 1209 | CABMAB010000007.1 | GCA902384065_00590 | gene | open | 470-748 | |||
| 1210 | CABMAB010000007.1 | GCA902384065_00591 | gene | open | 942-1295 | |||
| 1211 | CABMAB010000007.1 | GCA902384065_00592 | gene | open | 1480-2619 | |||
| 1212 | CABMAB010000007.1 | GCA902384065_00593 | gene | open | 2638-3558 | |||
| 1213 | CABMAB010000007.1 | GCA902384065_00594 | gene | open | 3894-4100 | |||
| 1214 | CABMAB010000007.1 | GCA902384065_00595 | gene | open | 4183-4512 | |||
| 1215 | CABMAB010000007.1 | GCA902384065_00596 | gene | open | 5118-5558 | |||
| 1216 | CABMAB010000007.1 | GCA902384065_00597 | gene | open | 5802-6464 | |||
| 1217 | CABMAB010000007.1 | GCA902384065_00598 | gene | open | 6578-8098 | |||
| 1218 | CABMAB010000007.1 | GCA902384065_00599 | gene | open | 8129-9742 | |||
| 1219 | CABMAB010000007.1 | GCA902384065_00600 | gene | open | 9764-11137 | |||
| 1220 | CABMAB010000007.1 | GCA902384065_00601 | gene | open | 11159-11770 | |||
| 1221 | CABMAB010000007.1 | GCA902384065_00602 | gene | open | 11800-13872 | |||
| 1222 | CABMAB010000007.1 | GCA902384065_00603 | gene | open | 14019-14312 | |||
| 1223 | CABMAB010000007.1 | GCA902384065_00604 | gene | open | 14333-15097 | |||
| 1224 | CABMAB010000007.1 | GCA902384065_00605 | gene | open | 15106-15423 | |||
| 1225 | CABMAB010000007.1 | GCA902384065_00606 | gene | open | 15451-15597 | |||
| 1226 | CABMAB010000007.1 | GCA902384065_00607 | gene | open | 15570-16121 | |||
| 1227 | CABMAB010000007.1 | GCA902384065_00608 | gene | open | 16331-16714 | |||
| 1228 | CABMAB010000007.1 | GCA902384065_00609 | gene | open | 16814-17755 | |||
| 1229 | CABMAB010000007.1 | GCA902384065_00610 | gene | open | 17996-18340 | |||
| 1230 | CABMAB010000007.1 | GCA902384065_00611 | gene | open | 18552-18650 | |||
| 1231 | CABMAB010000007.1 | GCA902384065_00612 | gene | open | 18774-19574 | |||
| 1232 | CABMAB010000007.1 | GCA902384065_00613 | gene | open | 19594-20100 | |||
| 1233 | CABMAB010000007.1 | GCA902384065_00614 | gene | open | 20094-20387 | |||
| 1234 | CABMAB010000007.1 | GCA902384065_00615 | gene | open | 20384-21391 | |||
| 1235 | CABMAB010000007.1 | GCA902384065_00616 | gene | open | 21657-22247 | |||
| 1236 | CABMAB010000007.1 | GCA902384065_00617 | gene | open | 22406-22618 | |||
| 1237 | CABMAB010000007.1 | GCA902384065_00618 | gene | open | 22641-23300 | |||
| 1238 | CABMAB010000007.1 | GCA902384065_00619 | gene | open | 23462-23641 | |||
| 1239 | CABMAB010000008.1 | repeat_region | open | 48223-50445 | CRISPR array with 34 repeats of length 30%2C consensus sequence ATTTCAATCCCAAATTGGTCTGATTAACAT and spacer length 36 | |||
| 1240 | CABMAB010000008.1 | GCA902384065_00620 | CDS | open | 164-496 | _na 110_aa | hypothetical protein | |
| 1241 | CABMAB010000008.1 | GCA902384065_00621 | CDS | open | 762-1166 | _na 134_aa | hypothetical protein | |
| 1242 | CABMAB010000008.1 | GCA902384065_00622 | CDS | open | 1402-3066 | _na 554_aa | 3-[(3aS%2C4S%2C7aS)-7a-methyl-1%2C 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase | |
| 1243 | CABMAB010000008.1 | GCA902384065_00623 | CDS | open | 3077-3646 | _na 189_aa | (S)-2-hydroxypropylphosphonic acid epoxidase | |
| 1244 | CABMAB010000008.1 | GCA902384065_00624 | CDS | open | 3805-4383 | _na 192_aa | hypothetical protein | |
| 1245 | CABMAB010000008.1 | GCA902384065_00625 | CDS | open | 4380-5105 | _na 241_aa | hypothetical protein | |
| 1246 | CABMAB010000008.1 | GCA902384065_00626 | CDS | open | 5536-6081 | _na 181_aa | hypothetical protein | |
| 1247 | CABMAB010000008.1 | GCA902384065_00627 | CDS | open | 6361-6672 | _na 103_aa | hypothetical protein | |
| 1248 | CABMAB010000008.1 | GCA902384065_00628 | CDS | open | 6997-7284 | _na 95_aa | hypothetical protein | |
| 1249 | CABMAB010000008.1 | GCA902384065_00629 | CDS | open | 7497-7784 | _na 95_aa | hypothetical protein | |
| 1250 | CABMAB010000008.1 | GCA902384065_00630 | CDS | open | 8099-9898 | _na 599_aa | irtA | Iron import ATP-binding/permease protein IrtA |
| 1251 | CABMAB010000008.1 | GCA902384065_00631 | CDS | open | 9891-10562 | _na 223_aa | hypothetical protein | |
| 1252 | CABMAB010000008.1 | GCA902384065_00632 | CDS | open | 10598-11647 | _na 349_aa | ABC transporter ATP-binding protein | |
| 1253 | CABMAB010000008.1 | GCA902384065_00633 | CDS | open | 11742-11921 | _na 59_aa | hypothetical protein | |
| 1254 | CABMAB010000008.1 | GCA902384065_00634 | CDS | open | 12286-13053 | _na 255_aa | hypothetical protein | |
| 1255 | CABMAB010000008.1 | GCA902384065_00635 | CDS | open | 13208-13810 | _na 200_aa | hypothetical protein | |
| 1256 | CABMAB010000008.1 | GCA902384065_00636 | CDS | open | 13904-14242 | _na 112_aa | UPF0145 protein SCO3412 | |
| 1257 | CABMAB010000008.1 | GCA902384065_00637 | CDS | open | 14574-15560 | _na 328_aa | hypothetical protein | |
| 1258 | CABMAB010000008.1 | GCA902384065_00638 | CDS | open | 15625-16479 | _na 284_aa | hypothetical protein | |
| 1259 | CABMAB010000008.1 | GCA902384065_00639 | CDS | open | 16534-16689 | _na 51_aa | hypothetical protein | |
| 1260 | CABMAB010000008.1 | GCA902384065_00640 | CDS | open | 16742-16861 | _na 39_aa | hypothetical protein | |
| 1261 | CABMAB010000008.1 | GCA902384065_00641 | CDS | open | 17035-17892 | _na 285_aa | hypothetical protein | |
| 1262 | CABMAB010000008.1 | GCA902384065_00642 | CDS | open | 18136-18699 | _na 187_aa | hypothetical protein | |
| 1263 | CABMAB010000008.1 | GCA902384065_00643 | CDS | open | 18739-19125 | _na 128_aa | hypothetical protein | |
| 1264 | CABMAB010000008.1 | GCA902384065_00644 | CDS | open | 19614-20393 | _na 259_aa | Polyketide biosynthesis methyltransferase | |
| 1265 | CABMAB010000008.1 | GCA902384065_00645 | CDS | open | 21363-21980 | _na 205_aa | hypothetical protein | |
| 1266 | CABMAB010000008.1 | GCA902384065_00646 | CDS | open | 22022-22732 | _na 236_aa | hypothetical protein | |
| 1267 | CABMAB010000008.1 | GCA902384065_00647 | CDS | open | 22773-23216 | _na 147_aa | hypothetical protein | |
| 1268 | CABMAB010000008.1 | GCA902384065_00648 | CDS | open | 23256-24194 | _na 312_aa | hypothetical protein | |
| 1269 | CABMAB010000008.1 | GCA902384065_00649 | CDS | open | 24389-24850 | _na 153_aa | hypothetical protein | |
| 1270 | CABMAB010000008.1 | GCA902384065_00650 | CDS | open | 24917-25399 | _na 160_aa | hypothetical protein | |
| 1271 | CABMAB010000008.1 | GCA902384065_00651 | CDS | open | 25624-26031 | _na 135_aa | hypothetical protein | |
| 1272 | CABMAB010000008.1 | GCA902384065_00652 | CDS | open | 26874-27722 | _na 282_aa | hypothetical protein | |
| 1273 | CABMAB010000008.1 | GCA902384065_00653 | CDS | open | 27730-28485 | _na 251_aa | Site-specific DNA-methyltransferase (adenine-specific) | |
| 1274 | CABMAB010000008.1 | GCA902384065_00654 | CDS | open | 28485-28667 | _na 60_aa | hypothetical protein | |
| 1275 | CABMAB010000008.1 | GCA902384065_00655 | CDS | open | 28795-29166 | _na 123_aa | hypothetical protein | |
| 1276 | CABMAB010000008.1 | GCA902384065_00656 | CDS | open | 29445-30230 | _na 261_aa | hypothetical protein | |
| 1277 | CABMAB010000008.1 | GCA902384065_00657 | CDS | open | 30238-30969 | _na 243_aa | hypothetical protein | |
| 1278 | CABMAB010000008.1 | GCA902384065_00658 | CDS | open | 30972-31175 | _na 67_aa | hypothetical protein | |
| 1279 | CABMAB010000008.1 | GCA902384065_00659 | CDS | open | 31788-32354 | _na 188_aa | Flavin reductase like domain-containing protein | |
| 1280 | CABMAB010000008.1 | GCA902384065_00660 | CDS | open | 32637-32744 | _na 35_aa | hypothetical protein | |
| 1281 | CABMAB010000008.1 | GCA902384065_00661 | CDS | open | 33020-33193 | _na 57_aa | hypothetical protein | |
| 1282 | CABMAB010000008.1 | GCA902384065_00662 | CDS | open | 33168-33407 | _na 79_aa | hypothetical protein | |
| 1283 | CABMAB010000008.1 | GCA902384065_00663 | CDS | open | 33807-34388 | _na 193_aa | TIGR02185 protein | |
| 1284 | CABMAB010000008.1 | GCA902384065_00664 | CDS | open | 34397-35140 | _na 247_aa | hypothetical protein | |
| 1285 | CABMAB010000008.1 | GCA902384065_00665 | CDS | open | 35133-36119 | _na 328_aa | hypothetical protein | |
| 1286 | CABMAB010000008.1 | GCA902384065_00666 | CDS | open | 36131-36568 | _na 145_aa | ABC transporter domain-containing protein | |
| 1287 | CABMAB010000008.1 | GCA902384065_00667 | CDS | open | 36545-39097 | _na 850_aa | hypothetical protein | |
| 1288 | CABMAB010000008.1 | GCA902384065_00668 | CDS | open | 39209-39769 | _na 186_aa | hypothetical protein | |
| 1289 | CABMAB010000008.1 | GCA902384065_00669 | CDS | open | 40839-41396 | _na 185_aa | Rubrerythrin family protein | |
| 1290 | CABMAB010000008.1 | GCA902384065_00670 | CDS | open | 41515-41991 | _na 158_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 1291 | CABMAB010000008.1 | GCA902384065_00671 | CDS | open | 42006-42311 | _na 101_aa | hypothetical protein | |
| 1292 | CABMAB010000008.1 | GCA902384065_00672 | CDS | open | 42459-43112 | _na 217_aa | hypothetical protein | |
| 1293 | CABMAB010000008.1 | GCA902384065_00673 | CDS | open | 43112-43903 | _na 263_aa | ModB2: putative molybdenum transport system permease protein | |
| 1294 | CABMAB010000008.1 | GCA902384065_00674 | CDS | open | 43922-44710 | _na 262_aa | hypothetical protein | |
| 1295 | CABMAB010000008.1 | GCA902384065_00675 | CDS | open | 45179-45883 | _na 234_aa | ABC transporter domain-containing protein | |
| 1296 | CABMAB010000008.1 | GCA902384065_00676 | CDS | open | 45867-48164 | _na 765_aa | hypothetical protein | |
| 1297 | CABMAB010000008.1 | GCA902384065_00677 | CDS | open | 51449-51679 | _na 76_aa | hypothetical protein | |
| 1298 | CABMAB010000008.1 | GCA902384065_00678 | CDS | open | 51679-52068 | _na 129_aa | hypothetical protein | |
| 1299 | CABMAB010000008.1 | GCA902384065_00679 | CDS | open | 53129-54229 | _na 366_aa | hypothetical protein | |
| 1300 | CABMAB010000008.1 | GCA902384065_00680 | CDS | open | 54238-54720 | _na 160_aa | hypothetical protein | |
| 1301 | CABMAB010000008.1 | GCA902384065_00681 | CDS | open | 55207-56331 | _na 374_aa | hypothetical protein | |
| 1302 | CABMAB010000008.1 | GCA902384065_00682 | CDS | open | 56403-56621 | _na 72_aa | hypothetical protein | |
| 1303 | CABMAB010000008.1 | GCA902384065_00683 | CDS | open | 56938-57477 | _na 179_aa | Glutathione peroxidase | |
| 1304 | CABMAB010000008.1 | GCA902384065_00684 | CDS | open | 57708-57902 | _na 64_aa | hypothetical protein | |
| 1305 | CABMAB010000008.1 | GCA902384065_00685 | CDS | open | 58099-58905 | _na 268_aa | hypothetical protein | |
| 1306 | CABMAB010000008.1 | GCA902384065_00686 | CDS | open | 59365-59517 | _na 50_aa | hypothetical protein | |
| 1307 | CABMAB010000008.1 | GCA902384065_00687 | CDS | open | 59520-59711 | _na 63_aa | hypothetical protein | |
| 1308 | CABMAB010000008.1 | GCA902384065_00688 | CDS | open | 59885-61312 | _na 475_aa | hypothetical protein | |
| 1309 | CABMAB010000008.1 | GCA902384065_00689 | CDS | open | 61454-62578 | _na 374_aa | hypothetical protein | |
| 1310 | CABMAB010000008.1 | GCA902384065_00690 | CDS | open | 62594-63775 | _na 393_aa | Saccharopine dehydrogenase NADP binding domain-containing protein | |
| 1311 | CABMAB010000008.1 | GCA902384065_00691 | CDS | open | 63777-64547 | _na 256_aa | hypothetical protein | |
| 1312 | CABMAB010000008.1 | GCA902384065_00692 | CDS | open | 64634-65554 | _na 306_aa | hypothetical protein | |
| 1313 | CABMAB010000008.1 | GCA902384065_00693 | CDS | open | 65575-66180 | _na 201_aa | Phosphodiesterase family protein | |
| 1314 | CABMAB010000008.1 | GCA902384065_00694 | CDS | open | 66201-66305 | _na 34_aa | hypothetical protein | |
| 1315 | CABMAB010000008.1 | GCA902384065_00695 | CDS | open | 66315-66710 | _na 131_aa | Phosphoenolpyruvate phosphomutase | |
| 1316 | CABMAB010000008.1 | GCA902384065_00696 | CDS | open | 66767-67621 | _na 284_aa | hypothetical protein | |
| 1317 | CABMAB010000008.1 | GCA902384065_00697 | CDS | open | 67779-68609 | _na 276_aa | hypothetical protein | |
| 1318 | CABMAB010000008.1 | GCA902384065_00698 | CDS | open | 68623-69396 | _na 257_aa | hypothetical protein | |
| 1319 | CABMAB010000008.1 | GCA902384065_00699 | CDS | open | 69473-70168 | _na 231_aa | hypothetical protein | |
| 1320 | CABMAB010000008.1 | GCA902384065_00700 | CDS | open | 70178-71146 | _na 322_aa | hypothetical protein | |
| 1321 | CABMAB010000008.1 | GCA902384065_00701 | CDS | open | 71279-71599 | _na 106_aa | Guanidinium exporter | |
| 1322 | CABMAB010000008.1 | GCA902384065_00702 | CDS | open | 71647-72063 | _na 138_aa | hypothetical protein | |
| 1323 | CABMAB010000008.1 | GCA902384065_00703 | CDS | open | 72025-72918 | _na 297_aa | hypothetical protein | |
| 1324 | CABMAB010000008.1 | GCA902384065_00704 | CDS | open | 72975-73526 | _na 183_aa | mntP | Putative manganese efflux pump MntP |
| 1325 | CABMAB010000008.1 | GCA902384065_00705 | CDS | open | 73907-74401 | _na 164_aa | hypothetical protein | |
| 1326 | CABMAB010000008.1 | GCA902384065_00706 | CDS | open | 74428-75483 | _na 351_aa | hypothetical protein | |
| 1327 | CABMAB010000008.1 | GCA902384065_00707 | CDS | open | 75542-76528 | _na 328_aa | hypothetical protein | |
| 1328 | CABMAB010000008.1 | GCA902384065_00708 | CDS | open | 76739-77422 | _na 227_aa | ABC-type polar amino acid transport system%2C ATPase component | |
| 1329 | CABMAB010000008.1 | GCA902384065_00709 | CDS | open | 77435-78085 | _na 216_aa | ABC transmembrane type-1 domain-containing protein | |
| 1330 | CABMAB010000008.1 | GCA902384065_00710 | CDS | open | 78223-78942 | _na 239_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 1331 | CABMAB010000008.1 | GCA902384065_00711 | CDS | open | 79051-79728 | _na 225_aa | hypothetical protein | |
| 1332 | CABMAB010000008.1 | GCA902384065_00712 | CDS | open | 79859-79972 | _na 37_aa | hypothetical protein | |
| 1333 | CABMAB010000008.1 | GCA902384065_00713 | CDS | open | 80330-81370 | _na 346_aa | hypothetical protein | |
| 1334 | CABMAB010000008.1 | GCA902384065_00714 | CDS | open | 81379-82740 | _na 453_aa | hypothetical protein | |
| 1335 | CABMAB010000008.1 | GCA902384065_00715 | CDS | open | 82744-83556 | _na 270_aa | hypothetical protein | |
| 1336 | CABMAB010000008.1 | GCA902384065_00716 | CDS | open | 83598-85331 | _na 577_aa | hypothetical protein | |
| 1337 | CABMAB010000008.1 | GCA902384065_00717 | CDS | open | 85335-86450 | _na 371_aa | hypothetical protein | |
| 1338 | CABMAB010000008.1 | GCA902384065_00718 | CDS | open | 86443-86742 | _na 99_aa | hypothetical protein | |
| 1339 | CABMAB010000008.1 | GCA902384065_00719 | CDS | open | 86805-87584 | _na 259_aa | hypothetical protein | |
| 1340 | CABMAB010000008.1 | GCA902384065_00720 | CDS | open | 87595-88614 | _na 339_aa | hypothetical protein | |
| 1341 | CABMAB010000008.1 | GCA902384065_00620 | gene | open | 164-496 | |||
| 1342 | CABMAB010000008.1 | GCA902384065_00621 | gene | open | 762-1166 | |||
| 1343 | CABMAB010000008.1 | GCA902384065_00622 | gene | open | 1402-3066 | |||
| 1344 | CABMAB010000008.1 | GCA902384065_00623 | gene | open | 3077-3646 | |||
| 1345 | CABMAB010000008.1 | GCA902384065_00624 | gene | open | 3805-4383 | |||
| 1346 | CABMAB010000008.1 | GCA902384065_00625 | gene | open | 4380-5105 | |||
| 1347 | CABMAB010000008.1 | GCA902384065_00626 | gene | open | 5536-6081 | |||
| 1348 | CABMAB010000008.1 | GCA902384065_00627 | gene | open | 6361-6672 | |||
| 1349 | CABMAB010000008.1 | GCA902384065_00628 | gene | open | 6997-7284 | |||
| 1350 | CABMAB010000008.1 | GCA902384065_00629 | gene | open | 7497-7784 | |||
| 1351 | CABMAB010000008.1 | GCA902384065_00630 | gene | open | 8099-9898 | irtA | ||
| 1352 | CABMAB010000008.1 | GCA902384065_00631 | gene | open | 9891-10562 | |||
| 1353 | CABMAB010000008.1 | GCA902384065_00632 | gene | open | 10598-11647 | |||
| 1354 | CABMAB010000008.1 | GCA902384065_00633 | gene | open | 11742-11921 | |||
| 1355 | CABMAB010000008.1 | GCA902384065_00634 | gene | open | 12286-13053 | |||
| 1356 | CABMAB010000008.1 | GCA902384065_00635 | gene | open | 13208-13810 | |||
| 1357 | CABMAB010000008.1 | GCA902384065_00636 | gene | open | 13904-14242 | |||
| 1358 | CABMAB010000008.1 | GCA902384065_00637 | gene | open | 14574-15560 | |||
| 1359 | CABMAB010000008.1 | GCA902384065_00638 | gene | open | 15625-16479 | |||
| 1360 | CABMAB010000008.1 | GCA902384065_00639 | gene | open | 16534-16689 | |||
| 1361 | CABMAB010000008.1 | GCA902384065_00640 | gene | open | 16742-16861 | |||
| 1362 | CABMAB010000008.1 | GCA902384065_00641 | gene | open | 17035-17892 | |||
| 1363 | CABMAB010000008.1 | GCA902384065_00642 | gene | open | 18136-18699 | |||
| 1364 | CABMAB010000008.1 | GCA902384065_00643 | gene | open | 18739-19125 | |||
| 1365 | CABMAB010000008.1 | GCA902384065_00644 | gene | open | 19614-20393 | |||
| 1366 | CABMAB010000008.1 | GCA902384065_00645 | gene | open | 21363-21980 | |||
| 1367 | CABMAB010000008.1 | GCA902384065_00646 | gene | open | 22022-22732 | |||
| 1368 | CABMAB010000008.1 | GCA902384065_00647 | gene | open | 22773-23216 | |||
| 1369 | CABMAB010000008.1 | GCA902384065_00648 | gene | open | 23256-24194 | |||
| 1370 | CABMAB010000008.1 | GCA902384065_00649 | gene | open | 24389-24850 | |||
| 1371 | CABMAB010000008.1 | GCA902384065_00650 | gene | open | 24917-25399 | |||
| 1372 | CABMAB010000008.1 | GCA902384065_00651 | gene | open | 25624-26031 | |||
| 1373 | CABMAB010000008.1 | GCA902384065_00652 | gene | open | 26874-27722 | |||
| 1374 | CABMAB010000008.1 | GCA902384065_00653 | gene | open | 27730-28485 | |||
| 1375 | CABMAB010000008.1 | GCA902384065_00654 | gene | open | 28485-28667 | |||
| 1376 | CABMAB010000008.1 | GCA902384065_00655 | gene | open | 28795-29166 | |||
| 1377 | CABMAB010000008.1 | GCA902384065_00656 | gene | open | 29445-30230 | |||
| 1378 | CABMAB010000008.1 | GCA902384065_00657 | gene | open | 30238-30969 | |||
| 1379 | CABMAB010000008.1 | GCA902384065_00658 | gene | open | 30972-31175 | |||
| 1380 | CABMAB010000008.1 | GCA902384065_00659 | gene | open | 31788-32354 | |||
| 1381 | CABMAB010000008.1 | GCA902384065_00660 | gene | open | 32637-32744 | |||
| 1382 | CABMAB010000008.1 | GCA902384065_00661 | gene | open | 33020-33193 | |||
| 1383 | CABMAB010000008.1 | GCA902384065_00662 | gene | open | 33168-33407 | |||
| 1384 | CABMAB010000008.1 | GCA902384065_00663 | gene | open | 33807-34388 | |||
| 1385 | CABMAB010000008.1 | GCA902384065_00664 | gene | open | 34397-35140 | |||
| 1386 | CABMAB010000008.1 | GCA902384065_00665 | gene | open | 35133-36119 | |||
| 1387 | CABMAB010000008.1 | GCA902384065_00666 | gene | open | 36131-36568 | |||
| 1388 | CABMAB010000008.1 | GCA902384065_00667 | gene | open | 36545-39097 | |||
| 1389 | CABMAB010000008.1 | GCA902384065_00668 | gene | open | 39209-39769 | |||
| 1390 | CABMAB010000008.1 | GCA902384065_00669 | gene | open | 40839-41396 | |||
| 1391 | CABMAB010000008.1 | GCA902384065_00670 | gene | open | 41515-41991 | |||
| 1392 | CABMAB010000008.1 | GCA902384065_00671 | gene | open | 42006-42311 | |||
| 1393 | CABMAB010000008.1 | GCA902384065_00672 | gene | open | 42459-43112 | |||
| 1394 | CABMAB010000008.1 | GCA902384065_00673 | gene | open | 43112-43903 | |||
| 1395 | CABMAB010000008.1 | GCA902384065_00674 | gene | open | 43922-44710 | |||
| 1396 | CABMAB010000008.1 | GCA902384065_00675 | gene | open | 45179-45883 | |||
| 1397 | CABMAB010000008.1 | GCA902384065_00676 | gene | open | 45867-48164 | |||
| 1398 | CABMAB010000008.1 | GCA902384065_00677 | gene | open | 51449-51679 | |||
| 1399 | CABMAB010000008.1 | GCA902384065_00678 | gene | open | 51679-52068 | |||
| 1400 | CABMAB010000008.1 | GCA902384065_00679 | gene | open | 53129-54229 | |||
| 1401 | CABMAB010000008.1 | GCA902384065_00680 | gene | open | 54238-54720 | |||
| 1402 | CABMAB010000008.1 | GCA902384065_00681 | gene | open | 55207-56331 | |||
| 1403 | CABMAB010000008.1 | GCA902384065_00682 | gene | open | 56403-56621 | |||
| 1404 | CABMAB010000008.1 | GCA902384065_00683 | gene | open | 56938-57477 | |||
| 1405 | CABMAB010000008.1 | GCA902384065_00684 | gene | open | 57708-57902 | |||
| 1406 | CABMAB010000008.1 | GCA902384065_00685 | gene | open | 58099-58905 | |||
| 1407 | CABMAB010000008.1 | GCA902384065_00686 | gene | open | 59365-59517 | |||
| 1408 | CABMAB010000008.1 | GCA902384065_00687 | gene | open | 59520-59711 | |||
| 1409 | CABMAB010000008.1 | GCA902384065_00688 | gene | open | 59885-61312 | |||
| 1410 | CABMAB010000008.1 | GCA902384065_00689 | gene | open | 61454-62578 | |||
| 1411 | CABMAB010000008.1 | GCA902384065_00690 | gene | open | 62594-63775 | |||
| 1412 | CABMAB010000008.1 | GCA902384065_00691 | gene | open | 63777-64547 | |||
| 1413 | CABMAB010000008.1 | GCA902384065_00692 | gene | open | 64634-65554 | |||
| 1414 | CABMAB010000008.1 | GCA902384065_00693 | gene | open | 65575-66180 | |||
| 1415 | CABMAB010000008.1 | GCA902384065_00694 | gene | open | 66201-66305 | |||
| 1416 | CABMAB010000008.1 | GCA902384065_00695 | gene | open | 66315-66710 | |||
| 1417 | CABMAB010000008.1 | GCA902384065_00696 | gene | open | 66767-67621 | |||
| 1418 | CABMAB010000008.1 | GCA902384065_00697 | gene | open | 67779-68609 | |||
| 1419 | CABMAB010000008.1 | GCA902384065_00698 | gene | open | 68623-69396 | |||
| 1420 | CABMAB010000008.1 | GCA902384065_00699 | gene | open | 69473-70168 | |||
| 1421 | CABMAB010000008.1 | GCA902384065_00700 | gene | open | 70178-71146 | |||
| 1422 | CABMAB010000008.1 | GCA902384065_00701 | gene | open | 71279-71599 | |||
| 1423 | CABMAB010000008.1 | GCA902384065_00702 | gene | open | 71647-72063 | |||
| 1424 | CABMAB010000008.1 | GCA902384065_00703 | gene | open | 72025-72918 | |||
| 1425 | CABMAB010000008.1 | GCA902384065_00704 | gene | open | 72975-73526 | mntP | ||
| 1426 | CABMAB010000008.1 | GCA902384065_00705 | gene | open | 73907-74401 | |||
| 1427 | CABMAB010000008.1 | GCA902384065_00706 | gene | open | 74428-75483 | |||
| 1428 | CABMAB010000008.1 | GCA902384065_00707 | gene | open | 75542-76528 | |||
| 1429 | CABMAB010000008.1 | GCA902384065_00708 | gene | open | 76739-77422 | |||
| 1430 | CABMAB010000008.1 | GCA902384065_00709 | gene | open | 77435-78085 | |||
| 1431 | CABMAB010000008.1 | GCA902384065_00710 | gene | open | 78223-78942 | |||
| 1432 | CABMAB010000008.1 | GCA902384065_00711 | gene | open | 79051-79728 | |||
| 1433 | CABMAB010000008.1 | GCA902384065_00712 | gene | open | 79859-79972 | |||
| 1434 | CABMAB010000008.1 | GCA902384065_00713 | gene | open | 80330-81370 | |||
| 1435 | CABMAB010000008.1 | GCA902384065_00714 | gene | open | 81379-82740 | |||
| 1436 | CABMAB010000008.1 | GCA902384065_00715 | gene | open | 82744-83556 | |||
| 1437 | CABMAB010000008.1 | GCA902384065_00716 | gene | open | 83598-85331 | |||
| 1438 | CABMAB010000008.1 | GCA902384065_00717 | gene | open | 85335-86450 | |||
| 1439 | CABMAB010000008.1 | GCA902384065_00718 | gene | open | 86443-86742 | |||
| 1440 | CABMAB010000008.1 | GCA902384065_00719 | gene | open | 86805-87584 | |||
| 1441 | CABMAB010000008.1 | GCA902384065_00720 | gene | open | 87595-88614 | |||
| 1442 | CABMAB010000009.1 | GCA902384065_00721 | CDS | open | 210-1973 | _na 587_aa | hypothetical protein | |
| 1443 | CABMAB010000009.1 | GCA902384065_00722 | CDS | open | 2028-2252 | _na 74_aa | hypothetical protein | |
| 1444 | CABMAB010000009.1 | GCA902384065_00723 | CDS | open | 2249-2500 | _na 83_aa | hypothetical protein | |
| 1445 | CABMAB010000009.1 | GCA902384065_00721 | gene | open | 210-1973 | |||
| 1446 | CABMAB010000009.1 | GCA902384065_00722 | gene | open | 2028-2252 | |||
| 1447 | CABMAB010000009.1 | GCA902384065_00723 | gene | open | 2249-2500 | |||
| 1448 | CABMAB010000010.1 | GCA902384065_00724 | CDS | open | 1492-2577 | _na 361_aa | hypothetical protein | |
| 1449 | CABMAB010000010.1 | GCA902384065_00725 | CDS | open | 2619-2825 | _na 68_aa | hypothetical protein | |
| 1450 | CABMAB010000010.1 | GCA902384065_00726 | CDS | open | 2846-4063 | _na 405_aa | hypothetical protein | |
| 1451 | CABMAB010000010.1 | GCA902384065_00727 | CDS | open | 4080-5390 | _na 436_aa | hypothetical protein | |
| 1452 | CABMAB010000010.1 | GCA902384065_00728 | CDS | open | 5462-5920 | _na 152_aa | hypothetical protein | |
| 1453 | CABMAB010000010.1 | GCA902384065_00729 | CDS | open | 5939-7264 | _na 441_aa | Carbamoylphosphate synthase large subunit short form | |
| 1454 | CABMAB010000010.1 | GCA902384065_00730 | CDS | open | 7338-9050 | _na 570_aa | hypothetical protein | |
| 1455 | CABMAB010000010.1 | GCA902384065_00731 | CDS | open | 9083-10111 | _na 342_aa | DegT/DnrJ/EryC1/StrS aminotransferase | |
| 1456 | CABMAB010000010.1 | GCA902384065_00732 | CDS | open | 10051-10212 | _na 53_aa | hypothetical protein | |
| 1457 | CABMAB010000010.1 | GCA902384065_00733 | CDS | open | 10359-10841 | _na 160_aa | hypothetical protein | |
| 1458 | CABMAB010000010.1 | GCA902384065_00734 | CDS | open | 10838-12043 | _na 401_aa | hypothetical protein | |
| 1459 | CABMAB010000010.1 | GCA902384065_00735 | CDS | open | 12088-12507 | _na 139_aa | hypothetical protein | |
| 1460 | CABMAB010000010.1 | GCA902384065_00736 | CDS | open | 12532-13287 | _na 251_aa | CDP-glycerol glycerophosphotransferase family protein | |
| 1461 | CABMAB010000010.1 | GCA902384065_00737 | CDS | open | 13314-14117 | _na 267_aa | hypothetical protein | |
| 1462 | CABMAB010000010.1 | GCA902384065_00738 | CDS | open | 14117-14749 | _na 210_aa | hypothetical protein | |
| 1463 | CABMAB010000010.1 | GCA902384065_00739 | CDS | open | 14850-16655 | _na 601_aa | hypothetical protein | |
| 1464 | CABMAB010000010.1 | GCA902384065_00740 | CDS | open | 16702-17082 | _na 126_aa | hypothetical protein | |
| 1465 | CABMAB010000010.1 | GCA902384065_00741 | CDS | open | 17274-17525 | _na 83_aa | hypothetical protein | |
| 1466 | CABMAB010000010.1 | GCA902384065_00742 | CDS | open | 19182-19913 | _na 243_aa | hypothetical protein | |
| 1467 | CABMAB010000010.1 | GCA902384065_00743 | CDS | open | 19923-20330 | _na 135_aa | hypothetical protein | |
| 1468 | CABMAB010000010.1 | GCA902384065_00744 | CDS | open | 20486-21208 | _na 240_aa | hypothetical protein | |
| 1469 | CABMAB010000010.1 | GCA902384065_00745 | CDS | open | 21352-22443 | _na 363_aa | Cation transporter | |
| 1470 | CABMAB010000010.1 | GCA902384065_00746 | CDS | open | 22440-23018 | _na 192_aa | hypothetical protein | |
| 1471 | CABMAB010000010.1 | GCA902384065_00747 | CDS | open | 23096-23794 | _na 232_aa | hypothetical protein | |
| 1472 | CABMAB010000010.1 | GCA902384065_00748 | CDS | open | 23801-27307 | _na 1168_aa | hypothetical protein | |
| 1473 | CABMAB010000010.1 | GCA902384065_00749 | CDS | open | 27414-28187 | _na 257_aa | hypothetical protein | |
| 1474 | CABMAB010000010.1 | GCA902384065_00750 | CDS | open | 28289-29413 | _na 374_aa | hypothetical protein | |
| 1475 | CABMAB010000010.1 | GCA902384065_00751 | CDS | open | 29391-30833 | _na 480_aa | hypothetical protein | |
| 1476 | CABMAB010000010.1 | GCA902384065_00752 | CDS | open | 30952-31248 | _na 98_aa | hypothetical protein | |
| 1477 | CABMAB010000010.1 | GCA902384065_00753 | CDS | open | 31261-31935 | _na 224_aa | hypothetical protein | |
| 1478 | CABMAB010000010.1 | GCA902384065_00754 | CDS | open | 32005-33081 | _na 358_aa | NADP-dependent isopropanol dehydrogenase | |
| 1479 | CABMAB010000010.1 | GCA902384065_00755 | CDS | open | 34376-34996 | _na 206_aa | hypothetical protein | |
| 1480 | CABMAB010000010.1 | GCA902384065_00724 | gene | open | 1492-2577 | |||
| 1481 | CABMAB010000010.1 | GCA902384065_00725 | gene | open | 2619-2825 | |||
| 1482 | CABMAB010000010.1 | GCA902384065_00726 | gene | open | 2846-4063 | |||
| 1483 | CABMAB010000010.1 | GCA902384065_00727 | gene | open | 4080-5390 | |||
| 1484 | CABMAB010000010.1 | GCA902384065_00728 | gene | open | 5462-5920 | |||
| 1485 | CABMAB010000010.1 | GCA902384065_00729 | gene | open | 5939-7264 | |||
| 1486 | CABMAB010000010.1 | GCA902384065_00730 | gene | open | 7338-9050 | |||
| 1487 | CABMAB010000010.1 | GCA902384065_00731 | gene | open | 9083-10111 | |||
| 1488 | CABMAB010000010.1 | GCA902384065_00732 | gene | open | 10051-10212 | |||
| 1489 | CABMAB010000010.1 | GCA902384065_00733 | gene | open | 10359-10841 | |||
| 1490 | CABMAB010000010.1 | GCA902384065_00734 | gene | open | 10838-12043 | |||
| 1491 | CABMAB010000010.1 | GCA902384065_00735 | gene | open | 12088-12507 | |||
| 1492 | CABMAB010000010.1 | GCA902384065_00736 | gene | open | 12532-13287 | |||
| 1493 | CABMAB010000010.1 | GCA902384065_00737 | gene | open | 13314-14117 | |||
| 1494 | CABMAB010000010.1 | GCA902384065_00738 | gene | open | 14117-14749 | |||
| 1495 | CABMAB010000010.1 | GCA902384065_00739 | gene | open | 14850-16655 | |||
| 1496 | CABMAB010000010.1 | GCA902384065_00740 | gene | open | 16702-17082 | |||
| 1497 | CABMAB010000010.1 | GCA902384065_00741 | gene | open | 17274-17525 | |||
| 1498 | CABMAB010000010.1 | GCA902384065_00742 | gene | open | 19182-19913 | |||
| 1499 | CABMAB010000010.1 | GCA902384065_00743 | gene | open | 19923-20330 | |||
| 1500 | CABMAB010000010.1 | GCA902384065_00744 | gene | open | 20486-21208 |
