HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas asaccharolytica (GCA_902406175.1)

Select a Genome:
BAKTA Annotations for GCA_902406175.1
Genome Selected: Porphyromonas asaccharolytica
ContigsBases CDSrRNA tmRNAtRNA
74 2088006 1636 0 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3374 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3374 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CABPCR010000009.1 GCA902406175_00494 tRNA open 44872-44948 trnH tRNA-His(gtg)
1002 CABPCR010000010.1 repeat_region open 27716-29057 CRISPR array with 20 repeats of length 33%2C consensus sequence GTCGCACCCCGCACGGGGTGCGTGAATTGAAAC and spacer length 34
1003 CABPCR010000010.1 GCA902406175_00500 CDS open 1026-2609 _na     527_aa Glycosyl hydrolase-like 10 domain-containing protein
1004 CABPCR010000010.1 GCA902406175_00501 CDS open 2613-3728 _na     371_aa hemW radical SAM family heme chaperone HemW
1005 CABPCR010000010.1 GCA902406175_00502 CDS open 3886-4386 _na     166_aa flavodoxin
1006 CABPCR010000010.1 GCA902406175_00503 CDS open 4442-4801 _na     119_aa DUF2023 domain-containing protein
1007 CABPCR010000010.1 GCA902406175_00505 CDS open 5332-6438 _na     368_aa Cell wall hydrolase/autolysin
1008 CABPCR010000010.1 GCA902406175_00506 CDS open 6455-7351 _na     298_aa Mammalian cell entry related domain protein
1009 CABPCR010000010.1 GCA902406175_00507 CDS open 7364-7561 _na     65_aa hypothetical protein
1010 CABPCR010000010.1 GCA902406175_00508 CDS open 7580-8110 _na     176_aa Chromate transport protein
1011 CABPCR010000010.1 GCA902406175_00509 CDS open 8123-8725 _na     200_aa Chromate transport protein
1012 CABPCR010000010.1 GCA902406175_00510 CDS open 8722-10074 _na     450_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
1013 CABPCR010000010.1 GCA902406175_00511 CDS open 10083-11102 _na     339_aa Glycosyltransferase%2C group 2 family protein
1014 CABPCR010000010.1 GCA902406175_00512 CDS open 11140-11535 _na     131_aa Transmembrane signal peptide protein
1015 CABPCR010000010.1 GCA902406175_00513 CDS open 11957-12526 _na     189_aa Site-specific recombinase%2C phage integrase family
1016 CABPCR010000010.1 GCA902406175_00514 CDS open 12628-13335 _na     235_aa DUF1266 domain-containing protein
1017 CABPCR010000010.1 GCA902406175_00515 CDS open 13383-14426 _na     347_aa DUF3137 domain-containing protein
1018 CABPCR010000010.1 GCA902406175_00516 CDS open 14430-14999 _na     189_aa lemA LemA family protein
1019 CABPCR010000010.1 GCA902406175_00517 CDS open 15015-15746 _na     243_aa MORN repeat protein
1020 CABPCR010000010.1 GCA902406175_00518 CDS open 15989-16291 _na     100_aa Helix-turn-helix domain-containing protein
1021 CABPCR010000010.1 GCA902406175_00519 CDS open 16523-17008 _na     161_aa Glutathione peroxidase
1022 CABPCR010000010.1 GCA902406175_00520 CDS open 17024-17479 _na     151_aa NfeD-like C-terminal domain-containing protein
1023 CABPCR010000010.1 GCA902406175_00521 CDS open 17501-18517 _na     338_aa Band 7 protein
1024 CABPCR010000010.1 GCA902406175_00522 CDS open 18570-19445 _na     291_aa fic protein adenylyltransferase Fic
1025 CABPCR010000010.1 GCA902406175_00523 CDS open 19581-21896 _na     771_aa CRISPR-associated helicase Cas3'
1026 CABPCR010000010.1 GCA902406175_00524 CDS open 21901-22647 _na     248_aa cas5c type I-C CRISPR-associated protein Cas5c
1027 CABPCR010000010.1 GCA902406175_00525 CDS open 22644-24542 _na     632_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
1028 CABPCR010000010.1 GCA902406175_00526 CDS open 24560-25438 _na     292_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
1029 CABPCR010000010.1 GCA902406175_00527 CDS open 25518-26195 _na     225_aa cas4 CRISPR-associated protein Cas4
1030 CABPCR010000010.1 GCA902406175_00528 CDS open 26192-27223 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1031 CABPCR010000010.1 GCA902406175_00529 CDS open 27223-27513 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
1032 CABPCR010000010.1 GCA902406175_00530 CDS open 29405-30640 _na     411_aa Polysaccharide biosynthesis protein
1033 CABPCR010000010.1 GCA902406175_00531 CDS open 30808-31293 _na     161_aa hypothetical protein
1034 CABPCR010000010.1 GCA902406175_00532 CDS open 31474-32685 _na     403_aa ATP-binding protein
1035 CABPCR010000010.1 GCA902406175_00533 CDS open 33296-34774 _na     492_aa cysS cysteine--tRNA ligase
1036 CABPCR010000010.1 GCA902406175_00534 CDS open 34801-35766 _na     321_aa Glycosyltransferase%2C group 2 family protein
1037 CABPCR010000010.1 GCA902406175_00535 CDS open 35720-38287 _na     855_aa yfhO Bacterial membrane protein YfhO
1038 CABPCR010000010.1 GCA902406175_00536 CDS open 38312-40000 _na     562_aa Tetratricopeptide TPR_2 repeat-containing protein
1039 CABPCR010000010.1 GCA902406175_00537 CDS open 40320-41435 _na     371_aa AMP-dependent synthetase and ligase
1040 CABPCR010000010.1 GCA902406175_00538 CDS open 41509-42606 _na     365_aa Mandelate racemase/muconate lactonizing protein
1041 CABPCR010000010.1 GCA902406175_00539 CDS open 42613-43443 _na     276_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
1042 CABPCR010000010.1 GCA902406175_00540 CDS open 43440-45158 _na     572_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
1043 CABPCR010000010.1 GCA902406175_00541 CDS open 45183-46322 _na     379_aa isochorismate synthase
1044 CABPCR010000010.1 GCA902406175_00542 CDS open 46458-48656 _na     732_aa RelA/SpoT family protein
1045 CABPCR010000010.1 GCA902406175_00543 CDS open 48784-49164 _na     126_aa 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1046 CABPCR010000010.1 GCA902406175_00544 CDS open 49189-50286 _na     365_aa 3-deoxy-7-phosphoheptulonate synthase
1047 CABPCR010000010.1 GCA902406175_00500 gene open 1026-2609
1048 CABPCR010000010.1 GCA902406175_00501 gene open 2613-3728 hemW
1049 CABPCR010000010.1 GCA902406175_00502 gene open 3886-4386
1050 CABPCR010000010.1 GCA902406175_00503 gene open 4442-4801
1051 CABPCR010000010.1 GCA902406175_00505 gene open 5332-6438
1052 CABPCR010000010.1 GCA902406175_00506 gene open 6455-7351
1053 CABPCR010000010.1 GCA902406175_00507 gene open 7364-7561
1054 CABPCR010000010.1 GCA902406175_00508 gene open 7580-8110
1055 CABPCR010000010.1 GCA902406175_00509 gene open 8123-8725
1056 CABPCR010000010.1 GCA902406175_00510 gene open 8722-10074 mtaB
1057 CABPCR010000010.1 GCA902406175_00511 gene open 10083-11102
1058 CABPCR010000010.1 GCA902406175_00512 gene open 11140-11535
1059 CABPCR010000010.1 GCA902406175_00513 gene open 11957-12526
1060 CABPCR010000010.1 GCA902406175_00514 gene open 12628-13335
1061 CABPCR010000010.1 GCA902406175_00515 gene open 13383-14426
1062 CABPCR010000010.1 GCA902406175_00516 gene open 14430-14999 lemA
1063 CABPCR010000010.1 GCA902406175_00517 gene open 15015-15746
1064 CABPCR010000010.1 GCA902406175_00518 gene open 15989-16291
1065 CABPCR010000010.1 GCA902406175_00519 gene open 16523-17008
1066 CABPCR010000010.1 GCA902406175_00520 gene open 17024-17479
1067 CABPCR010000010.1 GCA902406175_00521 gene open 17501-18517
1068 CABPCR010000010.1 GCA902406175_00522 gene open 18570-19445 fic
1069 CABPCR010000010.1 GCA902406175_00523 gene open 19581-21896
1070 CABPCR010000010.1 GCA902406175_00524 gene open 21901-22647 cas5c
1071 CABPCR010000010.1 GCA902406175_00525 gene open 22644-24542 cas8c
1072 CABPCR010000010.1 GCA902406175_00526 gene open 24560-25438 cas7c
1073 CABPCR010000010.1 GCA902406175_00527 gene open 25518-26195 cas4
1074 CABPCR010000010.1 GCA902406175_00528 gene open 26192-27223 cas1c
1075 CABPCR010000010.1 GCA902406175_00529 gene open 27223-27513 cas2
1076 CABPCR010000010.1 GCA902406175_00530 gene open 29405-30640
1077 CABPCR010000010.1 GCA902406175_00531 gene open 30808-31293
1078 CABPCR010000010.1 GCA902406175_00532 gene open 31474-32685
1079 CABPCR010000010.1 GCA902406175_00533 gene open 33296-34774 cysS
1080 CABPCR010000010.1 GCA902406175_00534 gene open 34801-35766
1081 CABPCR010000010.1 GCA902406175_00535 gene open 35720-38287 yfhO
1082 CABPCR010000010.1 GCA902406175_00536 gene open 38312-40000
1083 CABPCR010000010.1 GCA902406175_00537 gene open 40320-41435
1084 CABPCR010000010.1 GCA902406175_00538 gene open 41509-42606
1085 CABPCR010000010.1 GCA902406175_00539 gene open 42613-43443 menB
1086 CABPCR010000010.1 GCA902406175_00540 gene open 43440-45158 menD
1087 CABPCR010000010.1 GCA902406175_00541 gene open 45183-46322
1088 CABPCR010000010.1 GCA902406175_00542 gene open 46458-48656
1089 CABPCR010000010.1 GCA902406175_00543 gene open 48784-49164
1090 CABPCR010000010.1 GCA902406175_00544 gene open 49189-50286
1091 CABPCR010000010.1 GCA902406175_00504 gene open 4993-5065 trnK
1092 CABPCR010000010.1 GCA902406175_00504 tRNA open 4993-5065 trnK tRNA-Lys(ttt)
1093 CABPCR010000011.1 GCA902406175_00545 CDS open 351-674 _na     107_aa hypothetical protein
1094 CABPCR010000011.1 GCA902406175_00547 CDS open 1250-2482 _na     410_aa site-specific integrase
1095 CABPCR010000011.1 GCA902406175_00548 CDS open 2563-3192 _na     209_aa DUF4369 domain-containing protein
1096 CABPCR010000011.1 GCA902406175_00549 CDS open 3211-5994 _na     927_aa hypothetical protein
1097 CABPCR010000011.1 GCA902406175_00550 CDS open 6381-7529 _na     382_aa hypothetical protein
1098 CABPCR010000011.1 GCA902406175_00551 CDS open 7614-8168 _na     184_aa hypothetical protein
1099 CABPCR010000011.1 GCA902406175_00552 CDS open 8165-10672 _na     835_aa hypothetical protein
1100 CABPCR010000011.1 GCA902406175_00553 CDS open 10669-14424 _na     1251_aa tape measure protein
1101 CABPCR010000011.1 GCA902406175_00554 CDS open 14431-15018 _na     195_aa hypothetical protein
1102 CABPCR010000011.1 GCA902406175_00555 CDS open 15183-15704 _na     173_aa phage tail tube protein
1103 CABPCR010000011.1 GCA902406175_00556 CDS open 15717-16175 _na     152_aa hypothetical protein
1104 CABPCR010000011.1 GCA902406175_00557 CDS open 16175-16612 _na     145_aa hypothetical protein
1105 CABPCR010000011.1 GCA902406175_00558 CDS open 16609-16935 _na     108_aa head-tail adaptor protein
1106 CABPCR010000011.1 GCA902406175_00559 CDS open 16932-17228 _na     98_aa head-tail connector protein
1107 CABPCR010000011.1 GCA902406175_00560 CDS open 17267-18361 _na     364_aa phage major capsid protein
1108 CABPCR010000011.1 GCA902406175_00561 CDS open 18369-19046 _na     225_aa HK97 family phage prohead protease
1109 CABPCR010000011.1 GCA902406175_00562 CDS open 18985-20283 _na     432_aa phage portal protein
1110 CABPCR010000011.1 GCA902406175_00563 CDS open 20276-20704 _na     142_aa hypothetical protein
1111 CABPCR010000011.1 GCA902406175_00564 CDS open 20724-22439 _na     571_aa terL terminase TerL endonuclease subunit
1112 CABPCR010000011.1 GCA902406175_00565 CDS open 22436-22900 _na     154_aa P27 family phage terminase small subunit
1113 CABPCR010000011.1 GCA902406175_00566 CDS open 23299-23865 _na     188_aa hypothetical protein
1114 CABPCR010000011.1 GCA902406175_00567 CDS open 24253-24657 _na     134_aa hypothetical protein
1115 CABPCR010000011.1 GCA902406175_00568 CDS open 24736-26925 _na     729_aa hypothetical protein
1116 CABPCR010000011.1 GCA902406175_00569 CDS open 26997-27443 _na     148_aa hypothetical protein
1117 CABPCR010000011.1 GCA902406175_00570 CDS open 27469-27864 _na     131_aa type I-C CRISPR-associated protein Cas8c/Csd1
1118 CABPCR010000011.1 GCA902406175_00571 CDS open 27901-28218 _na     105_aa CRISPR associated protein Cas2
1119 CABPCR010000011.1 GCA902406175_00572 CDS open 28576-29337 _na     253_aa DNA cytosine methyltransferase
1120 CABPCR010000011.1 GCA902406175_00573 CDS open 29376-29546 _na     56_aa hypothetical protein
1121 CABPCR010000011.1 GCA902406175_00574 CDS open 29638-30030 _na     130_aa HNH endonuclease
1122 CABPCR010000011.1 GCA902406175_00575 CDS open 30002-30532 _na     176_aa hypothetical protein
1123 CABPCR010000011.1 GCA902406175_00576 CDS open 30616-30969 _na     117_aa VRR-NUC domain-containing protein
1124 CABPCR010000011.1 GCA902406175_00577 CDS open 30974-31405 _na     143_aa hypothetical protein
1125 CABPCR010000011.1 GCA902406175_00578 CDS open 31393-31557 _na     54_aa hypothetical protein
1126 CABPCR010000011.1 GCA902406175_00579 CDS open 31554-31775 _na     73_aa hypothetical protein
1127 CABPCR010000011.1 GCA902406175_00580 CDS open 31763-32212 _na     149_aa structural protein P5
1128 CABPCR010000011.1 GCA902406175_00581 CDS open 32252-32878 _na     208_aa hypothetical protein
1129 CABPCR010000011.1 GCA902406175_00582 CDS open 32835-33962 _na     375_aa Lin1244/Lin1753 domain-containing protein
1130 CABPCR010000011.1 GCA902406175_00583 CDS open 34062-34487 _na     141_aa single-stranded DNA-binding protein
1131 CABPCR010000011.1 GCA902406175_00584 CDS open 34511-34792 _na     93_aa hypothetical protein
1132 CABPCR010000011.1 GCA902406175_00585 CDS open 34789-35115 _na     108_aa hypothetical protein
1133 CABPCR010000011.1 GCA902406175_00586 CDS open 35119-35355 _na     78_aa hypothetical protein
1134 CABPCR010000011.1 GCA902406175_00587 CDS open 35357-35620 _na     87_aa hypothetical protein
1135 CABPCR010000011.1 GCA902406175_00588 CDS open 35607-35855 _na     82_aa hypothetical protein
1136 CABPCR010000011.1 GCA902406175_00589 CDS open 35842-36138 _na     98_aa hypothetical protein
1137 CABPCR010000011.1 GCA902406175_00590 CDS open 36095-36331 _na     78_aa hypothetical protein
1138 CABPCR010000011.1 GCA902406175_00591 CDS open 36381-36635 _na     84_aa hypothetical protein
1139 CABPCR010000011.1 GCA902406175_00592 CDS open 36622-36912 _na     96_aa hypothetical protein
1140 CABPCR010000011.1 GCA902406175_00593 CDS open 36917-37168 _na     83_aa hypothetical protein
1141 CABPCR010000011.1 GCA902406175_00594 CDS open 37173-37370 _na     65_aa helix-turn-helix domain-containing protein
1142 CABPCR010000011.1 GCA902406175_00595 CDS open 37375-37593 _na     72_aa hypothetical protein
1143 CABPCR010000011.1 GCA902406175_00596 CDS open 37699-37893 _na     64_aa hypothetical protein
1144 CABPCR010000011.1 GCA902406175_00597 CDS open 38025-38339 _na     104_aa hypothetical protein
1145 CABPCR010000011.1 GCA902406175_00598 CDS open 38363-38608 _na     81_aa hypothetical protein
1146 CABPCR010000011.1 GCA902406175_00599 CDS open 38615-38890 _na     91_aa hypothetical protein
1147 CABPCR010000011.1 GCA902406175_00600 CDS open 38869-39153 _na     94_aa hypothetical protein
1148 CABPCR010000011.1 GCA902406175_00601 CDS open 39282-40028 _na     248_aa S24 family peptidase
1149 CABPCR010000011.1 GCA902406175_00602 CDS open 40594-41391 _na     265_aa hypothetical protein
1150 CABPCR010000011.1 GCA902406175_00603 CDS open 41451-42155 _na     234_aa Phosphoesterase PA-phosphatase related protein
1151 CABPCR010000011.1 GCA902406175_00604 CDS open 42351-42866 _na     171_aa helix-hairpin-helix domain-containing protein
1152 CABPCR010000011.1 GCA902406175_00605 CDS open 42895-43587 _na     230_aa Fe(3+)-transporting ATPase
1153 CABPCR010000011.1 GCA902406175_00606 CDS open 43602-44360 _na     252_aa UBA/THIF-type NAD/FAD binding protein
1154 CABPCR010000011.1 GCA902406175_00607 CDS open 44367-45368 _na     333_aa Endolytic murein transglycosylase
1155 CABPCR010000011.1 GCA902406175_00608 CDS open 45623-47497 _na     624_aa DUF349 domain-containing protein
1156 CABPCR010000011.1 GCA902406175_00545 gene open 351-674
1157 CABPCR010000011.1 GCA902406175_00547 gene open 1250-2482
1158 CABPCR010000011.1 GCA902406175_00548 gene open 2563-3192
1159 CABPCR010000011.1 GCA902406175_00549 gene open 3211-5994
1160 CABPCR010000011.1 GCA902406175_00550 gene open 6381-7529
1161 CABPCR010000011.1 GCA902406175_00551 gene open 7614-8168
1162 CABPCR010000011.1 GCA902406175_00552 gene open 8165-10672
1163 CABPCR010000011.1 GCA902406175_00553 gene open 10669-14424
1164 CABPCR010000011.1 GCA902406175_00554 gene open 14431-15018
1165 CABPCR010000011.1 GCA902406175_00555 gene open 15183-15704
1166 CABPCR010000011.1 GCA902406175_00556 gene open 15717-16175
1167 CABPCR010000011.1 GCA902406175_00557 gene open 16175-16612
1168 CABPCR010000011.1 GCA902406175_00558 gene open 16609-16935
1169 CABPCR010000011.1 GCA902406175_00559 gene open 16932-17228
1170 CABPCR010000011.1 GCA902406175_00560 gene open 17267-18361
1171 CABPCR010000011.1 GCA902406175_00561 gene open 18369-19046
1172 CABPCR010000011.1 GCA902406175_00562 gene open 18985-20283
1173 CABPCR010000011.1 GCA902406175_00563 gene open 20276-20704
1174 CABPCR010000011.1 GCA902406175_00564 gene open 20724-22439 terL
1175 CABPCR010000011.1 GCA902406175_00565 gene open 22436-22900
1176 CABPCR010000011.1 GCA902406175_00566 gene open 23299-23865
1177 CABPCR010000011.1 GCA902406175_00567 gene open 24253-24657
1178 CABPCR010000011.1 GCA902406175_00568 gene open 24736-26925
1179 CABPCR010000011.1 GCA902406175_00569 gene open 26997-27443
1180 CABPCR010000011.1 GCA902406175_00570 gene open 27469-27864
1181 CABPCR010000011.1 GCA902406175_00571 gene open 27901-28218
1182 CABPCR010000011.1 GCA902406175_00572 gene open 28576-29337
1183 CABPCR010000011.1 GCA902406175_00573 gene open 29376-29546
1184 CABPCR010000011.1 GCA902406175_00574 gene open 29638-30030
1185 CABPCR010000011.1 GCA902406175_00575 gene open 30002-30532
1186 CABPCR010000011.1 GCA902406175_00576 gene open 30616-30969
1187 CABPCR010000011.1 GCA902406175_00577 gene open 30974-31405
1188 CABPCR010000011.1 GCA902406175_00578 gene open 31393-31557
1189 CABPCR010000011.1 GCA902406175_00579 gene open 31554-31775
1190 CABPCR010000011.1 GCA902406175_00580 gene open 31763-32212
1191 CABPCR010000011.1 GCA902406175_00581 gene open 32252-32878
1192 CABPCR010000011.1 GCA902406175_00582 gene open 32835-33962
1193 CABPCR010000011.1 GCA902406175_00583 gene open 34062-34487
1194 CABPCR010000011.1 GCA902406175_00584 gene open 34511-34792
1195 CABPCR010000011.1 GCA902406175_00585 gene open 34789-35115
1196 CABPCR010000011.1 GCA902406175_00586 gene open 35119-35355
1197 CABPCR010000011.1 GCA902406175_00587 gene open 35357-35620
1198 CABPCR010000011.1 GCA902406175_00588 gene open 35607-35855
1199 CABPCR010000011.1 GCA902406175_00589 gene open 35842-36138
1200 CABPCR010000011.1 GCA902406175_00590 gene open 36095-36331
1201 CABPCR010000011.1 GCA902406175_00591 gene open 36381-36635
1202 CABPCR010000011.1 GCA902406175_00592 gene open 36622-36912
1203 CABPCR010000011.1 GCA902406175_00593 gene open 36917-37168
1204 CABPCR010000011.1 GCA902406175_00594 gene open 37173-37370
1205 CABPCR010000011.1 GCA902406175_00595 gene open 37375-37593
1206 CABPCR010000011.1 GCA902406175_00596 gene open 37699-37893
1207 CABPCR010000011.1 GCA902406175_00597 gene open 38025-38339
1208 CABPCR010000011.1 GCA902406175_00598 gene open 38363-38608
1209 CABPCR010000011.1 GCA902406175_00599 gene open 38615-38890
1210 CABPCR010000011.1 GCA902406175_00600 gene open 38869-39153
1211 CABPCR010000011.1 GCA902406175_00601 gene open 39282-40028
1212 CABPCR010000011.1 GCA902406175_00602 gene open 40594-41391
1213 CABPCR010000011.1 GCA902406175_00603 gene open 41451-42155
1214 CABPCR010000011.1 GCA902406175_00604 gene open 42351-42866
1215 CABPCR010000011.1 GCA902406175_00605 gene open 42895-43587
1216 CABPCR010000011.1 GCA902406175_00606 gene open 43602-44360
1217 CABPCR010000011.1 GCA902406175_00607 gene open 44367-45368
1218 CABPCR010000011.1 GCA902406175_00608 gene open 45623-47497
1219 CABPCR010000011.1 GCA902406175_00546 gene open 903-976 trnR
1220 CABPCR010000011.1 GCA902406175_00546 tRNA open 903-976 trnR tRNA-Arg(tct)
1221 CABPCR010000012.1 GCA902406175_00609 CDS open 405-1277 _na     290_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1222 CABPCR010000012.1 GCA902406175_00610 CDS open 1289-2290 _na     333_aa Thioredoxin domain-containing protein
1223 CABPCR010000012.1 GCA902406175_00611 CDS open 2382-3059 _na     225_aa ompA OmpA family protein
1224 CABPCR010000012.1 GCA902406175_00612 CDS open 3121-4104 _na     327_aa Dihydroorotate oxidase
1225 CABPCR010000012.1 GCA902406175_00614 CDS open 4513-5586 _na     357_aa Endonuclease/exonuclease/phosphatase
1226 CABPCR010000012.1 GCA902406175_00615 CDS open 5637-6185 _na     182_aa RNA polymerase sigma factor
1227 CABPCR010000012.1 GCA902406175_00616 CDS open 6272-6730 _na     152_aa hypothetical protein
1228 CABPCR010000012.1 GCA902406175_00617 CDS open 6758-7234 _na     158_aa Periplasmic heavy metal sensor
1229 CABPCR010000012.1 GCA902406175_00618 CDS open 7449-9083 _na     544_aa groL chaperonin GroEL
1230 CABPCR010000012.1 GCA902406175_00619 CDS open 9135-9404 _na     89_aa Co-chaperonin GroES
1231 CABPCR010000012.1 GCA902406175_00620 CDS open 9638-10951 _na     437_aa UPF0597 protein Poras_0072
1232 CABPCR010000012.1 GCA902406175_00621 CDS open 10974-11426 _na     150_aa FHA domain-containing protein
1233 CABPCR010000012.1 GCA902406175_00622 CDS open 12089-13261 _na     390_aa Putative cytochrome d ubiquinol oxidase%2C subunit II
1234 CABPCR010000012.1 GCA902406175_00623 CDS open 13290-14921 _na     543_aa Bacterial cytochrome ubiquinol oxidase
1235 CABPCR010000012.1 GCA902406175_00624 CDS open 14939-15220 _na     93_aa DUF4492 domain-containing protein
1236 CABPCR010000012.1 GCA902406175_00625 CDS open 15317-15826 _na     169_aa Arginine repressor
1237 CABPCR010000012.1 GCA902406175_00626 CDS open 15921-17003 _na     360_aa Endonuclease/exonuclease/phosphatase
1238 CABPCR010000012.1 GCA902406175_00627 CDS open 17056-19134 _na     692_aa Endothelin-converting enzyme 1
1239 CABPCR010000012.1 GCA902406175_00628 CDS open 19155-20060 _na     301_aa Nucleotidyl transferase domain-containing protein
1240 CABPCR010000012.1 GCA902406175_00629 CDS open 20128-20607 _na     159_aa S-ribosylhomocysteine lyase
1241 CABPCR010000012.1 GCA902406175_00630 CDS open 20626-21348 _na     240_aa pepE dipeptidase PepE
1242 CABPCR010000012.1 GCA902406175_00631 CDS open 21709-24336 _na     875_aa DNA gyrase/topoisomerase IV subunit A
1243 CABPCR010000012.1 GCA902406175_00632 CDS open 24408-25259 _na     283_aa Outer membrane protein beta-barrel domain-containing protein
1244 CABPCR010000012.1 GCA902406175_00633 CDS open 25256-26311 _na     351_aa Peptidase S41
1245 CABPCR010000012.1 GCA902406175_00635 CDS open 27101-29725 _na     874_aa Bacterial repeat domain-containing protein
1246 CABPCR010000012.1 GCA902406175_00636 CDS open 30215-31396 _na     393_aa 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein
1247 CABPCR010000012.1 GCA902406175_00637 CDS open 31593-32582 _na     329_aa Lipoprotein
1248 CABPCR010000012.1 GCA902406175_00638 CDS open 32717-36130 _na     1137_aa ileS isoleucine--tRNA ligase
1249 CABPCR010000012.1 GCA902406175_00639 CDS open 36215-36595 _na     126_aa Zinc finger DksA/TraR C4-type domain-containing protein
1250 CABPCR010000012.1 GCA902406175_00640 CDS open 36613-37293 _na     226_aa lipoprotein signal peptidase
1251 CABPCR010000012.1 GCA902406175_00641 CDS open 37309-38304 _na     331_aa DUF4296 domain-containing protein
1252 CABPCR010000012.1 GCA902406175_00642 CDS open 38350-38580 _na     76_aa DUF5348 domain-containing protein
1253 CABPCR010000012.1 GCA902406175_00643 CDS open 38686-41304 _na     872_aa alaS alanine--tRNA ligase
1254 CABPCR010000012.1 GCA902406175_00644 CDS open 41362-42414 _na     350_aa 3-dehydroquinate synthase
1255 CABPCR010000012.1 GCA902406175_00645 CDS open 42607-43944 _na     445_aa Deoxyguanosinetriphosphate triphosphohydrolase
1256 CABPCR010000012.1 GCA902406175_00646 CDS open 43971-45395 _na     474_aa radA DNA repair protein RadA
1257 CABPCR010000012.1 GCA902406175_00647 CDS open 45399-46334 _na     311_aa Amidinotransferase
1258 CABPCR010000012.1 GCA902406175_00609 gene open 405-1277 rfbA
1259 CABPCR010000012.1 GCA902406175_00610 gene open 1289-2290
1260 CABPCR010000012.1 GCA902406175_00611 gene open 2382-3059 ompA
1261 CABPCR010000012.1 GCA902406175_00612 gene open 3121-4104
1262 CABPCR010000012.1 GCA902406175_00614 gene open 4513-5586
1263 CABPCR010000012.1 GCA902406175_00615 gene open 5637-6185
1264 CABPCR010000012.1 GCA902406175_00616 gene open 6272-6730
1265 CABPCR010000012.1 GCA902406175_00617 gene open 6758-7234
1266 CABPCR010000012.1 GCA902406175_00618 gene open 7449-9083 groL
1267 CABPCR010000012.1 GCA902406175_00619 gene open 9135-9404
1268 CABPCR010000012.1 GCA902406175_00620 gene open 9638-10951
1269 CABPCR010000012.1 GCA902406175_00621 gene open 10974-11426
1270 CABPCR010000012.1 GCA902406175_00622 gene open 12089-13261
1271 CABPCR010000012.1 GCA902406175_00623 gene open 13290-14921
1272 CABPCR010000012.1 GCA902406175_00624 gene open 14939-15220
1273 CABPCR010000012.1 GCA902406175_00625 gene open 15317-15826
1274 CABPCR010000012.1 GCA902406175_00626 gene open 15921-17003
1275 CABPCR010000012.1 GCA902406175_00627 gene open 17056-19134
1276 CABPCR010000012.1 GCA902406175_00628 gene open 19155-20060
1277 CABPCR010000012.1 GCA902406175_00629 gene open 20128-20607
1278 CABPCR010000012.1 GCA902406175_00630 gene open 20626-21348 pepE
1279 CABPCR010000012.1 GCA902406175_00631 gene open 21709-24336
1280 CABPCR010000012.1 GCA902406175_00632 gene open 24408-25259
1281 CABPCR010000012.1 GCA902406175_00633 gene open 25256-26311
1282 CABPCR010000012.1 GCA902406175_00635 gene open 27101-29725
1283 CABPCR010000012.1 GCA902406175_00636 gene open 30215-31396
1284 CABPCR010000012.1 GCA902406175_00637 gene open 31593-32582
1285 CABPCR010000012.1 GCA902406175_00638 gene open 32717-36130 ileS
1286 CABPCR010000012.1 GCA902406175_00639 gene open 36215-36595
1287 CABPCR010000012.1 GCA902406175_00640 gene open 36613-37293
1288 CABPCR010000012.1 GCA902406175_00641 gene open 37309-38304
1289 CABPCR010000012.1 GCA902406175_00642 gene open 38350-38580
1290 CABPCR010000012.1 GCA902406175_00643 gene open 38686-41304 alaS
1291 CABPCR010000012.1 GCA902406175_00644 gene open 41362-42414
1292 CABPCR010000012.1 GCA902406175_00645 gene open 42607-43944
1293 CABPCR010000012.1 GCA902406175_00646 gene open 43971-45395 radA
1294 CABPCR010000012.1 GCA902406175_00647 gene open 45399-46334
1295 CABPCR010000012.1 GCA902406175_00613 gene open 4218-4290 trnF
1296 CABPCR010000012.1 GCA902406175_00634 gene open 26553-26626 trnR
1297 CABPCR010000012.1 GCA902406175_00613 tRNA open 4218-4290 trnF tRNA-Phe(gaa)
1298 CABPCR010000012.1 GCA902406175_00634 tRNA open 26553-26626 trnR tRNA-Arg(acg)
1299 CABPCR010000013.1 GCA902406175_00648 CDS open 539-994 _na     151_aa greA transcription elongation factor GreA
1300 CABPCR010000013.1 GCA902406175_00649 CDS open 1041-1436 _na     131_aa Histidine triad (HIT) protein
1301 CABPCR010000013.1 GCA902406175_00650 CDS open 1453-2475 _na     340_aa PhoH-like protein
1302 CABPCR010000013.1 GCA902406175_00651 CDS open 2551-3495 _na     314_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
1303 CABPCR010000013.1 GCA902406175_00652 CDS open 3584-4297 _na     237_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
1304 CABPCR010000013.1 GCA902406175_00653 CDS open 4306-5064 _na     252_aa Putative shikimate dehydrogenase
1305 CABPCR010000013.1 GCA902406175_00654 CDS open 5074-6486 _na     470_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1306 CABPCR010000013.1 GCA902406175_00655 CDS open 6502-7887 _na     461_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1307 CABPCR010000013.1 GCA902406175_00656 CDS open 7916-9175 _na     419_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1308 CABPCR010000013.1 GCA902406175_00657 CDS open 9240-10739 _na     499_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1309 CABPCR010000013.1 GCA902406175_00658 CDS open 10760-13000 _na     746_aa Peptidoglycan glycosyltransferase
1310 CABPCR010000013.1 GCA902406175_00659 CDS open 13031-13708 _na     225_aa ftsL Cell division protein FtsL
1311 CABPCR010000013.1 GCA902406175_00660 CDS open 13722-14738 _na     338_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1312 CABPCR010000013.1 GCA902406175_00661 CDS open 15097-17862 _na     921_aa Lysyl endopeptidase
1313 CABPCR010000013.1 GCA902406175_00662 CDS open 18595-21660 _na     1021_aa TonB-dependent receptor
1314 CABPCR010000013.1 GCA902406175_00663 CDS open 21700-23358 _na     552_aa RagB/SusD domain-containing protein
1315 CABPCR010000013.1 GCA902406175_00664 CDS open 24182-25537 _na     451_aa Na(+)-translocating NADH-quinone reductase subunit A
1316 CABPCR010000013.1 GCA902406175_00665 CDS open 25607-26830 _na     407_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit B
1317 CABPCR010000013.1 GCA902406175_00666 CDS open 26845-27594 _na     249_aa nqrC NADH:ubiquinone reductase (Na(+)-transporting) subunit C
1318 CABPCR010000013.1 GCA902406175_00667 CDS open 27617-28240 _na     207_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit D
1319 CABPCR010000013.1 GCA902406175_00668 CDS open 28292-28906 _na     204_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
1320 CABPCR010000013.1 GCA902406175_00669 CDS open 28919-30166 _na     415_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
1321 CABPCR010000013.1 GCA902406175_00670 CDS open 30429-31034 _na     201_aa DUF3575 domain-containing protein
1322 CABPCR010000013.1 GCA902406175_00671 CDS open 31073-32515 _na     480_aa DUF3868 domain-containing protein
1323 CABPCR010000013.1 GCA902406175_00672 CDS open 33123-34085 _na     320_aa Peptidase%2C M48 family
1324 CABPCR010000013.1 GCA902406175_00673 CDS open 34085-34633 _na     182_aa ATP:corrinoid adenosyltransferase BtuR/CobO/CobP
1325 CABPCR010000013.1 GCA902406175_00674 CDS open 34655-35647 _na     330_aa Peptidase%2C M28 family
1326 CABPCR010000013.1 GCA902406175_00675 CDS open 35664-36083 _na     139_aa Fe-S metabolism associated domain protein
1327 CABPCR010000013.1 GCA902406175_00676 CDS open 36094-37035 _na     313_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
1328 CABPCR010000013.1 GCA902406175_00677 CDS open 37038-38024 _na     328_aa N-acetyltransferase domain-containing protein
1329 CABPCR010000013.1 GCA902406175_00678 CDS open 38051-40438 _na     795_aa sbsA SbsA Ig-like domain-containing protein
1330 CABPCR010000013.1 GCA902406175_00679 CDS open 40461-41063 _na     200_aa L-threonylcarbamoyladenylate synthase
1331 CABPCR010000013.1 GCA902406175_00680 CDS open 41070-41927 _na     285_aa nfo deoxyribonuclease IV
1332 CABPCR010000013.1 GCA902406175_00682 CDS open 42599-43960 _na     453_aa TPR domain-containing protein
1333 CABPCR010000013.1 GCA902406175_00683 CDS open 43969-44622 _na     217_aa queC 7-cyano-7-deazaguanine synthase QueC
1334 CABPCR010000013.1 GCA902406175_00684 CDS open 44634-46118 _na     494_aa proS proline--tRNA ligase
1335 CABPCR010000013.1 GCA902406175_00648 gene open 539-994 greA
1336 CABPCR010000013.1 GCA902406175_00649 gene open 1041-1436
1337 CABPCR010000013.1 GCA902406175_00650 gene open 1453-2475
1338 CABPCR010000013.1 GCA902406175_00651 gene open 2551-3495
1339 CABPCR010000013.1 GCA902406175_00652 gene open 3584-4297 ubiE
1340 CABPCR010000013.1 GCA902406175_00653 gene open 4306-5064
1341 CABPCR010000013.1 GCA902406175_00654 gene open 5074-6486 ftsW
1342 CABPCR010000013.1 GCA902406175_00655 gene open 6502-7887 murD
1343 CABPCR010000013.1 GCA902406175_00656 gene open 7916-9175 mraY
1344 CABPCR010000013.1 GCA902406175_00657 gene open 9240-10739
1345 CABPCR010000013.1 GCA902406175_00658 gene open 10760-13000
1346 CABPCR010000013.1 GCA902406175_00659 gene open 13031-13708 ftsL
1347 CABPCR010000013.1 GCA902406175_00660 gene open 13722-14738 rsmH
1348 CABPCR010000013.1 GCA902406175_00661 gene open 15097-17862
1349 CABPCR010000013.1 GCA902406175_00662 gene open 18595-21660
1350 CABPCR010000013.1 GCA902406175_00663 gene open 21700-23358
1351 CABPCR010000013.1 GCA902406175_00664 gene open 24182-25537
1352 CABPCR010000013.1 GCA902406175_00665 gene open 25607-26830
1353 CABPCR010000013.1 GCA902406175_00666 gene open 26845-27594 nqrC
1354 CABPCR010000013.1 GCA902406175_00667 gene open 27617-28240
1355 CABPCR010000013.1 GCA902406175_00668 gene open 28292-28906 nqrE
1356 CABPCR010000013.1 GCA902406175_00669 gene open 28919-30166 nqrF
1357 CABPCR010000013.1 GCA902406175_00670 gene open 30429-31034
1358 CABPCR010000013.1 GCA902406175_00671 gene open 31073-32515
1359 CABPCR010000013.1 GCA902406175_00672 gene open 33123-34085
1360 CABPCR010000013.1 GCA902406175_00673 gene open 34085-34633
1361 CABPCR010000013.1 GCA902406175_00674 gene open 34655-35647
1362 CABPCR010000013.1 GCA902406175_00675 gene open 35664-36083
1363 CABPCR010000013.1 GCA902406175_00676 gene open 36094-37035
1364 CABPCR010000013.1 GCA902406175_00677 gene open 37038-38024
1365 CABPCR010000013.1 GCA902406175_00678 gene open 38051-40438 sbsA
1366 CABPCR010000013.1 GCA902406175_00679 gene open 40461-41063
1367 CABPCR010000013.1 GCA902406175_00680 gene open 41070-41927 nfo
1368 CABPCR010000013.1 GCA902406175_00682 gene open 42599-43960
1369 CABPCR010000013.1 GCA902406175_00683 gene open 43969-44622 queC
1370 CABPCR010000013.1 GCA902406175_00684 gene open 44634-46118 proS
1371 CABPCR010000013.1 GCA902406175_00681 gene open 42090-42162 trnK
1372 CABPCR010000013.1 GCA902406175_00681 tRNA open 42090-42162 trnK tRNA-Lys(ctt)
1373 CABPCR010000014.1 GCA902406175_00685 CDS open 244-4296 _na     1350_aa leucine-rich repeat protein
1374 CABPCR010000014.1 GCA902406175_00686 CDS open 4766-5257 _na     163_aa rplQ 50S ribosomal protein L17
1375 CABPCR010000014.1 GCA902406175_00687 CDS open 5266-6258 _na     330_aa DNA-directed RNA polymerase subunit alpha
1376 CABPCR010000014.1 GCA902406175_00688 CDS open 6271-6876 _na     201_aa rpsD 30S ribosomal protein S4
1377 CABPCR010000014.1 GCA902406175_00689 CDS open 7291-7677 _na     128_aa rpsK 30S ribosomal protein S11
1378 CABPCR010000014.1 GCA902406175_00690 CDS open 7690-8070 _na     126_aa rpsM 30S ribosomal protein S13
1379 CABPCR010000014.1 GCA902406175_00691 CDS open 8306-8524 _na     72_aa infA translation initiation factor IF-1
1380 CABPCR010000014.1 GCA902406175_00692 CDS open 8526-9281 _na     251_aa map type I methionyl aminopeptidase
1381 CABPCR010000014.1 GCA902406175_00693 CDS open 9361-10707 _na     448_aa secY preprotein translocase subunit SecY
1382 CABPCR010000014.1 GCA902406175_00694 CDS open 10719-11180 _na     153_aa rplO 50S ribosomal protein L15
1383 CABPCR010000014.1 GCA902406175_00695 CDS open 11204-11380 _na     58_aa rpmD 50S ribosomal protein L30
1384 CABPCR010000014.1 GCA902406175_00696 CDS open 11405-11923 _na     172_aa rpsE 30S ribosomal protein S5
1385 CABPCR010000014.1 GCA902406175_00697 CDS open 11939-12283 _na     114_aa rplR 50S ribosomal protein L18
1386 CABPCR010000014.1 GCA902406175_00698 CDS open 12314-12865 _na     183_aa rplF 50S ribosomal protein L6
1387 CABPCR010000014.1 GCA902406175_00699 CDS open 12887-13282 _na     131_aa rpsH 30S ribosomal protein S8
1388 CABPCR010000014.1 GCA902406175_00700 CDS open 13775-14053 _na     92_aa rpsN 30S ribosomal protein S14
1389 CABPCR010000014.1 GCA902406175_00701 CDS open 14069-14623 _na     184_aa rplE 50S ribosomal protein L5
1390 CABPCR010000014.1 GCA902406175_00702 CDS open 14626-14946 _na     106_aa rplX 50S ribosomal protein L24
1391 CABPCR010000014.1 GCA902406175_00703 CDS open 14965-15330 _na     121_aa rplN 50S ribosomal protein L14
1392 CABPCR010000014.1 GCA902406175_00704 CDS open 15334-15588 _na     84_aa rpsQ 30S ribosomal protein S17
1393 CABPCR010000014.1 GCA902406175_00705 CDS open 15614-15808 _na     64_aa rpmC 50S ribosomal protein L29
1394 CABPCR010000014.1 GCA902406175_00706 CDS open 15830-16264 _na     144_aa rplP 50S ribosomal protein L16
1395 CABPCR010000014.1 GCA902406175_00707 CDS open 16280-17026 _na     248_aa rpsC 30S ribosomal protein S3
1396 CABPCR010000014.1 GCA902406175_00708 CDS open 17032-17445 _na     137_aa rplV 50S ribosomal protein L22
1397 CABPCR010000014.1 GCA902406175_00709 CDS open 17487-17750 _na     87_aa rpsS 30S ribosomal protein S19
1398 CABPCR010000014.1 GCA902406175_00710 CDS open 17782-18615 _na     277_aa rplB 50S ribosomal protein L2
1399 CABPCR010000014.1 GCA902406175_00711 CDS open 18619-18912 _na     97_aa rplW 50S ribosomal protein L23
1400 CABPCR010000014.1 GCA902406175_00712 CDS open 18940-19563 _na     207_aa rplD 50S ribosomal protein L4
1401 CABPCR010000014.1 GCA902406175_00713 CDS open 19563-20150 _na     195_aa rplC 50S ribosomal protein L3
1402 CABPCR010000014.1 GCA902406175_00714 CDS open 20202-20465 _na     87_aa rpsJ 30S ribosomal protein S10
1403 CABPCR010000014.1 GCA902406175_00715 CDS open 20526-22649 _na     707_aa fusA elongation factor G
1404 CABPCR010000014.1 GCA902406175_00716 CDS open 22671-23147 _na     158_aa rpsG 30S ribosomal protein S7
1405 CABPCR010000014.1 GCA902406175_00717 CDS open 23519-23896 _na     125_aa rpsL 30S ribosomal protein S12
1406 CABPCR010000014.1 GCA902406175_00718 CDS open 25134-25760 _na     208_aa HAD-superfamily hydrolase%2C subfamily IA%2C variant 3
1407 CABPCR010000014.1 GCA902406175_00719 CDS open 25767-27875 _na     702_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
1408 CABPCR010000014.1 GCA902406175_00720 CDS open 28638-30251 _na     537_aa leucine-rich repeat domain-containing protein
1409 CABPCR010000014.1 GCA902406175_00721 CDS open 30255-31313 _na     352_aa leucine-rich repeat domain-containing protein
1410 CABPCR010000014.1 GCA902406175_00722 CDS open 31590-35615 _na     1341_aa inlB InlB B-repeat-containing protein
1411 CABPCR010000014.1 GCA902406175_00723 CDS open 36119-38209 _na     696_aa Leucine-rich repeat-containing protein
1412 CABPCR010000014.1 GCA902406175_00724 CDS open 38382-39476 _na     364_aa Secretion system C-terminal sorting domain-containing protein
1413 CABPCR010000014.1 GCA902406175_00725 CDS open 39715-40398 _na     227_aa Outer membrane insertion C-terminal signal
1414 CABPCR010000014.1 GCA902406175_00726 CDS open 40498-41202 _na     234_aa Outer membrane insertion C-terminal signal
1415 CABPCR010000014.1 GCA902406175_00727 CDS open 41445-43817 _na     790_aa trypsin-like peptidase domain-containing protein
1416 CABPCR010000014.1 GCA902406175_00728 CDS open 43854-44696 _na     280_aa fumarate hydratase
1417 CABPCR010000014.1 GCA902406175_00729 CDS open 44709-45266 _na     185_aa Fe-S-containing hydro-lyase
1418 CABPCR010000014.1 GCA902406175_00685 gene open 244-4296
1419 CABPCR010000014.1 GCA902406175_00686 gene open 4766-5257 rplQ
1420 CABPCR010000014.1 GCA902406175_00687 gene open 5266-6258
1421 CABPCR010000014.1 GCA902406175_00688 gene open 6271-6876 rpsD
1422 CABPCR010000014.1 GCA902406175_00689 gene open 7291-7677 rpsK
1423 CABPCR010000014.1 GCA902406175_00690 gene open 7690-8070 rpsM
1424 CABPCR010000014.1 GCA902406175_00691 gene open 8306-8524 infA
1425 CABPCR010000014.1 GCA902406175_00692 gene open 8526-9281 map
1426 CABPCR010000014.1 GCA902406175_00693 gene open 9361-10707 secY
1427 CABPCR010000014.1 GCA902406175_00694 gene open 10719-11180 rplO
1428 CABPCR010000014.1 GCA902406175_00695 gene open 11204-11380 rpmD
1429 CABPCR010000014.1 GCA902406175_00696 gene open 11405-11923 rpsE
1430 CABPCR010000014.1 GCA902406175_00697 gene open 11939-12283 rplR
1431 CABPCR010000014.1 GCA902406175_00698 gene open 12314-12865 rplF
1432 CABPCR010000014.1 GCA902406175_00699 gene open 12887-13282 rpsH
1433 CABPCR010000014.1 GCA902406175_00700 gene open 13775-14053 rpsN
1434 CABPCR010000014.1 GCA902406175_00701 gene open 14069-14623 rplE
1435 CABPCR010000014.1 GCA902406175_00702 gene open 14626-14946 rplX
1436 CABPCR010000014.1 GCA902406175_00703 gene open 14965-15330 rplN
1437 CABPCR010000014.1 GCA902406175_00704 gene open 15334-15588 rpsQ
1438 CABPCR010000014.1 GCA902406175_00705 gene open 15614-15808 rpmC
1439 CABPCR010000014.1 GCA902406175_00706 gene open 15830-16264 rplP
1440 CABPCR010000014.1 GCA902406175_00707 gene open 16280-17026 rpsC
1441 CABPCR010000014.1 GCA902406175_00708 gene open 17032-17445 rplV
1442 CABPCR010000014.1 GCA902406175_00709 gene open 17487-17750 rpsS
1443 CABPCR010000014.1 GCA902406175_00710 gene open 17782-18615 rplB
1444 CABPCR010000014.1 GCA902406175_00711 gene open 18619-18912 rplW
1445 CABPCR010000014.1 GCA902406175_00712 gene open 18940-19563 rplD
1446 CABPCR010000014.1 GCA902406175_00713 gene open 19563-20150 rplC
1447 CABPCR010000014.1 GCA902406175_00714 gene open 20202-20465 rpsJ
1448 CABPCR010000014.1 GCA902406175_00715 gene open 20526-22649 fusA
1449 CABPCR010000014.1 GCA902406175_00716 gene open 22671-23147 rpsG
1450 CABPCR010000014.1 GCA902406175_00717 gene open 23519-23896 rpsL
1451 CABPCR010000014.1 GCA902406175_00718 gene open 25134-25760
1452 CABPCR010000014.1 GCA902406175_00719 gene open 25767-27875
1453 CABPCR010000014.1 GCA902406175_00720 gene open 28638-30251
1454 CABPCR010000014.1 GCA902406175_00721 gene open 30255-31313
1455 CABPCR010000014.1 GCA902406175_00722 gene open 31590-35615 inlB
1456 CABPCR010000014.1 GCA902406175_00723 gene open 36119-38209
1457 CABPCR010000014.1 GCA902406175_00724 gene open 38382-39476
1458 CABPCR010000014.1 GCA902406175_00725 gene open 39715-40398
1459 CABPCR010000014.1 GCA902406175_00726 gene open 40498-41202
1460 CABPCR010000014.1 GCA902406175_00727 gene open 41445-43817
1461 CABPCR010000014.1 GCA902406175_00728 gene open 43854-44696
1462 CABPCR010000014.1 GCA902406175_00729 gene open 44709-45266
1463 CABPCR010000015.1 regulatory_region open 11717-11930 Cobalamin riboswitch aptamer
1464 CABPCR010000015.1 GCA902406175_00730 CDS open 241-951 _na     236_aa Cobalt-precorrin-2 C(20)-methyltransferase
1465 CABPCR010000015.1 GCA902406175_00731 CDS open 948-2783 _na     611_aa cobM precorrin-4 C(11)-methyltransferase
1466 CABPCR010000015.1 GCA902406175_00732 CDS open 2789-3982 _na     397_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
1467 CABPCR010000015.1 GCA902406175_00733 CDS open 3979-5382 _na     467_aa Precorrin-3B C17-methyltransferase
1468 CABPCR010000015.1 GCA902406175_00734 CDS open 5423-6577 _na     384_aa PepSY domain-containing protein
1469 CABPCR010000015.1 GCA902406175_00735 CDS open 6570-6890 _na     106_aa hypothetical protein
1470 CABPCR010000015.1 GCA902406175_00736 CDS open 7078-8379 _na     433_aa Lipoprotein
1471 CABPCR010000015.1 GCA902406175_00737 CDS open 8418-10577 _na     719_aa TonB-dependent receptor plug
1472 CABPCR010000015.1 GCA902406175_00738 CDS open 10582-11541 _na     319_aa sirohydrochlorin cobaltochelatase
1473 CABPCR010000015.1 GCA902406175_00739 CDS open 12080-13381 _na     433_aa cobyrinate a%2Cc-diamide synthase
1474 CABPCR010000015.1 GCA902406175_00740 CDS open 13392-15185 _na     597_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
1475 CABPCR010000015.1 GCA902406175_00741 CDS open 15182-15979 _na     265_aa Iron-chelate-transporting ATPase
1476 CABPCR010000015.1 GCA902406175_00742 CDS open 15984-17018 _na     344_aa ABC-type transporter%2C integral membrane subunit
1477 CABPCR010000015.1 GCA902406175_00743 CDS open 17033-18214 _na     393_aa ABC-type transporter%2C periplasmic subunit
1478 CABPCR010000015.1 GCA902406175_00744 CDS open 18427-20070 _na     547_aa Ig domain protein group 2 domain protein
1479 CABPCR010000015.1 GCA902406175_00745 CDS open 20483-22426 _na     647_aa NAD(+) synthase
1480 CABPCR010000015.1 GCA902406175_00746 CDS open 22438-23424 _na     328_aa Polyprenyl synthetase
1481 CABPCR010000015.1 GCA902406175_00747 CDS open 23437-24015 _na     192_aa Colicin V production protein
1482 CABPCR010000015.1 GCA902406175_00748 CDS open 24008-25516 _na     502_aa sufB Fe-S cluster assembly protein SufB
1483 CABPCR010000015.1 GCA902406175_00749 CDS open 25557-26333 _na     258_aa sufC Fe-S cluster assembly ATPase SufC
1484 CABPCR010000015.1 GCA902406175_00750 CDS open 26330-27718 _na     462_aa sufD Fe-S cluster assembly protein SufD
1485 CABPCR010000015.1 GCA902406175_00751 CDS open 27738-28649 _na     303_aa eamA EamA domain-containing protein
1486 CABPCR010000015.1 GCA902406175_00752 CDS open 28818-29726 _na     302_aa Ig domain protein group 2 domain protein
1487 CABPCR010000015.1 GCA902406175_00753 CDS open 30000-31313 _na     437_aa mcrC 5-methylcytosine restriction system specificity protein McrC
1488 CABPCR010000015.1 GCA902406175_00754 CDS open 31313-33001 _na     562_aa AAA family ATPase
1489 CABPCR010000015.1 GCA902406175_00755 CDS open 33015-33452 _na     145_aa hypothetical protein
1490 CABPCR010000015.1 GCA902406175_00756 CDS open 33471-33992 _na     173_aa Putative DNA polymerase III%2C epsilon subunit
1491 CABPCR010000015.1 GCA902406175_00757 CDS open 33992-34957 _na     321_aa WYL domain-containing protein
1492 CABPCR010000015.1 GCA902406175_00758 CDS open 35034-35858 _na     274_aa ion transporter
1493 CABPCR010000015.1 GCA902406175_00759 CDS open 35950-36183 _na     77_aa Photosynthesis system II assembly factor Ycf48/Hcf136-like domain-containing protein
1494 CABPCR010000015.1 GCA902406175_00760 CDS open 36615-37151 _na     178_aa hypothetical protein
1495 CABPCR010000015.1 GCA902406175_00761 CDS open 37745-40183 _na     812_aa TonB-dependent receptor plug domain protein
1496 CABPCR010000015.1 GCA902406175_00762 CDS open 40196-41224 _na     342_aa Lipoprotein
1497 CABPCR010000015.1 GCA902406175_00763 CDS open 41240-42310 _na     356_aa Agmatine deiminase
1498 CABPCR010000015.1 GCA902406175_00764 CDS open 42307-43182 _na     291_aa N-carbamoylputrescine amidase
1499 CABPCR010000015.1 GCA902406175_00765 CDS open 43301-43990 _na     229_aa TPR domain-containing protein
1500 CABPCR010000015.1 GCA902406175_00766 CDS open 44114-44620 _na     168_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase