BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_902460445.1)
Select a Genome:
|
BAKTA Annotations for GCA_902460445.1
|
Search & Sort all 4060 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CABPUD010000002.1 | GCA902460445_00439 | gene | open | 6921-7904 | galE | ||
| 1002 | CABPUD010000002.1 | GCA902460445_00440 | gene | open | 7913-9235 | |||
| 1003 | CABPUD010000002.1 | GCA902460445_00441 | gene | open | 9232-9672 | |||
| 1004 | CABPUD010000002.1 | GCA902460445_00442 | gene | open | 9669-10901 | |||
| 1005 | CABPUD010000002.1 | GCA902460445_00443 | gene | open | 10910-13036 | |||
| 1006 | CABPUD010000002.1 | GCA902460445_00444 | gene | open | 13036-14553 | |||
| 1007 | CABPUD010000002.1 | GCA902460445_00445 | gene | open | 14554-15315 | |||
| 1008 | CABPUD010000002.1 | GCA902460445_00446 | gene | open | 15316-16248 | |||
| 1009 | CABPUD010000002.1 | GCA902460445_00447 | gene | open | 16245-17303 | |||
| 1010 | CABPUD010000002.1 | GCA902460445_00448 | gene | open | 17300-18343 | |||
| 1011 | CABPUD010000002.1 | GCA902460445_00449 | gene | open | 18340-19464 | |||
| 1012 | CABPUD010000002.1 | GCA902460445_00450 | gene | open | 19457-21556 | |||
| 1013 | CABPUD010000002.1 | GCA902460445_00451 | gene | open | 21559-22674 | pglA | ||
| 1014 | CABPUD010000002.1 | GCA902460445_00452 | gene | open | 22667-23272 | pglC | ||
| 1015 | CABPUD010000002.1 | GCA902460445_00453 | gene | open | 23259-23849 | pglD | ||
| 1016 | CABPUD010000002.1 | GCA902460445_00454 | gene | open | 23898-24989 | pglE | ||
| 1017 | CABPUD010000002.1 | GCA902460445_00455 | gene | open | 24990-26771 | pglF | ||
| 1018 | CABPUD010000002.1 | GCA902460445_00456 | gene | open | 26774-27670 | pglG | ||
| 1019 | CABPUD010000002.1 | GCA902460445_00457 | gene | open | 27667-28278 | hisH | ||
| 1020 | CABPUD010000002.1 | GCA902460445_00458 | gene | open | 28278-28988 | hisA | ||
| 1021 | CABPUD010000002.1 | GCA902460445_00459 | gene | open | 29052-29417 | cheY | ||
| 1022 | CABPUD010000002.1 | GCA902460445_00460 | gene | open | 29417-30250 | prmA | ||
| 1023 | CABPUD010000002.1 | GCA902460445_00461 | gene | open | 30243-32168 | ftsH | ||
| 1024 | CABPUD010000002.1 | GCA902460445_00462 | gene | open | 32171-32797 | |||
| 1025 | CABPUD010000002.1 | GCA902460445_00463 | gene | open | 32790-33521 | pssA | ||
| 1026 | CABPUD010000002.1 | GCA902460445_00464 | gene | open | 33667-35181 | leuA | ||
| 1027 | CABPUD010000002.1 | GCA902460445_00465 | gene | open | 35398-36048 | |||
| 1028 | CABPUD010000002.1 | GCA902460445_00466 | gene | open | 36038-36814 | surE | ||
| 1029 | CABPUD010000002.1 | GCA902460445_00467 | gene | open | 36917-37951 | lpxB | ||
| 1030 | CABPUD010000002.1 | GCA902460445_00468 | gene | open | 37955-38440 | greA | ||
| 1031 | CABPUD010000002.1 | GCA902460445_00469 | gene | open | 38504-39295 | |||
| 1032 | CABPUD010000002.1 | GCA902460445_00470 | gene | open | 39295-40248 | |||
| 1033 | CABPUD010000002.1 | GCA902460445_00471 | gene | open | 40257-42611 | |||
| 1034 | CABPUD010000002.1 | GCA902460445_00472 | gene | open | 42621-43118 | cheW | ||
| 1035 | CABPUD010000002.1 | GCA902460445_00473 | gene | open | 43127-43753 | serB | ||
| 1036 | CABPUD010000002.1 | GCA902460445_00474 | gene | open | 43757-44749 | |||
| 1037 | CABPUD010000002.1 | GCA902460445_00475 | gene | open | 44869-45405 | |||
| 1038 | CABPUD010000002.1 | GCA902460445_00476 | gene | open | 45417-45965 | pth | ||
| 1039 | CABPUD010000002.1 | GCA902460445_00477 | gene | open | 45962-47026 | |||
| 1040 | CABPUD010000002.1 | GCA902460445_00478 | gene | open | 47082-48305 | lysA | ||
| 1041 | CABPUD010000002.1 | GCA902460445_00479 | gene | open | 48289-49368 | pheA | ||
| 1042 | CABPUD010000002.1 | GCA902460445_00480 | gene | open | 49368-50465 | hisC | ||
| 1043 | CABPUD010000002.1 | GCA902460445_00481 | gene | open | 50470-52167 | fliF | ||
| 1044 | CABPUD010000002.1 | GCA902460445_00482 | gene | open | 52167-53198 | fliG | ||
| 1045 | CABPUD010000002.1 | GCA902460445_00483 | gene | open | 53195-54058 | fliH | ||
| 1046 | CABPUD010000002.1 | GCA902460445_00484 | gene | open | 54051-55877 | dxs | ||
| 1047 | CABPUD010000002.1 | GCA902460445_00485 | gene | open | 55950-56360 | perR | ||
| 1048 | CABPUD010000002.1 | GCA902460445_00486 | gene | open | 56501-57907 | |||
| 1049 | CABPUD010000002.1 | GCA902460445_00487 | gene | open | 57921-58643 | ubiE | ||
| 1050 | CABPUD010000002.1 | GCA902460445_00488 | gene | open | 58636-59802 | xseA | ||
| 1051 | CABPUD010000002.1 | GCA902460445_00489 | gene | open | 59805-60884 | serC | ||
| 1052 | CABPUD010000002.1 | GCA902460445_00490 | gene | open | 60884-62344 | |||
| 1053 | CABPUD010000002.1 | GCA902460445_00491 | gene | open | 62389-63129 | |||
| 1054 | CABPUD010000002.1 | GCA902460445_00492 | gene | open | 63282-64553 | |||
| 1055 | CABPUD010000002.1 | GCA902460445_00493 | gene | open | 64550-67420 | |||
| 1056 | CABPUD010000002.1 | GCA902460445_00494 | gene | open | 67410-68165 | |||
| 1057 | CABPUD010000002.1 | GCA902460445_00495 | gene | open | 68162-69979 | uvrC | ||
| 1058 | CABPUD010000002.1 | GCA902460445_00496 | gene | open | 69973-70488 | |||
| 1059 | CABPUD010000002.1 | GCA902460445_00497 | gene | open | 70736-72124 | nhaD | ||
| 1060 | CABPUD010000002.1 | GCA902460445_00498 | gene | open | 72135-73667 | guaA | ||
| 1061 | CABPUD010000002.1 | GCA902460445_00499 | gene | open | 74058-74462 | ybgA | ||
| 1062 | CABPUD010000002.1 | GCA902460445_00500 | gene | open | 74446-74814 | |||
| 1063 | CABPUD010000002.1 | GCA902460445_00501 | gene | open | 75372-76016 | |||
| 1064 | CABPUD010000002.1 | GCA902460445_00502 | gene | open | 76127-77287 | |||
| 1065 | CABPUD010000002.1 | GCA902460445_00503 | gene | open | 77280-77918 | |||
| 1066 | CABPUD010000002.1 | GCA902460445_00504 | gene | open | 78152-79396 | |||
| 1067 | CABPUD010000002.1 | GCA902460445_00505 | gene | open | 79393-79842 | |||
| 1068 | CABPUD010000002.1 | GCA902460445_00506 | gene | open | 79835-81994 | lptD | ||
| 1069 | CABPUD010000002.1 | GCA902460445_00507 | gene | open | 81995-82693 | |||
| 1070 | CABPUD010000002.1 | GCA902460445_00508 | gene | open | 82683-84881 | pnp | ||
| 1071 | CABPUD010000002.1 | GCA902460445_00509 | gene | open | 84899-85750 | uspA | ||
| 1072 | CABPUD010000002.1 | GCA902460445_00510 | gene | open | 86390-90007 | dnaE | ||
| 1073 | CABPUD010000002.1 | GCA902460445_00511 | gene | open | 90022-90696 | |||
| 1074 | CABPUD010000002.1 | GCA902460445_00512 | gene | open | 90693-91355 | |||
| 1075 | CABPUD010000002.1 | GCA902460445_00513 | gene | open | 91358-92341 | |||
| 1076 | CABPUD010000002.1 | GCA902460445_00514 | gene | open | 92338-93174 | |||
| 1077 | CABPUD010000002.1 | GCA902460445_00515 | gene | open | 93285-94616 | |||
| 1078 | CABPUD010000002.1 | GCA902460445_00516 | gene | open | 94613-95359 | |||
| 1079 | CABPUD010000002.1 | GCA902460445_00517 | gene | open | 95352-95957 | |||
| 1080 | CABPUD010000002.1 | GCA902460445_00518 | gene | open | 96028-97305 | |||
| 1081 | CABPUD010000002.1 | GCA902460445_00519 | gene | open | 97343-98449 | |||
| 1082 | CABPUD010000002.1 | GCA902460445_00520 | gene | open | 98502-99473 | |||
| 1083 | CABPUD010000002.1 | GCA902460445_00521 | gene | open | 99430-100080 | |||
| 1084 | CABPUD010000002.1 | GCA902460445_00522 | gene | open | 100025-100612 | |||
| 1085 | CABPUD010000002.1 | GCA902460445_00523 | gene | open | 100612-101799 | trmB | ||
| 1086 | CABPUD010000002.1 | GCA902460445_00524 | gene | open | 101783-102454 | ftsE | ||
| 1087 | CABPUD010000002.1 | GCA902460445_00525 | gene | open | 102441-103256 | ftsX | ||
| 1088 | CABPUD010000002.1 | GCA902460445_00526 | gene | open | 103253-104473 | |||
| 1089 | CABPUD010000002.1 | GCA902460445_00527 | gene | open | 104547-105263 | pyrH | ||
| 1090 | CABPUD010000002.1 | GCA902460445_00528 | gene | open | 105282-105497 | rpoZ | ||
| 1091 | CABPUD010000002.1 | GCA902460445_00529 | gene | open | 105484-107673 | |||
| 1092 | CABPUD010000002.1 | GCA902460445_00530 | gene | open | 107684-108889 | tyrS | ||
| 1093 | CABPUD010000002.1 | GCA902460445_00531 | gene | open | 108890-109981 | |||
| 1094 | CABPUD010000002.1 | GCA902460445_00532 | gene | open | 109978-111417 | |||
| 1095 | CABPUD010000002.1 | GCA902460445_00533 | gene | open | 111414-113294 | mnmC | ||
| 1096 | CABPUD010000002.1 | GCA902460445_00534 | gene | open | 113342-114829 | putP | ||
| 1097 | CABPUD010000002.1 | GCA902460445_00535 | gene | open | 114980-115690 | |||
| 1098 | CABPUD010000002.1 | GCA902460445_00536 | gene | open | 115683-116411 | |||
| 1099 | CABPUD010000002.1 | GCA902460445_00537 | gene | open | 116425-117195 | |||
| 1100 | CABPUD010000002.1 | GCA902460445_00538 | gene | open | 117907-119859 | |||
| 1101 | CABPUD010000002.1 | GCA902460445_00539 | gene | open | 120055-120771 | |||
| 1102 | CABPUD010000002.1 | GCA902460445_00540 | gene | open | 120847-123585 | pqqL | ||
| 1103 | CABPUD010000002.1 | GCA902460445_00541 | gene | open | 123753-124640 | |||
| 1104 | CABPUD010000002.1 | GCA902460445_00542 | gene | open | 124692-124898 | |||
| 1105 | CABPUD010000002.1 | GCA902460445_00543 | gene | open | 124946-125239 | |||
| 1106 | CABPUD010000002.1 | GCA902460445_00544 | gene | open | 125400-127853 | |||
| 1107 | CABPUD010000002.1 | GCA902460445_00545 | gene | open | 127905-129737 | |||
| 1108 | CABPUD010000002.1 | GCA902460445_00546 | gene | open | 129730-131817 | |||
| 1109 | CABPUD010000002.1 | GCA902460445_00547 | gene | open | 131913-132920 | tsaD | ||
| 1110 | CABPUD010000002.1 | GCA902460445_00548 | gene | open | 132917-134209 | |||
| 1111 | CABPUD010000002.1 | GCA902460445_00549 | gene | open | 134209-135444 | |||
| 1112 | CABPUD010000002.1 | GCA902460445_00550 | gene | open | 135431-136528 | dxr | ||
| 1113 | CABPUD010000002.1 | GCA902460445_00551 | gene | open | 136522-137253 | |||
| 1114 | CABPUD010000002.1 | GCA902460445_00552 | gene | open | 137486-138385 | |||
| 1115 | CABPUD010000002.1 | GCA902460445_00553 | gene | open | 138748-139467 | |||
| 1116 | CABPUD010000002.1 | GCA902460445_00554 | gene | open | 139460-141478 | |||
| 1117 | CABPUD010000002.1 | GCA902460445_00555 | gene | open | 141493-142191 | |||
| 1118 | CABPUD010000002.1 | GCA902460445_00556 | gene | open | 142311-143126 | lgt | ||
| 1119 | CABPUD010000002.1 | GCA902460445_00557 | gene | open | 143167-143808 | |||
| 1120 | CABPUD010000002.1 | GCA902460445_00558 | gene | open | 143935-144756 | galU | ||
| 1121 | CABPUD010000002.1 | GCA902460445_00559 | gene | open | 144753-145973 | |||
| 1122 | CABPUD010000002.1 | GCA902460445_00560 | gene | open | 145977-146522 | |||
| 1123 | CABPUD010000002.1 | GCA902460445_00561 | gene | open | 146585-148174 | abc-f | ||
| 1124 | CABPUD010000003.1 | rep_origin | open | 451055-451182 | ||||
| 1125 | CABPUD010000003.1 | GCA902460445_00640 | gene | open | 78911-80421 | rrs | ||
| 1126 | CABPUD010000003.1 | GCA902460445_00643 | gene | open | 81008-83911 | rrl | ||
| 1127 | CABPUD010000003.1 | GCA902460445_00644 | gene | open | 84044-84162 | rrf | ||
| 1128 | CABPUD010000003.1 | GCA902460445_01004 | gene | open | 443854-443951 | Bacteria_small_SRP | ||
| 1129 | CABPUD010000003.1 | GCA902460445_01004 | ncRNA | open | 443854-443951 | Bacterial small signal recognition particle RNA | ||
| 1130 | CABPUD010000003.1 | GCA902460445_00640 | rRNA | open | 78911-80421 | rrs | 16S ribosomal RNA | |
| 1131 | CABPUD010000003.1 | GCA902460445_00643 | rRNA | open | 81008-83911 | rrl | 23S ribosomal RNA | |
| 1132 | CABPUD010000003.1 | GCA902460445_00644 | rRNA | open | 84044-84162 | rrf | 5S ribosomal RNA | |
| 1133 | CABPUD010000003.1 | repeat_region | open | 268883-269556 | CRISPR array with 9 repeats of length 37%2C consensus sequence ATTTAAACAAATTTGACCCGATCAAGGGGATTGAAAC and spacer length 37 | |||
| 1134 | CABPUD010000003.1 | GCA902460445_00562 | CDS | open | 249-980 | _na 243_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 1135 | CABPUD010000003.1 | GCA902460445_00563 | CDS | open | 980-2008 | _na 342_aa | Lipooligosaccharide transport system%2C permease component (LptF family) | |
| 1136 | CABPUD010000003.1 | GCA902460445_00564 | CDS | open | 2001-2810 | _na 269_aa | Leader peptidase (Prepilin peptidase) / N-methyltransferase | |
| 1137 | CABPUD010000003.1 | GCA902460445_00565 | CDS | open | 2797-3468 | _na 223_aa | uppS | polyprenyl diphosphate synthase |
| 1138 | CABPUD010000003.1 | GCA902460445_00566 | CDS | open | 3472-4158 | _na 228_aa | hypothetical protein | |
| 1139 | CABPUD010000003.1 | GCA902460445_00567 | CDS | open | 4155-5339 | _na 394_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 1140 | CABPUD010000003.1 | GCA902460445_00568 | CDS | open | 5314-6621 | _na 435_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 1141 | CABPUD010000003.1 | GCA902460445_00569 | CDS | open | 6758-7525 | _na 255_aa | Flagellar motor protein | |
| 1142 | CABPUD010000003.1 | GCA902460445_00570 | CDS | open | 7525-8304 | _na 259_aa | Flagellar motor protein | |
| 1143 | CABPUD010000003.1 | GCA902460445_00571 | CDS | open | 8307-9038 | _na 243_aa | fliP | flagellar type III secretion system pore protein FliP |
| 1144 | CABPUD010000003.1 | GCA902460445_00572 | CDS | open | 9038-10303 | _na 421_aa | L-seryl-tRNA(Sec) selenium transferase | |
| 1145 | CABPUD010000003.1 | GCA902460445_00573 | CDS | open | 10300-11043 | _na 247_aa | Efflux transporter periplasmic adaptor subunit | |
| 1146 | CABPUD010000003.1 | GCA902460445_00574 | CDS | open | 11040-14066 | _na 1008_aa | RND family efflux transporter%2C membrane subunit | |
| 1147 | CABPUD010000003.1 | GCA902460445_00575 | CDS | open | 14063-15298 | _na 411_aa | tolC | TolC family protein |
| 1148 | CABPUD010000003.1 | GCA902460445_00576 | CDS | open | 15291-16154 | _na 287_aa | eamA | EamA domain-containing protein |
| 1149 | CABPUD010000003.1 | GCA902460445_00577 | CDS | open | 16151-17425 | _na 424_aa | Competence protein%2C ComEC family | |
| 1150 | CABPUD010000003.1 | GCA902460445_00578 | CDS | open | 17425-18837 | _na 470_aa | replicative DNA helicase | |
| 1151 | CABPUD010000003.1 | GCA902460445_00579 | CDS | open | 18849-19907 | _na 352_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 1152 | CABPUD010000003.1 | GCA902460445_00580 | CDS | open | 20148-22001 | _na 617_aa | primosomal protein N' | |
| 1153 | CABPUD010000003.1 | GCA902460445_00581 | CDS | open | 22001-22417 | _na 138_aa | Prepilin-type cleavage/methylation domain-containing protein | |
| 1154 | CABPUD010000003.1 | GCA902460445_00582 | CDS | open | 22414-22650 | _na 78_aa | Barstar (barnase inhibitor) domain-containing protein | |
| 1155 | CABPUD010000003.1 | GCA902460445_00583 | CDS | open | 22664-22897 | _na 77_aa | ABC transporter | |
| 1156 | CABPUD010000003.1 | GCA902460445_00584 | CDS | open | 23023-24999 | _na 658_aa | uvrB | excinuclease ABC subunit UvrB |
| 1157 | CABPUD010000003.1 | GCA902460445_00585 | CDS | open | 25177-26514 | _na 445_aa | hypothetical protein | |
| 1158 | CABPUD010000003.1 | GCA902460445_00586 | CDS | open | 26642-26893 | _na 83_aa | hypothetical protein | |
| 1159 | CABPUD010000003.1 | GCA902460445_00587 | CDS | open | 26997-27800 | _na 267_aa | MFS transporter | |
| 1160 | CABPUD010000003.1 | GCA902460445_00588 | CDS | open | 27801-30341 | _na 846_aa | Tryptophanyl-tRNA synthetase | |
| 1161 | CABPUD010000003.1 | GCA902460445_00589 | CDS | open | 30510-30770 | _na 86_aa | groES | co-chaperone GroES |
| 1162 | CABPUD010000003.1 | GCA902460445_00590 | CDS | open | 30788-32422 | _na 544_aa | groL | chaperonin GroEL |
| 1163 | CABPUD010000003.1 | GCA902460445_00591 | CDS | open | 32556-33923 | _na 455_aa | Phosphomannomutase/phosphoglucomutase | |
| 1164 | CABPUD010000003.1 | GCA902460445_00592 | CDS | open | 34308-35168 | _na 286_aa | Amino acid ABC transporter%2C periplasmic cysteine-binding protein | |
| 1165 | CABPUD010000003.1 | GCA902460445_00593 | CDS | open | 35262-35999 | _na 245_aa | ABC transporter domain-containing protein | |
| 1166 | CABPUD010000003.1 | GCA902460445_00594 | CDS | open | 36001-36669 | _na 222_aa | ABC transmembrane type-1 domain-containing protein | |
| 1167 | CABPUD010000003.1 | GCA902460445_00595 | CDS | open | 36656-37309 | _na 217_aa | Pathogenesis-associated glutamine ABC transporter%2C permease protein | |
| 1168 | CABPUD010000003.1 | GCA902460445_00596 | CDS | open | 37420-37665 | _na 81_aa | Permease | |
| 1169 | CABPUD010000003.1 | GCA902460445_00597 | CDS | open | 37662-38630 | _na 322_aa | Agmatine deiminase | |
| 1170 | CABPUD010000003.1 | GCA902460445_00598 | CDS | open | 38633-39559 | _na 308_aa | Cation diffusion facilitator family transporter | |
| 1171 | CABPUD010000003.1 | GCA902460445_00599 | CDS | open | 39561-40433 | _na 290_aa | Apolipoprotein acyltransferase | |
| 1172 | CABPUD010000003.1 | GCA902460445_00600 | CDS | open | 40460-41125 | _na 221_aa | pstB | Phosphate ABC transporter%2C ATP-binding protein PstB |
| 1173 | CABPUD010000003.1 | GCA902460445_00601 | CDS | open | 41094-41951 | _na 285_aa | pstA | Phosphate ABC transporter%2C permease protein PstA |
| 1174 | CABPUD010000003.1 | GCA902460445_00602 | CDS | open | 41938-42795 | _na 285_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 1175 | CABPUD010000003.1 | GCA902460445_00603 | CDS | open | 42799-43671 | _na 290_aa | pstS | Phosphate ABC transporter%2C periplasmic substrate-binding protein PstS |
| 1176 | CABPUD010000003.1 | GCA902460445_00604 | CDS | open | 43987-44928 | _na 313_aa | TRAP transporter solute receptor%2C TAXI family | |
| 1177 | CABPUD010000003.1 | GCA902460445_00605 | CDS | open | 45015-47081 | _na 688_aa | TRAP transporter%2C 4TM/12TM fusion protein | |
| 1178 | CABPUD010000003.1 | GCA902460445_00606 | CDS | open | 47221-47706 | _na 161_aa | beta-lactamase | |
| 1179 | CABPUD010000003.1 | GCA902460445_00607 | CDS | open | 47779-48441 | _na 220_aa | M48 family metallopeptidase | |
| 1180 | CABPUD010000003.1 | GCA902460445_00608 | CDS | open | 48417-49736 | _na 439_aa | matE | MatE efflux family protein |
| 1181 | CABPUD010000003.1 | GCA902460445_00609 | CDS | open | 49840-51771 | _na 643_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1182 | CABPUD010000003.1 | GCA902460445_00610 | CDS | open | 52284-53795 | _na 503_aa | Fusobacterium membrane protein | |
| 1183 | CABPUD010000003.1 | GCA902460445_00611 | CDS | open | 53795-55240 | _na 481_aa | Fusobacterium membrane protein | |
| 1184 | CABPUD010000003.1 | GCA902460445_00612 | CDS | open | 55366-57306 | _na 646_aa | BCCT (Betaine/carnitine/choline) family transporter | |
| 1185 | CABPUD010000003.1 | GCA902460445_00613 | CDS | open | 57667-58500 | _na 277_aa | modD | Putative pyrophosphorylase ModD |
| 1186 | CABPUD010000003.1 | GCA902460445_00614 | CDS | open | 58502-58762 | _na 86_aa | Helicase | |
| 1187 | CABPUD010000003.1 | GCA902460445_00615 | CDS | open | 58775-60235 | _na 486_aa | Na+/alanine symporter family protein | |
| 1188 | CABPUD010000003.1 | GCA902460445_00616 | CDS | open | 60253-62343 | _na 696_aa | Lead%2C cadmium%2C zinc and mercury transporting ATPase | |
| 1189 | CABPUD010000003.1 | GCA902460445_00617 | CDS | open | 62312-62635 | _na 107_aa | Oxidoreductase | |
| 1190 | CABPUD010000003.1 | GCA902460445_00618 | CDS | open | 62635-62949 | _na 104_aa | Cys/Met metabolism pyridoxal-phosphate-dependent enzyme | |
| 1191 | CABPUD010000003.1 | GCA902460445_00619 | CDS | open | 62959-63309 | _na 116_aa | Periplasmic protein | |
| 1192 | CABPUD010000003.1 | GCA902460445_00620 | CDS | open | 63302-63952 | _na 216_aa | Aminotransferase | |
| 1193 | CABPUD010000003.1 | GCA902460445_00621 | CDS | open | 63945-64268 | _na 107_aa | HMA domain-containing protein | |
| 1194 | CABPUD010000003.1 | GCA902460445_00622 | CDS | open | 64371-64817 | _na 148_aa | Transcriptional regulator%2C Fur family | |
| 1195 | CABPUD010000003.1 | GCA902460445_00623 | CDS | open | 64968-65177 | _na 69_aa | hypothetical protein | |
| 1196 | CABPUD010000003.1 | GCA902460445_00624 | CDS | open | 65269-65931 | _na 220_aa | Ysc84 actin-binding domain-containing protein | |
| 1197 | CABPUD010000003.1 | GCA902460445_00625 | CDS | open | 66049-66657 | _na 202_aa | Glycine transporter domain-containing protein | |
| 1198 | CABPUD010000003.1 | GCA902460445_00626 | CDS | open | 66654-67640 | _na 328_aa | SAM-dependent methyltransferase | |
| 1199 | CABPUD010000003.1 | GCA902460445_00627 | CDS | open | 67629-68111 | _na 160_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 1200 | CABPUD010000003.1 | GCA902460445_00628 | CDS | open | 68170-68706 | _na 178_aa | fliL | flagellar basal body-associated protein FliL |
| 1201 | CABPUD010000003.1 | GCA902460445_00629 | CDS | open | 68703-69047 | _na 114_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 1202 | CABPUD010000003.1 | GCA902460445_00630 | CDS | open | 70273-70653 | _na 126_aa | hypothetical protein | |
| 1203 | CABPUD010000003.1 | GCA902460445_00631 | CDS | open | 70799-72139 | _na 446_aa | radA | DNA repair protein RadA |
| 1204 | CABPUD010000003.1 | GCA902460445_00632 | CDS | open | 72114-72476 | _na 120_aa | VanZ-like domain-containing protein | |
| 1205 | CABPUD010000003.1 | GCA902460445_00633 | CDS | open | 72469-73335 | _na 288_aa | ftsY | signal recognition particle-docking protein FtsY |
| 1206 | CABPUD010000003.1 | GCA902460445_00634 | CDS | open | 73335-73967 | _na 210_aa | tlpA | Protein disulfide reductase%2C TlpA family |
| 1207 | CABPUD010000003.1 | GCA902460445_00635 | CDS | open | 74017-74661 | _na 214_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 1208 | CABPUD010000003.1 | GCA902460445_00636 | CDS | open | 74615-76135 | _na 506_aa | rny | ribonuclease Y |
| 1209 | CABPUD010000003.1 | GCA902460445_00637 | CDS | open | 76145-76741 | _na 198_aa | Ysc84 actin-binding domain-containing protein | |
| 1210 | CABPUD010000003.1 | GCA902460445_00638 | CDS | open | 76741-77307 | _na 188_aa | VTT domain-containing protein | |
| 1211 | CABPUD010000003.1 | GCA902460445_00639 | CDS | open | 77304-78644 | _na 446_aa | DUF945 domain-containing protein | |
| 1212 | CABPUD010000003.1 | GCA902460445_00645 | CDS | open | 84379-84825 | _na 148_aa | Competence protein ComEA helix-hairpin-helix region | |
| 1213 | CABPUD010000003.1 | GCA902460445_00646 | CDS | open | 85239-85583 | _na 114_aa | ftsZ | Cell division protein FtsZ |
| 1214 | CABPUD010000003.1 | GCA902460445_00647 | CDS | open | 85586-86908 | _na 440_aa | NFACT RNA-binding domain-containing protein | |
| 1215 | CABPUD010000003.1 | GCA902460445_00648 | CDS | open | 87141-89258 | _na 705_aa | TonB-dependent siderophore receptor | |
| 1216 | CABPUD010000003.1 | GCA902460445_00649 | CDS | open | 89341-90606 | _na 421_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 1217 | CABPUD010000003.1 | GCA902460445_00650 | CDS | open | 91073-91330 | _na 85_aa | Integral membrane protein | |
| 1218 | CABPUD010000003.1 | GCA902460445_00651 | CDS | open | 91457-91945 | _na 162_aa | DUF4375 domain-containing protein | |
| 1219 | CABPUD010000003.1 | GCA902460445_00652 | CDS | open | 92051-92626 | _na 191_aa | Molybdenum cofactor guanylyltransferase protein A | |
| 1220 | CABPUD010000003.1 | GCA902460445_00653 | CDS | open | 92616-93584 | _na 322_aa | Phosphatidylcholine 1-acylhydrolase | |
| 1221 | CABPUD010000003.1 | GCA902460445_00654 | CDS | open | 93751-95145 | _na 464_aa | Gluconate:H+ symporter (GntP) family transporter | |
| 1222 | CABPUD010000003.1 | GCA902460445_00655 | CDS | open | 95142-96275 | _na 377_aa | Glycerate kinase | |
| 1223 | CABPUD010000003.1 | GCA902460445_00656 | CDS | open | 96592-97656 | _na 354_aa | xerH | Tyrosine recombinase XerH |
| 1224 | CABPUD010000003.1 | GCA902460445_00657 | CDS | open | 97733-98593 | _na 286_aa | Putative periplasmic protein (AMIN domain) | |
| 1225 | CABPUD010000003.1 | GCA902460445_00658 | CDS | open | 98599-98889 | _na 96_aa | Septum formation initiator | |
| 1226 | CABPUD010000003.1 | GCA902460445_00659 | CDS | open | 98886-100136 | _na 416_aa | eno | phosphopyruvate hydratase |
| 1227 | CABPUD010000003.1 | GCA902460445_00660 | CDS | open | 100136-101233 | _na 365_aa | recA | recombinase RecA |
| 1228 | CABPUD010000003.1 | GCA902460445_00661 | CDS | open | 101296-101784 | _na 162_aa | Addiction module antitoxin | |
| 1229 | CABPUD010000003.1 | GCA902460445_00662 | CDS | open | 101793-102590 | _na 265_aa | UDP-N-acetylmuramate dehydrogenase | |
| 1230 | CABPUD010000003.1 | GCA902460445_00663 | CDS | open | 102587-102853 | _na 88_aa | fliQ | flagellar biosynthesis protein FliQ |
| 1231 | CABPUD010000003.1 | GCA902460445_00664 | CDS | open | 102853-103725 | _na 290_aa | 1%2C4-dihydroxy-6-naphtoate synthase | |
| 1232 | CABPUD010000003.1 | GCA902460445_00665 | CDS | open | 103781-104278 | _na 165_aa | Chemotaxis protein | |
| 1233 | CABPUD010000003.1 | GCA902460445_00666 | CDS | open | 104287-105375 | _na 362_aa | nicotinate phosphoribosyltransferase | |
| 1234 | CABPUD010000003.1 | GCA902460445_00667 | CDS | open | 105501-106199 | _na 232_aa | modA | molybdate ABC transporter substrate-binding protein |
| 1235 | CABPUD010000003.1 | GCA902460445_00668 | CDS | open | 106208-106867 | _na 219_aa | ABC transporter%2C permease protein | |
| 1236 | CABPUD010000003.1 | GCA902460445_00670 | CDS | open | 107080-107625 | _na 181_aa | BON domain-containing protein | |
| 1237 | CABPUD010000003.1 | GCA902460445_00671 | CDS | open | 107633-110077 | _na 814_aa | SSD domain-containing protein | |
| 1238 | CABPUD010000003.1 | GCA902460445_00672 | CDS | open | 110077-110679 | _na 200_aa | Toluene tolerance protein | |
| 1239 | CABPUD010000003.1 | GCA902460445_00673 | CDS | open | 110682-111392 | _na 236_aa | ABC transporter | |
| 1240 | CABPUD010000003.1 | GCA902460445_00674 | CDS | open | 111558-111791 | _na 77_aa | hypothetical protein | |
| 1241 | CABPUD010000003.1 | GCA902460445_00675 | CDS | open | 111854-112339 | _na 161_aa | TOBE domain-containing protein | |
| 1242 | CABPUD010000003.1 | GCA902460445_00676 | CDS | open | 112340-113095 | _na 251_aa | modA | molybdate ABC transporter substrate-binding protein |
| 1243 | CABPUD010000003.1 | GCA902460445_00677 | CDS | open | 113092-113487 | _na 131_aa | Putative molybdopterin binding protein | |
| 1244 | CABPUD010000003.1 | GCA902460445_00678 | CDS | open | 113484-114341 | _na 285_aa | Molybdenum ABC transporter ModABC%2C ATP-binding protein | |
| 1245 | CABPUD010000003.1 | GCA902460445_00679 | CDS | open | 114338-115015 | _na 225_aa | modB | molybdate ABC transporter permease subunit |
| 1246 | CABPUD010000003.1 | GCA902460445_00680 | CDS | open | 115063-115560 | _na 165_aa | Alkyl hydroperoxide reductase subunit C-like protein | |
| 1247 | CABPUD010000003.1 | GCA902460445_00681 | CDS | open | 115569-117125 | _na 518_aa | SAM-dependent methyltransferase | |
| 1248 | CABPUD010000003.1 | GCA902460445_00682 | CDS | open | 117129-117935 | _na 268_aa | Adenosine-3'(2')%2C5'-bisphosphate nucleotidase | |
| 1249 | CABPUD010000003.1 | GCA902460445_00683 | CDS | open | 117932-119209 | _na 425_aa | citrate synthase | |
| 1250 | CABPUD010000003.1 | GCA902460445_00684 | CDS | open | 119212-120375 | _na 387_aa | Cation/H+ exchanger transmembrane domain-containing protein | |
| 1251 | CABPUD010000003.1 | GCA902460445_00685 | CDS | open | 120493-120975 | _na 160_aa | DUF4252 domain-containing protein | |
| 1252 | CABPUD010000003.1 | GCA902460445_00686 | CDS | open | 121646-121999 | _na 117_aa | crcB | fluoride efflux transporter CrcB |
| 1253 | CABPUD010000003.1 | GCA902460445_00687 | CDS | open | 121999-122838 | _na 279_aa | bioB | biotin synthase |
| 1254 | CABPUD010000003.1 | GCA902460445_00688 | CDS | open | 123746-125860 | _na 704_aa | topA | type I DNA topoisomerase |
| 1255 | CABPUD010000003.1 | GCA902460445_00689 | CDS | open | 126052-127557 | _na 501_aa | Flagellin | |
| 1256 | CABPUD010000003.1 | GCA902460445_00690 | CDS | open | 127873-129894 | _na 673_aa | Motility accessory factor | |
| 1257 | CABPUD010000003.1 | GCA902460445_00691 | CDS | open | 129891-130922 | _na 343_aa | pseI | pseudaminic acid synthase |
| 1258 | CABPUD010000003.1 | GCA902460445_00692 | CDS | open | 130926-131384 | _na 152_aa | pseH | UDP-4-amino-4%2C6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase |
| 1259 | CABPUD010000003.1 | GCA902460445_00693 | CDS | open | 131369-132241 | _na 290_aa | pseG | UDP-2%2C4-diacetamido-2%2C4%2C6-trideoxy-beta-L-altropyranose hydrolase |
| 1260 | CABPUD010000003.1 | GCA902460445_00694 | CDS | open | 132242-132922 | _na 226_aa | pseF | pseudaminic acid cytidylyltransferase |
| 1261 | CABPUD010000003.1 | GCA902460445_00695 | CDS | open | 132925-134037 | _na 370_aa | pseC | UDP-4-amino-4%2C6-dideoxy-N-acetyl-beta-L-altrosamine transaminase |
| 1262 | CABPUD010000003.1 | GCA902460445_00696 | CDS | open | 134034-135029 | _na 331_aa | pseB | UDP-N-acetylglucosamine 4%2C6-dehydratase (inverting) |
| 1263 | CABPUD010000003.1 | GCA902460445_00697 | CDS | open | 135246-135806 | _na 186_aa | dcd | dCTP deaminase |
| 1264 | CABPUD010000003.1 | GCA902460445_00698 | CDS | open | 135926-136768 | _na 280_aa | Hydrogenase | |
| 1265 | CABPUD010000003.1 | GCA902460445_00699 | CDS | open | 136878-137324 | _na 148_aa | accB | acetyl-CoA carboxylase biotin carboxyl carrier protein |
| 1266 | CABPUD010000003.1 | GCA902460445_00700 | CDS | open | 137324-138655 | _na 443_aa | acetyl-CoA carboxylase biotin carboxylase subunit | |
| 1267 | CABPUD010000003.1 | GCA902460445_00701 | CDS | open | 138733-140091 | _na 452_aa | Multidrug-efflux transporter | |
| 1268 | CABPUD010000003.1 | GCA902460445_00702 | CDS | open | 140139-140807 | _na 222_aa | Lipoprotein | |
| 1269 | CABPUD010000003.1 | GCA902460445_00703 | CDS | open | 140792-141196 | _na 134_aa | DUF4810 domain-containing protein | |
| 1270 | CABPUD010000003.1 | GCA902460445_00704 | CDS | open | 141186-141863 | _na 225_aa | Lipoprotein | |
| 1271 | CABPUD010000003.1 | GCA902460445_00705 | CDS | open | 141869-142756 | _na 295_aa | eamA | EamA domain-containing protein |
| 1272 | CABPUD010000003.1 | GCA902460445_00706 | CDS | open | 142753-143175 | _na 140_aa | tsaC | Threonylcarbamoyl-AMP synthase TsaC |
| 1273 | CABPUD010000003.1 | GCA902460445_00707 | CDS | open | 143185-144912 | _na 575_aa | Oligoendopeptidase F | |
| 1274 | CABPUD010000003.1 | GCA902460445_00708 | CDS | open | 144922-146316 | _na 464_aa | dcuC | C4-dicarboxylate transporter DcuC |
| 1275 | CABPUD010000003.1 | GCA902460445_00709 | CDS | open | 146641-147786 | _na 381_aa | ywqK | Toxin-antitoxin system YwqK family antitoxin |
| 1276 | CABPUD010000003.1 | GCA902460445_00710 | CDS | open | 147893-148399 | _na 168_aa | DNA-deoxyinosine glycosylase | |
| 1277 | CABPUD010000003.1 | GCA902460445_00711 | CDS | open | 148452-149057 | _na 201_aa | lemA | LemA family protein |
| 1278 | CABPUD010000003.1 | GCA902460445_00712 | CDS | open | 149235-152837 | _na 1200_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 1279 | CABPUD010000003.1 | GCA902460445_00713 | CDS | open | 153007-154170 | _na 387_aa | sugar transporter | |
| 1280 | CABPUD010000003.1 | GCA902460445_00714 | CDS | open | 154309-154620 | _na 103_aa | DUF2325 domain-containing protein | |
| 1281 | CABPUD010000003.1 | GCA902460445_00715 | CDS | open | 154624-155337 | _na 237_aa | UDP-N-acetylmuramate--alanine ligase | |
| 1282 | CABPUD010000003.1 | GCA902460445_00716 | CDS | open | 155349-155840 | _na 163_aa | fldA | flavodoxin FldA |
| 1283 | CABPUD010000003.1 | GCA902460445_00717 | CDS | open | 155874-156611 | _na 245_aa | ABC transporter domain-containing protein | |
| 1284 | CABPUD010000003.1 | GCA902460445_00718 | CDS | open | 156611-157279 | _na 222_aa | ABC transmembrane type-1 domain-containing protein | |
| 1285 | CABPUD010000003.1 | GCA902460445_00719 | CDS | open | 157303-158055 | _na 250_aa | Solute-binding protein family 3/N-terminal domain-containing protein | |
| 1286 | CABPUD010000003.1 | GCA902460445_00720 | CDS | open | 158065-158817 | _na 250_aa | Amino acid ABC transporter%2C periplasmic cysteine-binding protein | |
| 1287 | CABPUD010000003.1 | GCA902460445_00721 | CDS | open | 159184-162633 | _na 1149_aa | acyl-[ACP]--phospholipid O-acyltransferase | |
| 1288 | CABPUD010000003.1 | GCA902460445_00722 | CDS | open | 162805-164670 | _na 621_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 1289 | CABPUD010000003.1 | GCA902460445_00723 | CDS | open | 164846-165349 | _na 167_aa | petA | ubiquinol-cytochrome c reductase iron-sulfur subunit |
| 1290 | CABPUD010000003.1 | GCA902460445_00724 | CDS | open | 165360-166604 | _na 414_aa | Ubiquinol cytochrome c oxidoreductase PetABC%2C cytochrome b subunit | |
| 1291 | CABPUD010000003.1 | GCA902460445_00725 | CDS | open | 166607-167650 | _na 347_aa | Ubiquinol cytochrome c oxidoreductase PetABC%2C membrane-bound cytochrome c subunit | |
| 1292 | CABPUD010000003.1 | GCA902460445_00726 | CDS | open | 168407-168694 | _na 95_aa | hypothetical protein | |
| 1293 | CABPUD010000003.1 | GCA902460445_00727 | CDS | open | 168739-169824 | _na 361_aa | Beta-lactamase family protein | |
| 1294 | CABPUD010000003.1 | GCA902460445_00728 | CDS | open | 170286-170855 | _na 189_aa | Hydrogenase-4%2C component A | |
| 1295 | CABPUD010000003.1 | GCA902460445_00729 | CDS | open | 170857-172824 | _na 655_aa | Hydrogenase-4%2C component B | |
| 1296 | CABPUD010000003.1 | GCA902460445_00730 | CDS | open | 172834-173754 | _na 306_aa | Formate hydrogenlyase subunit 4 | |
| 1297 | CABPUD010000003.1 | GCA902460445_00731 | CDS | open | 173756-174400 | _na 214_aa | hyfE | hydrogenase 4 membrane subunit |
| 1298 | CABPUD010000003.1 | GCA902460445_00732 | CDS | open | 174403-175884 | _na 493_aa | NADH:quinone oxidoreductase/Mrp antiporter transmembrane domain-containing protein | |
| 1299 | CABPUD010000003.1 | GCA902460445_00733 | CDS | open | 175881-177617 | _na 578_aa | DNA-3-methyladenine glycosylase I | |
| 1300 | CABPUD010000003.1 | GCA902460445_00734 | CDS | open | 177614-178153 | _na 179_aa | 4Fe-4S dicluster domain-containing protein | |
| 1301 | CABPUD010000003.1 | GCA902460445_00735 | CDS | open | 178150-178974 | _na 274_aa | Hydrogenase-4%2C component I | |
| 1302 | CABPUD010000003.1 | GCA902460445_00736 | CDS | open | 178971-179315 | _na 114_aa | Formate hydrogenlyase family maturation protein | |
| 1303 | CABPUD010000003.1 | GCA902460445_00737 | CDS | open | 179315-179761 | _na 148_aa | Coenzyme F420 hydrogenase maturation protease | |
| 1304 | CABPUD010000003.1 | GCA902460445_00738 | CDS | open | 179892-180791 | _na 299_aa | Formate efflux transporter | |
| 1305 | CABPUD010000003.1 | GCA902460445_00739 | CDS | open | 180871-181509 | _na 212_aa | HTH crp-type domain-containing protein | |
| 1306 | CABPUD010000003.1 | GCA902460445_00740 | CDS | open | 181658-182071 | _na 137_aa | Acyl-CoA thioester hydrolase | |
| 1307 | CABPUD010000003.1 | GCA902460445_00741 | CDS | open | 182163-184004 | _na 613_aa | ciaB | invasion protein CiaB |
| 1308 | CABPUD010000003.1 | GCA902460445_00742 | CDS | open | 184014-186341 | _na 775_aa | Diguanylate cyclase/phosphodiesterase | |
| 1309 | CABPUD010000003.1 | GCA902460445_00743 | CDS | open | 186334-186873 | _na 179_aa | YcxB-like protein domain-containing protein | |
| 1310 | CABPUD010000003.1 | GCA902460445_00744 | CDS | open | 187004-189319 | _na 771_aa | Diguanylate cyclase | |
| 1311 | CABPUD010000003.1 | GCA902460445_00745 | CDS | open | 189316-189504 | _na 62_aa | ClpX-type ZB domain-containing protein | |
| 1312 | CABPUD010000003.1 | GCA902460445_00746 | CDS | open | 189634-190329 | _na 231_aa | dUTPase%2C dimeric | |
| 1313 | CABPUD010000003.1 | GCA902460445_00747 | CDS | open | 190326-191066 | _na 246_aa | EI24 domain-containing protein | |
| 1314 | CABPUD010000003.1 | GCA902460445_00748 | CDS | open | 191085-191606 | _na 173_aa | ATP/GTP-binding protein | |
| 1315 | CABPUD010000003.1 | GCA902460445_00749 | CDS | open | 191691-192059 | _na 122_aa | L-arabinose ABC transporter | |
| 1316 | CABPUD010000003.1 | GCA902460445_00750 | CDS | open | 192060-192479 | _na 139_aa | pyridoxamine 5'-phosphate oxidase family protein | |
| 1317 | CABPUD010000003.1 | GCA902460445_00751 | CDS | open | 192535-193278 | _na 247_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 1318 | CABPUD010000003.1 | GCA902460445_00752 | CDS | open | 193367-193600 | _na 77_aa | acpP | acyl carrier protein |
| 1319 | CABPUD010000003.1 | GCA902460445_00753 | CDS | open | 193635-194846 | _na 403_aa | beta-ketoacyl-ACP synthase II | |
| 1320 | CABPUD010000003.1 | GCA902460445_00754 | CDS | open | 194848-195783 | _na 311_aa | accA | acetyl-CoA carboxylase carboxyl transferase subunit alpha |
| 1321 | CABPUD010000003.1 | GCA902460445_00755 | CDS | open | 195976-196200 | _na 74_aa | hypothetical protein | |
| 1322 | CABPUD010000003.1 | GCA902460445_00756 | CDS | open | 196222-196830 | _na 202_aa | cbrC | CbrC family protein |
| 1323 | CABPUD010000003.1 | GCA902460445_00757 | CDS | open | 196841-197692 | _na 283_aa | Peptide methionine sulfoxide reductase | |
| 1324 | CABPUD010000003.1 | GCA902460445_00758 | CDS | open | 197908-198522 | _na 204_aa | riboflavin synthase | |
| 1325 | CABPUD010000003.1 | GCA902460445_00759 | CDS | open | 198532-199263 | _na 243_aa | pgeF | peptidoglycan editing factor PgeF |
| 1326 | CABPUD010000003.1 | GCA902460445_00760 | CDS | open | 199419-200198 | _na 259_aa | DUF4198 domain-containing protein | |
| 1327 | CABPUD010000003.1 | GCA902460445_00761 | CDS | open | 200275-200490 | _na 71_aa | Acetyltransferase | |
| 1328 | CABPUD010000003.1 | GCA902460445_00762 | CDS | open | 200636-201424 | _na 262_aa | rpsB | 30S ribosomal protein S2 |
| 1329 | CABPUD010000003.1 | GCA902460445_00763 | CDS | open | 201424-202488 | _na 354_aa | tsf | translation elongation factor Ts |
| 1330 | CABPUD010000003.1 | GCA902460445_00764 | CDS | open | 202488-203132 | _na 214_aa | ABC transporter%2C ATP-binding protein | |
| 1331 | CABPUD010000003.1 | GCA902460445_00765 | CDS | open | 203445-203555 | _na 36_aa | hypothetical protein | |
| 1332 | CABPUD010000003.1 | GCA902460445_00766 | CDS | open | 204415-205023 | _na 202_aa | hisG | ATP phosphoribosyltransferase |
| 1333 | CABPUD010000003.1 | GCA902460445_00767 | CDS | open | 205020-205649 | _na 209_aa | type III pantothenate kinase | |
| 1334 | CABPUD010000003.1 | GCA902460445_00768 | CDS | open | 205636-205968 | _na 110_aa | hypothetical protein | |
| 1335 | CABPUD010000003.1 | GCA902460445_00769 | CDS | open | 205965-206972 | _na 335_aa | L-seryl-tRNA selenium transferase | |
| 1336 | CABPUD010000003.1 | GCA902460445_00770 | CDS | open | 206972-207535 | _na 187_aa | Tetratricopeptide repeat-like domain-containing protein | |
| 1337 | CABPUD010000003.1 | GCA902460445_00771 | CDS | open | 207663-207950 | _na 95_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 1338 | CABPUD010000003.1 | GCA902460445_00772 | CDS | open | 207961-209100 | _na 379_aa | Type II/IV secretion system protein%2C PilT/PilU family | |
| 1339 | CABPUD010000003.1 | GCA902460445_00773 | CDS | open | 209100-209711 | _na 203_aa | cvpA | CvpA family protein |
| 1340 | CABPUD010000003.1 | GCA902460445_00774 | CDS | open | 209713-210180 | _na 155_aa | Ferric uptake regulation protein | |
| 1341 | CABPUD010000003.1 | GCA902460445_00775 | CDS | open | 210182-211693 | _na 503_aa | lysS | lysine--tRNA ligase |
| 1342 | CABPUD010000003.1 | GCA902460445_00776 | CDS | open | 211690-212934 | _na 414_aa | glyA | Serine hydroxymethyltransferase |
| 1343 | CABPUD010000003.1 | GCA902460445_00777 | CDS | open | 212934-213476 | _na 180_aa | DUF1882 domain-containing protein | |
| 1344 | CABPUD010000003.1 | GCA902460445_00778 | CDS | open | 213490-214335 | _na 281_aa | ABC transporter ATP-binding protein | |
| 1345 | CABPUD010000003.1 | GCA902460445_00779 | CDS | open | 214332-215120 | _na 262_aa | shikimate dehydrogenase | |
| 1346 | CABPUD010000003.1 | GCA902460445_00780 | CDS | open | 215242-216297 | _na 351_aa | dctP | DctP family TRAP transporter solute receptor |
| 1347 | CABPUD010000003.1 | GCA902460445_00781 | CDS | open | 216388-217839 | _na 483_aa | pyk | pyruvate kinase |
| 1348 | CABPUD010000003.1 | GCA902460445_00782 | CDS | open | 218479-219621 | _na 380_aa | dnaJ | molecular chaperone DnaJ |
| 1349 | CABPUD010000003.1 | GCA902460445_00783 | CDS | open | 219744-220415 | _na 223_aa | Two-component system response regulator | |
| 1350 | CABPUD010000003.1 | GCA902460445_00784 | CDS | open | 220412-221668 | _na 418_aa | arsS | ArsS family sensor histidine kinase |
| 1351 | CABPUD010000003.1 | GCA902460445_00785 | CDS | open | 221665-222237 | _na 190_aa | recR | recombination mediator RecR |
| 1352 | CABPUD010000003.1 | GCA902460445_00786 | CDS | open | 222323-223939 | _na 538_aa | Anthranilate phosphoribosyltransferase | |
| 1353 | CABPUD010000003.1 | GCA902460445_00787 | CDS | open | 223926-224540 | _na 204_aa | N-(5'-phosphoribosyl)anthranilate isomerase | |
| 1354 | CABPUD010000003.1 | GCA902460445_00788 | CDS | open | 224530-225711 | _na 393_aa | trpB | tryptophan synthase subunit beta |
| 1355 | CABPUD010000003.1 | GCA902460445_00789 | CDS | open | 225704-226453 | _na 249_aa | trpA | tryptophan synthase subunit alpha |
| 1356 | CABPUD010000003.1 | GCA902460445_00790 | CDS | open | 226532-226951 | _na 139_aa | Chemotaxis phosphatase CheX-like domain-containing protein | |
| 1357 | CABPUD010000003.1 | GCA902460445_00791 | CDS | open | 226948-227265 | _na 105_aa | fliN | flagellar motor switch protein FliN |
| 1358 | CABPUD010000003.1 | GCA902460445_00792 | CDS | open | 227262-228140 | _na 292_aa | Excinuclease ABC subunit A | |
| 1359 | CABPUD010000003.1 | GCA902460445_00793 | CDS | open | 228202-229650 | _na 482_aa | Guanosine-5'-triphosphate%2C 3'-diphosphate pyrophosphatase | |
| 1360 | CABPUD010000003.1 | GCA902460445_00794 | CDS | open | 229653-230930 | _na 425_aa | histidine kinase | |
| 1361 | CABPUD010000003.1 | GCA902460445_00795 | CDS | open | 230909-231580 | _na 223_aa | ompR | Two-component system response regulator |
| 1362 | CABPUD010000003.1 | GCA902460445_00796 | CDS | open | 231657-231983 | _na 108_aa | Dihydroneopterin aldolase | |
| 1363 | CABPUD010000003.1 | GCA902460445_00797 | CDS | open | 231980-232591 | _na 203_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 1364 | CABPUD010000003.1 | GCA902460445_00798 | CDS | open | 232650-234938 | _na 762_aa | herA | Helicase HerA central domain-containing protein |
| 1365 | CABPUD010000003.1 | GCA902460445_00799 | CDS | open | 234947-236029 | _na 360_aa | pilZ | PilZ domain-containing protein |
| 1366 | CABPUD010000003.1 | GCA902460445_00800 | CDS | open | 236153-236752 | _na 199_aa | Alkyl hydroperoxide reductase protein%2C peroxidase component | |
| 1367 | CABPUD010000003.1 | GCA902460445_00801 | CDS | open | 237065-238069 | _na 334_aa | fabH | Beta-ketoacyl-[acyl-carrier-protein] synthase III |
| 1368 | CABPUD010000003.1 | GCA902460445_00802 | CDS | open | 238073-239062 | _na 329_aa | plsX | phosphate acyltransferase PlsX |
| 1369 | CABPUD010000003.1 | GCA902460445_00803 | CDS | open | 239066-239212 | _na 48_aa | rpmF | 50S ribosomal protein L32 |
| 1370 | CABPUD010000003.1 | GCA902460445_00804 | CDS | open | 239225-239584 | _na 119_aa | DNA-binding protein | |
| 1371 | CABPUD010000003.1 | GCA902460445_00805 | CDS | open | 239601-240014 | _na 137_aa | ndk | nucleoside-diphosphate kinase |
| 1372 | CABPUD010000003.1 | GCA902460445_00806 | CDS | open | 240123-240407 | _na 94_aa | 4Fe-4S binding protein | |
| 1373 | CABPUD010000003.1 | GCA902460445_00807 | CDS | open | 240582-243410 | _na 942_aa | uvrA | excinuclease ABC subunit UvrA |
| 1374 | CABPUD010000003.1 | GCA902460445_00808 | CDS | open | 243469-244641 | _na 390_aa | O-antigen ligase-related domain-containing protein | |
| 1375 | CABPUD010000003.1 | GCA902460445_00809 | CDS | open | 244728-245756 | _na 342_aa | Glycosyltransferase 2-like domain-containing protein | |
| 1376 | CABPUD010000003.1 | GCA902460445_00810 | CDS | open | 245760-246809 | _na 349_aa | Glycosyltransferase | |
| 1377 | CABPUD010000003.1 | GCA902460445_00811 | CDS | open | 246806-247564 | _na 252_aa | Xylanase | |
| 1378 | CABPUD010000003.1 | GCA902460445_00812 | CDS | open | 247573-248358 | _na 261_aa | Beta-1%2C4-galactosyltransferase | |
| 1379 | CABPUD010000003.1 | GCA902460445_00813 | CDS | open | 248351-248857 | _na 168_aa | AAA domain protein | |
| 1380 | CABPUD010000003.1 | GCA902460445_00814 | CDS | open | 248857-249654 | _na 265_aa | NodB-like y domain-containing protein | |
| 1381 | CABPUD010000003.1 | GCA902460445_00815 | CDS | open | 249651-250724 | _na 357_aa | Glycosyltransferase%2C family 1 | |
| 1382 | CABPUD010000003.1 | GCA902460445_00816 | CDS | open | 250729-251790 | _na 353_aa | rfaQ | putative lipopolysaccharide heptosyltransferase III |
| 1383 | CABPUD010000003.1 | GCA902460445_00817 | CDS | open | 251787-252491 | _na 234_aa | Glycosyltransferase 2-like domain-containing protein | |
| 1384 | CABPUD010000003.1 | GCA902460445_00818 | CDS | open | 252485-253378 | _na 297_aa | lipid A biosynthesis lauroyl acyltransferase | |
| 1385 | CABPUD010000003.1 | GCA902460445_00819 | CDS | open | 253371-254345 | _na 324_aa | waaC | lipopolysaccharide heptosyltransferase I |
| 1386 | CABPUD010000003.1 | GCA902460445_00820 | CDS | open | 254409-255440 | _na 343_aa | Putative polysaccharide biosynthesis protein | |
| 1387 | CABPUD010000003.1 | GCA902460445_00821 | CDS | open | 255512-255769 | _na 85_aa | SAP domain-containing protein | |
| 1388 | CABPUD010000003.1 | GCA902460445_00822 | CDS | open | 255947-256498 | _na 183_aa | Lipoprotein | |
| 1389 | CABPUD010000003.1 | GCA902460445_00823 | CDS | open | 256502-256981 | _na 159_aa | hypothetical protein | |
| 1390 | CABPUD010000003.1 | GCA902460445_00824 | CDS | open | 257102-257554 | _na 150_aa | hypothetical protein | |
| 1391 | CABPUD010000003.1 | GCA902460445_00825 | CDS | open | 257572-258054 | _na 160_aa | hypothetical protein | |
| 1392 | CABPUD010000003.1 | GCA902460445_00826 | CDS | open | 258057-258530 | _na 157_aa | hypothetical protein | |
| 1393 | CABPUD010000003.1 | GCA902460445_00827 | CDS | open | 258769-259209 | _na 146_aa | hypothetical protein | |
| 1394 | CABPUD010000003.1 | GCA902460445_00828 | CDS | open | 259206-259793 | _na 195_aa | TIGR02594 family protein | |
| 1395 | CABPUD010000003.1 | GCA902460445_00829 | CDS | open | 261016-262050 | _na 344_aa | RAMP superfamily | |
| 1396 | CABPUD010000003.1 | GCA902460445_00830 | CDS | open | 262043-262927 | _na 294_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 1397 | CABPUD010000003.1 | GCA902460445_00831 | CDS | open | 262927-263565 | _na 212_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 1398 | CABPUD010000003.1 | GCA902460445_00832 | CDS | open | 263575-263979 | _na 134_aa | type III-A CRISPR-associated protein Csm2 | |
| 1399 | CABPUD010000003.1 | GCA902460445_00833 | CDS | open | 263976-265484 | _na 502_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 1400 | CABPUD010000003.1 | GCA902460445_00834 | CDS | open | 265471-266307 | _na 278_aa | CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 | |
| 1401 | CABPUD010000003.1 | GCA902460445_00835 | CDS | open | 267471-268163 | _na 230_aa | CRISPR-associated endonuclease Cas1 | |
| 1402 | CABPUD010000003.1 | GCA902460445_00836 | CDS | open | 268163-268438 | _na 91_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1403 | CABPUD010000003.1 | GCA902460445_00837 | CDS | open | 269724-269849 | _na 41_aa | hypothetical protein | |
| 1404 | CABPUD010000003.1 | GCA902460445_00838 | CDS | open | 270610-272277 | _na 555_aa | dcuB | C4-dicarboxylate transporter DcuB |
| 1405 | CABPUD010000003.1 | GCA902460445_00839 | CDS | open | 272329-273402 | _na 357_aa | flhB | flagellar biosynthesis protein FlhB |
| 1406 | CABPUD010000003.1 | GCA902460445_00840 | CDS | open | 273536-274498 | _na 320_aa | hypothetical protein | |
| 1407 | CABPUD010000003.1 | GCA902460445_00841 | CDS | open | 274606-274920 | _na 104_aa | rplU | 50S ribosomal protein L21 |
| 1408 | CABPUD010000003.1 | GCA902460445_00842 | CDS | open | 274932-275189 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 1409 | CABPUD010000003.1 | GCA902460445_00843 | CDS | open | 275414-276472 | _na 352_aa | obgE | GTPase ObgE |
| 1410 | CABPUD010000003.1 | GCA902460445_00844 | CDS | open | 276519-276854 | _na 111_aa | EF-hand domain-containing protein | |
| 1411 | CABPUD010000003.1 | GCA902460445_00845 | CDS | open | 276871-277776 | _na 301_aa | fmt | methionyl-tRNA formyltransferase |
| 1412 | CABPUD010000003.1 | GCA902460445_00846 | CDS | open | 277801-278589 | _na 262_aa | hydroxymethylpyrimidine kinase | |
| 1413 | CABPUD010000003.1 | GCA902460445_00847 | CDS | open | 278591-279226 | _na 211_aa | biotin--[acetyl-CoA-carboxylase] ligase | |
| 1414 | CABPUD010000003.1 | GCA902460445_00848 | CDS | open | 279223-280005 | _na 260_aa | AAA domain-containing protein | |
| 1415 | CABPUD010000003.1 | GCA902460445_00849 | CDS | open | 280021-280881 | _na 286_aa | Chromosome partitioning protein | |
| 1416 | CABPUD010000003.1 | GCA902460445_00850 | CDS | open | 280977-281399 | _na 140_aa | ATP synthase%2C F0 complex%2C b' subunit | |
| 1417 | CABPUD010000003.1 | GCA902460445_00851 | CDS | open | 281409-281921 | _na 170_aa | atpF | F0F1 ATP synthase subunit B |
| 1418 | CABPUD010000003.1 | GCA902460445_00852 | CDS | open | 281921-282451 | _na 176_aa | atpH | F0F1 ATP synthase subunit delta |
| 1419 | CABPUD010000003.1 | GCA902460445_00853 | CDS | open | 282466-283983 | _na 505_aa | atpA | F0F1 ATP synthase subunit alpha |
| 1420 | CABPUD010000003.1 | GCA902460445_00854 | CDS | open | 283993-284880 | _na 295_aa | atpG | ATP synthase F1 subunit gamma |
| 1421 | CABPUD010000003.1 | GCA902460445_00855 | CDS | open | 284892-286289 | _na 465_aa | atpD | F0F1 ATP synthase subunit beta |
| 1422 | CABPUD010000003.1 | GCA902460445_00856 | CDS | open | 286308-286697 | _na 129_aa | atpC | ATP synthase F1 subunit epsilon |
| 1423 | CABPUD010000003.1 | GCA902460445_00857 | CDS | open | 286698-287282 | _na 194_aa | tolQ | Tol-Pal system subunit TolQ |
| 1424 | CABPUD010000003.1 | GCA902460445_00858 | CDS | open | 287283-287681 | _na 132_aa | tolR | Tol-Pal system subunit TolR |
| 1425 | CABPUD010000003.1 | GCA902460445_00859 | CDS | open | 287683-288630 | _na 315_aa | tonB | TonB family domain-containing protein |
| 1426 | CABPUD010000003.1 | GCA902460445_00860 | CDS | open | 288655-289911 | _na 418_aa | tolB | Tol-Pal system protein TolB |
| 1427 | CABPUD010000003.1 | GCA902460445_00861 | CDS | open | 289976-290482 | _na 168_aa | Peptidoglycan-associated lipoprotein | |
| 1428 | CABPUD010000003.1 | GCA902460445_00862 | CDS | open | 290500-291342 | _na 280_aa | ybgF | Tol-Pal system protein YbgF |
| 1429 | CABPUD010000003.1 | GCA902460445_00863 | CDS | open | 291405-291989 | _na 194_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1430 | CABPUD010000003.1 | GCA902460445_00864 | CDS | open | 291999-292928 | _na 309_aa | fabD | ACP S-malonyltransferase |
| 1431 | CABPUD010000003.1 | GCA902460445_00865 | CDS | open | 292925-293608 | _na 227_aa | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase | |
| 1432 | CABPUD010000003.1 | GCA902460445_00866 | CDS | open | 293605-294363 | _na 252_aa | tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein | |
| 1433 | CABPUD010000003.1 | GCA902460445_00867 | CDS | open | 294635-295249 | _na 204_aa | recO | recombination protein RecO |
| 1434 | CABPUD010000003.1 | GCA902460445_00868 | CDS | open | 295250-296173 | _na 307_aa | tRNA-dihydrouridine synthase | |
| 1435 | CABPUD010000003.1 | GCA902460445_00869 | CDS | open | 296170-297168 | _na 332_aa | Uroporphyrinogen III synthase HEM4 | |
| 1436 | CABPUD010000003.1 | GCA902460445_00870 | CDS | open | 297178-297534 | _na 118_aa | dksA | RNA polymerase-binding protein DksA |
| 1437 | CABPUD010000003.1 | GCA902460445_00871 | CDS | open | 297545-298000 | _na 151_aa | rlmH | Ribosomal RNA large subunit methyltransferase H |
| 1438 | CABPUD010000003.1 | GCA902460445_00872 | CDS | open | 298003-298917 | _na 304_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 1439 | CABPUD010000003.1 | GCA902460445_00873 | CDS | open | 299047-301302 | _na 751_aa | bamA | outer membrane protein assembly factor BamA |
| 1440 | CABPUD010000003.1 | GCA902460445_00874 | CDS | open | 301392-302222 | _na 276_aa | prephenate dehydrogenase | |
| 1441 | CABPUD010000003.1 | GCA902460445_00875 | CDS | open | 302286-303656 | _na 456_aa | Zinc metallopeptidase%2C M23 family | |
| 1442 | CABPUD010000003.1 | GCA902460445_00876 | CDS | open | 303719-304603 | _na 294_aa | lpxC | UDP-3-O-acyl-N-acetylglucosamine deacetylase |
| 1443 | CABPUD010000003.1 | GCA902460445_00877 | CDS | open | 304645-305046 | _na 133_aa | tsaB | N6-L-threonylcarbamoyladenine synthase%2C TsaB subunit |
| 1444 | CABPUD010000003.1 | GCA902460445_00878 | CDS | open | 305055-305939 | _na 294_aa | thrB | homoserine kinase |
| 1445 | CABPUD010000003.1 | GCA902460445_00879 | CDS | open | 305961-306215 | _na 84_aa | ylxR | YlxR domain-containing protein |
| 1446 | CABPUD010000003.1 | GCA902460445_00880 | CDS | open | 306202-308850 | _na 882_aa | infB | translation initiation factor IF-2 |
| 1447 | CABPUD010000003.1 | GCA902460445_00881 | CDS | open | 308847-309212 | _na 121_aa | rbfA | 30S ribosome-binding factor RbfA |
| 1448 | CABPUD010000003.1 | GCA902460445_00882 | CDS | open | 309205-309621 | _na 138_aa | rimP | ribosome maturation factor RimP |
| 1449 | CABPUD010000003.1 | GCA902460445_00883 | CDS | open | 309622-311271 | _na 549_aa | fhs | formate--tetrahydrofolate ligase |
| 1450 | CABPUD010000003.1 | GCA902460445_00884 | CDS | open | 311284-311835 | _na 183_aa | DUF4136 domain-containing protein | |
| 1451 | CABPUD010000003.1 | GCA902460445_00885 | CDS | open | 311851-312912 | _na 353_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 1452 | CABPUD010000003.1 | GCA902460445_00886 | CDS | open | 312909-313772 | _na 287_aa | Nodulin 21-related protein | |
| 1453 | CABPUD010000003.1 | GCA902460445_00888 | CDS | open | 313957-314259 | _na 100_aa | atpE | F0F1 ATP synthase subunit C |
| 1454 | CABPUD010000003.1 | GCA902460445_00889 | CDS | open | 314464-315810 | _na 448_aa | NSS family amino acid:sodium (Na+) symporter | |
| 1455 | CABPUD010000003.1 | GCA902460445_00890 | CDS | open | 315810-317138 | _na 442_aa | Na+-dependent transporter%2C SNF family | |
| 1456 | CABPUD010000003.1 | GCA902460445_00891 | CDS | open | 317138-318478 | _na 446_aa | Na+-dependent transporter%2C SNF family | |
| 1457 | CABPUD010000003.1 | GCA902460445_00892 | CDS | open | 318488-318997 | _na 169_aa | TRAP-type transport system%2C small permease | |
| 1458 | CABPUD010000003.1 | GCA902460445_00893 | CDS | open | 318997-320385 | _na 462_aa | TRAP-type transport system%2C large permease | |
| 1459 | CABPUD010000003.1 | GCA902460445_00894 | CDS | open | 320508-322310 | _na 600_aa | Pyruvate carboxylase%2C subunit B | |
| 1460 | CABPUD010000003.1 | GCA902460445_00895 | CDS | open | 322414-323991 | _na 525_aa | pckA | phosphoenolpyruvate carboxykinase (ATP) |
| 1461 | CABPUD010000003.1 | GCA902460445_00896 | CDS | open | 324360-325715 | _na 451_aa | C4-dicarboxylate transport protein | |
| 1462 | CABPUD010000003.1 | GCA902460445_00897 | CDS | open | 325727-326221 | _na 164_aa | peptidylprolyl isomerase | |
| 1463 | CABPUD010000003.1 | GCA902460445_00898 | CDS | open | 326233-326940 | _na 235_aa | putative transcriptional regulatory protein Ccon26_04940 | |
| 1464 | CABPUD010000003.1 | GCA902460445_00899 | CDS | open | 327091-327645 | _na 184_aa | Acetyltransferase | |
| 1465 | CABPUD010000003.1 | GCA902460445_00900 | CDS | open | 327642-327845 | _na 67_aa | HMA domain-containing protein | |
| 1466 | CABPUD010000003.1 | GCA902460445_00901 | CDS | open | 327847-330024 | _na 725_aa | Copper-transporting ATPase | |
| 1467 | CABPUD010000003.1 | GCA902460445_00902 | CDS | open | 330028-330567 | _na 179_aa | Oxidoreductase | |
| 1468 | CABPUD010000003.1 | GCA902460445_00903 | CDS | open | 330570-330959 | _na 129_aa | hypothetical protein | |
| 1469 | CABPUD010000003.1 | GCA902460445_00904 | CDS | open | 331287-332690 | _na 467_aa | argH | argininosuccinate lyase |
| 1470 | CABPUD010000003.1 | GCA902460445_00905 | CDS | open | 332702-334696 | _na 664_aa | Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein | |
| 1471 | CABPUD010000003.1 | GCA902460445_00906 | CDS | open | 334777-335859 | _na 360_aa | Methyl-accepting transducer domain-containing protein | |
| 1472 | CABPUD010000003.1 | GCA902460445_00907 | CDS | open | 335900-336253 | _na 117_aa | HIT domain-containing protein | |
| 1473 | CABPUD010000003.1 | GCA902460445_00908 | CDS | open | 336372-337367 | _na 331_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 1474 | CABPUD010000003.1 | GCA902460445_00909 | CDS | open | 337364-339700 | _na 778_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 1475 | CABPUD010000003.1 | GCA902460445_00910 | CDS | open | 339697-340974 | _na 425_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 1476 | CABPUD010000003.1 | GCA902460445_00911 | CDS | open | 340964-341788 | _na 274_aa | ispH | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase |
| 1477 | CABPUD010000003.1 | GCA902460445_00912 | CDS | open | 341869-343545 | _na 558_aa | 30S ribosomal protein S1 | |
| 1478 | CABPUD010000003.1 | GCA902460445_00913 | CDS | open | 343551-344033 | _na 160_aa | Periplasmic protein | |
| 1479 | CABPUD010000003.1 | GCA902460445_00914 | CDS | open | 344030-345607 | _na 525_aa | serA | phosphoglycerate dehydrogenase |
| 1480 | CABPUD010000003.1 | GCA902460445_00915 | CDS | open | 345627-346193 | _na 188_aa | efp | elongation factor P |
| 1481 | CABPUD010000003.1 | GCA902460445_00916 | CDS | open | 346879-347430 | _na 183_aa | DJ-1 family glyoxalase III | |
| 1482 | CABPUD010000003.1 | GCA902460445_00917 | CDS | open | 347654-347899 | _na 81_aa | RRM domain-containing protein | |
| 1483 | CABPUD010000003.1 | GCA902460445_00918 | CDS | open | 347877-348773 | _na 298_aa | Glutamyl/glutaminyl-tRNA synthetase class Ib catalytic domain-containing protein | |
| 1484 | CABPUD010000003.1 | GCA902460445_00919 | CDS | open | 348842-349705 | _na 287_aa | Signal peptide peptidase protease IV | |
| 1485 | CABPUD010000003.1 | GCA902460445_00920 | CDS | open | 349693-350910 | _na 405_aa | Amidohydrolase-related domain-containing protein | |
| 1486 | CABPUD010000003.1 | GCA902460445_00921 | CDS | open | 350996-351475 | _na 159_aa | aroQ | type II 3-dehydroquinate dehydratase |
| 1487 | CABPUD010000003.1 | GCA902460445_00922 | CDS | open | 351472-352497 | _na 341_aa | X-Pro dipeptidase | |
| 1488 | CABPUD010000003.1 | GCA902460445_00923 | CDS | open | 352494-352970 | _na 158_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1489 | CABPUD010000003.1 | GCA902460445_00924 | CDS | open | 352981-354339 | _na 452_aa | flhF | flagellar biosynthesis protein FlhF |
| 1490 | CABPUD010000003.1 | GCA902460445_00925 | CDS | open | 354332-355198 | _na 288_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 1491 | CABPUD010000003.1 | GCA902460445_00926 | CDS | open | 355212-355556 | _na 114_aa | Motility integral membrane protein | |
| 1492 | CABPUD010000003.1 | GCA902460445_00927 | CDS | open | 355528-356232 | _na 234_aa | RNA polymerase sigma28 factor | |
| 1493 | CABPUD010000003.1 | GCA902460445_00928 | CDS | open | 356232-357335 | _na 367_aa | fliM | flagellar motor switch protein FliM |
| 1494 | CABPUD010000003.1 | GCA902460445_00929 | CDS | open | 357325-358173 | _na 282_aa | fliY | flagellar motor switch protein FliY |
| 1495 | CABPUD010000003.1 | GCA902460445_00930 | CDS | open | 358173-358766 | _na 197_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 1496 | CABPUD010000003.1 | GCA902460445_00931 | CDS | open | 358815-359837 | _na 340_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 1497 | CABPUD010000003.1 | GCA902460445_00933 | CDS | open | 360352-360606 | _na 84_aa | DNA-binding protein | |
| 1498 | CABPUD010000003.1 | GCA902460445_00934 | CDS | open | 360606-360923 | _na 105_aa | plasmid mobilization protein | |
| 1499 | CABPUD010000003.1 | GCA902460445_00935 | CDS | open | 360926-362479 | _na 517_aa | relaxase/mobilization nuclease domain-containing protein | |
| 1500 | CABPUD010000003.1 | GCA902460445_00936 | CDS | open | 362575-362904 | _na 109_aa | hypothetical protein |

