BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_902387035.1)
Select a Genome:
|
BAKTA Annotations for GCA_902387035.1
|
Search & Sort all 3910 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | CABMKQ010000004.1 | GCA902387035_00252 | CDS | open | 2082-2261 | _na 59_aa | hypothetical protein | |
| 502 | CABMKQ010000004.1 | GCA902387035_00253 | CDS | open | 2262-2507 | _na 81_aa | HTH cro/C1-type domain-containing protein | |
| 503 | CABMKQ010000004.1 | GCA902387035_00254 | CDS | open | 2875-3669 | _na 264_aa | hrcA | HrcA family transcriptional regulator |
| 504 | CABMKQ010000004.1 | GCA902387035_00255 | CDS | open | 3666-4208 | _na 180_aa | grpE | nucleotide exchange factor GrpE |
| 505 | CABMKQ010000004.1 | GCA902387035_00256 | CDS | open | 4240-6114 | _na 624_aa | dnaK | molecular chaperone DnaK |
| 506 | CABMKQ010000004.1 | GCA902387035_00257 | CDS | open | 6241-6672 | _na 143_aa | Trehalose-6-phosphate synthase | |
| 507 | CABMKQ010000004.1 | GCA902387035_00258 | CDS | open | 6724-7533 | _na 269_aa | ppk2 | polyphosphate kinase 2 |
| 508 | CABMKQ010000004.1 | GCA902387035_00250 | gene | open | 119-1234 | thrC | ||
| 509 | CABMKQ010000004.1 | GCA902387035_00251 | gene | open | 1231-1944 | kdsB | ||
| 510 | CABMKQ010000004.1 | GCA902387035_00252 | gene | open | 2082-2261 | |||
| 511 | CABMKQ010000004.1 | GCA902387035_00253 | gene | open | 2262-2507 | |||
| 512 | CABMKQ010000004.1 | GCA902387035_00254 | gene | open | 2875-3669 | hrcA | ||
| 513 | CABMKQ010000004.1 | GCA902387035_00255 | gene | open | 3666-4208 | grpE | ||
| 514 | CABMKQ010000004.1 | GCA902387035_00256 | gene | open | 4240-6114 | dnaK | ||
| 515 | CABMKQ010000004.1 | GCA902387035_00257 | gene | open | 6241-6672 | |||
| 516 | CABMKQ010000004.1 | GCA902387035_00258 | gene | open | 6724-7533 | ppk2 | ||
| 517 | CABMKQ010000005.1 | repeat_region | open | 6829-6958 | CRISPR array with 3 repeats of length 24%2C consensus sequence GATGAAAAAAGATGACATGGGCAA and spacer length 24 | |||
| 518 | CABMKQ010000005.1 | GCA902387035_00259 | CDS | open | 69-2384 | _na 771_aa | flgL | flagellar hook-associated protein FlgL |
| 519 | CABMKQ010000005.1 | GCA902387035_00260 | CDS | open | 2524-3270 | _na 248_aa | yaaA | Peroxide stress protein YaaA |
| 520 | CABMKQ010000005.1 | GCA902387035_00261 | CDS | open | 3394-3696 | _na 100_aa | DNA-binding protein HU | |
| 521 | CABMKQ010000005.1 | GCA902387035_00263 | CDS | open | 3923-5692 | _na 589_aa | Response regulator | |
| 522 | CABMKQ010000005.1 | GCA902387035_00264 | CDS | open | 5790-6695 | _na 301_aa | Auxin efflux carrier | |
| 523 | CABMKQ010000005.1 | GCA902387035_00265 | CDS | open | 7022-7684 | _na 220_aa | Two-component system response regulator | |
| 524 | CABMKQ010000005.1 | GCA902387035_00266 | CDS | open | 7677-8846 | _na 389_aa | histidine kinase | |
| 525 | CABMKQ010000005.1 | GCA902387035_00267 | CDS | open | 8975-10450 | _na 491_aa | Aldehyde dehydrogenase B | |
| 526 | CABMKQ010000005.1 | GCA902387035_00268 | CDS | open | 10628-11329 | _na 233_aa | Metallophosphatase | |
| 527 | CABMKQ010000005.1 | GCA902387035_00269 | CDS | open | 11332-12357 | _na 341_aa | hypothetical protein | |
| 528 | CABMKQ010000005.1 | GCA902387035_00270 | CDS | open | 12448-13221 | _na 257_aa | brkB | Virulence factor%2C BrkB family protein |
| 529 | CABMKQ010000005.1 | GCA902387035_00271 | CDS | open | 13273-13995 | _na 240_aa | pgbA | Plasminogen-binding protein PgbA N-terminal domain-containing protein |
| 530 | CABMKQ010000005.1 | GCA902387035_00272 | CDS | open | 14109-15278 | _na 389_aa | Endopeptidase | |
| 531 | CABMKQ010000005.1 | GCA902387035_00273 | CDS | open | 15288-16655 | _na 455_aa | mgtE | magnesium transporter |
| 532 | CABMKQ010000005.1 | GCA902387035_00274 | CDS | open | 16640-17224 | _na 194_aa | Uridine diphosphate glucose pyrophosphatase | |
| 533 | CABMKQ010000005.1 | GCA902387035_00259 | gene | open | 69-2384 | flgL | ||
| 534 | CABMKQ010000005.1 | GCA902387035_00260 | gene | open | 2524-3270 | yaaA | ||
| 535 | CABMKQ010000005.1 | GCA902387035_00261 | gene | open | 3394-3696 | |||
| 536 | CABMKQ010000005.1 | GCA902387035_00263 | gene | open | 3923-5692 | |||
| 537 | CABMKQ010000005.1 | GCA902387035_00264 | gene | open | 5790-6695 | |||
| 538 | CABMKQ010000005.1 | GCA902387035_00265 | gene | open | 7022-7684 | |||
| 539 | CABMKQ010000005.1 | GCA902387035_00266 | gene | open | 7677-8846 | |||
| 540 | CABMKQ010000005.1 | GCA902387035_00267 | gene | open | 8975-10450 | |||
| 541 | CABMKQ010000005.1 | GCA902387035_00268 | gene | open | 10628-11329 | |||
| 542 | CABMKQ010000005.1 | GCA902387035_00269 | gene | open | 11332-12357 | |||
| 543 | CABMKQ010000005.1 | GCA902387035_00270 | gene | open | 12448-13221 | brkB | ||
| 544 | CABMKQ010000005.1 | GCA902387035_00271 | gene | open | 13273-13995 | pgbA | ||
| 545 | CABMKQ010000005.1 | GCA902387035_00272 | gene | open | 14109-15278 | |||
| 546 | CABMKQ010000005.1 | GCA902387035_00273 | gene | open | 15288-16655 | mgtE | ||
| 547 | CABMKQ010000005.1 | GCA902387035_00274 | gene | open | 16640-17224 | |||
| 548 | CABMKQ010000005.1 | GCA902387035_00262 | gene | open | 3770-3856 | trnL | ||
| 549 | CABMKQ010000005.1 | GCA902387035_00262 | tRNA | open | 3770-3856 | trnL | tRNA-Leu(caa) | |
| 550 | CABMKQ010000006.1 | GCA902387035_00275 | CDS | open | 10-924 | _na 304_aa | hypothetical protein | |
| 551 | CABMKQ010000006.1 | GCA902387035_00276 | CDS | open | 1027-2565 | _na 512_aa | Phosphate transporter | |
| 552 | CABMKQ010000006.1 | GCA902387035_00277 | CDS | open | 2696-3598 | _na 300_aa | Exopolyphosphatase%2C Ppx/GppA family | |
| 553 | CABMKQ010000006.1 | GCA902387035_00278 | CDS | open | 3629-4060 | _na 143_aa | Glutamyl-tRNA amidotransferase | |
| 554 | CABMKQ010000006.1 | GCA902387035_00279 | CDS | open | 4716-6062 | _na 448_aa | TolC-like outer membrane efflux protein | |
| 555 | CABMKQ010000006.1 | GCA902387035_00280 | CDS | open | 6064-7992 | _na 642_aa | pvdT | Pyoverdine export ATP-binding/permease protein PvdT |
| 556 | CABMKQ010000006.1 | GCA902387035_00281 | CDS | open | 7993-9186 | _na 397_aa | Efflux transporter periplasmic adaptor subunit | |
| 557 | CABMKQ010000006.1 | GCA902387035_00282 | CDS | open | 9240-11273 | _na 677_aa | DNA 3'-5' helicase | |
| 558 | CABMKQ010000006.1 | GCA902387035_00283 | CDS | open | 11339-13507 | _na 722_aa | pbpC | penicillin-binding protein 1C |
| 559 | CABMKQ010000006.1 | GCA902387035_00275 | gene | open | 10-924 | |||
| 560 | CABMKQ010000006.1 | GCA902387035_00276 | gene | open | 1027-2565 | |||
| 561 | CABMKQ010000006.1 | GCA902387035_00277 | gene | open | 2696-3598 | |||
| 562 | CABMKQ010000006.1 | GCA902387035_00278 | gene | open | 3629-4060 | |||
| 563 | CABMKQ010000006.1 | GCA902387035_00279 | gene | open | 4716-6062 | |||
| 564 | CABMKQ010000006.1 | GCA902387035_00280 | gene | open | 6064-7992 | pvdT | ||
| 565 | CABMKQ010000006.1 | GCA902387035_00281 | gene | open | 7993-9186 | |||
| 566 | CABMKQ010000006.1 | GCA902387035_00282 | gene | open | 9240-11273 | |||
| 567 | CABMKQ010000006.1 | GCA902387035_00283 | gene | open | 11339-13507 | pbpC | ||
| 568 | CABMKQ010000007.1 | GCA902387035_00284 | CDS | open | 31-255 | _na 74_aa | DUF2798 domain-containing protein | |
| 569 | CABMKQ010000007.1 | GCA902387035_00285 | CDS | open | 349-993 | _na 214_aa | Desulforubrerythrin | |
| 570 | CABMKQ010000007.1 | GCA902387035_00286 | CDS | open | 1095-1385 | _na 96_aa | TonB-dependent receptor | |
| 571 | CABMKQ010000007.1 | GCA902387035_00287 | CDS | open | 1415-2983 | _na 522_aa | rmuC | DNA recombination protein RmuC |
| 572 | CABMKQ010000007.1 | GCA902387035_00288 | CDS | open | 3064-4737 | _na 557_aa | ilvD | dihydroxy-acid dehydratase |
| 573 | CABMKQ010000007.1 | GCA902387035_00289 | CDS | open | 4981-5184 | _na 67_aa | hypothetical protein | |
| 574 | CABMKQ010000007.1 | GCA902387035_00284 | gene | open | 31-255 | |||
| 575 | CABMKQ010000007.1 | GCA902387035_00285 | gene | open | 349-993 | |||
| 576 | CABMKQ010000007.1 | GCA902387035_00286 | gene | open | 1095-1385 | |||
| 577 | CABMKQ010000007.1 | GCA902387035_00287 | gene | open | 1415-2983 | rmuC | ||
| 578 | CABMKQ010000007.1 | GCA902387035_00288 | gene | open | 3064-4737 | ilvD | ||
| 579 | CABMKQ010000007.1 | GCA902387035_00289 | gene | open | 4981-5184 | |||
| 580 | CABMKQ010000009.1 | GCA902387035_00290 | CDS | open | 579-1871 | _na 430_aa | Peptidoglycan LD-carboxypeptidase | |
| 581 | CABMKQ010000009.1 | GCA902387035_00291 | CDS | open | 1871-3106 | _na 411_aa | Xanthine/uracil permease | |
| 582 | CABMKQ010000009.1 | GCA902387035_00292 | CDS | open | 3093-4190 | _na 365_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 583 | CABMKQ010000009.1 | GCA902387035_00293 | CDS | open | 4184-4915 | _na 243_aa | Phosphatidate cytidylyltransferase | |
| 584 | CABMKQ010000009.1 | GCA902387035_00294 | CDS | open | 5148-6047 | _na 299_aa | Mrr restriction system protein | |
| 585 | CABMKQ010000009.1 | GCA902387035_00295 | CDS | open | 6118-6369 | _na 83_aa | hypothetical protein | |
| 586 | CABMKQ010000009.1 | GCA902387035_00296 | CDS | open | 6410-7129 | _na 239_aa | fumarate reductase iron-sulfur subunit | |
| 587 | CABMKQ010000009.1 | GCA902387035_00297 | CDS | open | 7122-9140 | _na 672_aa | fumarate reductase flavoprotein subunit | |
| 588 | CABMKQ010000009.1 | GCA902387035_00298 | CDS | open | 9155-9853 | _na 232_aa | fumarate reductase cytochrome b subunit | |
| 589 | CABMKQ010000009.1 | GCA902387035_00299 | CDS | open | 9973-10788 | _na 271_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 590 | CABMKQ010000009.1 | GCA902387035_00300 | CDS | open | 10837-11289 | _na 150_aa | restriction endonuclease subunit S | |
| 591 | CABMKQ010000009.1 | GCA902387035_00301 | CDS | open | 11385-11648 | _na 87_aa | hypothetical protein | |
| 592 | CABMKQ010000009.1 | GCA902387035_00302 | CDS | open | 11658-14669 | _na 1003_aa | N-6 DNA methylase | |
| 593 | CABMKQ010000009.1 | GCA902387035_00303 | CDS | open | 14710-15351 | _na 213_aa | Impact N-terminal domain-containing protein | |
| 594 | CABMKQ010000009.1 | GCA902387035_00304 | CDS | open | 15477-16298 | _na 273_aa | galU | UTP--glucose-1-phosphate uridylyltransferase GalU |
| 595 | CABMKQ010000009.1 | GCA902387035_00305 | CDS | open | 16295-17515 | _na 406_aa | glucose-6-phosphate isomerase | |
| 596 | CABMKQ010000009.1 | GCA902387035_00290 | gene | open | 579-1871 | |||
| 597 | CABMKQ010000009.1 | GCA902387035_00291 | gene | open | 1871-3106 | |||
| 598 | CABMKQ010000009.1 | GCA902387035_00292 | gene | open | 3093-4190 | dxr | ||
| 599 | CABMKQ010000009.1 | GCA902387035_00293 | gene | open | 4184-4915 | |||
| 600 | CABMKQ010000009.1 | GCA902387035_00294 | gene | open | 5148-6047 | |||
| 601 | CABMKQ010000009.1 | GCA902387035_00295 | gene | open | 6118-6369 | |||
| 602 | CABMKQ010000009.1 | GCA902387035_00296 | gene | open | 6410-7129 | |||
| 603 | CABMKQ010000009.1 | GCA902387035_00297 | gene | open | 7122-9140 | |||
| 604 | CABMKQ010000009.1 | GCA902387035_00298 | gene | open | 9155-9853 | |||
| 605 | CABMKQ010000009.1 | GCA902387035_00299 | gene | open | 9973-10788 | lgt | ||
| 606 | CABMKQ010000009.1 | GCA902387035_00300 | gene | open | 10837-11289 | |||
| 607 | CABMKQ010000009.1 | GCA902387035_00301 | gene | open | 11385-11648 | |||
| 608 | CABMKQ010000009.1 | GCA902387035_00302 | gene | open | 11658-14669 | |||
| 609 | CABMKQ010000009.1 | GCA902387035_00303 | gene | open | 14710-15351 | |||
| 610 | CABMKQ010000009.1 | GCA902387035_00304 | gene | open | 15477-16298 | galU | ||
| 611 | CABMKQ010000009.1 | GCA902387035_00305 | gene | open | 16295-17515 | |||
| 612 | CABMKQ010000010.1 | GCA902387035_00306 | CDS | open | 46-198 | _na 50_aa | Small hydrophobic protein | |
| 613 | CABMKQ010000010.1 | GCA902387035_00307 | CDS | open | 202-1605 | _na 467_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 614 | CABMKQ010000010.1 | GCA902387035_00308 | CDS | open | 1602-2081 | _na 159_aa | Putative tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 615 | CABMKQ010000010.1 | GCA902387035_00309 | CDS | open | 2156-3343 | _na 395_aa | Multifunctional tRNA nucleotidyl transferase / 2'3'-cyclic phosphodiesterase / 2' nucleotidase/phosphatase | |
| 616 | CABMKQ010000010.1 | GCA902387035_00310 | CDS | open | 3303-3719 | _na 138_aa | Campylobacter invasion antigen D C-terminal domain-containing protein | |
| 617 | CABMKQ010000010.1 | GCA902387035_00311 | CDS | open | 3716-3961 | _na 81_aa | Tetratricopeptide repeat protein | |
| 618 | CABMKQ010000010.1 | GCA902387035_00312 | CDS | open | 3958-5025 | _na 355_aa | leuB | 3-isopropylmalate dehydrogenase |
| 619 | CABMKQ010000010.1 | GCA902387035_00313 | CDS | open | 5029-5508 | _na 159_aa | 3-isopropylmalate dehydratase small subunit | |
| 620 | CABMKQ010000010.1 | GCA902387035_00314 | CDS | open | 5633-5815 | _na 60_aa | Thiol:disulfide interchange protein | |
| 621 | CABMKQ010000010.1 | GCA902387035_00315 | CDS | open | 5820-5981 | _na 53_aa | DUF2892 domain-containing protein | |
| 622 | CABMKQ010000010.1 | GCA902387035_00316 | CDS | open | 5992-7329 | _na 445_aa | FAD/NAD(P)-binding domain-containing protein | |
| 623 | CABMKQ010000010.1 | GCA902387035_00317 | CDS | open | 7415-8059 | _na 214_aa | HTH crp-type domain-containing protein | |
| 624 | CABMKQ010000010.1 | GCA902387035_00318 | CDS | open | 8143-9102 | _na 319_aa | C4-dicarboxylate ABC transporter | |
| 625 | CABMKQ010000010.1 | GCA902387035_00319 | CDS | open | 9123-9974 | _na 283_aa | Sugar-binding protein | |
| 626 | CABMKQ010000010.1 | GCA902387035_00320 | CDS | open | 10165-11061 | _na 298_aa | DUF4299 domain-containing protein | |
| 627 | CABMKQ010000010.1 | GCA902387035_00321 | CDS | open | 11081-11440 | _na 119_aa | drsE | Putative DrsE domain protein |
| 628 | CABMKQ010000010.1 | GCA902387035_00322 | CDS | open | 11515-12114 | _na 199_aa | Homoserine/Threonine efflux protein | |
| 629 | CABMKQ010000010.1 | GCA902387035_00323 | CDS | open | 12222-13268 | _na 348_aa | Asparaginase II | |
| 630 | CABMKQ010000010.1 | GCA902387035_00324 | CDS | open | 13354-13689 | _na 111_aa | azlD | Branched-chain amino acid transporter AzlD |
| 631 | CABMKQ010000010.1 | GCA902387035_00325 | CDS | open | 13686-14348 | _na 220_aa | Branched-chain amino acid transport protein | |
| 632 | CABMKQ010000010.1 | GCA902387035_00326 | CDS | open | 14453-14896 | _na 147_aa | beta-lactamase | |
| 633 | CABMKQ010000010.1 | GCA902387035_00327 | CDS | open | 15186-15971 | _na 261_aa | flgG | flagellar basal-body rod protein FlgG |
| 634 | CABMKQ010000010.1 | GCA902387035_00328 | CDS | open | 15990-16799 | _na 269_aa | Flagellar basal body rod protein | |
| 635 | CABMKQ010000010.1 | GCA902387035_00329 | CDS | open | 16950-18806 | _na 618_aa | rpoD | RNA polymerase sigma factor RpoD |
| 636 | CABMKQ010000010.1 | GCA902387035_00330 | CDS | open | 19049-19804 | _na 251_aa | flagellin | |
| 637 | CABMKQ010000010.1 | GCA902387035_00331 | CDS | open | 19889-21181 | _na 430_aa | Histidinol dehydrogenase | |
| 638 | CABMKQ010000010.1 | GCA902387035_00332 | CDS | open | 21178-22029 | _na 283_aa | 1-aminocyclopropane-1-carboxylate deaminase | |
| 639 | CABMKQ010000010.1 | GCA902387035_00333 | CDS | open | 22022-23113 | _na 363_aa | OmpA-like domain-containing protein | |
| 640 | CABMKQ010000010.1 | GCA902387035_00334 | CDS | open | 23110-24423 | _na 437_aa | Membrane protein | |
| 641 | CABMKQ010000010.1 | GCA902387035_00335 | CDS | open | 24428-25492 | _na 354_aa | fbaA | class II fructose-bisphosphate aldolase |
| 642 | CABMKQ010000010.1 | GCA902387035_00336 | CDS | open | 25508-26326 | _na 272_aa | peptidylprolyl isomerase | |
| 643 | CABMKQ010000010.1 | GCA902387035_00337 | CDS | open | 26421-27053 | _na 210_aa | nth | endonuclease III |
| 644 | CABMKQ010000010.1 | GCA902387035_00338 | CDS | open | 27050-28198 | _na 382_aa | dsbD | Protein-disulfide reductase DsbD |
| 645 | CABMKQ010000010.1 | GCA902387035_00306 | gene | open | 46-198 | |||
| 646 | CABMKQ010000010.1 | GCA902387035_00307 | gene | open | 202-1605 | |||
| 647 | CABMKQ010000010.1 | GCA902387035_00308 | gene | open | 1602-2081 | |||
| 648 | CABMKQ010000010.1 | GCA902387035_00309 | gene | open | 2156-3343 | |||
| 649 | CABMKQ010000010.1 | GCA902387035_00310 | gene | open | 3303-3719 | |||
| 650 | CABMKQ010000010.1 | GCA902387035_00311 | gene | open | 3716-3961 | |||
| 651 | CABMKQ010000010.1 | GCA902387035_00312 | gene | open | 3958-5025 | leuB | ||
| 652 | CABMKQ010000010.1 | GCA902387035_00313 | gene | open | 5029-5508 | |||
| 653 | CABMKQ010000010.1 | GCA902387035_00314 | gene | open | 5633-5815 | |||
| 654 | CABMKQ010000010.1 | GCA902387035_00315 | gene | open | 5820-5981 | |||
| 655 | CABMKQ010000010.1 | GCA902387035_00316 | gene | open | 5992-7329 | |||
| 656 | CABMKQ010000010.1 | GCA902387035_00317 | gene | open | 7415-8059 | |||
| 657 | CABMKQ010000010.1 | GCA902387035_00318 | gene | open | 8143-9102 | |||
| 658 | CABMKQ010000010.1 | GCA902387035_00319 | gene | open | 9123-9974 | |||
| 659 | CABMKQ010000010.1 | GCA902387035_00320 | gene | open | 10165-11061 | |||
| 660 | CABMKQ010000010.1 | GCA902387035_00321 | gene | open | 11081-11440 | drsE | ||
| 661 | CABMKQ010000010.1 | GCA902387035_00322 | gene | open | 11515-12114 | |||
| 662 | CABMKQ010000010.1 | GCA902387035_00323 | gene | open | 12222-13268 | |||
| 663 | CABMKQ010000010.1 | GCA902387035_00324 | gene | open | 13354-13689 | azlD | ||
| 664 | CABMKQ010000010.1 | GCA902387035_00325 | gene | open | 13686-14348 | |||
| 665 | CABMKQ010000010.1 | GCA902387035_00326 | gene | open | 14453-14896 | |||
| 666 | CABMKQ010000010.1 | GCA902387035_00327 | gene | open | 15186-15971 | flgG | ||
| 667 | CABMKQ010000010.1 | GCA902387035_00328 | gene | open | 15990-16799 | |||
| 668 | CABMKQ010000010.1 | GCA902387035_00329 | gene | open | 16950-18806 | rpoD | ||
| 669 | CABMKQ010000010.1 | GCA902387035_00330 | gene | open | 19049-19804 | |||
| 670 | CABMKQ010000010.1 | GCA902387035_00331 | gene | open | 19889-21181 | |||
| 671 | CABMKQ010000010.1 | GCA902387035_00332 | gene | open | 21178-22029 | |||
| 672 | CABMKQ010000010.1 | GCA902387035_00333 | gene | open | 22022-23113 | |||
| 673 | CABMKQ010000010.1 | GCA902387035_00334 | gene | open | 23110-24423 | |||
| 674 | CABMKQ010000010.1 | GCA902387035_00335 | gene | open | 24428-25492 | fbaA | ||
| 675 | CABMKQ010000010.1 | GCA902387035_00336 | gene | open | 25508-26326 | |||
| 676 | CABMKQ010000010.1 | GCA902387035_00337 | gene | open | 26421-27053 | nth | ||
| 677 | CABMKQ010000010.1 | GCA902387035_00338 | gene | open | 27050-28198 | dsbD | ||
| 678 | CABMKQ010000012.1 | GCA902387035_00340 | CDS | open | 689-949 | _na 86_aa | rpsR | 30S ribosomal protein S18 |
| 679 | CABMKQ010000012.1 | GCA902387035_00341 | CDS | open | 965-1522 | _na 185_aa | single-stranded DNA-binding protein | |
| 680 | CABMKQ010000012.1 | GCA902387035_00342 | CDS | open | 1536-1955 | _na 139_aa | rpsF | 30S ribosomal protein S6 |
| 681 | CABMKQ010000012.1 | GCA902387035_00343 | CDS | open | 2033-3031 | _na 332_aa | holA | DNA polymerase III subunit delta |
| 682 | CABMKQ010000012.1 | GCA902387035_00344 | CDS | open | 3024-4943 | _na 639_aa | exoribonuclease II | |
| 683 | CABMKQ010000012.1 | GCA902387035_00345 | CDS | open | 4940-5758 | _na 272_aa | HDOD domain-containing protein | |
| 684 | CABMKQ010000012.1 | GCA902387035_00346 | CDS | open | 5901-6923 | _na 340_aa | ilvC | ketol-acid reductoisomerase |
| 685 | CABMKQ010000012.1 | GCA902387035_00347 | CDS | open | 6927-8306 | _na 459_aa | Divergent polysaccharide deacetylase | |
| 686 | CABMKQ010000012.1 | GCA902387035_00348 | CDS | open | 8303-9070 | _na 255_aa | dprA | DNA protecting protein DprA |
| 687 | CABMKQ010000012.1 | GCA902387035_00349 | CDS | open | 9082-9450 | _na 122_aa | ruvX | Holliday junction resolvase RuvX |
| 688 | CABMKQ010000012.1 | GCA902387035_00350 | CDS | open | 9466-10266 | _na 266_aa | Response regulatory domain-containing protein | |
| 689 | CABMKQ010000012.1 | GCA902387035_00351 | CDS | open | 10263-11333 | _na 356_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 690 | CABMKQ010000012.1 | GCA902387035_00352 | CDS | open | 11278-12051 | _na 257_aa | tatC | twin-arginine translocase subunit TatC |
| 691 | CABMKQ010000012.1 | GCA902387035_00353 | CDS | open | 12051-12449 | _na 132_aa | tatB | Sec-independent protein translocase protein TatB |
| 692 | CABMKQ010000012.1 | GCA902387035_00354 | CDS | open | 12517-13563 | _na 348_aa | hemW | radical SAM family heme chaperone HemW |
| 693 | CABMKQ010000012.1 | GCA902387035_00355 | CDS | open | 13617-14501 | _na 294_aa | HTH araC/xylS-type domain-containing protein | |
| 694 | CABMKQ010000012.1 | GCA902387035_00356 | CDS | open | 14608-16554 | _na 648_aa | TonB-dependent receptor | |
| 695 | CABMKQ010000012.1 | GCA902387035_00357 | CDS | open | 16556-17653 | _na 365_aa | PepSY domain-containing protein | |
| 696 | CABMKQ010000012.1 | GCA902387035_00358 | CDS | open | 17717-18181 | _na 154_aa | RNA pyrophosphohydrolase | |
| 697 | CABMKQ010000012.1 | GCA902387035_00359 | CDS | open | 18181-19383 | _na 400_aa | aspartate kinase | |
| 698 | CABMKQ010000012.1 | GCA902387035_00360 | CDS | open | 19383-19925 | _na 180_aa | DnaA-binding chromosome replication initiation factor | |
| 699 | CABMKQ010000012.1 | GCA902387035_00361 | CDS | open | 19926-20546 | _na 206_aa | DNA polymerase III subunit delta' | |
| 700 | CABMKQ010000012.1 | GCA902387035_00362 | CDS | open | 20543-21682 | _na 379_aa | folP | dihydropteroate synthase |
| 701 | CABMKQ010000012.1 | GCA902387035_00363 | CDS | open | 21676-22107 | _na 143_aa | NADAR family protein | |
| 702 | CABMKQ010000012.1 | GCA902387035_00364 | CDS | open | 22149-24092 | _na 647_aa | ligA | NAD-dependent DNA ligase LigA |
| 703 | CABMKQ010000012.1 | GCA902387035_00365 | CDS | open | 24082-24795 | _na 237_aa | 16S/23S rRNA (Cytidine-2'-O)-methyltransferase | |
| 704 | CABMKQ010000012.1 | GCA902387035_00366 | CDS | open | 24761-25654 | _na 297_aa | bifunctional riboflavin kinase/FAD synthetase | |
| 705 | CABMKQ010000012.1 | GCA902387035_00367 | CDS | open | 25651-26355 | _na 234_aa | cmoA | carboxy-S-adenosyl-L-methionine synthase CmoA |
| 706 | CABMKQ010000012.1 | GCA902387035_00368 | CDS | open | 26408-26590 | _na 60_aa | hypothetical protein | |
| 707 | CABMKQ010000012.1 | GCA902387035_00369 | CDS | open | 26617-27051 | _na 144_aa | hypothetical protein | |
| 708 | CABMKQ010000012.1 | GCA902387035_00370 | CDS | open | 27104-28861 | _na 585_aa | fdhF | formate dehydrogenase subunit alpha |
| 709 | CABMKQ010000012.1 | GCA902387035_00371 | CDS | open | 28958-29380 | _na 140_aa | fdhF | formate dehydrogenase subunit alpha |
| 710 | CABMKQ010000012.1 | GCA902387035_00372 | CDS | open | 29776-30048 | _na 90_aa | rpsO | 30S ribosomal protein S15 |
| 711 | CABMKQ010000012.1 | GCA902387035_00373 | CDS | open | 30195-30599 | _na 134_aa | Rrf2 family transcriptional regulator | |
| 712 | CABMKQ010000012.1 | GCA902387035_00374 | CDS | open | 30602-32797 | _na 731_aa | flhA | flagellar biosynthesis protein FlhA |
| 713 | CABMKQ010000012.1 | GCA902387035_00375 | CDS | open | 32807-33832 | _na 341_aa | DHHA1 domain-containing protein | |
| 714 | CABMKQ010000012.1 | GCA902387035_00376 | CDS | open | 33829-34056 | _na 75_aa | Cell division protein | |
| 715 | CABMKQ010000012.1 | GCA902387035_00377 | CDS | open | 34066-34476 | _na 136_aa | beta-lactamase | |
| 716 | CABMKQ010000012.1 | GCA902387035_00378 | CDS | open | 34494-35423 | _na 309_aa | pyrB | aspartate carbamoyltransferase catalytic subunit |
| 717 | CABMKQ010000012.1 | GCA902387035_00379 | CDS | open | 35426-36703 | _na 425_aa | Dihydroorotase | |
| 718 | CABMKQ010000012.1 | GCA902387035_00380 | CDS | open | 36792-38081 | _na 429_aa | Aminoacyl-histidine dipeptidase | |
| 719 | CABMKQ010000012.1 | GCA902387035_00381 | CDS | open | 38098-38355 | _na 85_aa | Cation transporter | |
| 720 | CABMKQ010000012.1 | GCA902387035_00382 | CDS | open | 38348-38671 | _na 107_aa | Aryl sulfotransferase | |
| 721 | CABMKQ010000012.1 | GCA902387035_00383 | CDS | open | 38668-39747 | _na 359_aa | Transglutaminase-like domain-containing protein | |
| 722 | CABMKQ010000012.1 | GCA902387035_00384 | CDS | open | 40008-40877 | _na 289_aa | cmoB | tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB |
| 723 | CABMKQ010000012.1 | GCA902387035_00385 | CDS | open | 40886-41419 | _na 177_aa | Acyl-CoA thioesterase | |
| 724 | CABMKQ010000012.1 | GCA902387035_00386 | CDS | open | 41615-42892 | _na 425_aa | Major outer membrane protein | |
| 725 | CABMKQ010000012.1 | GCA902387035_00387 | CDS | open | 43065-43667 | _na 200_aa | Metallo-beta-lactamase family protein | |
| 726 | CABMKQ010000012.1 | GCA902387035_00388 | CDS | open | 43788-44525 | _na 245_aa | NAD+ synthase | |
| 727 | CABMKQ010000012.1 | GCA902387035_00389 | CDS | open | 44536-45666 | _na 376_aa | UDP-4-keto-6-deoxy-N-acetylglucosamine 4-aminotransferase | |
| 728 | CABMKQ010000012.1 | GCA902387035_00390 | CDS | open | 45659-46579 | _na 306_aa | tetraacyldisaccharide 4'-kinase | |
| 729 | CABMKQ010000012.1 | GCA902387035_00391 | CDS | open | 46629-46943 | _na 104_aa | cutA1 | Putative CutA1 divalent ion tolerance protein |
| 730 | CABMKQ010000012.1 | GCA902387035_00392 | CDS | open | 46940-47281 | _na 113_aa | hypothetical protein | |
| 731 | CABMKQ010000012.1 | GCA902387035_00340 | gene | open | 689-949 | rpsR | ||
| 732 | CABMKQ010000012.1 | GCA902387035_00341 | gene | open | 965-1522 | |||
| 733 | CABMKQ010000012.1 | GCA902387035_00342 | gene | open | 1536-1955 | rpsF | ||
| 734 | CABMKQ010000012.1 | GCA902387035_00343 | gene | open | 2033-3031 | holA | ||
| 735 | CABMKQ010000012.1 | GCA902387035_00344 | gene | open | 3024-4943 | |||
| 736 | CABMKQ010000012.1 | GCA902387035_00345 | gene | open | 4940-5758 | |||
| 737 | CABMKQ010000012.1 | GCA902387035_00346 | gene | open | 5901-6923 | ilvC | ||
| 738 | CABMKQ010000012.1 | GCA902387035_00347 | gene | open | 6927-8306 | |||
| 739 | CABMKQ010000012.1 | GCA902387035_00348 | gene | open | 8303-9070 | dprA | ||
| 740 | CABMKQ010000012.1 | GCA902387035_00349 | gene | open | 9082-9450 | ruvX | ||
| 741 | CABMKQ010000012.1 | GCA902387035_00350 | gene | open | 9466-10266 | |||
| 742 | CABMKQ010000012.1 | GCA902387035_00351 | gene | open | 10263-11333 | queA | ||
| 743 | CABMKQ010000012.1 | GCA902387035_00352 | gene | open | 11278-12051 | tatC | ||
| 744 | CABMKQ010000012.1 | GCA902387035_00353 | gene | open | 12051-12449 | tatB | ||
| 745 | CABMKQ010000012.1 | GCA902387035_00354 | gene | open | 12517-13563 | hemW | ||
| 746 | CABMKQ010000012.1 | GCA902387035_00355 | gene | open | 13617-14501 | |||
| 747 | CABMKQ010000012.1 | GCA902387035_00356 | gene | open | 14608-16554 | |||
| 748 | CABMKQ010000012.1 | GCA902387035_00357 | gene | open | 16556-17653 | |||
| 749 | CABMKQ010000012.1 | GCA902387035_00358 | gene | open | 17717-18181 | |||
| 750 | CABMKQ010000012.1 | GCA902387035_00359 | gene | open | 18181-19383 | |||
| 751 | CABMKQ010000012.1 | GCA902387035_00360 | gene | open | 19383-19925 | |||
| 752 | CABMKQ010000012.1 | GCA902387035_00361 | gene | open | 19926-20546 | |||
| 753 | CABMKQ010000012.1 | GCA902387035_00362 | gene | open | 20543-21682 | folP | ||
| 754 | CABMKQ010000012.1 | GCA902387035_00363 | gene | open | 21676-22107 | |||
| 755 | CABMKQ010000012.1 | GCA902387035_00364 | gene | open | 22149-24092 | ligA | ||
| 756 | CABMKQ010000012.1 | GCA902387035_00365 | gene | open | 24082-24795 | |||
| 757 | CABMKQ010000012.1 | GCA902387035_00366 | gene | open | 24761-25654 | |||
| 758 | CABMKQ010000012.1 | GCA902387035_00367 | gene | open | 25651-26355 | cmoA | ||
| 759 | CABMKQ010000012.1 | GCA902387035_00368 | gene | open | 26408-26590 | |||
| 760 | CABMKQ010000012.1 | GCA902387035_00369 | gene | open | 26617-27051 | |||
| 761 | CABMKQ010000012.1 | GCA902387035_00370 | gene | open | 27104-28861 | fdhF | ||
| 762 | CABMKQ010000012.1 | GCA902387035_00371 | gene | open | 28958-29380 | fdhF | ||
| 763 | CABMKQ010000012.1 | GCA902387035_00372 | gene | open | 29776-30048 | rpsO | ||
| 764 | CABMKQ010000012.1 | GCA902387035_00373 | gene | open | 30195-30599 | |||
| 765 | CABMKQ010000012.1 | GCA902387035_00374 | gene | open | 30602-32797 | flhA | ||
| 766 | CABMKQ010000012.1 | GCA902387035_00375 | gene | open | 32807-33832 | |||
| 767 | CABMKQ010000012.1 | GCA902387035_00376 | gene | open | 33829-34056 | |||
| 768 | CABMKQ010000012.1 | GCA902387035_00377 | gene | open | 34066-34476 | |||
| 769 | CABMKQ010000012.1 | GCA902387035_00378 | gene | open | 34494-35423 | pyrB | ||
| 770 | CABMKQ010000012.1 | GCA902387035_00379 | gene | open | 35426-36703 | |||
| 771 | CABMKQ010000012.1 | GCA902387035_00380 | gene | open | 36792-38081 | |||
| 772 | CABMKQ010000012.1 | GCA902387035_00381 | gene | open | 38098-38355 | |||
| 773 | CABMKQ010000012.1 | GCA902387035_00382 | gene | open | 38348-38671 | |||
| 774 | CABMKQ010000012.1 | GCA902387035_00383 | gene | open | 38668-39747 | |||
| 775 | CABMKQ010000012.1 | GCA902387035_00384 | gene | open | 40008-40877 | cmoB | ||
| 776 | CABMKQ010000012.1 | GCA902387035_00385 | gene | open | 40886-41419 | |||
| 777 | CABMKQ010000012.1 | GCA902387035_00386 | gene | open | 41615-42892 | |||
| 778 | CABMKQ010000012.1 | GCA902387035_00387 | gene | open | 43065-43667 | |||
| 779 | CABMKQ010000012.1 | GCA902387035_00388 | gene | open | 43788-44525 | |||
| 780 | CABMKQ010000012.1 | GCA902387035_00389 | gene | open | 44536-45666 | |||
| 781 | CABMKQ010000012.1 | GCA902387035_00390 | gene | open | 45659-46579 | |||
| 782 | CABMKQ010000012.1 | GCA902387035_00391 | gene | open | 46629-46943 | cutA1 | ||
| 783 | CABMKQ010000012.1 | GCA902387035_00392 | gene | open | 46940-47281 | |||
| 784 | CABMKQ010000012.1 | GCA902387035_00339 | gene | open | 47-122 | trnK | ||
| 785 | CABMKQ010000012.1 | GCA902387035_00339 | tRNA | open | 47-122 | trnK | tRNA-Lys(ttt) | |
| 786 | CABMKQ010000013.1 | GCA902387035_00393 | CDS | open | 48-851 | _na 267_aa | ATP-binding cassette domain-containing protein | |
| 787 | CABMKQ010000013.1 | GCA902387035_00394 | CDS | open | 808-1239 | _na 143_aa | Putative membrane protein | |
| 788 | CABMKQ010000013.1 | GCA902387035_00395 | CDS | open | 1371-2882 | _na 503_aa | Fusobacterium membrane protein | |
| 789 | CABMKQ010000013.1 | GCA902387035_00396 | CDS | open | 2882-4327 | _na 481_aa | Fusobacterium membrane protein | |
| 790 | CABMKQ010000013.1 | GCA902387035_00397 | CDS | open | 4454-6394 | _na 646_aa | BCCT (Betaine/carnitine/choline) family transporter | |
| 791 | CABMKQ010000013.1 | GCA902387035_00398 | CDS | open | 6755-7588 | _na 277_aa | modD | Putative pyrophosphorylase ModD |
| 792 | CABMKQ010000013.1 | GCA902387035_00399 | CDS | open | 7590-7850 | _na 86_aa | Helicase | |
| 793 | CABMKQ010000013.1 | GCA902387035_00400 | CDS | open | 7863-9323 | _na 486_aa | Na+/alanine symporter family protein | |
| 794 | CABMKQ010000013.1 | GCA902387035_00401 | CDS | open | 9341-11431 | _na 696_aa | Lead%2C cadmium%2C zinc and mercury transporting ATPase | |
| 795 | CABMKQ010000013.1 | GCA902387035_00402 | CDS | open | 11400-11723 | _na 107_aa | Oxidoreductase | |
| 796 | CABMKQ010000013.1 | GCA902387035_00403 | CDS | open | 11723-12037 | _na 104_aa | Cys/Met metabolism pyridoxal-phosphate-dependent enzyme | |
| 797 | CABMKQ010000013.1 | GCA902387035_00404 | CDS | open | 12047-12397 | _na 116_aa | Periplasmic protein | |
| 798 | CABMKQ010000013.1 | GCA902387035_00405 | CDS | open | 12390-13040 | _na 216_aa | Aminotransferase | |
| 799 | CABMKQ010000013.1 | GCA902387035_00406 | CDS | open | 13033-13356 | _na 107_aa | HMA domain-containing protein | |
| 800 | CABMKQ010000013.1 | GCA902387035_00407 | CDS | open | 13459-13905 | _na 148_aa | Transcriptional regulator%2C Fur family | |
| 801 | CABMKQ010000013.1 | GCA902387035_00408 | CDS | open | 14056-14265 | _na 69_aa | hypothetical protein | |
| 802 | CABMKQ010000013.1 | GCA902387035_00409 | CDS | open | 14357-15019 | _na 220_aa | Ysc84 actin-binding domain-containing protein | |
| 803 | CABMKQ010000013.1 | GCA902387035_00410 | CDS | open | 15137-15745 | _na 202_aa | Glycine transporter domain-containing protein | |
| 804 | CABMKQ010000013.1 | GCA902387035_00411 | CDS | open | 15742-16728 | _na 328_aa | midA | SAM-dependent methyltransferase%2C MidA family |
| 805 | CABMKQ010000013.1 | GCA902387035_00412 | CDS | open | 16717-17199 | _na 160_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 806 | CABMKQ010000013.1 | GCA902387035_00413 | CDS | open | 17258-17794 | _na 178_aa | fliL | flagellar basal body-associated protein FliL |
| 807 | CABMKQ010000013.1 | GCA902387035_00414 | CDS | open | 17791-18135 | _na 114_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 808 | CABMKQ010000013.1 | GCA902387035_00415 | CDS | open | 18281-19108 | _na 275_aa | Polyribonucleotide nucleotidyltransferase | |
| 809 | CABMKQ010000013.1 | GCA902387035_00416 | CDS | open | 19254-20594 | _na 446_aa | radA | DNA repair protein RadA |
| 810 | CABMKQ010000013.1 | GCA902387035_00417 | CDS | open | 20569-20931 | _na 120_aa | VanZ-like domain-containing protein | |
| 811 | CABMKQ010000013.1 | GCA902387035_00418 | CDS | open | 20924-21790 | _na 288_aa | ftsY | signal recognition particle-docking protein FtsY |
| 812 | CABMKQ010000013.1 | GCA902387035_00419 | CDS | open | 21790-22422 | _na 210_aa | tlpA | Protein disulfide reductase%2C TlpA family |
| 813 | CABMKQ010000013.1 | GCA902387035_00420 | CDS | open | 22472-23116 | _na 214_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 814 | CABMKQ010000013.1 | GCA902387035_00421 | CDS | open | 23070-24590 | _na 506_aa | rny | ribonuclease Y |
| 815 | CABMKQ010000013.1 | GCA902387035_00422 | CDS | open | 24600-25196 | _na 198_aa | Ysc84 actin-binding domain-containing protein | |
| 816 | CABMKQ010000013.1 | GCA902387035_00423 | CDS | open | 25196-25762 | _na 188_aa | VTT domain-containing protein | |
| 817 | CABMKQ010000013.1 | GCA902387035_00424 | CDS | open | 25759-27099 | _na 446_aa | DUF945 domain-containing protein | |
| 818 | CABMKQ010000013.1 | GCA902387035_00393 | gene | open | 48-851 | |||
| 819 | CABMKQ010000013.1 | GCA902387035_00394 | gene | open | 808-1239 | |||
| 820 | CABMKQ010000013.1 | GCA902387035_00395 | gene | open | 1371-2882 | |||
| 821 | CABMKQ010000013.1 | GCA902387035_00396 | gene | open | 2882-4327 | |||
| 822 | CABMKQ010000013.1 | GCA902387035_00397 | gene | open | 4454-6394 | |||
| 823 | CABMKQ010000013.1 | GCA902387035_00398 | gene | open | 6755-7588 | modD | ||
| 824 | CABMKQ010000013.1 | GCA902387035_00399 | gene | open | 7590-7850 | |||
| 825 | CABMKQ010000013.1 | GCA902387035_00400 | gene | open | 7863-9323 | |||
| 826 | CABMKQ010000013.1 | GCA902387035_00401 | gene | open | 9341-11431 | |||
| 827 | CABMKQ010000013.1 | GCA902387035_00402 | gene | open | 11400-11723 | |||
| 828 | CABMKQ010000013.1 | GCA902387035_00403 | gene | open | 11723-12037 | |||
| 829 | CABMKQ010000013.1 | GCA902387035_00404 | gene | open | 12047-12397 | |||
| 830 | CABMKQ010000013.1 | GCA902387035_00405 | gene | open | 12390-13040 | |||
| 831 | CABMKQ010000013.1 | GCA902387035_00406 | gene | open | 13033-13356 | |||
| 832 | CABMKQ010000013.1 | GCA902387035_00407 | gene | open | 13459-13905 | |||
| 833 | CABMKQ010000013.1 | GCA902387035_00408 | gene | open | 14056-14265 | |||
| 834 | CABMKQ010000013.1 | GCA902387035_00409 | gene | open | 14357-15019 | |||
| 835 | CABMKQ010000013.1 | GCA902387035_00410 | gene | open | 15137-15745 | |||
| 836 | CABMKQ010000013.1 | GCA902387035_00411 | gene | open | 15742-16728 | midA | ||
| 837 | CABMKQ010000013.1 | GCA902387035_00412 | gene | open | 16717-17199 | ybaK | ||
| 838 | CABMKQ010000013.1 | GCA902387035_00413 | gene | open | 17258-17794 | fliL | ||
| 839 | CABMKQ010000013.1 | GCA902387035_00414 | gene | open | 17791-18135 | acpS | ||
| 840 | CABMKQ010000013.1 | GCA902387035_00415 | gene | open | 18281-19108 | |||
| 841 | CABMKQ010000013.1 | GCA902387035_00416 | gene | open | 19254-20594 | radA | ||
| 842 | CABMKQ010000013.1 | GCA902387035_00417 | gene | open | 20569-20931 | |||
| 843 | CABMKQ010000013.1 | GCA902387035_00418 | gene | open | 20924-21790 | ftsY | ||
| 844 | CABMKQ010000013.1 | GCA902387035_00419 | gene | open | 21790-22422 | tlpA | ||
| 845 | CABMKQ010000013.1 | GCA902387035_00420 | gene | open | 22472-23116 | |||
| 846 | CABMKQ010000013.1 | GCA902387035_00421 | gene | open | 23070-24590 | rny | ||
| 847 | CABMKQ010000013.1 | GCA902387035_00422 | gene | open | 24600-25196 | |||
| 848 | CABMKQ010000013.1 | GCA902387035_00423 | gene | open | 25196-25762 | |||
| 849 | CABMKQ010000013.1 | GCA902387035_00424 | gene | open | 25759-27099 | |||
| 850 | CABMKQ010000014.1 | GCA902387035_00425 | CDS | open | 235-888 | _na 217_aa | Uracil-DNA glycosylase-like domain-containing protein | |
| 851 | CABMKQ010000014.1 | GCA902387035_00426 | CDS | open | 885-2135 | _na 416_aa | Periplasmic protein | |
| 852 | CABMKQ010000014.1 | GCA902387035_00427 | CDS | open | 2179-2568 | _na 129_aa | YbgC/FadM family acyl-CoA thioesterase | |
| 853 | CABMKQ010000014.1 | GCA902387035_00428 | CDS | open | 2578-2730 | _na 50_aa | hypothetical protein | |
| 854 | CABMKQ010000014.1 | GCA902387035_00429 | CDS | open | 2741-3913 | _na 390_aa | Flagellar hook-associated protein 2 C-terminal domain-containing protein | |
| 855 | CABMKQ010000014.1 | GCA902387035_00430 | CDS | open | 4028-4552 | _na 174_aa | thrE | Threonine/Serine exporter ThrE domain-containing protein |
| 856 | CABMKQ010000014.1 | GCA902387035_00431 | CDS | open | 4545-5327 | _na 260_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 857 | CABMKQ010000014.1 | GCA902387035_00432 | CDS | open | 5311-5790 | _na 159_aa | TMEM205-like domain-containing protein | |
| 858 | CABMKQ010000014.1 | GCA902387035_00433 | CDS | open | 5801-6613 | _na 270_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 859 | CABMKQ010000014.1 | GCA902387035_00434 | CDS | open | 6603-7805 | _na 400_aa | Peptidase%2C M48 family | |
| 860 | CABMKQ010000014.1 | GCA902387035_00435 | CDS | open | 7817-9190 | _na 457_aa | Transporter | |
| 861 | CABMKQ010000014.1 | GCA902387035_00436 | CDS | open | 9371-9811 | _na 146_aa | Type IV secretion protein Rhs | |
| 862 | CABMKQ010000014.1 | GCA902387035_00437 | CDS | open | 9918-10718 | _na 266_aa | 3'-5' exonuclease | |
| 863 | CABMKQ010000014.1 | GCA902387035_00438 | CDS | open | 10715-11362 | _na 215_aa | rpe | ribulose-phosphate 3-epimerase |
| 864 | CABMKQ010000014.1 | GCA902387035_00439 | CDS | open | 11372-12745 | _na 457_aa | Prephenate dehydrogenase | |
| 865 | CABMKQ010000014.1 | GCA902387035_00440 | CDS | open | 12742-13488 | _na 248_aa | HDOD domain-containing protein | |
| 866 | CABMKQ010000014.1 | GCA902387035_00441 | CDS | open | 13665-13856 | _na 63_aa | rpmB | 50S ribosomal protein L28 |
| 867 | CABMKQ010000014.1 | GCA902387035_00442 | CDS | open | 13880-15010 | _na 376_aa | Potassium channel protein | |
| 868 | CABMKQ010000014.1 | GCA902387035_00443 | CDS | open | 15125-15325 | _na 66_aa | DUF465 domain-containing protein | |
| 869 | CABMKQ010000014.1 | GCA902387035_00444 | CDS | open | 15351-15902 | _na 183_aa | epsC | serine O-acetyltransferase EpsC |
| 870 | CABMKQ010000014.1 | GCA902387035_00445 | CDS | open | 15907-16812 | _na 301_aa | cysK | cysteine synthase A |
| 871 | CABMKQ010000014.1 | GCA902387035_00446 | CDS | open | 16931-17599 | _na 222_aa | Endonuclease III | |
| 872 | CABMKQ010000014.1 | GCA902387035_00447 | CDS | open | 17596-18360 | _na 254_aa | AAA+ ATPase domain-containing protein | |
| 873 | CABMKQ010000014.1 | GCA902387035_00448 | CDS | open | 18357-21302 | _na 981_aa | mfd | transcription-repair coupling factor |
| 874 | CABMKQ010000014.1 | GCA902387035_00449 | CDS | open | 21283-22485 | _na 400_aa | tetrahydrofolate synthase | |
| 875 | CABMKQ010000014.1 | GCA902387035_00450 | CDS | open | 22482-24056 | _na 524_aa | GGDEF domain-containing protein | |
| 876 | CABMKQ010000014.1 | GCA902387035_00451 | CDS | open | 24037-24576 | _na 179_aa | Putative lipooligosaccharide transport system%2C OM component (LptE family) | |
| 877 | CABMKQ010000014.1 | GCA902387035_00452 | CDS | open | 24580-27045 | _na 821_aa | leuS | leucine--tRNA ligase |
| 878 | CABMKQ010000014.1 | GCA902387035_00453 | CDS | open | 27054-27392 | _na 112_aa | macA | MacA |
| 879 | CABMKQ010000014.1 | GCA902387035_00454 | CDS | open | 27402-28373 | _na 323_aa | secF | Protein-export membrane protein SecF |
| 880 | CABMKQ010000014.1 | GCA902387035_00455 | CDS | open | 28376-29956 | _na 526_aa | secD | Protein translocase subunit SecD |
| 881 | CABMKQ010000014.1 | GCA902387035_00456 | CDS | open | 29956-30228 | _na 90_aa | yajC | preprotein translocase subunit YajC |
| 882 | CABMKQ010000014.1 | GCA902387035_00457 | CDS | open | 30345-31496 | _na 383_aa | apolipoprotein N-acyltransferase | |
| 883 | CABMKQ010000014.1 | GCA902387035_00458 | CDS | open | 31540-32745 | _na 401_aa | metK | methionine adenosyltransferase |
| 884 | CABMKQ010000014.1 | GCA902387035_00459 | CDS | open | 32884-34251 | _na 455_aa | sstT | serine/threonine transporter SstT |
| 885 | CABMKQ010000014.1 | GCA902387035_00460 | CDS | open | 34340-36070 | _na 576_aa | Oligoendopeptidase F | |
| 886 | CABMKQ010000014.1 | GCA902387035_00461 | CDS | open | 36064-36513 | _na 149_aa | Stringent starvation protein B | |
| 887 | CABMKQ010000014.1 | GCA902387035_00462 | CDS | open | 36565-38634 | _na 689_aa | DNA 3'-5' helicase | |
| 888 | CABMKQ010000014.1 | GCA902387035_00463 | CDS | open | 38631-39452 | _na 273_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 889 | CABMKQ010000014.1 | GCA902387035_00464 | CDS | open | 39446-39676 | _na 76_aa | csrA | carbon storage regulator CsrA |
| 890 | CABMKQ010000014.1 | GCA902387035_00465 | CDS | open | 39673-40416 | _na 247_aa | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase | |
| 891 | CABMKQ010000014.1 | GCA902387035_00466 | CDS | open | 40428-40883 | _na 151_aa | smpB | SsrA-binding protein SmpB |
| 892 | CABMKQ010000014.1 | GCA902387035_00467 | CDS | open | 40892-41488 | _na 198_aa | Thioredoxin domain-containing protein | |
| 893 | CABMKQ010000014.1 | GCA902387035_00468 | CDS | open | 41551-41985 | _na 144_aa | flgB | flagellar basal body rod protein FlgB |
| 894 | CABMKQ010000014.1 | GCA902387035_00469 | CDS | open | 41994-42494 | _na 166_aa | flgC | flagellar basal body rod protein FlgC |
| 895 | CABMKQ010000014.1 | GCA902387035_00470 | CDS | open | 42494-42787 | _na 97_aa | fliE | flagellar hook-basal body complex protein FliE |
| 896 | CABMKQ010000014.1 | GCA902387035_00471 | CDS | open | 42795-44627 | _na 610_aa | ftsI | Cell division protein FtsI / penicillin-binding protein |
| 897 | CABMKQ010000014.1 | GCA902387035_00472 | CDS | open | 44740-45240 | _na 166_aa | Putative membrane protein | |
| 898 | CABMKQ010000014.1 | GCA902387035_00473 | CDS | open | 45294-45725 | _na 143_aa | Fatty-acid--CoA ligase | |
| 899 | CABMKQ010000014.1 | GCA902387035_00474 | CDS | open | 45726-48821 | _na 1031_aa | Cytochrome C biogenesis protein | |
| 900 | CABMKQ010000014.1 | GCA902387035_00475 | CDS | open | 48867-49424 | _na 185_aa | Cytochrome c domain-containing protein | |
| 901 | CABMKQ010000014.1 | GCA902387035_00476 | CDS | open | 49517-50791 | _na 424_aa | Major outer membrane protein | |
| 902 | CABMKQ010000014.1 | GCA902387035_00477 | CDS | open | 51047-51484 | _na 145_aa | Lipoprotein | |
| 903 | CABMKQ010000014.1 | GCA902387035_00478 | CDS | open | 51617-52204 | _na 195_aa | Hydrogenase-4 component G | |
| 904 | CABMKQ010000014.1 | GCA902387035_00479 | CDS | open | 52287-52721 | _na 144_aa | Ferritin/DPS protein domain-containing protein | |
| 905 | CABMKQ010000014.1 | GCA902387035_00480 | CDS | open | 52871-53248 | _na 125_aa | Rhodanese domain-containing protein | |
| 906 | CABMKQ010000014.1 | GCA902387035_00482 | CDS | open | 53780-55858 | _na 692_aa | fusA | elongation factor G |
| 907 | CABMKQ010000014.1 | GCA902387035_00483 | CDS | open | 55871-56341 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 908 | CABMKQ010000014.1 | GCA902387035_00484 | CDS | open | 56420-56818 | _na 132_aa | rpsL | 30S ribosomal protein S12 |
| 909 | CABMKQ010000014.1 | GCA902387035_00485 | CDS | open | 56950-57339 | _na 129_aa | doxX | DoxX family protein |
| 910 | CABMKQ010000014.1 | GCA902387035_00486 | CDS | open | 57462-61976 | _na 1504_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 911 | CABMKQ010000014.1 | GCA902387035_00487 | CDS | open | 61963-65550 | _na 1195_aa | hypothetical protein | |
| 912 | CABMKQ010000014.1 | GCA902387035_00425 | gene | open | 235-888 | |||
| 913 | CABMKQ010000014.1 | GCA902387035_00426 | gene | open | 885-2135 | |||
| 914 | CABMKQ010000014.1 | GCA902387035_00427 | gene | open | 2179-2568 | |||
| 915 | CABMKQ010000014.1 | GCA902387035_00428 | gene | open | 2578-2730 | |||
| 916 | CABMKQ010000014.1 | GCA902387035_00429 | gene | open | 2741-3913 | |||
| 917 | CABMKQ010000014.1 | GCA902387035_00430 | gene | open | 4028-4552 | thrE | ||
| 918 | CABMKQ010000014.1 | GCA902387035_00431 | gene | open | 4545-5327 | |||
| 919 | CABMKQ010000014.1 | GCA902387035_00432 | gene | open | 5311-5790 | |||
| 920 | CABMKQ010000014.1 | GCA902387035_00433 | gene | open | 5801-6613 | prmC | ||
| 921 | CABMKQ010000014.1 | GCA902387035_00434 | gene | open | 6603-7805 | |||
| 922 | CABMKQ010000014.1 | GCA902387035_00435 | gene | open | 7817-9190 | |||
| 923 | CABMKQ010000014.1 | GCA902387035_00436 | gene | open | 9371-9811 | |||
| 924 | CABMKQ010000014.1 | GCA902387035_00437 | gene | open | 9918-10718 | |||
| 925 | CABMKQ010000014.1 | GCA902387035_00438 | gene | open | 10715-11362 | rpe | ||
| 926 | CABMKQ010000014.1 | GCA902387035_00439 | gene | open | 11372-12745 | |||
| 927 | CABMKQ010000014.1 | GCA902387035_00440 | gene | open | 12742-13488 | |||
| 928 | CABMKQ010000014.1 | GCA902387035_00441 | gene | open | 13665-13856 | rpmB | ||
| 929 | CABMKQ010000014.1 | GCA902387035_00442 | gene | open | 13880-15010 | |||
| 930 | CABMKQ010000014.1 | GCA902387035_00443 | gene | open | 15125-15325 | |||
| 931 | CABMKQ010000014.1 | GCA902387035_00444 | gene | open | 15351-15902 | epsC | ||
| 932 | CABMKQ010000014.1 | GCA902387035_00445 | gene | open | 15907-16812 | cysK | ||
| 933 | CABMKQ010000014.1 | GCA902387035_00446 | gene | open | 16931-17599 | |||
| 934 | CABMKQ010000014.1 | GCA902387035_00447 | gene | open | 17596-18360 | |||
| 935 | CABMKQ010000014.1 | GCA902387035_00448 | gene | open | 18357-21302 | mfd | ||
| 936 | CABMKQ010000014.1 | GCA902387035_00449 | gene | open | 21283-22485 | |||
| 937 | CABMKQ010000014.1 | GCA902387035_00450 | gene | open | 22482-24056 | |||
| 938 | CABMKQ010000014.1 | GCA902387035_00451 | gene | open | 24037-24576 | |||
| 939 | CABMKQ010000014.1 | GCA902387035_00452 | gene | open | 24580-27045 | leuS | ||
| 940 | CABMKQ010000014.1 | GCA902387035_00453 | gene | open | 27054-27392 | macA | ||
| 941 | CABMKQ010000014.1 | GCA902387035_00454 | gene | open | 27402-28373 | secF | ||
| 942 | CABMKQ010000014.1 | GCA902387035_00455 | gene | open | 28376-29956 | secD | ||
| 943 | CABMKQ010000014.1 | GCA902387035_00456 | gene | open | 29956-30228 | yajC | ||
| 944 | CABMKQ010000014.1 | GCA902387035_00457 | gene | open | 30345-31496 | |||
| 945 | CABMKQ010000014.1 | GCA902387035_00458 | gene | open | 31540-32745 | metK | ||
| 946 | CABMKQ010000014.1 | GCA902387035_00459 | gene | open | 32884-34251 | sstT | ||
| 947 | CABMKQ010000014.1 | GCA902387035_00460 | gene | open | 34340-36070 | |||
| 948 | CABMKQ010000014.1 | GCA902387035_00461 | gene | open | 36064-36513 | |||
| 949 | CABMKQ010000014.1 | GCA902387035_00462 | gene | open | 36565-38634 | |||
| 950 | CABMKQ010000014.1 | GCA902387035_00463 | gene | open | 38631-39452 | truB | ||
| 951 | CABMKQ010000014.1 | GCA902387035_00464 | gene | open | 39446-39676 | csrA | ||
| 952 | CABMKQ010000014.1 | GCA902387035_00465 | gene | open | 39673-40416 | |||
| 953 | CABMKQ010000014.1 | GCA902387035_00466 | gene | open | 40428-40883 | smpB | ||
| 954 | CABMKQ010000014.1 | GCA902387035_00467 | gene | open | 40892-41488 | |||
| 955 | CABMKQ010000014.1 | GCA902387035_00468 | gene | open | 41551-41985 | flgB | ||
| 956 | CABMKQ010000014.1 | GCA902387035_00469 | gene | open | 41994-42494 | flgC | ||
| 957 | CABMKQ010000014.1 | GCA902387035_00470 | gene | open | 42494-42787 | fliE | ||
| 958 | CABMKQ010000014.1 | GCA902387035_00471 | gene | open | 42795-44627 | ftsI | ||
| 959 | CABMKQ010000014.1 | GCA902387035_00472 | gene | open | 44740-45240 | |||
| 960 | CABMKQ010000014.1 | GCA902387035_00473 | gene | open | 45294-45725 | |||
| 961 | CABMKQ010000014.1 | GCA902387035_00474 | gene | open | 45726-48821 | |||
| 962 | CABMKQ010000014.1 | GCA902387035_00475 | gene | open | 48867-49424 | |||
| 963 | CABMKQ010000014.1 | GCA902387035_00476 | gene | open | 49517-50791 | |||
| 964 | CABMKQ010000014.1 | GCA902387035_00477 | gene | open | 51047-51484 | |||
| 965 | CABMKQ010000014.1 | GCA902387035_00478 | gene | open | 51617-52204 | |||
| 966 | CABMKQ010000014.1 | GCA902387035_00479 | gene | open | 52287-52721 | |||
| 967 | CABMKQ010000014.1 | GCA902387035_00480 | gene | open | 52871-53248 | |||
| 968 | CABMKQ010000014.1 | GCA902387035_00482 | gene | open | 53780-55858 | fusA | ||
| 969 | CABMKQ010000014.1 | GCA902387035_00483 | gene | open | 55871-56341 | rpsG | ||
| 970 | CABMKQ010000014.1 | GCA902387035_00484 | gene | open | 56420-56818 | rpsL | ||
| 971 | CABMKQ010000014.1 | GCA902387035_00485 | gene | open | 56950-57339 | doxX | ||
| 972 | CABMKQ010000014.1 | GCA902387035_00486 | gene | open | 57462-61976 | rpoC | ||
| 973 | CABMKQ010000014.1 | GCA902387035_00487 | gene | open | 61963-65550 | |||
| 974 | CABMKQ010000014.1 | GCA902387035_00481 | gene | open | 53624-53700 | trnR | ||
| 975 | CABMKQ010000014.1 | GCA902387035_00481 | tRNA | open | 53624-53700 | trnR | tRNA-Arg(cct) | |
| 976 | CABMKQ010000015.1 | GCA902387035_00488 | CDS | open | 73-573 | _na 166_aa | hypothetical protein | |
| 977 | CABMKQ010000015.1 | GCA902387035_00488 | gene | open | 73-573 | |||
| 978 | CABMKQ010000016.1 | GCA902387035_00489 | CDS | open | 354-974 | _na 206_aa | hypothetical protein | |
| 979 | CABMKQ010000016.1 | GCA902387035_00490 | CDS | open | 958-1839 | _na 293_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 980 | CABMKQ010000016.1 | GCA902387035_00491 | CDS | open | 1919-2917 | _na 332_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 981 | CABMKQ010000016.1 | GCA902387035_00492 | CDS | open | 2934-4136 | _na 400_aa | Phosphoglycerate kinase | |
| 982 | CABMKQ010000016.1 | GCA902387035_00493 | CDS | open | 4133-4810 | _na 225_aa | triose-phosphate isomerase | |
| 983 | CABMKQ010000016.1 | GCA902387035_00494 | CDS | open | 5112-5930 | _na 272_aa | fabI | enoyl-ACP reductase FabI |
| 984 | CABMKQ010000016.1 | GCA902387035_00495 | CDS | open | 6101-6442 | _na 113_aa | DUF2625 domain-containing protein | |
| 985 | CABMKQ010000016.1 | GCA902387035_00496 | CDS | open | 7105-7206 | _na 33_aa | hypothetical protein | |
| 986 | CABMKQ010000016.1 | GCA902387035_00497 | CDS | open | 7271-9088 | _na 605_aa | TonB-dependent receptor domain-containing protein | |
| 987 | CABMKQ010000016.1 | GCA902387035_00498 | CDS | open | 9216-10562 | _na 448_aa | malate dehydrogenase (quinone) | |
| 988 | CABMKQ010000016.1 | GCA902387035_00499 | CDS | open | 10565-11278 | _na 237_aa | DUF4272 domain-containing protein | |
| 989 | CABMKQ010000016.1 | GCA902387035_00500 | CDS | open | 11324-12382 | _na 352_aa | NAD dependent epimerase/dehydratase family protein | |
| 990 | CABMKQ010000016.1 | GCA902387035_00501 | CDS | open | 12392-12970 | _na 192_aa | DNA-3-methyladenine glycosylase I%2C constitutive | |
| 991 | CABMKQ010000016.1 | GCA902387035_00502 | CDS | open | 12967-13818 | _na 283_aa | DNA ligase | |
| 992 | CABMKQ010000016.1 | GCA902387035_00503 | CDS | open | 13899-14882 | _na 327_aa | galE | UDP-glucose 4-epimerase GalE |
| 993 | CABMKQ010000016.1 | GCA902387035_00504 | CDS | open | 14891-16213 | _na 440_aa | UDP-glucose 6-dehydrogenase | |
| 994 | CABMKQ010000016.1 | GCA902387035_00505 | CDS | open | 16210-16650 | _na 146_aa | Putative Ecotin domain protein | |
| 995 | CABMKQ010000016.1 | GCA902387035_00506 | CDS | open | 16647-17879 | _na 410_aa | UDP-glucose/GDP-mannose dehydrogenase C-terminal domain-containing protein | |
| 996 | CABMKQ010000016.1 | GCA902387035_00507 | CDS | open | 17888-20008 | _na 706_aa | Glycosyltransferase | |
| 997 | CABMKQ010000016.1 | GCA902387035_00508 | CDS | open | 20008-21525 | _na 505_aa | Polysaccharide biosynthesis protein C-terminal domain-containing protein | |
| 998 | CABMKQ010000016.1 | GCA902387035_00509 | CDS | open | 21526-22287 | _na 253_aa | LPS biosynthesis glycosyltransferase | |
| 999 | CABMKQ010000016.1 | GCA902387035_00510 | CDS | open | 22288-23220 | _na 310_aa | GalNAc5-diNAcBac-PP-undecaprenol beta-1%2C3-glucosyltransferase | |
| 1000 | CABMKQ010000016.1 | GCA902387035_00511 | CDS | open | 23217-24275 | _na 352_aa | GalNAc-alpha-(1%2C4)-GalNAc-alpha-(1%2C 3)-diNAcBac-PP-undecaprenol alpha-1%2C4-N-acetyl-D-galactosaminyltransferase |

