HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_905371675.1)

Select a Genome:
BAKTA Annotations for GCA_905371675.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
57 2245144 2162 0 1 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4463 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4463 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 CAJPLX010000035.1 GCA905371675_01992 gene open 8633-9352
4002 CAJPLX010000035.1 GCA905371675_01993 gene open 9349-10671
4003 CAJPLX010000035.1 GCA905371675_01994 gene open 10798-12855 metG
4004 CAJPLX010000035.1 GCA905371675_01995 gene open 12879-13073
4005 CAJPLX010000035.1 GCA905371675_01996 gene open 13183-14049 rsgA
4006 CAJPLX010000035.1 GCA905371675_01997 gene open 14200-14817
4007 CAJPLX010000035.1 GCA905371675_01998 gene open 14917-15837
4008 CAJPLX010000035.1 GCA905371675_01999 gene open 15946-17802 vacB
4009 CAJPLX010000035.1 GCA905371675_02000 gene open 17938-18165 xseB
4010 CAJPLX010000035.1 GCA905371675_02001 gene open 18149-19045 ispA
4011 CAJPLX010000036.1 repeat_region open 17894-18470 CRISPR array with 9 repeats of length 32%2C consensus sequence CCAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34
4012 CAJPLX010000036.1 GCA905371675_02002 CDS open 562-2085 _na     507_aa ttdA Fumarate hydratase class I
4013 CAJPLX010000036.1 GCA905371675_02004 CDS open 2474-3265 _na     263_aa focA Formate/nitrite transporter
4014 CAJPLX010000036.1 GCA905371675_02005 CDS open 3512-3946 _na     144_aa yciA acyl-CoA thioester hydrolase YciA
4015 CAJPLX010000036.1 GCA905371675_02006 CDS open 4071-5000 _na     309_aa pip prolyl aminopeptidase
4016 CAJPLX010000036.1 GCA905371675_02007 CDS open 5134-7410 _na     758_aa CRISPR-associated helicase/endonuclease Cas3
4017 CAJPLX010000036.1 GCA905371675_02008 CDS open 7473-8888 _na     471_aa SIR2-like domain-containing protein
4018 CAJPLX010000036.1 GCA905371675_02009 CDS open 8888-10957 _na     689_aa ATP-binding protein
4019 CAJPLX010000036.1 GCA905371675_02010 CDS open 11077-11751 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
4020 CAJPLX010000036.1 GCA905371675_02011 CDS open 11748-13529 _na     593_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
4021 CAJPLX010000036.1 GCA905371675_02012 CDS open 13541-14407 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
4022 CAJPLX010000036.1 GCA905371675_02013 CDS open 14423-15085 _na     220_aa cas4 CRISPR-associated protein Cas4
4023 CAJPLX010000036.1 GCA905371675_02014 CDS open 15146-16252 _na     368_aa hypothetical protein
4024 CAJPLX010000036.1 GCA905371675_02015 CDS open 16323-17336 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
4025 CAJPLX010000036.1 GCA905371675_02016 CDS open 17411-17704 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
4026 CAJPLX010000036.1 GCA905371675_02002 gene open 562-2085 ttdA
4027 CAJPLX010000036.1 GCA905371675_02004 gene open 2474-3265 focA
4028 CAJPLX010000036.1 GCA905371675_02005 gene open 3512-3946 yciA
4029 CAJPLX010000036.1 GCA905371675_02006 gene open 4071-5000 pip
4030 CAJPLX010000036.1 GCA905371675_02007 gene open 5134-7410
4031 CAJPLX010000036.1 GCA905371675_02008 gene open 7473-8888
4032 CAJPLX010000036.1 GCA905371675_02009 gene open 8888-10957
4033 CAJPLX010000036.1 GCA905371675_02010 gene open 11077-11751 cas5c
4034 CAJPLX010000036.1 GCA905371675_02011 gene open 11748-13529 cas8c
4035 CAJPLX010000036.1 GCA905371675_02012 gene open 13541-14407 cas7c
4036 CAJPLX010000036.1 GCA905371675_02013 gene open 14423-15085 cas4
4037 CAJPLX010000036.1 GCA905371675_02014 gene open 15146-16252
4038 CAJPLX010000036.1 GCA905371675_02015 gene open 16323-17336 cas1c
4039 CAJPLX010000036.1 GCA905371675_02016 gene open 17411-17704 cas2
4040 CAJPLX010000036.1 GCA905371675_02003 gene open 2240-2316 trnP
4041 CAJPLX010000036.1 GCA905371675_02003 tRNA open 2240-2316 trnP tRNA-Pro(ggg)
4042 CAJPLX010000037.1 GCA905371675_02017 CDS open 334-1596 _na     420_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
4043 CAJPLX010000037.1 GCA905371675_02018 CDS open 1735-2166 _na     143_aa petE Copper (Cu2+) binding protein
4044 CAJPLX010000037.1 GCA905371675_02019 CDS open 2336-3103 _na     255_aa fepC Hemin import ATP-binding protein HmuV
4045 CAJPLX010000037.1 GCA905371675_02020 CDS open 3114-4160 _na     348_aa fepD Hemin transport system permease protein HmuU
4046 CAJPLX010000037.1 GCA905371675_02021 CDS open 4277-5392 _na     371_aa fepB Vitamin B12-binding protein
4047 CAJPLX010000037.1 GCA905371675_02022 CDS open 5898-7661 _na     587_aa Phosphoenolpyruvate-protein phosphotransferase
4048 CAJPLX010000037.1 GCA905371675_02023 CDS open 7661-7930 _na     89_aa ptsH Protein PtsH
4049 CAJPLX010000037.1 GCA905371675_02024 CDS open 7975-8403 _na     142_aa PTS system fructose IIA component
4050 CAJPLX010000037.1 GCA905371675_02025 CDS open 8462-9025 _na     187_aa hptA hypoxanthine-guanine phosphoribosyltransferase
4051 CAJPLX010000037.1 GCA905371675_02026 CDS open 9140-10609 _na     489_aa cysW Sulfate transport system permease protein CysW
4052 CAJPLX010000037.1 GCA905371675_02027 CDS open 10903-11433 _na     176_aa Cytochrome b561
4053 CAJPLX010000037.1 GCA905371675_02028 CDS open 11590-12594 _na     334_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
4054 CAJPLX010000037.1 GCA905371675_02029 CDS open 12786-13781 _na     331_aa sppA Signal peptide peptidase SppA
4055 CAJPLX010000037.1 GCA905371675_02030 CDS open 13836-14858 _na     340_aa Lysozyme inhibitor LprI-like N-terminal domain-containing protein
4056 CAJPLX010000037.1 GCA905371675_02031 CDS open 14964-16178 _na     404_aa gltS sodium/glutamate symporter
4057 CAJPLX010000037.1 GCA905371675_02032 CDS open 16396-17802 _na     468_aa Sel1 repeat family protein
4058 CAJPLX010000037.1 GCA905371675_02017 gene open 334-1596 waaA
4059 CAJPLX010000037.1 GCA905371675_02018 gene open 1735-2166 petE
4060 CAJPLX010000037.1 GCA905371675_02019 gene open 2336-3103 fepC
4061 CAJPLX010000037.1 GCA905371675_02020 gene open 3114-4160 fepD
4062 CAJPLX010000037.1 GCA905371675_02021 gene open 4277-5392 fepB
4063 CAJPLX010000037.1 GCA905371675_02022 gene open 5898-7661
4064 CAJPLX010000037.1 GCA905371675_02023 gene open 7661-7930 ptsH
4065 CAJPLX010000037.1 GCA905371675_02024 gene open 7975-8403
4066 CAJPLX010000037.1 GCA905371675_02025 gene open 8462-9025 hptA
4067 CAJPLX010000037.1 GCA905371675_02026 gene open 9140-10609 cysW
4068 CAJPLX010000037.1 GCA905371675_02027 gene open 10903-11433
4069 CAJPLX010000037.1 GCA905371675_02028 gene open 11590-12594 pdxA
4070 CAJPLX010000037.1 GCA905371675_02029 gene open 12786-13781 sppA
4071 CAJPLX010000037.1 GCA905371675_02030 gene open 13836-14858
4072 CAJPLX010000037.1 GCA905371675_02031 gene open 14964-16178 gltS
4073 CAJPLX010000037.1 GCA905371675_02032 gene open 16396-17802
4074 CAJPLX010000038.1 regulatory_region open 2884-2963 traJ-II RNA
4075 CAJPLX010000038.1 GCA905371675_02033 CDS open 66-422 _na     118_aa kfrB KfrB
4076 CAJPLX010000038.1 GCA905371675_02034 CDS open 459-995 _na     178_aa kfrC KfrC
4077 CAJPLX010000038.1 GCA905371675_02035 CDS open 1052-1534 _na     160_aa traM TraM
4078 CAJPLX010000038.1 GCA905371675_02036 CDS open 1542-2267 _na     241_aa traL TraL
4079 CAJPLX010000038.1 GCA905371675_02037 CDS open 2268-2687 _na     139_aa traK TraK
4080 CAJPLX010000038.1 GCA905371675_02038 CDS open 2684-2911 _na     75_aa hypothetical protein
4081 CAJPLX010000038.1 GCA905371675_02039 CDS open 3019-3396 _na     125_aa Relaxosome protein
4082 CAJPLX010000038.1 GCA905371675_02040 CDS open 3399-5792 _na     797_aa traI TraI/MobA(P) family conjugative relaxase
4083 CAJPLX010000038.1 GCA905371675_02041 CDS open 5809-7698 _na     629_aa traG TraG
4084 CAJPLX010000038.1 GCA905371675_02042 CDS open 7695-8231 _na     178_aa traF conjugative transfer signal peptidase TraF
4085 CAJPLX010000038.1 GCA905371675_02043 CDS open 8234-10429 _na     731_aa DNA topoisomerase 3
4086 CAJPLX010000038.1 GCA905371675_02044 CDS open 10433-10615 _na     60_aa traD TraD
4087 CAJPLX010000038.1 GCA905371675_02045 CDS open 10618-13617 _na     999_aa traC TraC
4088 CAJPLX010000038.1 GCA905371675_02046 CDS open 13626-14120 _na     164_aa Transcription elongation factor
4089 CAJPLX010000038.1 GCA905371675_02047 CDS open 14117-14677 _na     186_aa DUF882 domain-containing protein
4090 CAJPLX010000038.1 GCA905371675_02048 CDS open 14674-15033 _na     119_aa Phage associated protein
4091 CAJPLX010000038.1 GCA905371675_02049 CDS open 15400-15714 _na     104_aa Phage associated protein
4092 CAJPLX010000038.1 GCA905371675_02050 CDS open 15728-16069 _na     113_aa hypothetical protein
4093 CAJPLX010000038.1 GCA905371675_02051 CDS open 16073-16969 _na     298_aa DNA methylase
4094 CAJPLX010000038.1 GCA905371675_02052 CDS open 17121-17594 _na     157_aa Integral membrane protein
4095 CAJPLX010000038.1 GCA905371675_02033 gene open 66-422 kfrB
4096 CAJPLX010000038.1 GCA905371675_02034 gene open 459-995 kfrC
4097 CAJPLX010000038.1 GCA905371675_02035 gene open 1052-1534 traM
4098 CAJPLX010000038.1 GCA905371675_02036 gene open 1542-2267 traL
4099 CAJPLX010000038.1 GCA905371675_02037 gene open 2268-2687 traK
4100 CAJPLX010000038.1 GCA905371675_02038 gene open 2684-2911
4101 CAJPLX010000038.1 GCA905371675_02039 gene open 3019-3396
4102 CAJPLX010000038.1 GCA905371675_02040 gene open 3399-5792 traI
4103 CAJPLX010000038.1 GCA905371675_02041 gene open 5809-7698 traG
4104 CAJPLX010000038.1 GCA905371675_02042 gene open 7695-8231 traF
4105 CAJPLX010000038.1 GCA905371675_02043 gene open 8234-10429
4106 CAJPLX010000038.1 GCA905371675_02044 gene open 10433-10615 traD
4107 CAJPLX010000038.1 GCA905371675_02045 gene open 10618-13617 traC
4108 CAJPLX010000038.1 GCA905371675_02046 gene open 13626-14120
4109 CAJPLX010000038.1 GCA905371675_02047 gene open 14117-14677
4110 CAJPLX010000038.1 GCA905371675_02048 gene open 14674-15033
4111 CAJPLX010000038.1 GCA905371675_02049 gene open 15400-15714
4112 CAJPLX010000038.1 GCA905371675_02050 gene open 15728-16069
4113 CAJPLX010000038.1 GCA905371675_02051 gene open 16073-16969
4114 CAJPLX010000038.1 GCA905371675_02052 gene open 17121-17594
4115 CAJPLX010000039.1 regulatory_region open 9128-9238 SAM-I/IV (S-adenosyl methionine) riboswitch aptamer
4116 CAJPLX010000039.1 GCA905371675_02053 CDS open 543-1541 _na     332_aa ilvE branched-chain-amino-acid transaminase
4117 CAJPLX010000039.1 GCA905371675_02054 CDS open 1760-2083 _na     107_aa Lipopolysaccharide assembly protein A domain-containing protein
4118 CAJPLX010000039.1 GCA905371675_02055 CDS open 2109-3278 _na     389_aa lapB lipopolysaccharide assembly protein LapB
4119 CAJPLX010000039.1 GCA905371675_02056 CDS open 3466-3921 _na     151_aa N-acetyltransferase domain-containing protein
4120 CAJPLX010000039.1 GCA905371675_02057 CDS open 3998-4504 _na     168_aa Thioredoxin domain-containing protein
4121 CAJPLX010000039.1 GCA905371675_02058 CDS open 4508-7807 _na     1099_aa recC exodeoxyribonuclease V subunit gamma
4122 CAJPLX010000039.1 GCA905371675_02060 CDS open 8138-9019 _na     293_aa lysophospholipid acyltransferase family protein
4123 CAJPLX010000039.1 GCA905371675_02061 CDS open 9412-10581 _na     389_aa metK methionine adenosyltransferase
4124 CAJPLX010000039.1 GCA905371675_02062 CDS open 10692-11819 _na     375_aa DUF1176 domain-containing protein
4125 CAJPLX010000039.1 GCA905371675_02063 CDS open 11944-12264 _na     106_aa ubiK Ubiquinone biosynthesis accessory factor UbiK
4126 CAJPLX010000039.1 GCA905371675_02064 CDS open 12278-13774 _na     498_aa yifB YifB family Mg chelatase-like AAA ATPase
4127 CAJPLX010000039.1 GCA905371675_02065 CDS open 13929-14933 _na     334_aa ftsN Cell division protein FtsN
4128 CAJPLX010000039.1 GCA905371675_02066 CDS open 14947-15588 _na     213_aa Thiol:disulfide interchange protein
4129 CAJPLX010000039.1 GCA905371675_02067 CDS open 15633-16457 _na     274_aa undecaprenyl-diphosphate phosphatase
4130 CAJPLX010000039.1 GCA905371675_02053 gene open 543-1541 ilvE
4131 CAJPLX010000039.1 GCA905371675_02054 gene open 1760-2083
4132 CAJPLX010000039.1 GCA905371675_02055 gene open 2109-3278 lapB
4133 CAJPLX010000039.1 GCA905371675_02056 gene open 3466-3921
4134 CAJPLX010000039.1 GCA905371675_02057 gene open 3998-4504
4135 CAJPLX010000039.1 GCA905371675_02058 gene open 4508-7807 recC
4136 CAJPLX010000039.1 GCA905371675_02060 gene open 8138-9019
4137 CAJPLX010000039.1 GCA905371675_02061 gene open 9412-10581 metK
4138 CAJPLX010000039.1 GCA905371675_02062 gene open 10692-11819
4139 CAJPLX010000039.1 GCA905371675_02063 gene open 11944-12264 ubiK
4140 CAJPLX010000039.1 GCA905371675_02064 gene open 12278-13774 yifB
4141 CAJPLX010000039.1 GCA905371675_02065 gene open 13929-14933 ftsN
4142 CAJPLX010000039.1 GCA905371675_02066 gene open 14947-15588
4143 CAJPLX010000039.1 GCA905371675_02067 gene open 15633-16457
4144 CAJPLX010000039.1 GCA905371675_02059 gene open 8012-8088 trnP
4145 CAJPLX010000039.1 GCA905371675_02059 tRNA open 8012-8088 trnP tRNA-Pro(cgg)
4146 CAJPLX010000040.1 GCA905371675_02069 CDS open 270-545 _na     91_aa secE preprotein translocase subunit SecE
4147 CAJPLX010000040.1 GCA905371675_02070 CDS open 548-1081 _na     177_aa nusG transcription termination/antitermination protein NusG
4148 CAJPLX010000040.1 GCA905371675_02071 CDS open 1186-1620 _na     144_aa rplK 50S ribosomal protein L11
4149 CAJPLX010000040.1 GCA905371675_02072 CDS open 1620-2315 _na     231_aa rplA 50S ribosomal protein L1
4150 CAJPLX010000040.1 GCA905371675_02073 CDS open 2539-3039 _na     166_aa rplJ 50S ribosomal protein L10
4151 CAJPLX010000040.1 GCA905371675_02074 CDS open 3097-3468 _na     123_aa rplL 50S ribosomal protein L7/L12
4152 CAJPLX010000040.1 GCA905371675_02075 CDS open 3607-7836 _na     1409_aa rpoB DNA-directed RNA polymerase subunit beta
4153 CAJPLX010000040.1 GCA905371675_02076 CDS open 7993-12168 _na     1391_aa rpoC DNA-directed RNA polymerase subunit beta'
4154 CAJPLX010000040.1 GCA905371675_02077 CDS open 12440-12658 _na     72_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
4155 CAJPLX010000040.1 GCA905371675_02078 CDS open 12661-13398 _na     245_aa AAA family ATPase
4156 CAJPLX010000040.1 GCA905371675_02079 CDS open 13507-14706 _na     399_aa hypothetical protein
4157 CAJPLX010000040.1 GCA905371675_02080 CDS open 14722-16308 _na     528_aa ftsK FtsK domain-containing protein
4158 CAJPLX010000040.1 GCA905371675_02069 gene open 270-545 secE
4159 CAJPLX010000040.1 GCA905371675_02070 gene open 548-1081 nusG
4160 CAJPLX010000040.1 GCA905371675_02071 gene open 1186-1620 rplK
4161 CAJPLX010000040.1 GCA905371675_02072 gene open 1620-2315 rplA
4162 CAJPLX010000040.1 GCA905371675_02073 gene open 2539-3039 rplJ
4163 CAJPLX010000040.1 GCA905371675_02074 gene open 3097-3468 rplL
4164 CAJPLX010000040.1 GCA905371675_02075 gene open 3607-7836 rpoB
4165 CAJPLX010000040.1 GCA905371675_02076 gene open 7993-12168 rpoC
4166 CAJPLX010000040.1 GCA905371675_02077 gene open 12440-12658
4167 CAJPLX010000040.1 GCA905371675_02078 gene open 12661-13398
4168 CAJPLX010000040.1 GCA905371675_02079 gene open 13507-14706
4169 CAJPLX010000040.1 GCA905371675_02080 gene open 14722-16308 ftsK
4170 CAJPLX010000040.1 GCA905371675_02068 gene open 62-137 trnW
4171 CAJPLX010000040.1 GCA905371675_02068 tRNA open 62-137 trnW tRNA-Trp(cca)
4172 CAJPLX010000041.1 GCA905371675_02095 gene open 11284-11398 yrlA
4173 CAJPLX010000041.1 GCA905371675_02095 ncRNA open 11284-11398 yrlA Y RNA-like
4174 CAJPLX010000041.1 GCA905371675_02081 CDS open 745-1053 _na     102_aa hypothetical protein
4175 CAJPLX010000041.1 GCA905371675_02082 CDS open 1204-1971 _na     255_aa hypothetical protein
4176 CAJPLX010000041.1 GCA905371675_02083 CDS open 1990-2421 _na     143_aa Lipoprotein
4177 CAJPLX010000041.1 GCA905371675_02084 CDS open 2778-2939 _na     53_aa hypothetical protein
4178 CAJPLX010000041.1 GCA905371675_02085 CDS open 3079-3612 _na     177_aa ppa Inorganic pyrophosphatase
4179 CAJPLX010000041.1 GCA905371675_02086 CDS open 3697-4161 _na     154_aa nudB dihydroneopterin triphosphate diphosphatase
4180 CAJPLX010000041.1 GCA905371675_02087 CDS open 4299-4952 _na     217_aa Phosphoesterase
4181 CAJPLX010000041.1 GCA905371675_02088 CDS open 5072-5515 _na     147_aa Ribose 5-phosphate isomerase B
4182 CAJPLX010000041.1 GCA905371675_02089 CDS open 5603-6163 _na     186_aa Ig-like domain-containing protein
4183 CAJPLX010000041.1 GCA905371675_02090 CDS open 6257-7735 _na     492_aa T4 RNA ligase 1-like N-terminal domain-containing protein
4184 CAJPLX010000041.1 GCA905371675_02091 CDS open 7954-8652 _na     232_aa DUF4145 domain-containing protein
4185 CAJPLX010000041.1 GCA905371675_02092 CDS open 8801-10369 _na     522_aa TROVE domain-containing protein
4186 CAJPLX010000041.1 GCA905371675_02094 CDS open 10846-11235 _na     129_aa hypothetical protein
4187 CAJPLX010000041.1 GCA905371675_02097 CDS open 11911-13434 _na     507_aa rtcR RNA repair transcriptional activator RtcR
4188 CAJPLX010000041.1 GCA905371675_02098 CDS open 13625-14452 _na     275_aa fghA S-formylglutathione hydrolase
4189 CAJPLX010000041.1 GCA905371675_02099 CDS open 14461-15597 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
4190 CAJPLX010000041.1 GCA905371675_02081 gene open 745-1053
4191 CAJPLX010000041.1 GCA905371675_02082 gene open 1204-1971
4192 CAJPLX010000041.1 GCA905371675_02083 gene open 1990-2421
4193 CAJPLX010000041.1 GCA905371675_02084 gene open 2778-2939
4194 CAJPLX010000041.1 GCA905371675_02085 gene open 3079-3612 ppa
4195 CAJPLX010000041.1 GCA905371675_02086 gene open 3697-4161 nudB
4196 CAJPLX010000041.1 GCA905371675_02087 gene open 4299-4952
4197 CAJPLX010000041.1 GCA905371675_02088 gene open 5072-5515
4198 CAJPLX010000041.1 GCA905371675_02089 gene open 5603-6163
4199 CAJPLX010000041.1 GCA905371675_02090 gene open 6257-7735
4200 CAJPLX010000041.1 GCA905371675_02091 gene open 7954-8652
4201 CAJPLX010000041.1 GCA905371675_02092 gene open 8801-10369
4202 CAJPLX010000041.1 GCA905371675_02094 gene open 10846-11235
4203 CAJPLX010000041.1 GCA905371675_02097 gene open 11911-13434 rtcR
4204 CAJPLX010000041.1 GCA905371675_02098 gene open 13625-14452 fghA
4205 CAJPLX010000041.1 GCA905371675_02099 gene open 14461-15597 frmA
4206 CAJPLX010000041.1 GCA905371675_02093 gene open 10606-10772
4207 CAJPLX010000041.1 GCA905371675_02096 gene open 11584-11670 trnR
4208 CAJPLX010000041.1 GCA905371675_02093 tRNA open 10606-10772 tRNA-Xxx
4209 CAJPLX010000041.1 GCA905371675_02096 tRNA open 11584-11670 trnR tRNA-Arg(acg)
4210 CAJPLX010000042.1 GCA905371675_02100 CDS open 168-1085 _na     305_aa thrB homoserine kinase
4211 CAJPLX010000042.1 GCA905371675_02101 CDS open 1128-2654 _na     508_aa Multidrug resistance protein B
4212 CAJPLX010000042.1 GCA905371675_02102 CDS open 2756-3946 _na     396_aa emrA Multidrug export protein EmrA
4213 CAJPLX010000042.1 GCA905371675_02103 CDS open 4171-5577 _na     468_aa RND transporter
4214 CAJPLX010000042.1 GCA905371675_02104 CDS open 5627-6121 _na     164_aa marR MarR family transcriptional regulator
4215 CAJPLX010000042.1 GCA905371675_02105 CDS open 6418-7299 _na     293_aa Prephenate dehydrogenase
4216 CAJPLX010000042.1 GCA905371675_02106 CDS open 7408-8700 _na     430_aa hisD Histidinol dehydrogenase
4217 CAJPLX010000042.1 GCA905371675_02107 CDS open 8772-9497 _na     241_aa nfsA oxygen-insensitive NADPH nitroreductase
4218 CAJPLX010000042.1 GCA905371675_02108 CDS open 9546-10199 _na     217_aa hisG ATP phosphoribosyltransferase
4219 CAJPLX010000042.1 GCA905371675_02109 CDS open 10281-10943 _na     220_aa SCO1 protein
4220 CAJPLX010000042.1 GCA905371675_02111 CDS open 11704-13431 _na     575_aa ilvB biosynthetic-type acetolactate synthase large subunit
4221 CAJPLX010000042.1 GCA905371675_02112 CDS open 13442-13933 _na     163_aa ilvN acetolactate synthase small subunit
4222 CAJPLX010000042.1 GCA905371675_02113 CDS open 14000-14293 _na     97_aa ABM domain-containing protein
4223 CAJPLX010000042.1 GCA905371675_02114 CDS open 14355-15368 _na     337_aa ilvC ketol-acid reductoisomerase
4224 CAJPLX010000042.1 GCA905371675_02100 gene open 168-1085 thrB
4225 CAJPLX010000042.1 GCA905371675_02101 gene open 1128-2654
4226 CAJPLX010000042.1 GCA905371675_02102 gene open 2756-3946 emrA
4227 CAJPLX010000042.1 GCA905371675_02103 gene open 4171-5577
4228 CAJPLX010000042.1 GCA905371675_02104 gene open 5627-6121 marR
4229 CAJPLX010000042.1 GCA905371675_02105 gene open 6418-7299
4230 CAJPLX010000042.1 GCA905371675_02106 gene open 7408-8700 hisD
4231 CAJPLX010000042.1 GCA905371675_02107 gene open 8772-9497 nfsA
4232 CAJPLX010000042.1 GCA905371675_02108 gene open 9546-10199 hisG
4233 CAJPLX010000042.1 GCA905371675_02109 gene open 10281-10943
4234 CAJPLX010000042.1 GCA905371675_02111 gene open 11704-13431 ilvB
4235 CAJPLX010000042.1 GCA905371675_02112 gene open 13442-13933 ilvN
4236 CAJPLX010000042.1 GCA905371675_02113 gene open 14000-14293
4237 CAJPLX010000042.1 GCA905371675_02114 gene open 14355-15368 ilvC
4238 CAJPLX010000042.1 GCA905371675_02110 gene open 11229-11313 trnL
4239 CAJPLX010000042.1 GCA905371675_02110 tRNA open 11229-11313 trnL tRNA-Leu(caa)
4240 CAJPLX010000043.1 GCA905371675_02115 CDS open 164-982 _na     272_aa DNA ligase
4241 CAJPLX010000043.1 GCA905371675_02116 CDS open 1078-1728 _na     216_aa Phosphoglycolate phosphatase
4242 CAJPLX010000043.1 GCA905371675_02117 CDS open 1739-2725 _na     328_aa Pseudouridine synthase
4243 CAJPLX010000043.1 GCA905371675_02118 CDS open 3241-6123 _na     960_aa Ribonuclease E
4244 CAJPLX010000043.1 GCA905371675_02119 CDS open 6377-6820 _na     147_aa mscL large conductance mechanosensitive channel protein MscL
4245 CAJPLX010000043.1 GCA905371675_02120 CDS open 7269-8057 _na     262_aa fabI enoyl-ACP reductase FabI
4246 CAJPLX010000043.1 GCA905371675_02121 CDS open 8266-10323 _na     685_aa ppk1 polyphosphate kinase 1
4247 CAJPLX010000043.1 GCA905371675_02122 CDS open 10426-12441 _na     671_aa preP Prolyl endopeptidase
4248 CAJPLX010000043.1 GCA905371675_02123 CDS open 12629-14533 _na     634_aa site-specific DNA-methyltransferase (adenine-specific)
4249 CAJPLX010000043.1 GCA905371675_02115 gene open 164-982
4250 CAJPLX010000043.1 GCA905371675_02116 gene open 1078-1728
4251 CAJPLX010000043.1 GCA905371675_02117 gene open 1739-2725
4252 CAJPLX010000043.1 GCA905371675_02118 gene open 3241-6123
4253 CAJPLX010000043.1 GCA905371675_02119 gene open 6377-6820 mscL
4254 CAJPLX010000043.1 GCA905371675_02120 gene open 7269-8057 fabI
4255 CAJPLX010000043.1 GCA905371675_02121 gene open 8266-10323 ppk1
4256 CAJPLX010000043.1 GCA905371675_02122 gene open 10426-12441 preP
4257 CAJPLX010000043.1 GCA905371675_02123 gene open 12629-14533
4258 CAJPLX010000044.1 GCA905371675_02124 CDS open 313-948 _na     211_aa phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
4259 CAJPLX010000044.1 GCA905371675_02125 CDS open 1037-1837 _na     266_aa PEP/pyruvate-binding domain-containing protein
4260 CAJPLX010000044.1 GCA905371675_02126 CDS open 1884-2918 _na     344_aa PEP/pyruvate-binding domain-containing protein
4261 CAJPLX010000044.1 GCA905371675_02127 CDS open 3430-4098 _na     222_aa Secreted protein
4262 CAJPLX010000044.1 GCA905371675_02128 CDS open 4095-5405 _na     436_aa lipase
4263 CAJPLX010000044.1 GCA905371675_02129 CDS open 6098-7606 _na     502_aa nadB L-aspartate oxidase
4264 CAJPLX010000044.1 GCA905371675_02130 CDS open 7658-8770 _na     370_aa nadA quinolinate synthase NadA
4265 CAJPLX010000044.1 GCA905371675_02131 CDS open 8974-9912 _na     312_aa nadQ NrtR DNA-binding winged helix domain-containing protein
4266 CAJPLX010000044.1 GCA905371675_02132 CDS open 9985-10866 _na     293_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
4267 CAJPLX010000044.1 GCA905371675_02133 CDS open 10812-10916 _na     34_aa hypothetical protein
4268 CAJPLX010000044.1 GCA905371675_02134 CDS open 11254-12966 _na     570_aa TonB-dependent receptor domain-containing protein
4269 CAJPLX010000044.1 GCA905371675_02135 CDS open 12999-13892 _na     297_aa hypothetical protein
4270 CAJPLX010000044.1 GCA905371675_02136 CDS open 13894-14439 _na     181_aa Plug domain-containing protein
4271 CAJPLX010000044.1 GCA905371675_02124 gene open 313-948
4272 CAJPLX010000044.1 GCA905371675_02125 gene open 1037-1837
4273 CAJPLX010000044.1 GCA905371675_02126 gene open 1884-2918
4274 CAJPLX010000044.1 GCA905371675_02127 gene open 3430-4098
4275 CAJPLX010000044.1 GCA905371675_02128 gene open 4095-5405
4276 CAJPLX010000044.1 GCA905371675_02129 gene open 6098-7606 nadB
4277 CAJPLX010000044.1 GCA905371675_02130 gene open 7658-8770 nadA
4278 CAJPLX010000044.1 GCA905371675_02131 gene open 8974-9912 nadQ
4279 CAJPLX010000044.1 GCA905371675_02132 gene open 9985-10866 nadC
4280 CAJPLX010000044.1 GCA905371675_02133 gene open 10812-10916
4281 CAJPLX010000044.1 GCA905371675_02134 gene open 11254-12966
4282 CAJPLX010000044.1 GCA905371675_02135 gene open 12999-13892
4283 CAJPLX010000044.1 GCA905371675_02136 gene open 13894-14439
4284 CAJPLX010000045.1 GCA905371675_02138 CDS open 258-1421 _na     387_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
4285 CAJPLX010000045.1 GCA905371675_02139 CDS open 1494-2060 _na     188_aa Inner membrane protein
4286 CAJPLX010000045.1 GCA905371675_02140 CDS open 2064-3548 _na     494_aa ccoG cytochrome c oxidase accessory protein CcoG
4287 CAJPLX010000045.1 GCA905371675_02141 CDS open 3998-5977 _na     659_aa tkt transketolase
4288 CAJPLX010000045.1 GCA905371675_02142 CDS open 6044-8323 _na     759_aa clpA ATP-dependent Clp protease ATP-binding subunit ClpA
4289 CAJPLX010000045.1 GCA905371675_02143 CDS open 8327-8638 _na     103_aa clpS ATP-dependent Clp protease adapter ClpS
4290 CAJPLX010000045.1 GCA905371675_02144 CDS open 8896-9099 _na     67_aa cspC Cold-shock domain family protein
4291 CAJPLX010000045.1 GCA905371675_02145 CDS open 9175-9390 _na     71_aa Branched-chain amino acid ABC transporter
4292 CAJPLX010000045.1 GCA905371675_02146 CDS open 9475-9921 _na     148_aa smpB SsrA-binding protein SmpB
4293 CAJPLX010000045.1 GCA905371675_02147 CDS open 9993-10433 _na     146_aa Lipoprotein
4294 CAJPLX010000045.1 GCA905371675_02148 CDS open 10506-10991 _na     161_aa DUF4189 domain-containing protein
4295 CAJPLX010000045.1 GCA905371675_02149 CDS open 11257-11595 _na     112_aa hypothetical protein
4296 CAJPLX010000045.1 GCA905371675_02150 CDS open 11592-12218 _na     208_aa hypothetical protein
4297 CAJPLX010000045.1 GCA905371675_02151 CDS open 12267-12794 _na     175_aa paaY Anhydrase
4298 CAJPLX010000045.1 GCA905371675_02152 CDS open 13232-13870 _na     212_aa hemO Heme oxygenase
4299 CAJPLX010000045.1 GCA905371675_02138 gene open 258-1421 pgsA
4300 CAJPLX010000045.1 GCA905371675_02139 gene open 1494-2060
4301 CAJPLX010000045.1 GCA905371675_02140 gene open 2064-3548 ccoG
4302 CAJPLX010000045.1 GCA905371675_02141 gene open 3998-5977 tkt
4303 CAJPLX010000045.1 GCA905371675_02142 gene open 6044-8323 clpA
4304 CAJPLX010000045.1 GCA905371675_02143 gene open 8327-8638 clpS
4305 CAJPLX010000045.1 GCA905371675_02144 gene open 8896-9099 cspC
4306 CAJPLX010000045.1 GCA905371675_02145 gene open 9175-9390
4307 CAJPLX010000045.1 GCA905371675_02146 gene open 9475-9921 smpB
4308 CAJPLX010000045.1 GCA905371675_02147 gene open 9993-10433
4309 CAJPLX010000045.1 GCA905371675_02148 gene open 10506-10991
4310 CAJPLX010000045.1 GCA905371675_02149 gene open 11257-11595
4311 CAJPLX010000045.1 GCA905371675_02150 gene open 11592-12218
4312 CAJPLX010000045.1 GCA905371675_02151 gene open 12267-12794 paaY
4313 CAJPLX010000045.1 GCA905371675_02152 gene open 13232-13870 hemO
4314 CAJPLX010000045.1 GCA905371675_02137 gene open 88-163 trnG
4315 CAJPLX010000045.1 GCA905371675_02137 tRNA open 88-163 trnG tRNA-Gly(gcc)
4316 CAJPLX010000046.1 GCA905371675_02153 CDS open 113-940 _na     275_aa yktD Tetracenomycin polyketide synthesis O-methyltransferase TcmP
4317 CAJPLX010000046.1 GCA905371675_02154 CDS open 1075-2118 _na     347_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
4318 CAJPLX010000046.1 GCA905371675_02155 CDS open 2147-3391 _na     414_aa ftsW putative lipid II flippase FtsW
4319 CAJPLX010000046.1 GCA905371675_02156 CDS open 3681-5177 _na     498_aa gatA Aspartyl/glutamyl-tRNA amidotransferase subunit A
4320 CAJPLX010000046.1 GCA905371675_02157 CDS open 5380-5940 _na     186_aa ErfK/YbiS/YcfS/YnhG
4321 CAJPLX010000046.1 GCA905371675_02158 CDS open 5954-7291 _na     445_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
4322 CAJPLX010000046.1 GCA905371675_02159 CDS open 7337-8812 _na     491_aa hypothetical protein
4323 CAJPLX010000046.1 GCA905371675_02160 CDS open 8862-9386 _na     174_aa t-SNARE coiled-coil-like y domain-containing protein
4324 CAJPLX010000046.1 GCA905371675_02161 CDS open 9411-10421 _na     336_aa hypothetical protein
4325 CAJPLX010000046.1 GCA905371675_02162 CDS open 10481-10852 _na     123_aa hypothetical protein
4326 CAJPLX010000046.1 GCA905371675_02163 CDS open 11341-11934 _na     197_aa Lipoprotein
4327 CAJPLX010000046.1 GCA905371675_02164 CDS open 11966-12337 _na     123_aa hypothetical protein
4328 CAJPLX010000046.1 GCA905371675_02153 gene open 113-940 yktD
4329 CAJPLX010000046.1 GCA905371675_02154 gene open 1075-2118 murG
4330 CAJPLX010000046.1 GCA905371675_02155 gene open 2147-3391 ftsW
4331 CAJPLX010000046.1 GCA905371675_02156 gene open 3681-5177 gatA
4332 CAJPLX010000046.1 GCA905371675_02157 gene open 5380-5940
4333 CAJPLX010000046.1 GCA905371675_02158 gene open 5954-7291 murD
4334 CAJPLX010000046.1 GCA905371675_02159 gene open 7337-8812
4335 CAJPLX010000046.1 GCA905371675_02160 gene open 8862-9386
4336 CAJPLX010000046.1 GCA905371675_02161 gene open 9411-10421
4337 CAJPLX010000046.1 GCA905371675_02162 gene open 10481-10852
4338 CAJPLX010000046.1 GCA905371675_02163 gene open 11341-11934
4339 CAJPLX010000046.1 GCA905371675_02164 gene open 11966-12337
4340 CAJPLX010000047.1 GCA905371675_02165 CDS open 249-1268 _na     339_aa virB11 P-type DNA transfer ATPase VirB11
4341 CAJPLX010000047.1 GCA905371675_02166 CDS open 1340-3037 _na     565_aa calcium-binding protein
4342 CAJPLX010000047.1 GCA905371675_02167 CDS open 3049-3702 _na     217_aa Lipoprotein
4343 CAJPLX010000047.1 GCA905371675_02168 CDS open 3766-5457 _na     563_aa TRAG family protein
4344 CAJPLX010000047.1 GCA905371675_02169 CDS open 5788-6936 _na     382_aa TrbI/VirB10 family protein
4345 CAJPLX010000047.1 GCA905371675_02170 CDS open 7116-7505 _na     129_aa virB2 VirB2 protein
4346 CAJPLX010000047.1 GCA905371675_02171 CDS open 7515-7820 _na     101_aa virB3 type IV secretion system protein VirB3
4347 CAJPLX010000047.1 GCA905371675_02172 CDS open 7817-10333 _na     838_aa virB4 Type IV secretion system protein virB4
4348 CAJPLX010000047.1 GCA905371675_02165 gene open 249-1268 virB11
4349 CAJPLX010000047.1 GCA905371675_02166 gene open 1340-3037
4350 CAJPLX010000047.1 GCA905371675_02167 gene open 3049-3702
4351 CAJPLX010000047.1 GCA905371675_02168 gene open 3766-5457
4352 CAJPLX010000047.1 GCA905371675_02169 gene open 5788-6936
4353 CAJPLX010000047.1 GCA905371675_02170 gene open 7116-7505 virB2
4354 CAJPLX010000047.1 GCA905371675_02171 gene open 7515-7820 virB3
4355 CAJPLX010000047.1 GCA905371675_02172 gene open 7817-10333 virB4
4356 CAJPLX010000048.1 GCA905371675_02173 CDS open 393-1124 _na     243_aa hypothetical protein
4357 CAJPLX010000048.1 GCA905371675_02174 CDS open 1203-2780 _na     525_aa hypothetical protein
4358 CAJPLX010000048.1 GCA905371675_02175 CDS open 2795-4726 _na     643_aa adhesin
4359 CAJPLX010000048.1 GCA905371675_02176 CDS open 5189-6661 _na     490_aa pyk pyruvate kinase
4360 CAJPLX010000048.1 GCA905371675_02177 CDS open 6875-7378 _na     167_aa Integral membrane protein
4361 CAJPLX010000048.1 GCA905371675_02178 CDS open 7444-7569 _na     41_aa Lipoprotein
4362 CAJPLX010000048.1 GCA905371675_02179 CDS open 7593-8456 _na     287_aa Aminoalkylphosphonate N-acetyltransferase
4363 CAJPLX010000048.1 GCA905371675_02180 CDS open 8732-9142 _na     136_aa Integral membrane protein
4364 CAJPLX010000048.1 GCA905371675_02181 CDS open 9179-9343 _na     54_aa hypothetical protein
4365 CAJPLX010000048.1 GCA905371675_02173 gene open 393-1124
4366 CAJPLX010000048.1 GCA905371675_02174 gene open 1203-2780
4367 CAJPLX010000048.1 GCA905371675_02175 gene open 2795-4726
4368 CAJPLX010000048.1 GCA905371675_02176 gene open 5189-6661 pyk
4369 CAJPLX010000048.1 GCA905371675_02177 gene open 6875-7378
4370 CAJPLX010000048.1 GCA905371675_02178 gene open 7444-7569
4371 CAJPLX010000048.1 GCA905371675_02179 gene open 7593-8456
4372 CAJPLX010000048.1 GCA905371675_02180 gene open 8732-9142
4373 CAJPLX010000048.1 GCA905371675_02181 gene open 9179-9343
4374 CAJPLX010000049.1 GCA905371675_02182 CDS open 106-723 _na     205_aa UDP-glucose 4-epimerase
4375 CAJPLX010000049.1 GCA905371675_02183 CDS open 840-1907 _na     355_aa rffG dTDP-glucose 4%2C6-dehydratase
4376 CAJPLX010000049.1 GCA905371675_02184 CDS open 1981-2847 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
4377 CAJPLX010000049.1 GCA905371675_02185 CDS open 2886-3440 _na     184_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
4378 CAJPLX010000049.1 GCA905371675_02186 CDS open 3465-5162 _na     565_aa lipA Capsule polysaccharide modification protein LipA
4379 CAJPLX010000049.1 GCA905371675_02187 CDS open 5245-5577 _na     110_aa hypothetical protein
4380 CAJPLX010000049.1 GCA905371675_02188 CDS open 5714-6163 _na     149_aa Capsule polysaccharide biosynthesis protein
4381 CAJPLX010000049.1 GCA905371675_02189 CDS open 6117-6512 _na     131_aa hypothetical protein
4382 CAJPLX010000049.1 GCA905371675_02190 CDS open 6522-6749 _na     75_aa hypothetical protein
4383 CAJPLX010000049.1 GCA905371675_02182 gene open 106-723
4384 CAJPLX010000049.1 GCA905371675_02183 gene open 840-1907 rffG
4385 CAJPLX010000049.1 GCA905371675_02184 gene open 1981-2847 rfbA
4386 CAJPLX010000049.1 GCA905371675_02185 gene open 2886-3440 rfbC
4387 CAJPLX010000049.1 GCA905371675_02186 gene open 3465-5162 lipA
4388 CAJPLX010000049.1 GCA905371675_02187 gene open 5245-5577
4389 CAJPLX010000049.1 GCA905371675_02188 gene open 5714-6163
4390 CAJPLX010000049.1 GCA905371675_02189 gene open 6117-6512
4391 CAJPLX010000049.1 GCA905371675_02190 gene open 6522-6749
4392 CAJPLX010000050.1 GCA905371675_02191 CDS open 140-2245 _na     701_aa fusA elongation factor G
4393 CAJPLX010000050.1 GCA905371675_02192 CDS open 2264-2734 _na     156_aa rpsG 30S ribosomal protein S7
4394 CAJPLX010000050.1 GCA905371675_02193 CDS open 2852-3223 _na     123_aa rpsL 30S ribosomal protein S12
4395 CAJPLX010000050.1 GCA905371675_02194 CDS open 3515-4318 _na     267_aa tnp IS5 family transposase
4396 CAJPLX010000050.1 GCA905371675_02195 CDS open 4607-6205 _na     532_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
4397 CAJPLX010000050.1 GCA905371675_02191 gene open 140-2245 fusA
4398 CAJPLX010000050.1 GCA905371675_02192 gene open 2264-2734 rpsG
4399 CAJPLX010000050.1 GCA905371675_02193 gene open 2852-3223 rpsL
4400 CAJPLX010000050.1 GCA905371675_02194 gene open 3515-4318 tnp
4401 CAJPLX010000050.1 GCA905371675_02195 gene open 4607-6205 cysI
4402 CAJPLX010000051.1 GCA905371675_02196 CDS open 351-917 _na     188_aa GDSL-like protein
4403 CAJPLX010000051.1 GCA905371675_02197 CDS open 1040-1297 _na     85_aa Thiol-activated cytolysin C-terminal domain-containing protein
4404 CAJPLX010000051.1 GCA905371675_02198 CDS open 1385-3547 _na     720_aa zntA Cation transporter E1-E2 family ATPase
4405 CAJPLX010000051.1 GCA905371675_02199 CDS open 3698-3907 _na     69_aa HMA domain-containing protein
4406 CAJPLX010000051.1 GCA905371675_02200 CDS open 4053-5225 _na     390_aa sugar transporter
4407 CAJPLX010000051.1 GCA905371675_02196 gene open 351-917
4408 CAJPLX010000051.1 GCA905371675_02197 gene open 1040-1297
4409 CAJPLX010000051.1 GCA905371675_02198 gene open 1385-3547 zntA
4410 CAJPLX010000051.1 GCA905371675_02199 gene open 3698-3907
4411 CAJPLX010000051.1 GCA905371675_02200 gene open 4053-5225
4412 CAJPLX010000052.1 GCA905371675_02201 CDS open 348-1043 _na     231_aa IS6 family transposase
4413 CAJPLX010000052.1 GCA905371675_02202 CDS open 1036-1272 _na     78_aa Plasmid replication protein
4414 CAJPLX010000052.1 GCA905371675_02203 CDS open 1500-1661 _na     53_aa hsdD HsdD protein
4415 CAJPLX010000052.1 GCA905371675_02204 CDS open 1886-2686 _na     266_aa ecfA2 Cobalt transport system ATP-binding protein
4416 CAJPLX010000052.1 GCA905371675_02205 CDS open 2673-3509 _na     278_aa ecfA2 Cobalt/nickel transport system ATP-binding protein
4417 CAJPLX010000052.1 GCA905371675_02206 CDS open 3485-4279 _na     264_aa ecfT Cobalt transport protein
4418 CAJPLX010000052.1 GCA905371675_02207 CDS open 4276-4878 _na     200_aa ECF transporter S component
4419 CAJPLX010000052.1 GCA905371675_02201 gene open 348-1043
4420 CAJPLX010000052.1 GCA905371675_02202 gene open 1036-1272
4421 CAJPLX010000052.1 GCA905371675_02203 gene open 1500-1661 hsdD
4422 CAJPLX010000052.1 GCA905371675_02204 gene open 1886-2686 ecfA2
4423 CAJPLX010000052.1 GCA905371675_02205 gene open 2673-3509 ecfA2
4424 CAJPLX010000052.1 GCA905371675_02206 gene open 3485-4279 ecfT
4425 CAJPLX010000052.1 GCA905371675_02207 gene open 4276-4878
4426 CAJPLX010000053.1 GCA905371675_02208 CDS open 42-1901 _na     619_aa nhhA Autotransporter adhesin NhhA
4427 CAJPLX010000053.1 GCA905371675_02209 CDS open 2057-4678 _na     873_aa pepN aminopeptidase N
4428 CAJPLX010000053.1 GCA905371675_02208 gene open 42-1901 nhhA
4429 CAJPLX010000053.1 GCA905371675_02209 gene open 2057-4678 pepN
4430 CAJPLX010000054.1 GCA905371675_02210 CDS open 63-740 _na     225_aa hypothetical protein
4431 CAJPLX010000054.1 GCA905371675_02211 CDS open 835-2028 _na     397_aa type IV secretion system protein
4432 CAJPLX010000054.1 GCA905371675_02212 CDS open 2314-2823 _na     169_aa DUF4189 domain-containing protein
4433 CAJPLX010000054.1 GCA905371675_02213 CDS open 2905-3213 _na     102_aa TrbM/KikA/MpfK family conjugal transfer protein
4434 CAJPLX010000054.1 GCA905371675_02214 CDS open 3394-3831 _na     145_aa hypothetical protein
4435 CAJPLX010000054.1 GCA905371675_02215 CDS open 3889-4389 _na     166_aa DUF4189 domain-containing protein
4436 CAJPLX010000054.1 GCA905371675_02210 gene open 63-740
4437 CAJPLX010000054.1 GCA905371675_02211 gene open 835-2028
4438 CAJPLX010000054.1 GCA905371675_02212 gene open 2314-2823
4439 CAJPLX010000054.1 GCA905371675_02213 gene open 2905-3213
4440 CAJPLX010000054.1 GCA905371675_02214 gene open 3394-3831
4441 CAJPLX010000054.1 GCA905371675_02215 gene open 3889-4389
4442 CAJPLX010000055.1 GCA905371675_02216 CDS open 264-1067 _na     267_aa tnp IS5 family transposase
4443 CAJPLX010000055.1 GCA905371675_02217 CDS open 1338-4256 _na     972_aa autotransporter outer membrane beta-barrel domain-containing protein
4444 CAJPLX010000055.1 GCA905371675_02216 gene open 264-1067 tnp
4445 CAJPLX010000055.1 GCA905371675_02217 gene open 1338-4256
4446 CAJPLX010000056.1 GCA905371675_02218 CDS open 227-442 _na     71_aa hypothetical protein
4447 CAJPLX010000056.1 GCA905371675_02219 CDS open 977-1543 _na     188_aa hypothetical protein
4448 CAJPLX010000056.1 GCA905371675_02220 CDS open 1668-2081 _na     137_aa hypothetical protein
4449 CAJPLX010000056.1 GCA905371675_02221 CDS open 2437-2562 _na     41_aa hypothetical protein
4450 CAJPLX010000056.1 GCA905371675_02222 CDS open 2645-3292 _na     215_aa frpC RTX iron-regulated FrpC family protein
4451 CAJPLX010000056.1 GCA905371675_02223 CDS open 3768-4118 _na     116_aa Transposase Synechocystis PCC 6803 domain-containing protein
4452 CAJPLX010000056.1 GCA905371675_02218 gene open 227-442
4453 CAJPLX010000056.1 GCA905371675_02219 gene open 977-1543
4454 CAJPLX010000056.1 GCA905371675_02220 gene open 1668-2081
4455 CAJPLX010000056.1 GCA905371675_02221 gene open 2437-2562
4456 CAJPLX010000056.1 GCA905371675_02222 gene open 2645-3292 frpC
4457 CAJPLX010000056.1 GCA905371675_02223 gene open 3768-4118
4458 CAJPLX010000057.1 GCA905371675_02224 CDS open 446-757 _na     103_aa hypothetical protein
4459 CAJPLX010000057.1 GCA905371675_02225 CDS open 821-1504 _na     227_aa hypothetical protein
4460 CAJPLX010000057.1 GCA905371675_02226 CDS open 2191-3711 _na     506_aa hypothetical protein
4461 CAJPLX010000057.1 GCA905371675_02224 gene open 446-757
4462 CAJPLX010000057.1 GCA905371675_02225 gene open 821-1504
4463 CAJPLX010000057.1 GCA905371675_02226 gene open 2191-3711