HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella denticola (GCA_902483045.1)

Select a Genome:
BAKTA Annotations for GCA_902483045.1
Genome Selected: Prevotella denticola
ContigsBases CDSrRNA tmRNAtRNA
27 2774939 2203 1 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4506 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4506 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
2501 CABTBH010000007.1 GCA902483045_01222 gene open 72862-73674
2502 CABTBH010000007.1 GCA902483045_01223 gene open 74064-74900
2503 CABTBH010000007.1 GCA902483045_01224 gene open 75122-75628
2504 CABTBH010000007.1 GCA902483045_01225 gene open 75634-76491
2505 CABTBH010000007.1 GCA902483045_01226 gene open 77050-78213
2506 CABTBH010000007.1 GCA902483045_01227 gene open 78452-79258
2507 CABTBH010000007.1 GCA902483045_01228 gene open 79261-80517
2508 CABTBH010000007.1 GCA902483045_01229 gene open 80524-82527
2509 CABTBH010000007.1 GCA902483045_01230 gene open 82747-83340
2510 CABTBH010000007.1 GCA902483045_01231 gene open 83366-83782 sufE
2511 CABTBH010000007.1 GCA902483045_01232 gene open 83939-85183 rlhA
2512 CABTBH010000007.1 GCA902483045_01233 gene open 85590-86237
2513 CABTBH010000007.1 GCA902483045_01234 gene open 86284-87798 rpoN
2514 CABTBH010000007.1 GCA902483045_01235 gene open 87933-88550
2515 CABTBH010000007.1 GCA902483045_01236 gene open 88578-89084
2516 CABTBH010000007.1 GCA902483045_01237 gene open 89317-91242 ispG
2517 CABTBH010000007.1 GCA902483045_01238 gene open 91844-92920
2518 CABTBH010000007.1 GCA902483045_01239 gene open 93055-94008
2519 CABTBH010000007.1 GCA902483045_01240 gene open 93992-94609
2520 CABTBH010000007.1 GCA902483045_01241 gene open 94708-96030
2521 CABTBH010000007.1 GCA902483045_01242 gene open 96324-97523
2522 CABTBH010000007.1 GCA902483045_01243 gene open 97498-98640
2523 CABTBH010000007.1 GCA902483045_01244 gene open 98788-99867
2524 CABTBH010000007.1 GCA902483045_01245 gene open 100080-100577
2525 CABTBH010000007.1 GCA902483045_01246 gene open 100574-101272 fecR
2526 CABTBH010000007.1 GCA902483045_01247 gene open 101279-103855
2527 CABTBH010000007.1 GCA902483045_01248 gene open 104162-106825 mutS
2528 CABTBH010000007.1 GCA902483045_01249 gene open 106941-107927
2529 CABTBH010000007.1 GCA902483045_01250 gene open 108241-108537
2530 CABTBH010000007.1 GCA902483045_01251 gene open 108627-109661
2531 CABTBH010000007.1 GCA902483045_01252 gene open 109848-110597
2532 CABTBH010000007.1 GCA902483045_01253 gene open 110816-111052 acpP
2533 CABTBH010000007.1 GCA902483045_01254 gene open 111142-112404 fabF
2534 CABTBH010000007.1 GCA902483045_01255 gene open 112394-113464 rnc
2535 CABTBH010000007.1 GCA902483045_01256 gene open 113597-114340
2536 CABTBH010000007.1 GCA902483045_01257 gene open 114507-115610 ychF
2537 CABTBH010000007.1 GCA902483045_01258 gene open 115709-116551 lgt
2538 CABTBH010000007.1 GCA902483045_01259 gene open 116985-117305
2539 CABTBH010000007.1 GCA902483045_01260 gene open 117462-118949 cysS
2540 CABTBH010000007.1 GCA902483045_01261 gene open 119042-119809
2541 CABTBH010000007.1 GCA902483045_01262 gene open 119814-120524
2542 CABTBH010000007.1 GCA902483045_01263 gene open 120521-121780 nosD
2543 CABTBH010000007.1 GCA902483045_01264 gene open 121744-122229 nosL
2544 CABTBH010000007.1 GCA902483045_01265 gene open 122243-122938 nosL
2545 CABTBH010000007.1 GCA902483045_01266 gene open 122963-124816
2546 CABTBH010000007.1 GCA902483045_01267 gene open 124817-124999
2547 CABTBH010000007.1 GCA902483045_01268 gene open 125060-125179
2548 CABTBH010000007.1 GCA902483045_01269 gene open 125294-126127
2549 CABTBH010000007.1 GCA902483045_01270 gene open 126760-127401
2550 CABTBH010000007.1 GCA902483045_01271 gene open 127417-128076 upp
2551 CABTBH010000007.1 GCA902483045_01272 gene open 128354-129967 pckA
2552 CABTBH010000007.1 GCA902483045_01273 gene open 130285-132516
2553 CABTBH010000007.1 GCA902483045_01274 gene open 133220-133807
2554 CABTBH010000007.1 GCA902483045_01275 gene open 133905-134369
2555 CABTBH010000008.1 GCA902483045_01291 gene open 19774-19962 Bacteroidales-1
2556 CABTBH010000008.1 GCA902483045_01291 ncRNA open 19774-19962 Bacteroidales-1 6S-Bacteroidales RNA suggested
2557 CABTBH010000008.1 repeat_region open 131343-133243 CRISPR array with 25 repeats of length 47%2C consensus sequence ATTGTGCTTGCTACTGCAAAGATACACATTTTGAAGCAATTCACAAC and spacer length 29
2558 CABTBH010000008.1 GCA902483045_01276 CDS open 557-955 _na     132_aa Type VI secretion system needle protein Hcp
2559 CABTBH010000008.1 GCA902483045_01277 CDS open 1727-1969 _na     80_aa hypothetical protein
2560 CABTBH010000008.1 GCA902483045_01278 CDS open 2020-2808 _na     262_aa Putative lipoprotein
2561 CABTBH010000008.1 GCA902483045_01279 CDS open 2894-3448 _na     184_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
2562 CABTBH010000008.1 GCA902483045_01280 CDS open 3660-4655 _na     331_aa SPOR domain-containing protein
2563 CABTBH010000008.1 GCA902483045_01281 CDS open 4844-5374 _na     176_aa FHA domain
2564 CABTBH010000008.1 GCA902483045_01282 CDS open 5371-5493 _na     40_aa hypothetical protein
2565 CABTBH010000008.1 GCA902483045_01283 CDS open 6017-7546 _na     509_aa Putative lipoprotein
2566 CABTBH010000008.1 GCA902483045_01284 CDS open 7553-10879 _na     1108_aa TonB-linked outer membrane protein%2C SusC/RagA family
2567 CABTBH010000008.1 GCA902483045_01285 CDS open 11123-11647 _na     174_aa sigV RNA polymerase sigma factor sigV
2568 CABTBH010000008.1 GCA902483045_01286 CDS open 12039-13004 _na     321_aa putative transmembrane transcriptional regulator (Anti-sigma factor)
2569 CABTBH010000008.1 GCA902483045_01287 CDS open 13076-16135 _na     1019_aa Beta-galactosidase
2570 CABTBH010000008.1 GCA902483045_01288 CDS open 16837-17910 _na     357_aa ypdA Inner membrane protein ypdA
2571 CABTBH010000008.1 GCA902483045_01289 CDS open 17885-18595 _na     236_aa lytT Response regulatory domain-containing protein
2572 CABTBH010000008.1 GCA902483045_01290 CDS open 18757-19374 _na     205_aa riboflavin synthase
2573 CABTBH010000008.1 GCA902483045_01292 CDS open 20180-21544 _na     454_aa lpdA dihydrolipoyl dehydrogenase
2574 CABTBH010000008.1 GCA902483045_01293 CDS open 21607-23097 _na     496_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
2575 CABTBH010000008.1 GCA902483045_01294 CDS open 23129-24439 _na     436_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
2576 CABTBH010000008.1 GCA902483045_01295 CDS open 24758-25138 _na     126_aa gcvH glycine cleavage system protein GcvH
2577 CABTBH010000008.1 GCA902483045_01296 CDS open 25304-26389 _na     361_aa gcvT glycine cleavage system aminomethyltransferase GcvT
2578 CABTBH010000008.1 GCA902483045_01297 CDS open 26625-27716 _na     363_aa FMN-binding domain protein
2579 CABTBH010000008.1 GCA902483045_01298 CDS open 27783-28805 _na     340_aa Phytase-like domain-containing protein
2580 CABTBH010000008.1 GCA902483045_01299 CDS open 28822-28992 _na     56_aa hypothetical protein
2581 CABTBH010000008.1 GCA902483045_01300 CDS open 29158-30225 _na     355_aa Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase
2582 CABTBH010000008.1 GCA902483045_01301 CDS open 30747-33740 _na     997_aa Pyruvate phosphate dikinase%2C PEP/pyruvate binding domain protein
2583 CABTBH010000008.1 GCA902483045_01302 CDS open 34000-35337 _na     445_aa gdhA NADP-specific glutamate dehydrogenase
2584 CABTBH010000008.1 GCA902483045_01303 CDS open 35456-36202 _na     248_aa rlpA putative endolytic peptidoglycan transglycosylase RlpA
2585 CABTBH010000008.1 GCA902483045_01304 CDS open 36370-36939 _na     189_aa Zinc ribbon domain-containing protein
2586 CABTBH010000008.1 GCA902483045_01305 CDS open 37116-37640 _na     174_aa Lipoprotein
2587 CABTBH010000008.1 GCA902483045_01306 CDS open 37684-38280 _na     198_aa Lipoprotein
2588 CABTBH010000008.1 GCA902483045_01307 CDS open 38355-39617 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
2589 CABTBH010000008.1 GCA902483045_01308 CDS open 39767-40315 _na     182_aa BFN domain-containing protein
2590 CABTBH010000008.1 GCA902483045_01309 CDS open 40361-41140 _na     259_aa Ribosomal RNA small subunit methyltransferase E
2591 CABTBH010000008.1 GCA902483045_01310 CDS open 41372-44632 _na     1086_aa TonB-dependent receptor plug domain-containing protein
2592 CABTBH010000008.1 GCA902483045_01311 CDS open 44793-45125 _na     110_aa Cupin domain protein
2593 CABTBH010000008.1 GCA902483045_01312 CDS open 45506-48274 _na     922_aa TonB-dependent receptor plug domain protein
2594 CABTBH010000008.1 GCA902483045_01313 CDS open 48297-49604 _na     435_aa DUF4876 domain-containing protein
2595 CABTBH010000008.1 GCA902483045_01314 CDS open 49591-51147 _na     518_aa DUF6850 domain-containing protein
2596 CABTBH010000008.1 GCA902483045_01315 CDS open 51206-52807 _na     533_aa Leucine-rich repeat domain-containing protein
2597 CABTBH010000008.1 GCA902483045_01316 CDS open 53072-54718 _na     548_aa ttdA Fumarate hydratase class I
2598 CABTBH010000008.1 GCA902483045_01317 CDS open 54895-57825 _na     976_aa Peptidase M16 inactive domain protein
2599 CABTBH010000008.1 GCA902483045_01318 CDS open 57865-59757 _na     630_aa glgC DUF6819 domain-containing protein
2600 CABTBH010000008.1 GCA902483045_01319 CDS open 59783-61030 _na     415_aa hflX GTPase HflX
2601 CABTBH010000008.1 GCA902483045_01320 CDS open 61207-62484 _na     425_aa DUF3078 domain-containing protein
2602 CABTBH010000008.1 GCA902483045_01321 CDS open 63258-65549 _na     763_aa TonB-dependent receptor
2603 CABTBH010000008.1 GCA902483045_01322 CDS open 65636-66130 _na     164_aa gldH Gliding motility-associated lipoprotein GldH
2604 CABTBH010000008.1 GCA902483045_01323 CDS open 66127-67470 _na     447_aa PSP1 C-terminal conserved region
2605 CABTBH010000008.1 GCA902483045_01324 CDS open 67614-68753 _na     379_aa DNA polymerase III subunit tau
2606 CABTBH010000008.1 GCA902483045_01325 CDS open 69393-71012 _na     539_aa BACON domain-containing protein
2607 CABTBH010000008.1 GCA902483045_01326 CDS open 71049-72653 _na     534_aa BACON domain-containing protein
2608 CABTBH010000008.1 GCA902483045_01327 CDS open 72671-75433 _na     920_aa Peptidase%2C S8/S53 family
2609 CABTBH010000008.1 GCA902483045_01328 CDS open 75446-76399 _na     317_aa Outer membrane insertion signal domain protein
2610 CABTBH010000008.1 GCA902483045_01329 CDS open 76442-77995 _na     517_aa Lipocalin-like domain-containing protein
2611 CABTBH010000008.1 GCA902483045_01330 CDS open 78159-78359 _na     66_aa hypothetical protein
2612 CABTBH010000008.1 GCA902483045_01331 CDS open 78499-79461 _na     320_aa manA mannose-6-phosphate isomerase%2C class I
2613 CABTBH010000008.1 GCA902483045_01332 CDS open 79530-80861 _na     443_aa rmuC DNA recombination protein rmuC
2614 CABTBH010000008.1 GCA902483045_01333 CDS open 81148-81648 _na     166_aa DNA mismatch endonuclease Vsr
2615 CABTBH010000008.1 GCA902483045_01334 CDS open 81894-83591 _na     565_aa ettA energy-dependent translational throttle protein EttA
2616 CABTBH010000008.1 GCA902483045_01335 CDS open 84524-85603 _na     359_aa Pheromone autoinducer 2 transporter
2617 CABTBH010000008.1 GCA902483045_01336 CDS open 85610-86212 _na     200_aa thymidine kinase
2618 CABTBH010000008.1 GCA902483045_01337 CDS open 86452-87450 _na     332_aa luxR Transcriptional regulator%2C LuxR family
2619 CABTBH010000008.1 GCA902483045_01338 CDS open 87484-87648 _na     54_aa hypothetical protein
2620 CABTBH010000008.1 GCA902483045_01339 CDS open 87985-88701 _na     238_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2621 CABTBH010000008.1 GCA902483045_01340 CDS open 88723-89619 _na     298_aa Lipoprotein
2622 CABTBH010000008.1 GCA902483045_01341 CDS open 90330-90647 _na     105_aa hypothetical protein
2623 CABTBH010000008.1 GCA902483045_01342 CDS open 90733-92667 _na     644_aa hypothetical protein
2624 CABTBH010000008.1 GCA902483045_01343 CDS open 92868-93077 _na     69_aa hypothetical protein
2625 CABTBH010000008.1 GCA902483045_01344 CDS open 93074-95341 _na     755_aa hypothetical protein
2626 CABTBH010000008.1 GCA902483045_01345 CDS open 95286-95597 _na     103_aa hypothetical protein
2627 CABTBH010000008.1 GCA902483045_01346 CDS open 95872-96261 _na     129_aa PTS cellobiose transporter subunit IIC
2628 CABTBH010000008.1 GCA902483045_01347 CDS open 96258-96740 _na     160_aa RNA polymerase sigma factor
2629 CABTBH010000008.1 GCA902483045_01348 CDS open 96747-97202 _na     151_aa DUF2721 domain-containing protein
2630 CABTBH010000008.1 GCA902483045_01349 CDS open 98080-100560 _na     826_aa alr bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
2631 CABTBH010000008.1 GCA902483045_01350 CDS open 100848-101249 _na     133_aa hypothetical protein
2632 CABTBH010000008.1 GCA902483045_01351 CDS open 101285-102136 _na     283_aa GSCFA family protein
2633 CABTBH010000008.1 GCA902483045_01352 CDS open 102354-102806 _na     150_aa Bifunctional NMN adenylyltransferase/Nudix hydrolase
2634 CABTBH010000008.1 GCA902483045_01353 CDS open 102711-103184 _na     157_aa hypothetical protein
2635 CABTBH010000008.1 GCA902483045_01354 CDS open 103230-105437 _na     735_aa oVP1 sodium-translocating pyrophosphatase
2636 CABTBH010000008.1 GCA902483045_01355 CDS open 105733-106386 _na     217_aa Carbohydrate-binding domain-containing protein
2637 CABTBH010000008.1 GCA902483045_01356 CDS open 106383-107474 _na     363_aa Mucin-desulfating sulfatase
2638 CABTBH010000008.1 GCA902483045_01357 CDS open 107574-109724 _na     716_aa Putative alpha-1%2C2-mannosidase
2639 CABTBH010000008.1 GCA902483045_01358 CDS open 109957-112056 _na     699_aa beta-N-acetylhexosaminidase
2640 CABTBH010000008.1 GCA902483045_01359 CDS open 112109-114364 _na     751_aa Putative alpha-1%2C2-mannosidase
2641 CABTBH010000008.1 GCA902483045_01360 CDS open 114370-114522 _na     50_aa hypothetical protein
2642 CABTBH010000008.1 GCA902483045_01361 CDS open 114517-115491 _na     324_aa Glycosidase
2643 CABTBH010000008.1 GCA902483045_01362 CDS open 115552-115776 _na     74_aa hypothetical protein
2644 CABTBH010000008.1 GCA902483045_01363 CDS open 115715-116458 _na     247_aa thiamine diphosphokinase
2645 CABTBH010000008.1 GCA902483045_01364 CDS open 116600-117178 _na     192_aa pnuC nicotinamide riboside transporter PnuC
2646 CABTBH010000008.1 GCA902483045_01365 CDS open 117290-119674 _na     794_aa cirA TonB-dependent receptor plug domain protein
2647 CABTBH010000008.1 GCA902483045_01366 CDS open 120670-122106 _na     478_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2648 CABTBH010000008.1 GCA902483045_01367 CDS open 122072-122200 _na     42_aa hypothetical protein
2649 CABTBH010000008.1 GCA902483045_01368 CDS open 122313-125033 _na     906_aa ppdK pyruvate%2C phosphate dikinase
2650 CABTBH010000008.1 GCA902483045_01369 CDS open 124966-125259 _na     97_aa hypothetical protein
2651 CABTBH010000008.1 GCA902483045_01370 CDS open 125701-129981 _na     1426_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2652 CABTBH010000008.1 GCA902483045_01371 CDS open 129978-130904 _na     308_aa cas1 type II CRISPR-associated endonuclease Cas1
2653 CABTBH010000008.1 GCA902483045_01372 CDS open 130931-131236 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
2654 CABTBH010000008.1 GCA902483045_01276 gene open 557-955
2655 CABTBH010000008.1 GCA902483045_01277 gene open 1727-1969
2656 CABTBH010000008.1 GCA902483045_01278 gene open 2020-2808
2657 CABTBH010000008.1 GCA902483045_01279 gene open 2894-3448 rfbC
2658 CABTBH010000008.1 GCA902483045_01280 gene open 3660-4655
2659 CABTBH010000008.1 GCA902483045_01281 gene open 4844-5374
2660 CABTBH010000008.1 GCA902483045_01282 gene open 5371-5493
2661 CABTBH010000008.1 GCA902483045_01283 gene open 6017-7546
2662 CABTBH010000008.1 GCA902483045_01284 gene open 7553-10879
2663 CABTBH010000008.1 GCA902483045_01285 gene open 11123-11647 sigV
2664 CABTBH010000008.1 GCA902483045_01286 gene open 12039-13004
2665 CABTBH010000008.1 GCA902483045_01287 gene open 13076-16135
2666 CABTBH010000008.1 GCA902483045_01288 gene open 16837-17910 ypdA
2667 CABTBH010000008.1 GCA902483045_01289 gene open 17885-18595 lytT
2668 CABTBH010000008.1 GCA902483045_01290 gene open 18757-19374
2669 CABTBH010000008.1 GCA902483045_01292 gene open 20180-21544 lpdA
2670 CABTBH010000008.1 GCA902483045_01293 gene open 21607-23097 gcvPB
2671 CABTBH010000008.1 GCA902483045_01294 gene open 23129-24439 gcvPA
2672 CABTBH010000008.1 GCA902483045_01295 gene open 24758-25138 gcvH
2673 CABTBH010000008.1 GCA902483045_01296 gene open 25304-26389 gcvT
2674 CABTBH010000008.1 GCA902483045_01297 gene open 26625-27716
2675 CABTBH010000008.1 GCA902483045_01298 gene open 27783-28805
2676 CABTBH010000008.1 GCA902483045_01299 gene open 28822-28992
2677 CABTBH010000008.1 GCA902483045_01300 gene open 29158-30225
2678 CABTBH010000008.1 GCA902483045_01301 gene open 30747-33740
2679 CABTBH010000008.1 GCA902483045_01302 gene open 34000-35337 gdhA
2680 CABTBH010000008.1 GCA902483045_01303 gene open 35456-36202 rlpA
2681 CABTBH010000008.1 GCA902483045_01304 gene open 36370-36939
2682 CABTBH010000008.1 GCA902483045_01305 gene open 37116-37640
2683 CABTBH010000008.1 GCA902483045_01306 gene open 37684-38280
2684 CABTBH010000008.1 GCA902483045_01307 gene open 38355-39617
2685 CABTBH010000008.1 GCA902483045_01308 gene open 39767-40315
2686 CABTBH010000008.1 GCA902483045_01309 gene open 40361-41140
2687 CABTBH010000008.1 GCA902483045_01310 gene open 41372-44632
2688 CABTBH010000008.1 GCA902483045_01311 gene open 44793-45125
2689 CABTBH010000008.1 GCA902483045_01312 gene open 45506-48274
2690 CABTBH010000008.1 GCA902483045_01313 gene open 48297-49604
2691 CABTBH010000008.1 GCA902483045_01314 gene open 49591-51147
2692 CABTBH010000008.1 GCA902483045_01315 gene open 51206-52807
2693 CABTBH010000008.1 GCA902483045_01316 gene open 53072-54718 ttdA
2694 CABTBH010000008.1 GCA902483045_01317 gene open 54895-57825
2695 CABTBH010000008.1 GCA902483045_01318 gene open 57865-59757 glgC
2696 CABTBH010000008.1 GCA902483045_01319 gene open 59783-61030 hflX
2697 CABTBH010000008.1 GCA902483045_01320 gene open 61207-62484
2698 CABTBH010000008.1 GCA902483045_01321 gene open 63258-65549
2699 CABTBH010000008.1 GCA902483045_01322 gene open 65636-66130 gldH
2700 CABTBH010000008.1 GCA902483045_01323 gene open 66127-67470
2701 CABTBH010000008.1 GCA902483045_01324 gene open 67614-68753
2702 CABTBH010000008.1 GCA902483045_01325 gene open 69393-71012
2703 CABTBH010000008.1 GCA902483045_01326 gene open 71049-72653
2704 CABTBH010000008.1 GCA902483045_01327 gene open 72671-75433
2705 CABTBH010000008.1 GCA902483045_01328 gene open 75446-76399
2706 CABTBH010000008.1 GCA902483045_01329 gene open 76442-77995
2707 CABTBH010000008.1 GCA902483045_01330 gene open 78159-78359
2708 CABTBH010000008.1 GCA902483045_01331 gene open 78499-79461 manA
2709 CABTBH010000008.1 GCA902483045_01332 gene open 79530-80861 rmuC
2710 CABTBH010000008.1 GCA902483045_01333 gene open 81148-81648
2711 CABTBH010000008.1 GCA902483045_01334 gene open 81894-83591 ettA
2712 CABTBH010000008.1 GCA902483045_01335 gene open 84524-85603
2713 CABTBH010000008.1 GCA902483045_01336 gene open 85610-86212
2714 CABTBH010000008.1 GCA902483045_01337 gene open 86452-87450 luxR
2715 CABTBH010000008.1 GCA902483045_01338 gene open 87484-87648
2716 CABTBH010000008.1 GCA902483045_01339 gene open 87985-88701 rsmI
2717 CABTBH010000008.1 GCA902483045_01340 gene open 88723-89619
2718 CABTBH010000008.1 GCA902483045_01341 gene open 90330-90647
2719 CABTBH010000008.1 GCA902483045_01342 gene open 90733-92667
2720 CABTBH010000008.1 GCA902483045_01343 gene open 92868-93077
2721 CABTBH010000008.1 GCA902483045_01344 gene open 93074-95341
2722 CABTBH010000008.1 GCA902483045_01345 gene open 95286-95597
2723 CABTBH010000008.1 GCA902483045_01346 gene open 95872-96261
2724 CABTBH010000008.1 GCA902483045_01347 gene open 96258-96740
2725 CABTBH010000008.1 GCA902483045_01348 gene open 96747-97202
2726 CABTBH010000008.1 GCA902483045_01349 gene open 98080-100560 alr
2727 CABTBH010000008.1 GCA902483045_01350 gene open 100848-101249
2728 CABTBH010000008.1 GCA902483045_01351 gene open 101285-102136
2729 CABTBH010000008.1 GCA902483045_01352 gene open 102354-102806
2730 CABTBH010000008.1 GCA902483045_01353 gene open 102711-103184
2731 CABTBH010000008.1 GCA902483045_01354 gene open 103230-105437 oVP1
2732 CABTBH010000008.1 GCA902483045_01355 gene open 105733-106386
2733 CABTBH010000008.1 GCA902483045_01356 gene open 106383-107474
2734 CABTBH010000008.1 GCA902483045_01357 gene open 107574-109724
2735 CABTBH010000008.1 GCA902483045_01358 gene open 109957-112056
2736 CABTBH010000008.1 GCA902483045_01359 gene open 112109-114364
2737 CABTBH010000008.1 GCA902483045_01360 gene open 114370-114522
2738 CABTBH010000008.1 GCA902483045_01361 gene open 114517-115491
2739 CABTBH010000008.1 GCA902483045_01362 gene open 115552-115776
2740 CABTBH010000008.1 GCA902483045_01363 gene open 115715-116458
2741 CABTBH010000008.1 GCA902483045_01364 gene open 116600-117178 pnuC
2742 CABTBH010000008.1 GCA902483045_01365 gene open 117290-119674 cirA
2743 CABTBH010000008.1 GCA902483045_01366 gene open 120670-122106 rlmD
2744 CABTBH010000008.1 GCA902483045_01367 gene open 122072-122200
2745 CABTBH010000008.1 GCA902483045_01368 gene open 122313-125033 ppdK
2746 CABTBH010000008.1 GCA902483045_01369 gene open 124966-125259
2747 CABTBH010000008.1 GCA902483045_01370 gene open 125701-129981 cas9
2748 CABTBH010000008.1 GCA902483045_01371 gene open 129978-130904 cas1
2749 CABTBH010000008.1 GCA902483045_01372 gene open 130931-131236 cas2
2750 CABTBH010000009.1 GCA902483045_01373 CDS open 62-2149 _na     695_aa topA DNA topoisomerase
2751 CABTBH010000009.1 GCA902483045_01374 CDS open 2211-3779 _na     522_aa DUF3945 domain-containing protein
2752 CABTBH010000009.1 GCA902483045_01375 CDS open 3800-4150 _na     116_aa Helix-turn-helix domain-containing protein
2753 CABTBH010000009.1 GCA902483045_01376 CDS open 4154-4510 _na     118_aa DNA binding domain%2C excisionase family
2754 CABTBH010000009.1 GCA902483045_01377 CDS open 4758-5012 _na     84_aa helix-turn-helix domain-containing protein
2755 CABTBH010000009.1 GCA902483045_01378 CDS open 5044-5349 _na     101_aa Helix-turn-helix domain-containing protein
2756 CABTBH010000009.1 GCA902483045_01379 CDS open 5430-5792 _na     120_aa rhuM RhuM protein
2757 CABTBH010000009.1 GCA902483045_01380 CDS open 5805-7040 _na     411_aa xerD Tyr recombinase domain-containing protein
2758 CABTBH010000009.1 GCA902483045_01381 CDS open 7415-9709 _na     764_aa sfcA Phosphate acetyl/butyryl transferase
2759 CABTBH010000009.1 GCA902483045_01382 CDS open 9932-10711 _na     259_aa Outer membrane protein beta-barrel domain-containing protein
2760 CABTBH010000009.1 GCA902483045_01383 CDS open 10756-11838 _na     360_aa Glycoside hydrolase
2761 CABTBH010000009.1 GCA902483045_01384 CDS open 12701-13468 _na     255_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
2762 CABTBH010000009.1 GCA902483045_01385 CDS open 13539-14285 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
2763 CABTBH010000009.1 GCA902483045_01386 CDS open 14412-15005 _na     197_aa HTH tetR-type domain-containing protein
2764 CABTBH010000009.1 GCA902483045_01387 CDS open 15253-16227 _na     324_aa Putative lipoprotein
2765 CABTBH010000009.1 GCA902483045_01388 CDS open 16318-17517 _na     399_aa DUF4421 domain-containing protein
2766 CABTBH010000009.1 GCA902483045_01389 CDS open 17561-18658 _na     365_aa mviM Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
2767 CABTBH010000009.1 GCA902483045_01390 CDS open 18719-19318 _na     199_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
2768 CABTBH010000009.1 GCA902483045_01391 CDS open 19323-21110 _na     595_aa abc-f ribosomal protection-like ABC-F family protein
2769 CABTBH010000009.1 GCA902483045_01392 CDS open 21243-21995 _na     250_aa lptB Lipopolysaccharide export system ATP-binding protein LptB
2770 CABTBH010000009.1 GCA902483045_01393 CDS open 21976-25335 _na     1119_aa secA preprotein translocase subunit SecA
2771 CABTBH010000009.1 GCA902483045_01394 CDS open 25685-26047 _na     120_aa Secreted protein
2772 CABTBH010000009.1 GCA902483045_01395 CDS open 26044-27216 _na     390_aa DUF4105 domain-containing protein
2773 CABTBH010000009.1 GCA902483045_01396 CDS open 27411-28166 _na     251_aa Putative hydrolase
2774 CABTBH010000009.1 GCA902483045_01397 CDS open 28561-29565 _na     334_aa murB UDP-N-acetylmuramate dehydrogenase
2775 CABTBH010000009.1 GCA902483045_01398 CDS open 29624-30196 _na     190_aa Bacterial transferase hexapeptide repeat protein
2776 CABTBH010000009.1 GCA902483045_01399 CDS open 30273-31088 _na     271_aa DUF4348 domain-containing protein
2777 CABTBH010000009.1 GCA902483045_01400 CDS open 31272-32309 _na     345_aa pheS phenylalanine--tRNA ligase subunit alpha
2778 CABTBH010000009.1 GCA902483045_01401 CDS open 32705-32857 _na     50_aa Lipoprotein
2779 CABTBH010000009.1 GCA902483045_01402 CDS open 32884-33546 _na     220_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
2780 CABTBH010000009.1 GCA902483045_01403 CDS open 33633-35621 _na     662_aa oPT OPT family oligopeptide transporter
2781 CABTBH010000009.1 GCA902483045_01404 CDS open 35731-37092 _na     453_aa TrpB-like pyridoxal phosphate-dependent enzyme
2782 CABTBH010000009.1 GCA902483045_01405 CDS open 37256-38683 _na     475_aa Na(+)/glucose symporter
2783 CABTBH010000009.1 GCA902483045_01406 CDS open 38720-39550 _na     276_aa coaW type II pantothenate kinase
2784 CABTBH010000009.1 GCA902483045_01407 CDS open 39753-40031 _na     92_aa DNA-binding protein HU
2785 CABTBH010000009.1 GCA902483045_01408 CDS open 40074-40163 _na     29_aa Mitochondrial mRNA-processing protein COX24 C-terminal domain-containing protein
2786 CABTBH010000009.1 GCA902483045_01409 CDS open 40350-41921 _na     523_aa cafA S1 RNA binding domain protein
2787 CABTBH010000009.1 GCA902483045_01410 CDS open 42016-42594 _na     192_aa hypothetical protein
2788 CABTBH010000009.1 GCA902483045_01411 CDS open 42879-44435 _na     518_aa kdpD histidine kinase
2789 CABTBH010000009.1 GCA902483045_01412 CDS open 44469-45176 _na     235_aa ompR Transcriptional regulatory protein RprY
2790 CABTBH010000009.1 GCA902483045_01413 CDS open 45369-46961 _na     530_aa nadB L-aspartate oxidase
2791 CABTBH010000009.1 GCA902483045_01414 CDS open 47120-48112 _na     330_aa nadA quinolinate synthase NadA
2792 CABTBH010000009.1 GCA902483045_01415 CDS open 48132-48998 _na     288_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
2793 CABTBH010000009.1 GCA902483045_01416 CDS open 49155-50771 _na     538_aa beta-N-acetylhexosaminidase
2794 CABTBH010000009.1 GCA902483045_01417 CDS open 51172-52023 _na     283_aa Endonuclease/exonuclease/phosphatase family protein
2795 CABTBH010000009.1 GCA902483045_01418 CDS open 52359-52907 _na     182_aa Conserved domain protein
2796 CABTBH010000009.1 GCA902483045_01419 CDS open 53356-54294 _na     312_aa DUF4468 domain-containing protein
2797 CABTBH010000009.1 GCA902483045_01420 CDS open 54504-54734 _na     76_aa Lipoprotein
2798 CABTBH010000009.1 GCA902483045_01421 CDS open 54735-57128 _na     797_aa Porin
2799 CABTBH010000009.1 GCA902483045_01422 CDS open 57189-58130 _na     313_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
2800 CABTBH010000009.1 GCA902483045_01423 CDS open 58210-58848 _na     212_aa putative HD superfamily hydrolase
2801 CABTBH010000009.1 GCA902483045_01424 CDS open 58869-59336 _na     155_aa tadA Guanine deaminase
2802 CABTBH010000009.1 GCA902483045_01425 CDS open 59484-59936 _na     150_aa tRNA-specific adenosine deaminase
2803 CABTBH010000009.1 GCA902483045_01426 CDS open 60137-60502 _na     121_aa UPF0102 protein HMPREF9303_1851
2804 CABTBH010000009.1 GCA902483045_01427 CDS open 60518-61309 _na     263_aa Biotin--[acetyl-CoA-carboxylase] ligase
2805 CABTBH010000009.1 GCA902483045_01428 CDS open 61408-62118 _na     236_aa pyrH UMP kinase
2806 CABTBH010000009.1 GCA902483045_01429 CDS open 62376-64475 _na     699_aa dsbD Thiol:disulfide interchange protein DsbD
2807 CABTBH010000009.1 GCA902483045_01430 CDS open 65239-65868 _na     209_aa udk uridine kinase
2808 CABTBH010000009.1 GCA902483045_01431 CDS open 65907-66491 _na     194_aa Uracil-DNA glycosylase family protein
2809 CABTBH010000009.1 GCA902483045_01432 CDS open 66667-67710 _na     347_aa Endonuclease/exonuclease/phosphatase family protein
2810 CABTBH010000009.1 GCA902483045_01433 CDS open 67999-70572 _na     857_aa TonB-dependent receptor
2811 CABTBH010000009.1 GCA902483045_01434 CDS open 70594-71829 _na     411_aa DUF5689 domain-containing protein
2812 CABTBH010000009.1 GCA902483045_01435 CDS open 71854-73197 _na     447_aa Nucleic acid-binding domain protein
2813 CABTBH010000009.1 GCA902483045_01436 CDS open 73333-73584 _na     83_aa type B 50S ribosomal protein L31
2814 CABTBH010000009.1 GCA902483045_01437 CDS open 73708-74631 _na     307_aa Nuclease
2815 CABTBH010000009.1 GCA902483045_01438 CDS open 74719-75531 _na     270_aa gldB Gliding motility-associated lipoprotein GldB
2816 CABTBH010000009.1 GCA902483045_01439 CDS open 75641-76681 _na     346_aa dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase
2817 CABTBH010000009.1 GCA902483045_01440 CDS open 76678-78030 _na     450_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2818 CABTBH010000009.1 GCA902483045_01441 CDS open 79005-79487 _na     160_aa Secretion system C-terminal sorting domain-containing protein
2819 CABTBH010000009.1 GCA902483045_01442 CDS open 79484-80077 _na     197_aa Lipocalin-like domain-containing protein
2820 CABTBH010000009.1 GCA902483045_01443 CDS open 80096-80887 _na     263_aa hmuY HmuY family protein
2821 CABTBH010000009.1 GCA902483045_01444 CDS open 80961-82940 _na     659_aa TonB-dependent receptor
2822 CABTBH010000009.1 GCA902483045_01445 CDS open 82958-83830 _na     290_aa Transporter
2823 CABTBH010000009.1 GCA902483045_01446 CDS open 84743-85210 _na     155_aa Stage IV sporulation protein H
2824 CABTBH010000009.1 GCA902483045_01447 CDS open 85252-86838 _na     528_aa Outer membrane insertion signal domain protein
2825 CABTBH010000009.1 GCA902483045_01448 CDS open 86844-87632 _na     262_aa Outer membrane lipoprotein Omp28 family protein
2826 CABTBH010000009.1 GCA902483045_01449 CDS open 87677-88351 _na     224_aa T9SS C-terminal target domain-containing protein
2827 CABTBH010000009.1 GCA902483045_01450 CDS open 88383-89705 _na     440_aa Thioredoxin domain-containing protein
2828 CABTBH010000009.1 GCA902483045_01451 CDS open 89736-91541 _na     601_aa mutS DNA mismatch repair protein mutS
2829 CABTBH010000009.1 GCA902483045_01452 CDS open 92022-93335 _na     437_aa DUF58 domain-containing protein
2830 CABTBH010000009.1 GCA902483045_01453 CDS open 93475-94449 _na     324_aa ATPase%2C AAA family
2831 CABTBH010000009.1 GCA902483045_01454 CDS open 94503-95756 _na     417_aa DUF4350 domain-containing protein
2832 CABTBH010000009.1 GCA902483045_01455 CDS open 95753-96364 _na     203_aa Protein-glutamine gamma-glutamyltransferase-like C-terminal domain-containing protein
2833 CABTBH010000009.1 GCA902483045_01456 CDS open 96377-97369 _na     330_aa Transmembrane protein
2834 CABTBH010000009.1 GCA902483045_01457 CDS open 97344-98324 _na     326_aa Integral membrane protein DUF95
2835 CABTBH010000009.1 GCA902483045_01458 CDS open 98426-99151 _na     241_aa RDD family
2836 CABTBH010000009.1 GCA902483045_01459 CDS open 99558-101804 _na     748_aa pflB formate C-acetyltransferase
2837 CABTBH010000009.1 GCA902483045_01460 CDS open 101854-102576 _na     240_aa pflA pyruvate formate-lyase-activating protein
2838 CABTBH010000009.1 GCA902483045_01461 CDS open 102778-104400 _na     540_aa uup ABC transporter domain-containing protein
2839 CABTBH010000009.1 GCA902483045_01462 CDS open 104452-105042 _na     196_aa grpE Protein GrpE
2840 CABTBH010000009.1 GCA902483045_01463 CDS open 105189-106331 _na     380_aa dnaJ molecular chaperone DnaJ
2841 CABTBH010000009.1 GCA902483045_01464 CDS open 106412-107698 _na     428_aa tetrahydrofolate synthase
2842 CABTBH010000009.1 GCA902483045_01465 CDS open 107916-111758 _na     1280_aa histidine kinase
2843 CABTBH010000009.1 GCA902483045_01466 CDS open 112056-113105 _na     349_aa Arabinogalactan endo-beta-1%2C4-galactanase
2844 CABTBH010000009.1 GCA902483045_01467 CDS open 113130-114818 _na     562_aa DUF5114 domain-containing protein
2845 CABTBH010000009.1 GCA902483045_01468 CDS open 114832-116406 _na     524_aa susD SusD family protein
2846 CABTBH010000009.1 GCA902483045_01469 CDS open 116420-119389 _na     989_aa TonB-linked outer membrane protein%2C SusC/RagA family
2847 CABTBH010000009.1 GCA902483045_01470 CDS open 120168-121097 _na     309_aa ADP-ribosylglycohydrolase
2848 CABTBH010000009.1 GCA902483045_01373 gene open 62-2149 topA
2849 CABTBH010000009.1 GCA902483045_01374 gene open 2211-3779
2850 CABTBH010000009.1 GCA902483045_01375 gene open 3800-4150
2851 CABTBH010000009.1 GCA902483045_01376 gene open 4154-4510
2852 CABTBH010000009.1 GCA902483045_01377 gene open 4758-5012
2853 CABTBH010000009.1 GCA902483045_01378 gene open 5044-5349
2854 CABTBH010000009.1 GCA902483045_01379 gene open 5430-5792 rhuM
2855 CABTBH010000009.1 GCA902483045_01380 gene open 5805-7040 xerD
2856 CABTBH010000009.1 GCA902483045_01381 gene open 7415-9709 sfcA
2857 CABTBH010000009.1 GCA902483045_01382 gene open 9932-10711
2858 CABTBH010000009.1 GCA902483045_01383 gene open 10756-11838
2859 CABTBH010000009.1 GCA902483045_01384 gene open 12701-13468
2860 CABTBH010000009.1 GCA902483045_01385 gene open 13539-14285 fabG
2861 CABTBH010000009.1 GCA902483045_01386 gene open 14412-15005
2862 CABTBH010000009.1 GCA902483045_01387 gene open 15253-16227
2863 CABTBH010000009.1 GCA902483045_01388 gene open 16318-17517
2864 CABTBH010000009.1 GCA902483045_01389 gene open 17561-18658 mviM
2865 CABTBH010000009.1 GCA902483045_01390 gene open 18719-19318 yihA
2866 CABTBH010000009.1 GCA902483045_01391 gene open 19323-21110 abc-f
2867 CABTBH010000009.1 GCA902483045_01392 gene open 21243-21995 lptB
2868 CABTBH010000009.1 GCA902483045_01393 gene open 21976-25335 secA
2869 CABTBH010000009.1 GCA902483045_01394 gene open 25685-26047
2870 CABTBH010000009.1 GCA902483045_01395 gene open 26044-27216
2871 CABTBH010000009.1 GCA902483045_01396 gene open 27411-28166
2872 CABTBH010000009.1 GCA902483045_01397 gene open 28561-29565 murB
2873 CABTBH010000009.1 GCA902483045_01398 gene open 29624-30196
2874 CABTBH010000009.1 GCA902483045_01399 gene open 30273-31088
2875 CABTBH010000009.1 GCA902483045_01400 gene open 31272-32309 pheS
2876 CABTBH010000009.1 GCA902483045_01401 gene open 32705-32857
2877 CABTBH010000009.1 GCA902483045_01402 gene open 32884-33546 tsaA
2878 CABTBH010000009.1 GCA902483045_01403 gene open 33633-35621 oPT
2879 CABTBH010000009.1 GCA902483045_01404 gene open 35731-37092
2880 CABTBH010000009.1 GCA902483045_01405 gene open 37256-38683
2881 CABTBH010000009.1 GCA902483045_01406 gene open 38720-39550 coaW
2882 CABTBH010000009.1 GCA902483045_01407 gene open 39753-40031
2883 CABTBH010000009.1 GCA902483045_01408 gene open 40074-40163
2884 CABTBH010000009.1 GCA902483045_01409 gene open 40350-41921 cafA
2885 CABTBH010000009.1 GCA902483045_01410 gene open 42016-42594
2886 CABTBH010000009.1 GCA902483045_01411 gene open 42879-44435 kdpD
2887 CABTBH010000009.1 GCA902483045_01412 gene open 44469-45176 ompR
2888 CABTBH010000009.1 GCA902483045_01413 gene open 45369-46961 nadB
2889 CABTBH010000009.1 GCA902483045_01414 gene open 47120-48112 nadA
2890 CABTBH010000009.1 GCA902483045_01415 gene open 48132-48998 nadC
2891 CABTBH010000009.1 GCA902483045_01416 gene open 49155-50771
2892 CABTBH010000009.1 GCA902483045_01417 gene open 51172-52023
2893 CABTBH010000009.1 GCA902483045_01418 gene open 52359-52907
2894 CABTBH010000009.1 GCA902483045_01419 gene open 53356-54294
2895 CABTBH010000009.1 GCA902483045_01420 gene open 54504-54734
2896 CABTBH010000009.1 GCA902483045_01421 gene open 54735-57128
2897 CABTBH010000009.1 GCA902483045_01422 gene open 57189-58130 menA
2898 CABTBH010000009.1 GCA902483045_01423 gene open 58210-58848
2899 CABTBH010000009.1 GCA902483045_01424 gene open 58869-59336 tadA
2900 CABTBH010000009.1 GCA902483045_01425 gene open 59484-59936
2901 CABTBH010000009.1 GCA902483045_01426 gene open 60137-60502
2902 CABTBH010000009.1 GCA902483045_01427 gene open 60518-61309
2903 CABTBH010000009.1 GCA902483045_01428 gene open 61408-62118 pyrH
2904 CABTBH010000009.1 GCA902483045_01429 gene open 62376-64475 dsbD
2905 CABTBH010000009.1 GCA902483045_01430 gene open 65239-65868 udk
2906 CABTBH010000009.1 GCA902483045_01431 gene open 65907-66491
2907 CABTBH010000009.1 GCA902483045_01432 gene open 66667-67710
2908 CABTBH010000009.1 GCA902483045_01433 gene open 67999-70572
2909 CABTBH010000009.1 GCA902483045_01434 gene open 70594-71829
2910 CABTBH010000009.1 GCA902483045_01435 gene open 71854-73197
2911 CABTBH010000009.1 GCA902483045_01436 gene open 73333-73584
2912 CABTBH010000009.1 GCA902483045_01437 gene open 73708-74631
2913 CABTBH010000009.1 GCA902483045_01438 gene open 74719-75531 gldB
2914 CABTBH010000009.1 GCA902483045_01439 gene open 75641-76681
2915 CABTBH010000009.1 GCA902483045_01440 gene open 76678-78030 mtaB
2916 CABTBH010000009.1 GCA902483045_01441 gene open 79005-79487
2917 CABTBH010000009.1 GCA902483045_01442 gene open 79484-80077
2918 CABTBH010000009.1 GCA902483045_01443 gene open 80096-80887 hmuY
2919 CABTBH010000009.1 GCA902483045_01444 gene open 80961-82940
2920 CABTBH010000009.1 GCA902483045_01445 gene open 82958-83830
2921 CABTBH010000009.1 GCA902483045_01446 gene open 84743-85210
2922 CABTBH010000009.1 GCA902483045_01447 gene open 85252-86838
2923 CABTBH010000009.1 GCA902483045_01448 gene open 86844-87632
2924 CABTBH010000009.1 GCA902483045_01449 gene open 87677-88351
2925 CABTBH010000009.1 GCA902483045_01450 gene open 88383-89705
2926 CABTBH010000009.1 GCA902483045_01451 gene open 89736-91541 mutS
2927 CABTBH010000009.1 GCA902483045_01452 gene open 92022-93335
2928 CABTBH010000009.1 GCA902483045_01453 gene open 93475-94449
2929 CABTBH010000009.1 GCA902483045_01454 gene open 94503-95756
2930 CABTBH010000009.1 GCA902483045_01455 gene open 95753-96364
2931 CABTBH010000009.1 GCA902483045_01456 gene open 96377-97369
2932 CABTBH010000009.1 GCA902483045_01457 gene open 97344-98324
2933 CABTBH010000009.1 GCA902483045_01458 gene open 98426-99151
2934 CABTBH010000009.1 GCA902483045_01459 gene open 99558-101804 pflB
2935 CABTBH010000009.1 GCA902483045_01460 gene open 101854-102576 pflA
2936 CABTBH010000009.1 GCA902483045_01461 gene open 102778-104400 uup
2937 CABTBH010000009.1 GCA902483045_01462 gene open 104452-105042 grpE
2938 CABTBH010000009.1 GCA902483045_01463 gene open 105189-106331 dnaJ
2939 CABTBH010000009.1 GCA902483045_01464 gene open 106412-107698
2940 CABTBH010000009.1 GCA902483045_01465 gene open 107916-111758
2941 CABTBH010000009.1 GCA902483045_01466 gene open 112056-113105
2942 CABTBH010000009.1 GCA902483045_01467 gene open 113130-114818
2943 CABTBH010000009.1 GCA902483045_01468 gene open 114832-116406 susD
2944 CABTBH010000009.1 GCA902483045_01469 gene open 116420-119389
2945 CABTBH010000009.1 GCA902483045_01470 gene open 120168-121097
2946 CABTBH010000010.1 GCA902483045_01513 gene open 40760-40866 Bacteroidales_small_SRP
2947 CABTBH010000010.1 GCA902483045_01514 gene open 40767-40856 Bacteria_small_SRP
2948 CABTBH010000010.1 GCA902483045_01513 ncRNA open 40760-40866 Bacteroidales small SRP
2949 CABTBH010000010.1 GCA902483045_01514 ncRNA open 40767-40856 Bacterial small signal recognition particle RNA
2950 CABTBH010000010.1 GCA902483045_01471 CDS open 1003-3471 _na     822_aa pheT phenylalanine--tRNA ligase subunit beta
2951 CABTBH010000010.1 GCA902483045_01472 CDS open 3484-4224 _na     246_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
2952 CABTBH010000010.1 GCA902483045_01473 CDS open 4426-4881 _na     151_aa pyrI aspartate carbamoyltransferase regulatory subunit
2953 CABTBH010000010.1 GCA902483045_01474 CDS open 4985-5404 _na     139_aa BACON domain-containing protein
2954 CABTBH010000010.1 GCA902483045_01475 CDS open 5430-6377 _na     315_aa pyrB aspartate carbamoyltransferase
2955 CABTBH010000010.1 GCA902483045_01476 CDS open 6541-8844 _na     767_aa mrcA peptidoglycan glycosyltransferase
2956 CABTBH010000010.1 GCA902483045_01477 CDS open 9615-10862 _na     415_aa lolE Lipoprotein-releasing system transmembrane protein lolE
2957 CABTBH010000010.1 GCA902483045_01478 CDS open 10966-12171 _na     401_aa aspB Aminotransferase%2C class I/II
2958 CABTBH010000010.1 GCA902483045_01479 CDS open 12284-12400 _na     38_aa hypothetical protein
2959 CABTBH010000010.1 GCA902483045_01480 CDS open 12397-12885 _na     162_aa Phage tail component domain protein
2960 CABTBH010000010.1 GCA902483045_01481 CDS open 12921-13592 _na     223_aa Pyridoxal phosphate homeostasis protein
2961 CABTBH010000010.1 GCA902483045_01482 CDS open 13696-14742 _na     348_aa hisC histidinol-phosphate transaminase
2962 CABTBH010000010.1 GCA902483045_01483 CDS open 14792-15520 _na     242_aa trmH RNA methyltransferase%2C TrmH family
2963 CABTBH010000010.1 GCA902483045_01484 CDS open 15673-17937 _na     754_aa Outer membrane protein%2C OMP85 family
2964 CABTBH010000010.1 GCA902483045_01485 CDS open 18057-18857 _na     266_aa Metallo-beta-lactamase
2965 CABTBH010000010.1 GCA902483045_01486 CDS open 19075-19239 _na     54_aa rubredoxin
2966 CABTBH010000010.1 GCA902483045_01487 CDS open 19392-19898 _na     168_aa DUF4375 domain-containing protein
2967 CABTBH010000010.1 GCA902483045_01488 CDS open 19895-20374 _na     159_aa smpB SsrA-binding protein SmpB
2968 CABTBH010000010.1 GCA902483045_01489 CDS open 20760-21647 _na     295_aa map type I methionyl aminopeptidase
2969 CABTBH010000010.1 GCA902483045_01490 CDS open 21713-22744 _na     343_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
2970 CABTBH010000010.1 GCA902483045_01491 CDS open 22779-23282 _na     167_aa Competence protein
2971 CABTBH010000010.1 GCA902483045_01492 CDS open 23408-23671 _na     87_aa rpmB 50S ribosomal protein L28
2972 CABTBH010000010.1 GCA902483045_01493 CDS open 23677-23865 _na     62_aa rpmG 50S ribosomal protein L33
2973 CABTBH010000010.1 GCA902483045_01494 CDS open 23911-24069 _na     52_aa DUF4295 domain-containing protein
2974 CABTBH010000010.1 GCA902483045_01495 CDS open 24162-25001 _na     279_aa 4Fe-4S binding domain protein
2975 CABTBH010000010.1 GCA902483045_01496 CDS open 25134-26654 _na     506_aa ComEC/Rec2-like protein
2976 CABTBH010000010.1 GCA902483045_01497 CDS open 26679-27440 _na     253_aa truA tRNA pseudouridine(38-40) synthase TruA
2977 CABTBH010000010.1 GCA902483045_01498 CDS open 27453-28379 _na     308_aa Putative membrane protein
2978 CABTBH010000010.1 GCA902483045_01499 CDS open 28583-29467 _na     294_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2979 CABTBH010000010.1 GCA902483045_01500 CDS open 29972-30799 _na     275_aa pyrF orotidine-5'-phosphate decarboxylase
2980 CABTBH010000010.1 GCA902483045_01501 CDS open 30984-32096 _na     370_aa prfA peptide chain release factor 1
2981 CABTBH010000010.1 GCA902483045_01502 CDS open 32116-33072 _na     318_aa hrgA HrgA protein
2982 CABTBH010000010.1 GCA902483045_01503 CDS open 33077-34225 _na     382_aa Phosphoribosylformylglycinamidine cyclo-ligase
2983 CABTBH010000010.1 GCA902483045_01504 CDS open 34371-34847 _na     158_aa TonB-dependent receptor
2984 CABTBH010000010.1 GCA902483045_01505 CDS open 34959-35699 _na     246_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
2985 CABTBH010000010.1 GCA902483045_01506 CDS open 35835-36632 _na     265_aa NADP oxidoreductase coenzyme F420-dependent
2986 CABTBH010000010.1 GCA902483045_01507 CDS open 36710-37228 _na     172_aa kdsC 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
2987 CABTBH010000010.1 GCA902483045_01508 CDS open 37243-37806 _na     187_aa dTTP/UTP pyrophosphatase
2988 CABTBH010000010.1 GCA902483045_01509 CDS open 37808-38278 _na     156_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2989 CABTBH010000010.1 GCA902483045_01510 CDS open 38828-40078 _na     416_aa pgk Phosphoglycerate kinase
2990 CABTBH010000010.1 GCA902483045_01515 CDS open 41013-41552 _na     179_aa DUF4199 domain-containing protein
2991 CABTBH010000010.1 GCA902483045_01516 CDS open 41687-42640 _na     317_aa wcaA Glycosyltransferase 2-like domain-containing protein
2992 CABTBH010000010.1 GCA902483045_01517 CDS open 42754-43233 _na     159_aa Conserved domain protein
2993 CABTBH010000010.1 GCA902483045_01518 CDS open 43187-43879 _na     230_aa Outer membrane protein beta-barrel domain-containing protein
2994 CABTBH010000010.1 GCA902483045_01519 CDS open 44011-45027 _na     338_aa FAD:protein FMN transferase
2995 CABTBH010000010.1 GCA902483045_01520 CDS open 45141-45806 _na     221_aa Cyclic nucleotide-binding domain protein
2996 CABTBH010000010.1 GCA902483045_01521 CDS open 46795-48453 _na     552_aa Hemin receptor
2997 CABTBH010000010.1 GCA902483045_01522 CDS open 48496-49557 _na     353_aa Lipoprotein
2998 CABTBH010000010.1 GCA902483045_01523 CDS open 49737-50603 _na     288_aa prmA 50S ribosomal protein L11 methyltransferase
2999 CABTBH010000010.1 GCA902483045_01524 CDS open 50512-51387 _na     291_aa Lysozyme M1
3000 CABTBH010000010.1 GCA902483045_01525 CDS open 51848-53491 _na     547_aa pfkA diphosphate--fructose-6-phosphate 1-phosphotransferase