HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_902460445.1)

Select a Genome:
BAKTA Annotations for GCA_902460445.1
Genome Selected: Campylobacter concisus clade-575
ContigsBases CDSrRNA tmRNAtRNA
13 2012410 1977 3 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4060 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4060 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 CABPUD010000010.1 GCA902460445_01992 gene open 39765-41738
4002 CABPUD010000010.1 GCA902460445_01993 gene open 41777-43324 traM
4003 CABPUD010000010.1 GCA902460445_01994 gene open 43326-43883
4004 CABPUD010000010.1 GCA902460445_01995 gene open 43993-45282
4005 CABPUD010000010.1 GCA902460445_01996 gene open 45554-46165
4006 CABPUD010000010.1 GCA902460445_01997 gene open 46176-47117
4007 CABPUD010000010.1 GCA902460445_01998 gene open 47246-47677
4008 CABPUD010000010.1 GCA902460445_01999 gene open 47876-48367
4009 CABPUD010000010.1 GCA902460445_02000 gene open 48395-48871
4010 CABPUD010000010.1 GCA902460445_02001 gene open 49098-49550
4011 CABPUD010000010.1 GCA902460445_02002 gene open 49655-51358 mcrB
4012 CABPUD010000010.1 GCA902460445_02003 gene open 51363-52619 mcrC
4013 CABPUD010000010.1 GCA902460445_02004 gene open 53226-54476
4014 CABPUD010000010.1 GCA902460445_02005 gene open 54487-54774
4015 CABPUD010000010.1 GCA902460445_02006 gene open 54775-55026
4016 CABPUD010000011.1 GCA902460445_02007 CDS open 568-1338 _na     256_aa oxidoreductase
4017 CABPUD010000011.1 GCA902460445_02008 CDS open 1325-2032 _na     235_aa CMP-legionaminic acid synthetase
4018 CABPUD010000011.1 GCA902460445_02009 CDS open 2025-2933 _na     302_aa ptmF Glucosamine-6-P synthase%2C isomerase subunit PtmF
4019 CABPUD010000011.1 GCA902460445_02010 CDS open 2938-4038 _na     366_aa N-acetyl sugar amidotransferase
4020 CABPUD010000011.1 GCA902460445_02011 CDS open 4056-5105 _na     349_aa D-glycero-D-manno-heptose 1-phosphate guanosyltransferase
4021 CABPUD010000011.1 GCA902460445_02012 CDS open 5109-6266 _na     385_aa neuC UDP-N-acetylglucosamine 2-epimerase
4022 CABPUD010000011.1 GCA902460445_02013 CDS open 6263-7297 _na     344_aa neuB N-acetylneuraminate synthase
4023 CABPUD010000011.1 GCA902460445_02014 CDS open 7254-8141 _na     295_aa Formyltransferase domain-containing protein
4024 CABPUD010000011.1 GCA902460445_02015 CDS open 8172-9323 _na     383_aa Aminotransferase%2C DegT/DnrJ/EryC1/StrS family
4025 CABPUD010000011.1 GCA902460445_02016 CDS open 9310-10500 _na     396_aa UDP-N-acetylglucosamine 4%2C6-dehydratase
4026 CABPUD010000011.1 GCA902460445_02017 CDS open 10502-11830 _na     442_aa Capsular biosynthesis protein
4027 CABPUD010000011.1 GCA902460445_02007 gene open 568-1338
4028 CABPUD010000011.1 GCA902460445_02008 gene open 1325-2032
4029 CABPUD010000011.1 GCA902460445_02009 gene open 2025-2933 ptmF
4030 CABPUD010000011.1 GCA902460445_02010 gene open 2938-4038
4031 CABPUD010000011.1 GCA902460445_02011 gene open 4056-5105
4032 CABPUD010000011.1 GCA902460445_02012 gene open 5109-6266 neuC
4033 CABPUD010000011.1 GCA902460445_02013 gene open 6263-7297 neuB
4034 CABPUD010000011.1 GCA902460445_02014 gene open 7254-8141
4035 CABPUD010000011.1 GCA902460445_02015 gene open 8172-9323
4036 CABPUD010000011.1 GCA902460445_02016 gene open 9310-10500
4037 CABPUD010000011.1 GCA902460445_02017 gene open 10502-11830
4038 CABPUD010000012.1 repeat_region open 5286-5556 CRISPR array with 4 repeats of length 38%2C consensus sequence GTTTCAATCCCCTTGATCGGGTCAAATTTGTTTAAATA and spacer length 36
4039 CABPUD010000012.1 GCA902460445_02018 CDS open 162-536 _na     124_aa csx20 CRISPR-associated protein Csx20
4040 CABPUD010000012.1 GCA902460445_02019 CDS open 623-1942 _na     439_aa CRISPR-associated DxTHG motif protein
4041 CABPUD010000012.1 GCA902460445_02020 CDS open 2018-2638 _na     206_aa DUF4433 domain-containing protein
4042 CABPUD010000012.1 GCA902460445_02021 CDS open 2647-3330 _na     227_aa Macro domain-containing protein
4043 CABPUD010000012.1 GCA902460445_02022 CDS open 3331-4290 _na     319_aa WYL domain-containing protein
4044 CABPUD010000012.1 GCA902460445_02018 gene open 162-536 csx20
4045 CABPUD010000012.1 GCA902460445_02019 gene open 623-1942
4046 CABPUD010000012.1 GCA902460445_02020 gene open 2018-2638
4047 CABPUD010000012.1 GCA902460445_02021 gene open 2647-3330
4048 CABPUD010000012.1 GCA902460445_02022 gene open 3331-4290
4049 CABPUD010000013.1 GCA902460445_02023 CDS open 213-578 _na     121_aa Lysozyme inhibitor
4050 CABPUD010000013.1 GCA902460445_02024 CDS open 629-1099 _na     156_aa hypothetical protein
4051 CABPUD010000013.1 GCA902460445_02025 CDS open 1104-1448 _na     114_aa Lytic transglycosylase
4052 CABPUD010000013.1 GCA902460445_02026 CDS open 1448-1636 _na     62_aa hypothetical protein
4053 CABPUD010000013.1 GCA902460445_02027 CDS open 1837-2637 _na     266_aa hypothetical protein
4054 CABPUD010000013.1 GCA902460445_02028 CDS open 2649-3539 _na     296_aa hypothetical protein
4055 CABPUD010000013.1 GCA902460445_02023 gene open 213-578
4056 CABPUD010000013.1 GCA902460445_02024 gene open 629-1099
4057 CABPUD010000013.1 GCA902460445_02025 gene open 1104-1448
4058 CABPUD010000013.1 GCA902460445_02026 gene open 1448-1636
4059 CABPUD010000013.1 GCA902460445_02027 gene open 1837-2637
4060 CABPUD010000013.1 GCA902460445_02028 gene open 2649-3539