BAKTAGenome Explorer: Segatella buccae (GCA_902461075.1)
Select a Genome:
|
BAKTA Annotations for GCA_902461075.1
|
Search & Sort all 4808 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CABPVU010000007.1 | GCA902461075_00782 | CDS | open | 84767-86611 | _na 614_aa | yesW | Rhamnogalacturonan endolyase yesW |
| 1502 | CABPVU010000007.1 | GCA902461075_00783 | CDS | open | 87415-89031 | _na 538_aa | rhgT | Rhamnogalacturonan acetylesterase rhgT |
| 1503 | CABPVU010000007.1 | GCA902461075_00784 | CDS | open | 89058-89375 | _na 105_aa | rhaM | L-rhamnose mutarotase |
| 1504 | CABPVU010000007.1 | GCA902461075_00785 | CDS | open | 89416-90651 | _na 411_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 1505 | CABPVU010000007.1 | GCA902461075_00786 | CDS | open | 90664-93036 | _na 790_aa | Beta-galactosidase | |
| 1506 | CABPVU010000007.1 | GCA902461075_00787 | CDS | open | 93105-95558 | _na 817_aa | Glycosyl hydrolase family 2%2C sugar binding domain protein | |
| 1507 | CABPVU010000007.1 | GCA902461075_00788 | CDS | open | 95555-96676 | _na 373_aa | Glycosyl hydrolase%2C family 88 | |
| 1508 | CABPVU010000007.1 | GCA902461075_00789 | CDS | open | 97048-97152 | _na 34_aa | hypothetical protein | |
| 1509 | CABPVU010000007.1 | GCA902461075_00790 | CDS | open | 97486-99546 | _na 686_aa | metG | methionine--tRNA ligase |
| 1510 | CABPVU010000007.1 | GCA902461075_00791 | CDS | open | 99632-100981 | _na 449_aa | Mg chelatase-like protein | |
| 1511 | CABPVU010000007.1 | GCA902461075_00720 | gene | open | 957-1625 | |||
| 1512 | CABPVU010000007.1 | GCA902461075_00721 | gene | open | 1774-2004 | |||
| 1513 | CABPVU010000007.1 | GCA902461075_00722 | gene | open | 2425-3453 | |||
| 1514 | CABPVU010000007.1 | GCA902461075_00723 | gene | open | 3539-5374 | |||
| 1515 | CABPVU010000007.1 | GCA902461075_00724 | gene | open | 5371-5838 | asnC | ||
| 1516 | CABPVU010000007.1 | GCA902461075_00725 | gene | open | 6010-6867 | |||
| 1517 | CABPVU010000007.1 | GCA902461075_00726 | gene | open | 6935-7807 | |||
| 1518 | CABPVU010000007.1 | GCA902461075_00727 | gene | open | 7936-8517 | |||
| 1519 | CABPVU010000007.1 | GCA902461075_00728 | gene | open | 8819-9520 | |||
| 1520 | CABPVU010000007.1 | GCA902461075_00729 | gene | open | 10206-10544 | |||
| 1521 | CABPVU010000007.1 | GCA902461075_00730 | gene | open | 10622-11128 | |||
| 1522 | CABPVU010000007.1 | GCA902461075_00731 | gene | open | 11313-11402 | |||
| 1523 | CABPVU010000007.1 | GCA902461075_00732 | gene | open | 11636-12964 | |||
| 1524 | CABPVU010000007.1 | GCA902461075_00733 | gene | open | 12986-13684 | |||
| 1525 | CABPVU010000007.1 | GCA902461075_00734 | gene | open | 13742-14503 | |||
| 1526 | CABPVU010000007.1 | GCA902461075_00735 | gene | open | 14528-17146 | |||
| 1527 | CABPVU010000007.1 | GCA902461075_00736 | gene | open | 17295-17846 | |||
| 1528 | CABPVU010000007.1 | GCA902461075_00737 | gene | open | 17946-18431 | |||
| 1529 | CABPVU010000007.1 | GCA902461075_00738 | gene | open | 18569-19075 | |||
| 1530 | CABPVU010000007.1 | GCA902461075_00739 | gene | open | 19134-19970 | murI | ||
| 1531 | CABPVU010000007.1 | GCA902461075_00740 | gene | open | 19983-20321 | rbfA | ||
| 1532 | CABPVU010000007.1 | GCA902461075_00741 | gene | open | 20481-21794 | |||
| 1533 | CABPVU010000007.1 | GCA902461075_00743 | gene | open | 22655-23455 | |||
| 1534 | CABPVU010000007.1 | GCA902461075_00744 | gene | open | 23760-26771 | secDF | ||
| 1535 | CABPVU010000007.1 | GCA902461075_00745 | gene | open | 26888-27985 | |||
| 1536 | CABPVU010000007.1 | GCA902461075_00746 | gene | open | 28000-28944 | aarA | ||
| 1537 | CABPVU010000007.1 | GCA902461075_00747 | gene | open | 29147-29422 | |||
| 1538 | CABPVU010000007.1 | GCA902461075_00748 | gene | open | 29795-30610 | |||
| 1539 | CABPVU010000007.1 | GCA902461075_00749 | gene | open | 30700-31545 | kduI | ||
| 1540 | CABPVU010000007.1 | GCA902461075_00750 | gene | open | 31672-32934 | |||
| 1541 | CABPVU010000007.1 | GCA902461075_00752 | gene | open | 33208-34500 | tyrS | ||
| 1542 | CABPVU010000007.1 | GCA902461075_00753 | gene | open | 34563-34802 | yidD | ||
| 1543 | CABPVU010000007.1 | GCA902461075_00754 | gene | open | 34799-35293 | rnpA | ||
| 1544 | CABPVU010000007.1 | GCA902461075_00755 | gene | open | 35327-36076 | |||
| 1545 | CABPVU010000007.1 | GCA902461075_00756 | gene | open | 36084-37106 | |||
| 1546 | CABPVU010000007.1 | GCA902461075_00757 | gene | open | 37109-38383 | metK | ||
| 1547 | CABPVU010000007.1 | GCA902461075_00758 | gene | open | 38896-41724 | |||
| 1548 | CABPVU010000007.1 | GCA902461075_00759 | gene | open | 41803-41997 | |||
| 1549 | CABPVU010000007.1 | GCA902461075_00760 | gene | open | 42033-45266 | |||
| 1550 | CABPVU010000007.1 | GCA902461075_00761 | gene | open | 45711-46370 | upp | ||
| 1551 | CABPVU010000007.1 | GCA902461075_00762 | gene | open | 46814-48427 | pckA | ||
| 1552 | CABPVU010000007.1 | GCA902461075_00763 | gene | open | 49372-50376 | |||
| 1553 | CABPVU010000007.1 | GCA902461075_00764 | gene | open | 50388-52289 | |||
| 1554 | CABPVU010000007.1 | GCA902461075_00765 | gene | open | 52564-54225 | |||
| 1555 | CABPVU010000007.1 | GCA902461075_00766 | gene | open | 54306-56015 | |||
| 1556 | CABPVU010000007.1 | GCA902461075_00767 | gene | open | 56128-57849 | |||
| 1557 | CABPVU010000007.1 | GCA902461075_00768 | gene | open | 58774-63333 | |||
| 1558 | CABPVU010000007.1 | GCA902461075_00769 | gene | open | 63338-64384 | |||
| 1559 | CABPVU010000007.1 | GCA902461075_00770 | gene | open | 64532-66730 | |||
| 1560 | CABPVU010000007.1 | GCA902461075_00771 | gene | open | 67196-68134 | |||
| 1561 | CABPVU010000007.1 | GCA902461075_00772 | gene | open | 68263-69216 | |||
| 1562 | CABPVU010000007.1 | GCA902461075_00773 | gene | open | 69280-69978 | |||
| 1563 | CABPVU010000007.1 | GCA902461075_00774 | gene | open | 69975-70397 | aroQ | ||
| 1564 | CABPVU010000007.1 | GCA902461075_00775 | gene | open | 70518-71432 | xerA | ||
| 1565 | CABPVU010000007.1 | GCA902461075_00776 | gene | open | 71972-72763 | |||
| 1566 | CABPVU010000007.1 | GCA902461075_00777 | gene | open | 73130-76297 | |||
| 1567 | CABPVU010000007.1 | GCA902461075_00778 | gene | open | 76317-78332 | susD | ||
| 1568 | CABPVU010000007.1 | GCA902461075_00779 | gene | open | 78402-81398 | |||
| 1569 | CABPVU010000007.1 | GCA902461075_00780 | gene | open | 81424-83181 | susD | ||
| 1570 | CABPVU010000007.1 | GCA902461075_00781 | gene | open | 83259-84704 | |||
| 1571 | CABPVU010000007.1 | GCA902461075_00782 | gene | open | 84767-86611 | yesW | ||
| 1572 | CABPVU010000007.1 | GCA902461075_00783 | gene | open | 87415-89031 | rhgT | ||
| 1573 | CABPVU010000007.1 | GCA902461075_00784 | gene | open | 89058-89375 | rhaM | ||
| 1574 | CABPVU010000007.1 | GCA902461075_00785 | gene | open | 89416-90651 | |||
| 1575 | CABPVU010000007.1 | GCA902461075_00786 | gene | open | 90664-93036 | |||
| 1576 | CABPVU010000007.1 | GCA902461075_00787 | gene | open | 93105-95558 | |||
| 1577 | CABPVU010000007.1 | GCA902461075_00788 | gene | open | 95555-96676 | |||
| 1578 | CABPVU010000007.1 | GCA902461075_00789 | gene | open | 97048-97152 | |||
| 1579 | CABPVU010000007.1 | GCA902461075_00790 | gene | open | 97486-99546 | metG | ||
| 1580 | CABPVU010000007.1 | GCA902461075_00791 | gene | open | 99632-100981 | |||
| 1581 | CABPVU010000007.1 | GCA902461075_00742 | gene | open | 22513-22584 | trnR | ||
| 1582 | CABPVU010000007.1 | GCA902461075_00751 | gene | open | 33073-33143 | trnQ | ||
| 1583 | CABPVU010000007.1 | GCA902461075_00742 | tRNA | open | 22513-22584 | trnR | tRNA-Arg(cct) | |
| 1584 | CABPVU010000007.1 | GCA902461075_00751 | tRNA | open | 33073-33143 | trnQ | tRNA-Gln(ttg) | |
| 1585 | CABPVU010000008.1 | GCA902461075_00792 | CDS | open | 4-375 | _na 123_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 1586 | CABPVU010000008.1 | GCA902461075_00793 | CDS | open | 969-2786 | _na 605_aa | RNA helicase | |
| 1587 | CABPVU010000008.1 | GCA902461075_00794 | CDS | open | 2915-5041 | _na 708_aa | Dipeptidyl-peptidase | |
| 1588 | CABPVU010000008.1 | GCA902461075_00795 | CDS | open | 5070-6563 | _na 497_aa | Polysaccharide biosynthesis protein | |
| 1589 | CABPVU010000008.1 | GCA902461075_00796 | CDS | open | 6764-7993 | _na 409_aa | Spore maturation protein A | |
| 1590 | CABPVU010000008.1 | GCA902461075_00798 | CDS | open | 8788-9708 | _na 306_aa | bifunctional riboflavin kinase/FAD synthetase | |
| 1591 | CABPVU010000008.1 | GCA902461075_00799 | CDS | open | 9701-10534 | _na 277_aa | CAAX amino terminal protease family protein | |
| 1592 | CABPVU010000008.1 | GCA902461075_00800 | CDS | open | 10749-11231 | _na 160_aa | Pyruvate ferredoxin oxidoreductase | |
| 1593 | CABPVU010000008.1 | GCA902461075_00801 | CDS | open | 11221-11733 | _na 170_aa | Sigma-70 region 2 | |
| 1594 | CABPVU010000008.1 | GCA902461075_00802 | CDS | open | 12101-12946 | _na 281_aa | Acetylglutamate kinase | |
| 1595 | CABPVU010000008.1 | GCA902461075_00803 | CDS | open | 13014-14906 | _na 630_aa | speA | biosynthetic arginine decarboxylase |
| 1596 | CABPVU010000008.1 | GCA902461075_00804 | CDS | open | 14903-15430 | _na 175_aa | shikimate kinase | |
| 1597 | CABPVU010000008.1 | GCA902461075_00805 | CDS | open | 15427-17760 | _na 777_aa | topA | type I DNA topoisomerase |
| 1598 | CABPVU010000008.1 | GCA902461075_00806 | CDS | open | 17845-18390 | _na 181_aa | NADH pyrophosphatase | |
| 1599 | CABPVU010000008.1 | GCA902461075_00807 | CDS | open | 18406-19830 | _na 474_aa | Sialate O-acetylesterase domain-containing protein | |
| 1600 | CABPVU010000008.1 | GCA902461075_00808 | CDS | open | 19953-20105 | _na 50_aa | hypothetical protein | |
| 1601 | CABPVU010000008.1 | GCA902461075_00809 | CDS | open | 20167-21333 | _na 388_aa | Antioxidant%2C AhpC/TSA family | |
| 1602 | CABPVU010000008.1 | GCA902461075_00810 | CDS | open | 21528-23870 | _na 780_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 1603 | CABPVU010000008.1 | GCA902461075_00811 | CDS | open | 24025-24570 | _na 181_aa | 2-oxoacid:ferredoxin/flavodoxin oxidoreductase%2C gamma subunit | |
| 1604 | CABPVU010000008.1 | GCA902461075_00812 | CDS | open | 24567-25385 | _na 272_aa | Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain protein | |
| 1605 | CABPVU010000008.1 | GCA902461075_00813 | CDS | open | 25418-26500 | _na 360_aa | Pyruvate flavodoxin/ferredoxin oxidoreductase%2C thiamine diP-binding domain protein | |
| 1606 | CABPVU010000008.1 | GCA902461075_00814 | CDS | open | 26525-26752 | _na 75_aa | 4Fe-4S binding domain protein | |
| 1607 | CABPVU010000008.1 | GCA902461075_00815 | CDS | open | 26782-26961 | _na 59_aa | Tetratricopeptide repeat protein | |
| 1608 | CABPVU010000008.1 | GCA902461075_00816 | CDS | open | 27258-28346 | _na 362_aa | bifunctional methionine sulfoxide reductase B/A protein | |
| 1609 | CABPVU010000008.1 | GCA902461075_00817 | CDS | open | 28455-28823 | _na 122_aa | yccF | YccF domain-containing protein |
| 1610 | CABPVU010000008.1 | GCA902461075_00818 | CDS | open | 29595-30968 | _na 457_aa | Leucine Rich Repeat protein | |
| 1611 | CABPVU010000008.1 | GCA902461075_00819 | CDS | open | 31297-32985 | _na 562_aa | Sigma-24 | |
| 1612 | CABPVU010000008.1 | GCA902461075_00820 | CDS | open | 33086-34153 | _na 355_aa | Radical SAM domain protein | |
| 1613 | CABPVU010000008.1 | GCA902461075_00821 | CDS | open | 34169-35257 | _na 362_aa | yhhX | putative oxidoreductase yhhX |
| 1614 | CABPVU010000008.1 | GCA902461075_00822 | CDS | open | 35313-35846 | _na 177_aa | Lipoprotein | |
| 1615 | CABPVU010000008.1 | GCA902461075_00824 | CDS | open | 36376-38037 | _na 553_aa | ctpB | Carboxy-terminal processing protease CtpB |
| 1616 | CABPVU010000008.1 | GCA902461075_00825 | CDS | open | 38508-40238 | _na 576_aa | M6 family metalloprotease domain protein | |
| 1617 | CABPVU010000008.1 | GCA902461075_00826 | CDS | open | 40533-41687 | _na 384_aa | BACON domain-containing protein | |
| 1618 | CABPVU010000008.1 | GCA902461075_00827 | CDS | open | 41701-43314 | _na 537_aa | BACON domain-containing protein | |
| 1619 | CABPVU010000008.1 | GCA902461075_00828 | CDS | open | 43330-44238 | _na 302_aa | Substrate import-associated zinc metallohydrolase lipoprotein | |
| 1620 | CABPVU010000008.1 | GCA902461075_00829 | CDS | open | 44268-45854 | _na 528_aa | SusD-like N-terminal domain-containing protein | |
| 1621 | CABPVU010000008.1 | GCA902461075_00830 | CDS | open | 45873-49190 | _na 1105_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 1622 | CABPVU010000008.1 | GCA902461075_00831 | CDS | open | 49980-50429 | _na 149_aa | thioredoxin-dependent peroxiredoxin | |
| 1623 | CABPVU010000008.1 | GCA902461075_00832 | CDS | open | 50674-51888 | _na 404_aa | GDSL-like protein | |
| 1624 | CABPVU010000008.1 | GCA902461075_00833 | CDS | open | 52185-52652 | _na 155_aa | rimP | ribosome assembly cofactor RimP |
| 1625 | CABPVU010000008.1 | GCA902461075_00834 | CDS | open | 52657-53922 | _na 421_aa | nusA | Transcription termination/antitermination protein NusA |
| 1626 | CABPVU010000008.1 | GCA902461075_00835 | CDS | open | 54076-56967 | _na 963_aa | infB | translation initiation factor IF-2 |
| 1627 | CABPVU010000008.1 | GCA902461075_00836 | CDS | open | 57203-58651 | _na 482_aa | sufB | Fe-S cluster assembly protein SufB |
| 1628 | CABPVU010000008.1 | GCA902461075_00837 | CDS | open | 58796-59551 | _na 251_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 1629 | CABPVU010000008.1 | GCA902461075_00838 | CDS | open | 59556-60899 | _na 447_aa | sufD | Fe-S cluster assembly protein SufD |
| 1630 | CABPVU010000008.1 | GCA902461075_00839 | CDS | open | 61007-62287 | _na 426_aa | Cysteine desulfurase | |
| 1631 | CABPVU010000008.1 | GCA902461075_00840 | CDS | open | 62390-62698 | _na 102_aa | hypothetical protein | |
| 1632 | CABPVU010000008.1 | GCA902461075_00841 | CDS | open | 62839-63444 | _na 201_aa | ribonuclease HII | |
| 1633 | CABPVU010000008.1 | GCA902461075_00842 | CDS | open | 63645-64535 | _na 296_aa | HTH domain protein | |
| 1634 | CABPVU010000008.1 | GCA902461075_00843 | CDS | open | 64902-65849 | _na 315_aa | Transposase IS200-like domain-containing protein | |
| 1635 | CABPVU010000008.1 | GCA902461075_00844 | CDS | open | 66008-66844 | _na 278_aa | DUF1735 domain-containing protein | |
| 1636 | CABPVU010000008.1 | GCA902461075_00845 | CDS | open | 66878-68536 | _na 552_aa | RagB/SusD family nutrient uptake outer membrane protein | |
| 1637 | CABPVU010000008.1 | GCA902461075_00846 | CDS | open | 68565-71804 | _na 1079_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 1638 | CABPVU010000008.1 | GCA902461075_00847 | CDS | open | 72851-74809 | _na 652_aa | susD | SusD family protein |
| 1639 | CABPVU010000008.1 | GCA902461075_00848 | CDS | open | 74980-78087 | _na 1035_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 1640 | CABPVU010000008.1 | GCA902461075_00849 | CDS | open | 78400-80073 | _na 557_aa | Glycosyl hydrolase family 35 | |
| 1641 | CABPVU010000008.1 | GCA902461075_00850 | CDS | open | 80130-82157 | _na 675_aa | Glycosyl hydrolase family 67 middle domain protein | |
| 1642 | CABPVU010000008.1 | GCA902461075_00851 | CDS | open | 82231-85653 | _na 1140_aa | histidine kinase | |
| 1643 | CABPVU010000008.1 | GCA902461075_00792 | gene | open | 4-375 | |||
| 1644 | CABPVU010000008.1 | GCA902461075_00793 | gene | open | 969-2786 | |||
| 1645 | CABPVU010000008.1 | GCA902461075_00794 | gene | open | 2915-5041 | |||
| 1646 | CABPVU010000008.1 | GCA902461075_00795 | gene | open | 5070-6563 | |||
| 1647 | CABPVU010000008.1 | GCA902461075_00796 | gene | open | 6764-7993 | |||
| 1648 | CABPVU010000008.1 | GCA902461075_00798 | gene | open | 8788-9708 | |||
| 1649 | CABPVU010000008.1 | GCA902461075_00799 | gene | open | 9701-10534 | |||
| 1650 | CABPVU010000008.1 | GCA902461075_00800 | gene | open | 10749-11231 | |||
| 1651 | CABPVU010000008.1 | GCA902461075_00801 | gene | open | 11221-11733 | |||
| 1652 | CABPVU010000008.1 | GCA902461075_00802 | gene | open | 12101-12946 | |||
| 1653 | CABPVU010000008.1 | GCA902461075_00803 | gene | open | 13014-14906 | speA | ||
| 1654 | CABPVU010000008.1 | GCA902461075_00804 | gene | open | 14903-15430 | |||
| 1655 | CABPVU010000008.1 | GCA902461075_00805 | gene | open | 15427-17760 | topA | ||
| 1656 | CABPVU010000008.1 | GCA902461075_00806 | gene | open | 17845-18390 | |||
| 1657 | CABPVU010000008.1 | GCA902461075_00807 | gene | open | 18406-19830 | |||
| 1658 | CABPVU010000008.1 | GCA902461075_00808 | gene | open | 19953-20105 | |||
| 1659 | CABPVU010000008.1 | GCA902461075_00809 | gene | open | 20167-21333 | |||
| 1660 | CABPVU010000008.1 | GCA902461075_00810 | gene | open | 21528-23870 | pnp | ||
| 1661 | CABPVU010000008.1 | GCA902461075_00811 | gene | open | 24025-24570 | |||
| 1662 | CABPVU010000008.1 | GCA902461075_00812 | gene | open | 24567-25385 | |||
| 1663 | CABPVU010000008.1 | GCA902461075_00813 | gene | open | 25418-26500 | |||
| 1664 | CABPVU010000008.1 | GCA902461075_00814 | gene | open | 26525-26752 | |||
| 1665 | CABPVU010000008.1 | GCA902461075_00815 | gene | open | 26782-26961 | |||
| 1666 | CABPVU010000008.1 | GCA902461075_00816 | gene | open | 27258-28346 | |||
| 1667 | CABPVU010000008.1 | GCA902461075_00817 | gene | open | 28455-28823 | yccF | ||
| 1668 | CABPVU010000008.1 | GCA902461075_00818 | gene | open | 29595-30968 | |||
| 1669 | CABPVU010000008.1 | GCA902461075_00819 | gene | open | 31297-32985 | |||
| 1670 | CABPVU010000008.1 | GCA902461075_00820 | gene | open | 33086-34153 | |||
| 1671 | CABPVU010000008.1 | GCA902461075_00821 | gene | open | 34169-35257 | yhhX | ||
| 1672 | CABPVU010000008.1 | GCA902461075_00822 | gene | open | 35313-35846 | |||
| 1673 | CABPVU010000008.1 | GCA902461075_00824 | gene | open | 36376-38037 | ctpB | ||
| 1674 | CABPVU010000008.1 | GCA902461075_00825 | gene | open | 38508-40238 | |||
| 1675 | CABPVU010000008.1 | GCA902461075_00826 | gene | open | 40533-41687 | |||
| 1676 | CABPVU010000008.1 | GCA902461075_00827 | gene | open | 41701-43314 | |||
| 1677 | CABPVU010000008.1 | GCA902461075_00828 | gene | open | 43330-44238 | |||
| 1678 | CABPVU010000008.1 | GCA902461075_00829 | gene | open | 44268-45854 | |||
| 1679 | CABPVU010000008.1 | GCA902461075_00830 | gene | open | 45873-49190 | |||
| 1680 | CABPVU010000008.1 | GCA902461075_00831 | gene | open | 49980-50429 | |||
| 1681 | CABPVU010000008.1 | GCA902461075_00832 | gene | open | 50674-51888 | |||
| 1682 | CABPVU010000008.1 | GCA902461075_00833 | gene | open | 52185-52652 | rimP | ||
| 1683 | CABPVU010000008.1 | GCA902461075_00834 | gene | open | 52657-53922 | nusA | ||
| 1684 | CABPVU010000008.1 | GCA902461075_00835 | gene | open | 54076-56967 | infB | ||
| 1685 | CABPVU010000008.1 | GCA902461075_00836 | gene | open | 57203-58651 | sufB | ||
| 1686 | CABPVU010000008.1 | GCA902461075_00837 | gene | open | 58796-59551 | sufC | ||
| 1687 | CABPVU010000008.1 | GCA902461075_00838 | gene | open | 59556-60899 | sufD | ||
| 1688 | CABPVU010000008.1 | GCA902461075_00839 | gene | open | 61007-62287 | |||
| 1689 | CABPVU010000008.1 | GCA902461075_00840 | gene | open | 62390-62698 | |||
| 1690 | CABPVU010000008.1 | GCA902461075_00841 | gene | open | 62839-63444 | |||
| 1691 | CABPVU010000008.1 | GCA902461075_00842 | gene | open | 63645-64535 | |||
| 1692 | CABPVU010000008.1 | GCA902461075_00843 | gene | open | 64902-65849 | |||
| 1693 | CABPVU010000008.1 | GCA902461075_00844 | gene | open | 66008-66844 | |||
| 1694 | CABPVU010000008.1 | GCA902461075_00845 | gene | open | 66878-68536 | |||
| 1695 | CABPVU010000008.1 | GCA902461075_00846 | gene | open | 68565-71804 | |||
| 1696 | CABPVU010000008.1 | GCA902461075_00847 | gene | open | 72851-74809 | susD | ||
| 1697 | CABPVU010000008.1 | GCA902461075_00848 | gene | open | 74980-78087 | |||
| 1698 | CABPVU010000008.1 | GCA902461075_00849 | gene | open | 78400-80073 | |||
| 1699 | CABPVU010000008.1 | GCA902461075_00850 | gene | open | 80130-82157 | |||
| 1700 | CABPVU010000008.1 | GCA902461075_00851 | gene | open | 82231-85653 | |||
| 1701 | CABPVU010000008.1 | GCA902461075_00797 | gene | open | 8403-8476 | trnI | ||
| 1702 | CABPVU010000008.1 | GCA902461075_00823 | gene | open | 36058-36131 | trnN | ||
| 1703 | CABPVU010000008.1 | GCA902461075_00797 | tRNA | open | 8403-8476 | trnI | tRNA-Ile2(cat) | |
| 1704 | CABPVU010000008.1 | GCA902461075_00823 | tRNA | open | 36058-36131 | trnN | tRNA-Asn(gtt) | |
| 1705 | CABPVU010000009.1 | repeat_region | open | 43174-44009 | CRISPR array with 13 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTTCAAAAAGAAGGCAGATGCAAC and spacer length 29 | |||
| 1706 | CABPVU010000009.1 | GCA902461075_00852 | CDS | open | 349-762 | _na 137_aa | DUF3127 domain-containing protein | |
| 1707 | CABPVU010000009.1 | GCA902461075_00853 | CDS | open | 951-2075 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 1708 | CABPVU010000009.1 | GCA902461075_00854 | CDS | open | 2157-3011 | _na 284_aa | DNA polymerase III polC-type | |
| 1709 | CABPVU010000009.1 | GCA902461075_00855 | CDS | open | 3012-4274 | _na 420_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 1710 | CABPVU010000009.1 | GCA902461075_00856 | CDS | open | 4325-5245 | _na 306_aa | DUF4835 domain-containing protein | |
| 1711 | CABPVU010000009.1 | GCA902461075_00857 | CDS | open | 5249-6913 | _na 554_aa | recN | DNA repair protein RecN |
| 1712 | CABPVU010000009.1 | GCA902461075_00858 | CDS | open | 6982-8691 | _na 569_aa | putative O-linked N-acetylglucosamine transferase%2C SPINDLY family | |
| 1713 | CABPVU010000009.1 | GCA902461075_00861 | CDS | open | 9353-10516 | _na 387_aa | AI-2E family transporter | |
| 1714 | CABPVU010000009.1 | GCA902461075_00862 | CDS | open | 10491-11096 | _na 201_aa | thymidine kinase | |
| 1715 | CABPVU010000009.1 | GCA902461075_00863 | CDS | open | 11164-11883 | _na 239_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 1716 | CABPVU010000009.1 | GCA902461075_00864 | CDS | open | 11894-12748 | _na 284_aa | Lipoprotein | |
| 1717 | CABPVU010000009.1 | GCA902461075_00865 | CDS | open | 12857-13141 | _na 94_aa | hypothetical protein | |
| 1718 | CABPVU010000009.1 | GCA902461075_00866 | CDS | open | 13255-13599 | _na 114_aa | tRNA-specific adenosine deaminase | |
| 1719 | CABPVU010000009.1 | GCA902461075_00867 | CDS | open | 13602-14630 | _na 342_aa | Adhesin domain-containing protein | |
| 1720 | CABPVU010000009.1 | GCA902461075_00868 | CDS | open | 14649-15434 | _na 261_aa | hypothetical protein | |
| 1721 | CABPVU010000009.1 | GCA902461075_00869 | CDS | open | 15427-16170 | _na 247_aa | Fluoroquinolones export ATP-binding protein Rv2688c/MT2762 | |
| 1722 | CABPVU010000009.1 | GCA902461075_00870 | CDS | open | 16311-16688 | _na 125_aa | yraN | YraN family protein |
| 1723 | CABPVU010000009.1 | GCA902461075_00871 | CDS | open | 16705-17439 | _na 244_aa | Biotin--[acetyl-CoA-carboxylase] ligase | |
| 1724 | CABPVU010000009.1 | GCA902461075_00872 | CDS | open | 17534-18196 | _na 220_aa | pyrH | UMP kinase |
| 1725 | CABPVU010000009.1 | GCA902461075_00873 | CDS | open | 18432-18827 | _na 131_aa | GxxExxY protein | |
| 1726 | CABPVU010000009.1 | GCA902461075_00874 | CDS | open | 19090-19332 | _na 80_aa | DUF4834 domain-containing protein | |
| 1727 | CABPVU010000009.1 | GCA902461075_00875 | CDS | open | 19329-20081 | _na 250_aa | Putative CDP-diacylglycerol-serine O-phosphatidyltransferase | |
| 1728 | CABPVU010000009.1 | GCA902461075_00876 | CDS | open | 20153-20845 | _na 230_aa | phosphatidylserine decarboxylase family protein | |
| 1729 | CABPVU010000009.1 | GCA902461075_00877 | CDS | open | 20984-24706 | _na 1240_aa | dnaE | DNA polymerase III subunit alpha |
| 1730 | CABPVU010000009.1 | GCA902461075_00878 | CDS | open | 24796-25110 | _na 104_aa | trxA | thioredoxin |
| 1731 | CABPVU010000009.1 | GCA902461075_00879 | CDS | open | 25241-25654 | _na 137_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 1732 | CABPVU010000009.1 | GCA902461075_00880 | CDS | open | 25659-27266 | _na 535_aa | Staphylococcal respiratory response protein A | |
| 1733 | CABPVU010000009.1 | GCA902461075_00881 | CDS | open | 27270-30602 | _na 1110_aa | Tetratricopeptide repeat protein | |
| 1734 | CABPVU010000009.1 | GCA902461075_00882 | CDS | open | 30583-31413 | _na 276_aa | znuB | High-affinity zinc uptake system membrane protein znuB |
| 1735 | CABPVU010000009.1 | GCA902461075_00883 | CDS | open | 31410-31796 | _na 128_aa | Phospholipase | |
| 1736 | CABPVU010000009.1 | GCA902461075_00884 | CDS | open | 31793-33040 | _na 415_aa | 3-phosphoshikimate 1-carboxyvinyltransferase | |
| 1737 | CABPVU010000009.1 | GCA902461075_00885 | CDS | open | 33062-34240 | _na 392_aa | zinc-dependent metalloproteinase lipoprotein | |
| 1738 | CABPVU010000009.1 | GCA902461075_00887 | CDS | open | 35284-36618 | _na 444_aa | Neuraminidase | |
| 1739 | CABPVU010000009.1 | GCA902461075_00888 | CDS | open | 36637-38505 | _na 622_aa | mutS | MutS domain V protein |
| 1740 | CABPVU010000009.1 | GCA902461075_00889 | CDS | open | 38712-39068 | _na 118_aa | Uroporphyrinogen-III C-methyltransferase | |
| 1741 | CABPVU010000009.1 | GCA902461075_00890 | CDS | open | 39084-40391 | _na 435_aa | eno | phosphopyruvate hydratase |
| 1742 | CABPVU010000009.1 | GCA902461075_00891 | CDS | open | 40554-41333 | _na 259_aa | Metal cation transporter%2C ZIP family | |
| 1743 | CABPVU010000009.1 | GCA902461075_00892 | CDS | open | 41576-42655 | _na 359_aa | terC | Integral membrane protein%2C TerC family |
| 1744 | CABPVU010000009.1 | GCA902461075_00893 | CDS | open | 44074-44598 | _na 174_aa | csx28 | CRISPR-associated protein Csx28 |
| 1745 | CABPVU010000009.1 | GCA902461075_00894 | CDS | open | 44611-47919 | _na 1102_aa | cas13b | type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b |
| 1746 | CABPVU010000009.1 | GCA902461075_00895 | CDS | open | 48374-51097 | _na 907_aa | Streptopain | |
| 1747 | CABPVU010000009.1 | GCA902461075_00896 | CDS | open | 51226-51495 | _na 89_aa | hypothetical protein | |
| 1748 | CABPVU010000009.1 | GCA902461075_00897 | CDS | open | 51780-52205 | _na 141_aa | Lipocalin-like domain-containing protein | |
| 1749 | CABPVU010000009.1 | GCA902461075_00898 | CDS | open | 52793-53287 | _na 164_aa | DUF4251 domain-containing protein | |
| 1750 | CABPVU010000009.1 | GCA902461075_00899 | CDS | open | 53284-54435 | _na 383_aa | tonB | TonB family domain protein |
| 1751 | CABPVU010000009.1 | GCA902461075_00900 | CDS | open | 54955-55446 | _na 163_aa | MORN repeat protein | |
| 1752 | CABPVU010000009.1 | GCA902461075_00901 | CDS | open | 55481-55603 | _na 40_aa | hypothetical protein | |
| 1753 | CABPVU010000009.1 | GCA902461075_00902 | CDS | open | 55600-56349 | _na 249_aa | exodeoxyribonuclease III | |
| 1754 | CABPVU010000009.1 | GCA902461075_00903 | CDS | open | 56510-57166 | _na 218_aa | folE | GTP cyclohydrolase I FolE |
| 1755 | CABPVU010000009.1 | GCA902461075_00904 | CDS | open | 57244-57930 | _na 228_aa | Sporulation and cell division repeat protein | |
| 1756 | CABPVU010000009.1 | GCA902461075_00905 | CDS | open | 57999-60077 | _na 692_aa | tpiA | triose-phosphate isomerase |
| 1757 | CABPVU010000009.1 | GCA902461075_00906 | CDS | open | 60074-60682 | _na 202_aa | Nucleotide modification associated domain-containing protein | |
| 1758 | CABPVU010000009.1 | GCA902461075_00907 | CDS | open | 60854-62221 | _na 455_aa | HDIG domain protein | |
| 1759 | CABPVU010000009.1 | GCA902461075_00908 | CDS | open | 63187-64374 | _na 395_aa | ttgA | putative efflux pump periplasmic linker ttgA |
| 1760 | CABPVU010000009.1 | GCA902461075_00909 | CDS | open | 64412-67672 | _na 1086_aa | RND transporter%2C HAE1 family | |
| 1761 | CABPVU010000009.1 | GCA902461075_00910 | CDS | open | 67677-69065 | _na 462_aa | cusC | Cation efflux system protein CusC |
| 1762 | CABPVU010000009.1 | GCA902461075_00911 | CDS | open | 69094-69876 | _na 260_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 1763 | CABPVU010000009.1 | GCA902461075_00912 | CDS | open | 70550-71344 | _na 264_aa | Radical SAM domain protein | |
| 1764 | CABPVU010000009.1 | GCA902461075_00913 | CDS | open | 71550-72389 | _na 279_aa | ftsX | Cell division protein FtsX |
| 1765 | CABPVU010000009.1 | GCA902461075_00914 | CDS | open | 72392-72631 | _na 79_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 1766 | CABPVU010000009.1 | GCA902461075_00915 | CDS | open | 72628-73491 | _na 287_aa | undecaprenyl-diphosphate phosphatase | |
| 1767 | CABPVU010000009.1 | GCA902461075_00916 | CDS | open | 73491-74198 | _na 235_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 1768 | CABPVU010000009.1 | GCA902461075_00917 | CDS | open | 74224-75405 | _na 393_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 1769 | CABPVU010000009.1 | GCA902461075_00918 | CDS | open | 75405-75818 | _na 137_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1770 | CABPVU010000009.1 | GCA902461075_00919 | CDS | open | 76034-76303 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 1771 | CABPVU010000009.1 | GCA902461075_00920 | CDS | open | 76583-78385 | _na 600_aa | typA | translational GTPase TypA |
| 1772 | CABPVU010000009.1 | GCA902461075_00921 | CDS | open | 78578-79321 | _na 247_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1773 | CABPVU010000009.1 | GCA902461075_00922 | CDS | open | 79849-80238 | _na 129_aa | S-ribosylhomocysteine lyase | |
| 1774 | CABPVU010000009.1 | GCA902461075_00852 | gene | open | 349-762 | |||
| 1775 | CABPVU010000009.1 | GCA902461075_00853 | gene | open | 951-2075 | dnaN | ||
| 1776 | CABPVU010000009.1 | GCA902461075_00854 | gene | open | 2157-3011 | |||
| 1777 | CABPVU010000009.1 | GCA902461075_00855 | gene | open | 3012-4274 | coaBC | ||
| 1778 | CABPVU010000009.1 | GCA902461075_00856 | gene | open | 4325-5245 | |||
| 1779 | CABPVU010000009.1 | GCA902461075_00857 | gene | open | 5249-6913 | recN | ||
| 1780 | CABPVU010000009.1 | GCA902461075_00858 | gene | open | 6982-8691 | |||
| 1781 | CABPVU010000009.1 | GCA902461075_00861 | gene | open | 9353-10516 | |||
| 1782 | CABPVU010000009.1 | GCA902461075_00862 | gene | open | 10491-11096 | |||
| 1783 | CABPVU010000009.1 | GCA902461075_00863 | gene | open | 11164-11883 | rsmI | ||
| 1784 | CABPVU010000009.1 | GCA902461075_00864 | gene | open | 11894-12748 | |||
| 1785 | CABPVU010000009.1 | GCA902461075_00865 | gene | open | 12857-13141 | |||
| 1786 | CABPVU010000009.1 | GCA902461075_00866 | gene | open | 13255-13599 | |||
| 1787 | CABPVU010000009.1 | GCA902461075_00867 | gene | open | 13602-14630 | |||
| 1788 | CABPVU010000009.1 | GCA902461075_00868 | gene | open | 14649-15434 | |||
| 1789 | CABPVU010000009.1 | GCA902461075_00869 | gene | open | 15427-16170 | |||
| 1790 | CABPVU010000009.1 | GCA902461075_00870 | gene | open | 16311-16688 | yraN | ||
| 1791 | CABPVU010000009.1 | GCA902461075_00871 | gene | open | 16705-17439 | |||
| 1792 | CABPVU010000009.1 | GCA902461075_00872 | gene | open | 17534-18196 | pyrH | ||
| 1793 | CABPVU010000009.1 | GCA902461075_00873 | gene | open | 18432-18827 | |||
| 1794 | CABPVU010000009.1 | GCA902461075_00874 | gene | open | 19090-19332 | |||
| 1795 | CABPVU010000009.1 | GCA902461075_00875 | gene | open | 19329-20081 | |||
| 1796 | CABPVU010000009.1 | GCA902461075_00876 | gene | open | 20153-20845 | |||
| 1797 | CABPVU010000009.1 | GCA902461075_00877 | gene | open | 20984-24706 | dnaE | ||
| 1798 | CABPVU010000009.1 | GCA902461075_00878 | gene | open | 24796-25110 | trxA | ||
| 1799 | CABPVU010000009.1 | GCA902461075_00879 | gene | open | 25241-25654 | tsaE | ||
| 1800 | CABPVU010000009.1 | GCA902461075_00880 | gene | open | 25659-27266 | |||
| 1801 | CABPVU010000009.1 | GCA902461075_00881 | gene | open | 27270-30602 | |||
| 1802 | CABPVU010000009.1 | GCA902461075_00882 | gene | open | 30583-31413 | znuB | ||
| 1803 | CABPVU010000009.1 | GCA902461075_00883 | gene | open | 31410-31796 | |||
| 1804 | CABPVU010000009.1 | GCA902461075_00884 | gene | open | 31793-33040 | |||
| 1805 | CABPVU010000009.1 | GCA902461075_00885 | gene | open | 33062-34240 | |||
| 1806 | CABPVU010000009.1 | GCA902461075_00887 | gene | open | 35284-36618 | |||
| 1807 | CABPVU010000009.1 | GCA902461075_00888 | gene | open | 36637-38505 | mutS | ||
| 1808 | CABPVU010000009.1 | GCA902461075_00889 | gene | open | 38712-39068 | |||
| 1809 | CABPVU010000009.1 | GCA902461075_00890 | gene | open | 39084-40391 | eno | ||
| 1810 | CABPVU010000009.1 | GCA902461075_00891 | gene | open | 40554-41333 | |||
| 1811 | CABPVU010000009.1 | GCA902461075_00892 | gene | open | 41576-42655 | terC | ||
| 1812 | CABPVU010000009.1 | GCA902461075_00893 | gene | open | 44074-44598 | csx28 | ||
| 1813 | CABPVU010000009.1 | GCA902461075_00894 | gene | open | 44611-47919 | cas13b | ||
| 1814 | CABPVU010000009.1 | GCA902461075_00895 | gene | open | 48374-51097 | |||
| 1815 | CABPVU010000009.1 | GCA902461075_00896 | gene | open | 51226-51495 | |||
| 1816 | CABPVU010000009.1 | GCA902461075_00897 | gene | open | 51780-52205 | |||
| 1817 | CABPVU010000009.1 | GCA902461075_00898 | gene | open | 52793-53287 | |||
| 1818 | CABPVU010000009.1 | GCA902461075_00899 | gene | open | 53284-54435 | tonB | ||
| 1819 | CABPVU010000009.1 | GCA902461075_00900 | gene | open | 54955-55446 | |||
| 1820 | CABPVU010000009.1 | GCA902461075_00901 | gene | open | 55481-55603 | |||
| 1821 | CABPVU010000009.1 | GCA902461075_00902 | gene | open | 55600-56349 | |||
| 1822 | CABPVU010000009.1 | GCA902461075_00903 | gene | open | 56510-57166 | folE | ||
| 1823 | CABPVU010000009.1 | GCA902461075_00904 | gene | open | 57244-57930 | |||
| 1824 | CABPVU010000009.1 | GCA902461075_00905 | gene | open | 57999-60077 | tpiA | ||
| 1825 | CABPVU010000009.1 | GCA902461075_00906 | gene | open | 60074-60682 | |||
| 1826 | CABPVU010000009.1 | GCA902461075_00907 | gene | open | 60854-62221 | |||
| 1827 | CABPVU010000009.1 | GCA902461075_00908 | gene | open | 63187-64374 | ttgA | ||
| 1828 | CABPVU010000009.1 | GCA902461075_00909 | gene | open | 64412-67672 | |||
| 1829 | CABPVU010000009.1 | GCA902461075_00910 | gene | open | 67677-69065 | cusC | ||
| 1830 | CABPVU010000009.1 | GCA902461075_00911 | gene | open | 69094-69876 | lpxA | ||
| 1831 | CABPVU010000009.1 | GCA902461075_00912 | gene | open | 70550-71344 | |||
| 1832 | CABPVU010000009.1 | GCA902461075_00913 | gene | open | 71550-72389 | ftsX | ||
| 1833 | CABPVU010000009.1 | GCA902461075_00914 | gene | open | 72392-72631 | |||
| 1834 | CABPVU010000009.1 | GCA902461075_00915 | gene | open | 72628-73491 | |||
| 1835 | CABPVU010000009.1 | GCA902461075_00916 | gene | open | 73491-74198 | truB | ||
| 1836 | CABPVU010000009.1 | GCA902461075_00917 | gene | open | 74224-75405 | queA | ||
| 1837 | CABPVU010000009.1 | GCA902461075_00918 | gene | open | 75405-75818 | folK | ||
| 1838 | CABPVU010000009.1 | GCA902461075_00919 | gene | open | 76034-76303 | rpsO | ||
| 1839 | CABPVU010000009.1 | GCA902461075_00920 | gene | open | 76583-78385 | typA | ||
| 1840 | CABPVU010000009.1 | GCA902461075_00921 | gene | open | 78578-79321 | |||
| 1841 | CABPVU010000009.1 | GCA902461075_00922 | gene | open | 79849-80238 | |||
| 1842 | CABPVU010000009.1 | GCA902461075_00859 | gene | open | 8850-8923 | trnR | ||
| 1843 | CABPVU010000009.1 | GCA902461075_00860 | gene | open | 9157-9229 | trnK | ||
| 1844 | CABPVU010000009.1 | GCA902461075_00886 | gene | open | 34351-34423 | trnP | ||
| 1845 | CABPVU010000009.1 | GCA902461075_00859 | tRNA | open | 8850-8923 | trnR | tRNA-Arg(tct) | |
| 1846 | CABPVU010000009.1 | GCA902461075_00860 | tRNA | open | 9157-9229 | trnK | tRNA-Lys(ttt) | |
| 1847 | CABPVU010000009.1 | GCA902461075_00886 | tRNA | open | 34351-34423 | trnP | tRNA-Pro(ggg) | |
| 1848 | CABPVU010000010.1 | GCA902461075_00923 | CDS | open | 785-1072 | _na 95_aa | Tyr recombinase domain-containing protein | |
| 1849 | CABPVU010000010.1 | GCA902461075_00924 | CDS | open | 1084-2355 | _na 423_aa | yhcG | Putative nuclease YhcG |
| 1850 | CABPVU010000010.1 | GCA902461075_00925 | CDS | open | 2454-3155 | _na 233_aa | PIN-like domain-containing protein | |
| 1851 | CABPVU010000010.1 | GCA902461075_00926 | CDS | open | 3104-3805 | _na 233_aa | DUF4935 domain-containing protein | |
| 1852 | CABPVU010000010.1 | GCA902461075_00927 | CDS | open | 3939-4598 | _na 219_aa | Mobilization protein | |
| 1853 | CABPVU010000010.1 | GCA902461075_00928 | CDS | open | 4620-5546 | _na 308_aa | relaxase/mobilization nuclease domain-containing protein | |
| 1854 | CABPVU010000010.1 | GCA902461075_00929 | CDS | open | 5543-5890 | _na 115_aa | plasmid mobilization protein | |
| 1855 | CABPVU010000010.1 | GCA902461075_00930 | CDS | open | 5993-6883 | _na 296_aa | Mobilization protein | |
| 1856 | CABPVU010000010.1 | GCA902461075_00931 | CDS | open | 7064-8116 | _na 350_aa | Mobilization protein | |
| 1857 | CABPVU010000010.1 | GCA902461075_00932 | CDS | open | 8113-8418 | _na 101_aa | DUF3853 domain-containing protein | |
| 1858 | CABPVU010000010.1 | GCA902461075_00933 | CDS | open | 9152-9514 | _na 120_aa | Toxin | |
| 1859 | CABPVU010000010.1 | GCA902461075_00934 | CDS | open | 9514-9894 | _na 126_aa | hypothetical protein | |
| 1860 | CABPVU010000010.1 | GCA902461075_00935 | CDS | open | 9907-11289 | _na 460_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 1861 | CABPVU010000010.1 | GCA902461075_00936 | CDS | open | 11300-12034 | _na 244_aa | nuclease-related domain-containing protein | |
| 1862 | CABPVU010000010.1 | GCA902461075_00937 | CDS | open | 12047-12781 | _na 244_aa | HNH endonuclease family protein | |
| 1863 | CABPVU010000010.1 | GCA902461075_00938 | CDS | open | 12934-13881 | _na 315_aa | DUF262 domain-containing protein | |
| 1864 | CABPVU010000010.1 | GCA902461075_00939 | CDS | open | 13903-14979 | _na 358_aa | HNH nuclease domain-containing protein | |
| 1865 | CABPVU010000010.1 | GCA902461075_00940 | CDS | open | 14972-16231 | _na 419_aa | Cytosine-specific methyltransferase | |
| 1866 | CABPVU010000010.1 | GCA902461075_00941 | CDS | open | 16231-17298 | _na 355_aa | Cytosine-specific methyltransferase | |
| 1867 | CABPVU010000010.1 | GCA902461075_00942 | CDS | open | 17299-17454 | _na 51_aa | hypothetical protein | |
| 1868 | CABPVU010000010.1 | GCA902461075_00943 | CDS | open | 17466-17687 | _na 73_aa | XRE family transcriptional regulator | |
| 1869 | CABPVU010000010.1 | GCA902461075_00944 | CDS | open | 17808-17957 | _na 49_aa | hypothetical protein | |
| 1870 | CABPVU010000010.1 | GCA902461075_00945 | CDS | open | 18243-19337 | _na 364_aa | xerD | Tyr recombinase domain-containing protein |
| 1871 | CABPVU010000010.1 | GCA902461075_00946 | CDS | open | 20269-23823 | _na 1184_aa | hypothetical protein | |
| 1872 | CABPVU010000010.1 | GCA902461075_00947 | CDS | open | 24512-24940 | _na 142_aa | DUF3408 domain-containing protein | |
| 1873 | CABPVU010000010.1 | GCA902461075_00948 | CDS | open | 25667-26083 | _na 138_aa | mobA | MobA protein |
| 1874 | CABPVU010000010.1 | GCA902461075_00949 | CDS | open | 26167-26493 | _na 108_aa | rteC | RteC protein |
| 1875 | CABPVU010000010.1 | GCA902461075_00950 | CDS | open | 26516-26761 | _na 81_aa | Ribosome biogenesis protein | |
| 1876 | CABPVU010000010.1 | GCA902461075_00951 | CDS | open | 26829-28139 | _na 436_aa | norM | Multidrug export protein MepA |
| 1877 | CABPVU010000010.1 | GCA902461075_00952 | CDS | open | 28236-29084 | _na 282_aa | helix-turn-helix transcriptional regulator | |
| 1878 | CABPVU010000010.1 | GCA902461075_00953 | CDS | open | 29118-29627 | _na 169_aa | HXXEE domain-containing protein | |
| 1879 | CABPVU010000010.1 | GCA902461075_00954 | CDS | open | 29665-30072 | _na 135_aa | Polyketide cyclase | |
| 1880 | CABPVU010000010.1 | GCA902461075_00955 | CDS | open | 30100-30693 | _na 197_aa | ydeA | putative protease ydeA |
| 1881 | CABPVU010000010.1 | GCA902461075_00956 | CDS | open | 30752-31735 | _na 327_aa | hypothetical protein | |
| 1882 | CABPVU010000010.1 | GCA902461075_00957 | CDS | open | 31768-32382 | _na 204_aa | DNA alkylation repair enzyme | |
| 1883 | CABPVU010000010.1 | GCA902461075_00958 | CDS | open | 32382-33053 | _na 223_aa | hypothetical protein | |
| 1884 | CABPVU010000010.1 | GCA902461075_00959 | CDS | open | 33219-34025 | _na 268_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 1885 | CABPVU010000010.1 | GCA902461075_00960 | CDS | open | 34022-34675 | _na 217_aa | CAAX amino terminal protease family protein | |
| 1886 | CABPVU010000010.1 | GCA902461075_00961 | CDS | open | 35376-35642 | _na 88_aa | IstB-like ATP-binding domain-containing protein | |
| 1887 | CABPVU010000010.1 | GCA902461075_00962 | CDS | open | 35939-36676 | _na 245_aa | Nucleotidyl transferase | |
| 1888 | CABPVU010000010.1 | GCA902461075_00963 | CDS | open | 36764-38308 | _na 514_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1889 | CABPVU010000010.1 | GCA902461075_00964 | CDS | open | 38366-38506 | _na 46_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 1890 | CABPVU010000010.1 | GCA902461075_00965 | CDS | open | 39133-39564 | _na 143_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 1891 | CABPVU010000010.1 | GCA902461075_00966 | CDS | open | 39873-40904 | _na 343_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 1892 | CABPVU010000010.1 | GCA902461075_00967 | CDS | open | 41087-42028 | _na 313_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1893 | CABPVU010000010.1 | GCA902461075_00968 | CDS | open | 42077-43006 | _na 309_aa | bmrU | Lipid kinase BmrU |
| 1894 | CABPVU010000010.1 | GCA902461075_00969 | CDS | open | 43062-43766 | _na 234_aa | Cyclic nucleotide-binding domain protein | |
| 1895 | CABPVU010000010.1 | GCA902461075_00970 | CDS | open | 44015-45961 | _na 648_aa | Putative glycogen debranching enzyme%2C archaeal type | |
| 1896 | CABPVU010000010.1 | GCA902461075_00971 | CDS | open | 45978-47246 | _na 422_aa | glycosyltransferase family 4 protein | |
| 1897 | CABPVU010000010.1 | GCA902461075_00972 | CDS | open | 47306-48751 | _na 481_aa | Glycosyl hydrolase%2C family 57 | |
| 1898 | CABPVU010000010.1 | GCA902461075_00973 | CDS | open | 49332-51077 | _na 581_aa | Pectate lyase | |
| 1899 | CABPVU010000010.1 | GCA902461075_00974 | CDS | open | 51252-54074 | _na 940_aa | Pectinesterase A | |
| 1900 | CABPVU010000010.1 | GCA902461075_00975 | CDS | open | 54339-54983 | _na 214_aa | Lipocalin-like domain-containing protein | |
| 1901 | CABPVU010000010.1 | GCA902461075_00976 | CDS | open | 55583-56194 | _na 203_aa | Lipocalin-like domain-containing protein | |
| 1902 | CABPVU010000010.1 | GCA902461075_00977 | CDS | open | 56417-57058 | _na 213_aa | Lipocalin-like domain-containing protein | |
| 1903 | CABPVU010000010.1 | GCA902461075_00978 | CDS | open | 57263-59017 | _na 584_aa | Pectate lyase | |
| 1904 | CABPVU010000010.1 | GCA902461075_00979 | CDS | open | 59099-61660 | _na 853_aa | yteR | Unsaturated rhamnogalacturonyl hydrolase YteR |
| 1905 | CABPVU010000010.1 | GCA902461075_00980 | CDS | open | 61714-62145 | _na 143_aa | hypothetical protein | |
| 1906 | CABPVU010000010.1 | GCA902461075_00981 | CDS | open | 62630-63610 | _na 326_aa | ROK family protein | |
| 1907 | CABPVU010000010.1 | GCA902461075_00982 | CDS | open | 63722-64423 | _na 233_aa | lysE | Translocator protein%2C LysE family |
| 1908 | CABPVU010000010.1 | GCA902461075_00983 | CDS | open | 64522-65073 | _na 183_aa | DUF4924 domain-containing protein | |
| 1909 | CABPVU010000010.1 | GCA902461075_00984 | CDS | open | 65109-65996 | _na 295_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 1910 | CABPVU010000010.1 | GCA902461075_00985 | CDS | open | 66010-67596 | _na 528_aa | peptide chain release factor 3 | |
| 1911 | CABPVU010000010.1 | GCA902461075_00986 | CDS | open | 67689-68225 | _na 178_aa | nusG | Transcription termination/antitermination factor NusG |
| 1912 | CABPVU010000010.1 | GCA902461075_00987 | CDS | open | 68257-68820 | _na 187_aa | Glutamine amidotransferase%2C class I | |
| 1913 | CABPVU010000010.1 | GCA902461075_00988 | CDS | open | 68948-70468 | _na 506_aa | Anthranilate synthase component 1 | |
| 1914 | CABPVU010000010.1 | GCA902461075_00989 | CDS | open | 70504-71721 | _na 405_aa | trpB | tryptophan synthase subunit beta |
| 1915 | CABPVU010000010.1 | GCA902461075_00990 | CDS | open | 71740-72516 | _na 258_aa | trpA | tryptophan synthase subunit alpha |
| 1916 | CABPVU010000010.1 | GCA902461075_00991 | CDS | open | 72538-73266 | _na 242_aa | N-(5'-phosphoribosyl)anthranilate isomerase | |
| 1917 | CABPVU010000010.1 | GCA902461075_00992 | CDS | open | 73270-74079 | _na 269_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 1918 | CABPVU010000010.1 | GCA902461075_00993 | CDS | open | 74090-75094 | _na 334_aa | Anthranilate phosphoribosyltransferase | |
| 1919 | CABPVU010000010.1 | GCA902461075_00994 | CDS | open | 75570-76166 | _na 198_aa | Sigma-70 region 2 | |
| 1920 | CABPVU010000010.1 | GCA902461075_00995 | CDS | open | 76173-76829 | _na 218_aa | rpe | ribulose-phosphate 3-epimerase |
| 1921 | CABPVU010000010.1 | GCA902461075_00996 | CDS | open | 76849-76977 | _na 42_aa | hypothetical protein | |
| 1922 | CABPVU010000010.1 | GCA902461075_00997 | CDS | open | 77126-77776 | _na 216_aa | yhcR | Endonuclease YhcR N-terminal domain-containing protein |
| 1923 | CABPVU010000010.1 | GCA902461075_00999 | CDS | open | 78365-78781 | _na 138_aa | Transglycosylase SLT domain-containing protein | |
| 1924 | CABPVU010000010.1 | GCA902461075_00923 | gene | open | 785-1072 | |||
| 1925 | CABPVU010000010.1 | GCA902461075_00924 | gene | open | 1084-2355 | yhcG | ||
| 1926 | CABPVU010000010.1 | GCA902461075_00925 | gene | open | 2454-3155 | |||
| 1927 | CABPVU010000010.1 | GCA902461075_00926 | gene | open | 3104-3805 | |||
| 1928 | CABPVU010000010.1 | GCA902461075_00927 | gene | open | 3939-4598 | |||
| 1929 | CABPVU010000010.1 | GCA902461075_00928 | gene | open | 4620-5546 | |||
| 1930 | CABPVU010000010.1 | GCA902461075_00929 | gene | open | 5543-5890 | |||
| 1931 | CABPVU010000010.1 | GCA902461075_00930 | gene | open | 5993-6883 | |||
| 1932 | CABPVU010000010.1 | GCA902461075_00931 | gene | open | 7064-8116 | |||
| 1933 | CABPVU010000010.1 | GCA902461075_00932 | gene | open | 8113-8418 | |||
| 1934 | CABPVU010000010.1 | GCA902461075_00933 | gene | open | 9152-9514 | |||
| 1935 | CABPVU010000010.1 | GCA902461075_00934 | gene | open | 9514-9894 | |||
| 1936 | CABPVU010000010.1 | GCA902461075_00935 | gene | open | 9907-11289 | |||
| 1937 | CABPVU010000010.1 | GCA902461075_00936 | gene | open | 11300-12034 | |||
| 1938 | CABPVU010000010.1 | GCA902461075_00937 | gene | open | 12047-12781 | |||
| 1939 | CABPVU010000010.1 | GCA902461075_00938 | gene | open | 12934-13881 | |||
| 1940 | CABPVU010000010.1 | GCA902461075_00939 | gene | open | 13903-14979 | |||
| 1941 | CABPVU010000010.1 | GCA902461075_00940 | gene | open | 14972-16231 | |||
| 1942 | CABPVU010000010.1 | GCA902461075_00941 | gene | open | 16231-17298 | |||
| 1943 | CABPVU010000010.1 | GCA902461075_00942 | gene | open | 17299-17454 | |||
| 1944 | CABPVU010000010.1 | GCA902461075_00943 | gene | open | 17466-17687 | |||
| 1945 | CABPVU010000010.1 | GCA902461075_00944 | gene | open | 17808-17957 | |||
| 1946 | CABPVU010000010.1 | GCA902461075_00945 | gene | open | 18243-19337 | xerD | ||
| 1947 | CABPVU010000010.1 | GCA902461075_00946 | gene | open | 20269-23823 | |||
| 1948 | CABPVU010000010.1 | GCA902461075_00947 | gene | open | 24512-24940 | |||
| 1949 | CABPVU010000010.1 | GCA902461075_00948 | gene | open | 25667-26083 | mobA | ||
| 1950 | CABPVU010000010.1 | GCA902461075_00949 | gene | open | 26167-26493 | rteC | ||
| 1951 | CABPVU010000010.1 | GCA902461075_00950 | gene | open | 26516-26761 | |||
| 1952 | CABPVU010000010.1 | GCA902461075_00951 | gene | open | 26829-28139 | norM | ||
| 1953 | CABPVU010000010.1 | GCA902461075_00952 | gene | open | 28236-29084 | |||
| 1954 | CABPVU010000010.1 | GCA902461075_00953 | gene | open | 29118-29627 | |||
| 1955 | CABPVU010000010.1 | GCA902461075_00954 | gene | open | 29665-30072 | |||
| 1956 | CABPVU010000010.1 | GCA902461075_00955 | gene | open | 30100-30693 | ydeA | ||
| 1957 | CABPVU010000010.1 | GCA902461075_00956 | gene | open | 30752-31735 | |||
| 1958 | CABPVU010000010.1 | GCA902461075_00957 | gene | open | 31768-32382 | |||
| 1959 | CABPVU010000010.1 | GCA902461075_00958 | gene | open | 32382-33053 | |||
| 1960 | CABPVU010000010.1 | GCA902461075_00959 | gene | open | 33219-34025 | |||
| 1961 | CABPVU010000010.1 | GCA902461075_00960 | gene | open | 34022-34675 | |||
| 1962 | CABPVU010000010.1 | GCA902461075_00961 | gene | open | 35376-35642 | |||
| 1963 | CABPVU010000010.1 | GCA902461075_00962 | gene | open | 35939-36676 | |||
| 1964 | CABPVU010000010.1 | GCA902461075_00963 | gene | open | 36764-38308 | guaA | ||
| 1965 | CABPVU010000010.1 | GCA902461075_00964 | gene | open | 38366-38506 | |||
| 1966 | CABPVU010000010.1 | GCA902461075_00965 | gene | open | 39133-39564 | mscL | ||
| 1967 | CABPVU010000010.1 | GCA902461075_00966 | gene | open | 39873-40904 | gap | ||
| 1968 | CABPVU010000010.1 | GCA902461075_00967 | gene | open | 41087-42028 | miaA | ||
| 1969 | CABPVU010000010.1 | GCA902461075_00968 | gene | open | 42077-43006 | bmrU | ||
| 1970 | CABPVU010000010.1 | GCA902461075_00969 | gene | open | 43062-43766 | |||
| 1971 | CABPVU010000010.1 | GCA902461075_00970 | gene | open | 44015-45961 | |||
| 1972 | CABPVU010000010.1 | GCA902461075_00971 | gene | open | 45978-47246 | |||
| 1973 | CABPVU010000010.1 | GCA902461075_00972 | gene | open | 47306-48751 | |||
| 1974 | CABPVU010000010.1 | GCA902461075_00973 | gene | open | 49332-51077 | |||
| 1975 | CABPVU010000010.1 | GCA902461075_00974 | gene | open | 51252-54074 | |||
| 1976 | CABPVU010000010.1 | GCA902461075_00975 | gene | open | 54339-54983 | |||
| 1977 | CABPVU010000010.1 | GCA902461075_00976 | gene | open | 55583-56194 | |||
| 1978 | CABPVU010000010.1 | GCA902461075_00977 | gene | open | 56417-57058 | |||
| 1979 | CABPVU010000010.1 | GCA902461075_00978 | gene | open | 57263-59017 | |||
| 1980 | CABPVU010000010.1 | GCA902461075_00979 | gene | open | 59099-61660 | yteR | ||
| 1981 | CABPVU010000010.1 | GCA902461075_00980 | gene | open | 61714-62145 | |||
| 1982 | CABPVU010000010.1 | GCA902461075_00981 | gene | open | 62630-63610 | |||
| 1983 | CABPVU010000010.1 | GCA902461075_00982 | gene | open | 63722-64423 | lysE | ||
| 1984 | CABPVU010000010.1 | GCA902461075_00983 | gene | open | 64522-65073 | |||
| 1985 | CABPVU010000010.1 | GCA902461075_00984 | gene | open | 65109-65996 | rfbD | ||
| 1986 | CABPVU010000010.1 | GCA902461075_00985 | gene | open | 66010-67596 | |||
| 1987 | CABPVU010000010.1 | GCA902461075_00986 | gene | open | 67689-68225 | nusG | ||
| 1988 | CABPVU010000010.1 | GCA902461075_00987 | gene | open | 68257-68820 | |||
| 1989 | CABPVU010000010.1 | GCA902461075_00988 | gene | open | 68948-70468 | |||
| 1990 | CABPVU010000010.1 | GCA902461075_00989 | gene | open | 70504-71721 | trpB | ||
| 1991 | CABPVU010000010.1 | GCA902461075_00990 | gene | open | 71740-72516 | trpA | ||
| 1992 | CABPVU010000010.1 | GCA902461075_00991 | gene | open | 72538-73266 | |||
| 1993 | CABPVU010000010.1 | GCA902461075_00992 | gene | open | 73270-74079 | trpC | ||
| 1994 | CABPVU010000010.1 | GCA902461075_00993 | gene | open | 74090-75094 | |||
| 1995 | CABPVU010000010.1 | GCA902461075_00994 | gene | open | 75570-76166 | |||
| 1996 | CABPVU010000010.1 | GCA902461075_00995 | gene | open | 76173-76829 | rpe | ||
| 1997 | CABPVU010000010.1 | GCA902461075_00996 | gene | open | 76849-76977 | |||
| 1998 | CABPVU010000010.1 | GCA902461075_00997 | gene | open | 77126-77776 | yhcR | ||
| 1999 | CABPVU010000010.1 | GCA902461075_00999 | gene | open | 78365-78781 | |||
| 2000 | CABPVU010000010.1 | GCA902461075_00998 | gene | open | 77983-78055 | trnfM |

