HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_905371675.1)

Select a Genome:
BAKTA Annotations for GCA_905371675.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
57 2245144 2162 0 1 53
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4463 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4463 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPLX010000008.1 GCA905371675_00989 gene open 60386-60925
2002 CAJPLX010000008.1 GCA905371675_00990 gene open 60940-61539
2003 CAJPLX010000008.1 GCA905371675_00991 gene open 61628-62407 rsmA
2004 CAJPLX010000008.1 GCA905371675_00992 gene open 62415-62738
2005 CAJPLX010000008.1 GCA905371675_00993 gene open 62738-63466 glnQ
2006 CAJPLX010000008.1 GCA905371675_00994 gene open 63530-63889 vacJ
2007 CAJPLX010000008.1 GCA905371675_00995 gene open 64002-64346
2008 CAJPLX010000008.1 GCA905371675_00996 gene open 64385-65668 folC
2009 CAJPLX010000008.1 GCA905371675_00997 gene open 65682-66827 ftsN
2010 CAJPLX010000008.1 GCA905371675_00998 gene open 66820-67353 cvpA
2011 CAJPLX010000008.1 GCA905371675_00999 gene open 67506-69050 purF
2012 CAJPLX010000008.1 GCA905371675_01000 gene open 69125-69616 greB
2013 CAJPLX010000008.1 GCA905371675_01001 gene open 69898-70830
2014 CAJPLX010000008.1 GCA905371675_01002 gene open 70827-71957
2015 CAJPLX010000008.1 GCA905371675_01003 gene open 72123-72734 plsY
2016 CAJPLX010000008.1 GCA905371675_01004 gene open 72792-73142 folB
2017 CAJPLX010000008.1 GCA905371675_01005 gene open 73189-73836
2018 CAJPLX010000008.1 GCA905371675_01006 gene open 73922-74458
2019 CAJPLX010000008.1 GCA905371675_01007 gene open 74588-75226
2020 CAJPLX010000008.1 GCA905371675_01008 gene open 75266-76060 speE
2021 CAJPLX010000008.1 GCA905371675_01009 gene open 76276-76351 trnT
2022 CAJPLX010000008.1 GCA905371675_01010 gene open 76396-76439
2023 CAJPLX010000008.1 GCA905371675_01009 tRNA open 76276-76351 trnT tRNA-Thr(tgt)
2024 CAJPLX010000008.1 GCA905371675_01010 tRNA open 76396-76439 tRNA-Xxx
2025 CAJPLX010000009.1 regulatory_region open 3578-3677 TPP riboswitch aptamer (THI element)
2026 CAJPLX010000009.1 GCA905371675_01011 CDS open 277-1281 _na     334_aa quinone-dependent dihydroorotate dehydrogenase
2027 CAJPLX010000009.1 GCA905371675_01012 CDS open 1338-2030 _na     230_aa rnhB ribonuclease HII
2028 CAJPLX010000009.1 GCA905371675_01013 CDS open 2086-3231 _na     381_aa Fusaric acid resistance protein conserved region
2029 CAJPLX010000009.1 GCA905371675_01015 CDS open 3771-5660 _na     629_aa thiC phosphomethylpyrimidine synthase ThiC
2030 CAJPLX010000009.1 GCA905371675_01016 CDS open 5752-7290 _na     512_aa murJ murein biosynthesis integral membrane protein MurJ
2031 CAJPLX010000009.1 GCA905371675_01017 CDS open 7300-8475 _na     391_aa lpxB lipid-A-disaccharide synthase
2032 CAJPLX010000009.1 GCA905371675_01018 CDS open 8638-9414 _na     258_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2033 CAJPLX010000009.1 GCA905371675_01019 CDS open 9489-9938 _na     149_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2034 CAJPLX010000009.1 GCA905371675_01020 CDS open 10012-11052 _na     346_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
2035 CAJPLX010000009.1 GCA905371675_01021 CDS open 11154-11663 _na     169_aa Outer membrane protein chaperone
2036 CAJPLX010000009.1 GCA905371675_01022 CDS open 11775-14171 _na     798_aa bamA outer membrane protein assembly factor BamA
2037 CAJPLX010000009.1 GCA905371675_01023 CDS open 14175-15515 _na     446_aa rseP RIP metalloprotease RseP
2038 CAJPLX010000009.1 GCA905371675_01024 CDS open 15647-16864 _na     405_aa ispC 1-deoxy-D-xylulose-5-phosphate reductoisomerase
2039 CAJPLX010000009.1 GCA905371675_01025 CDS open 16946-17695 _na     249_aa SIMPL domain-containing protein
2040 CAJPLX010000009.1 GCA905371675_01026 CDS open 17729-18496 _na     255_aa Phosphatidate cytidylyltransferase
2041 CAJPLX010000009.1 GCA905371675_01027 CDS open 18529-19275 _na     248_aa isoprenyl transferase
2042 CAJPLX010000009.1 GCA905371675_01028 CDS open 19333-19890 _na     185_aa frr ribosome recycling factor
2043 CAJPLX010000009.1 GCA905371675_01029 CDS open 20423-21028 _na     201_aa Lipoprotein
2044 CAJPLX010000009.1 GCA905371675_01030 CDS open 21339-21638 _na     99_aa Inner membrane protein
2045 CAJPLX010000009.1 GCA905371675_01031 CDS open 21859-23301 _na     480_aa nuoN NADH-quinone oxidoreductase subunit NuoN
2046 CAJPLX010000009.1 GCA905371675_01032 CDS open 23311-24807 _na     498_aa nuoM NADH-quinone oxidoreductase subunit M
2047 CAJPLX010000009.1 GCA905371675_01033 CDS open 24903-26927 _na     674_aa nuoL NADH-quinone oxidoreductase subunit L
2048 CAJPLX010000009.1 GCA905371675_01034 CDS open 26930-27235 _na     101_aa nuoK NADH-quinone oxidoreductase subunit NuoK
2049 CAJPLX010000009.1 GCA905371675_01035 CDS open 27232-27903 _na     223_aa nuoJ NADH-quinone oxidoreductase subunit J
2050 CAJPLX010000009.1 GCA905371675_01036 CDS open 27915-28394 _na     159_aa nuoI NADH-quinone oxidoreductase subunit NuoI
2051 CAJPLX010000009.1 GCA905371675_01037 CDS open 28492-28650 _na     52_aa hypothetical protein
2052 CAJPLX010000009.1 GCA905371675_01038 CDS open 29184-30260 _na     358_aa nuoH NADH-quinone oxidoreductase subunit NuoH
2053 CAJPLX010000009.1 GCA905371675_01039 CDS open 30263-32524 _na     753_aa nuoG NADH-quinone oxidoreductase subunit NuoG
2054 CAJPLX010000009.1 GCA905371675_01040 CDS open 32905-33261 _na     118_aa DUF559 domain-containing protein
2055 CAJPLX010000009.1 GCA905371675_01041 CDS open 33447-34742 _na     431_aa nuoF NADH-quinone oxidoreductase subunit NuoF
2056 CAJPLX010000009.1 GCA905371675_01042 CDS open 35097-35225 _na     42_aa hypothetical protein
2057 CAJPLX010000009.1 GCA905371675_01043 CDS open 35349-36044 _na     231_aa DUF1566 domain-containing protein
2058 CAJPLX010000009.1 GCA905371675_01044 CDS open 36139-36612 _na     157_aa nuoE NADH-quinone oxidoreductase subunit NuoE
2059 CAJPLX010000009.1 GCA905371675_01045 CDS open 36612-37868 _na     418_aa nuoD NADH-quinone oxidoreductase subunit D
2060 CAJPLX010000009.1 GCA905371675_01046 CDS open 37858-38451 _na     197_aa nuoC NADH-quinone oxidoreductase subunit C
2061 CAJPLX010000009.1 GCA905371675_01047 CDS open 38464-38946 _na     160_aa nuoB NADH-quinone oxidoreductase subunit B
2062 CAJPLX010000009.1 GCA905371675_01048 CDS open 38937-39293 _na     118_aa nuoA NADH-quinone oxidoreductase subunit A
2063 CAJPLX010000009.1 GCA905371675_01049 CDS open 39631-41088 _na     485_aa Di-/tripeptide transporter
2064 CAJPLX010000009.1 GCA905371675_01050 CDS open 41539-42642 _na     367_aa prfB peptide chain release factor 2
2065 CAJPLX010000009.1 GCA905371675_01051 CDS open 42740-43456 _na     238_aa truC tRNA pseudouridine(65) synthase TruC
2066 CAJPLX010000009.1 GCA905371675_01052 CDS open 43597-44325 _na     242_aa ppnN Cytokinin riboside 5'-monophosphate phosphoribohydrolase
2067 CAJPLX010000009.1 GCA905371675_01053 CDS open 44422-44913 _na     163_aa Surface-adhesin protein E-like domain-containing protein
2068 CAJPLX010000009.1 GCA905371675_01054 CDS open 44915-45562 _na     215_aa hypothetical protein
2069 CAJPLX010000009.1 GCA905371675_01055 CDS open 45688-47544 _na     618_aa mdlB Multidrug export ATP-binding/permease protein
2070 CAJPLX010000009.1 GCA905371675_01056 CDS open 47772-48995 _na     407_aa sstT serine/threonine transporter SstT
2071 CAJPLX010000009.1 GCA905371675_01057 CDS open 49443-51284 _na     613_aa tamA Translocation and assembly module subunit TamA
2072 CAJPLX010000009.1 GCA905371675_01058 CDS open 51365-55513 _na     1382_aa tamB Translocation/assembly module TamB
2073 CAJPLX010000009.1 GCA905371675_01059 CDS open 55753-55926 _na     57_aa Zinc-finger domain-containing protein
2074 CAJPLX010000009.1 GCA905371675_01060 CDS open 55939-56517 _na     192_aa RNA polymerase sigma factor
2075 CAJPLX010000009.1 GCA905371675_01061 CDS open 56519-56713 _na     64_aa hypothetical protein
2076 CAJPLX010000009.1 GCA905371675_01062 CDS open 56660-57346 _na     228_aa DNA-binding domain-containing protein
2077 CAJPLX010000009.1 GCA905371675_01063 CDS open 57336-58178 _na     280_aa UPF0276 protein NMB2142
2078 CAJPLX010000009.1 GCA905371675_01064 CDS open 58265-58582 _na     105_aa Periplasmic protein
2079 CAJPLX010000009.1 GCA905371675_01065 CDS open 58666-59115 _na     149_aa doxX DoxX family protein
2080 CAJPLX010000009.1 GCA905371675_01066 CDS open 59339-61648 _na     769_aa recQ DNA helicase RecQ
2081 CAJPLX010000009.1 GCA905371675_01067 CDS open 61865-62200 _na     111_aa phnA Putative alkylphosphonate utilization operon protein PhnA
2082 CAJPLX010000009.1 GCA905371675_01068 CDS open 62260-62598 _na     112_aa Periplasmic protein
2083 CAJPLX010000009.1 GCA905371675_01069 CDS open 62890-64284 _na     464_aa gltX glutamate--tRNA ligase
2084 CAJPLX010000009.1 GCA905371675_01070 CDS open 64449-65543 _na     364_aa Vitamin B12-binding protein
2085 CAJPLX010000009.1 GCA905371675_01071 CDS open 65614-66270 _na     218_aa DUF218 domain-containing protein
2086 CAJPLX010000009.1 GCA905371675_01072 CDS open 66296-66655 _na     119_aa arsC arsenate reductase (glutaredoxin)
2087 CAJPLX010000009.1 GCA905371675_01073 CDS open 66825-67307 _na     160_aa Redoxin family protein
2088 CAJPLX010000009.1 GCA905371675_01074 CDS open 67386-70406 _na     1006_aa type I site-specific deoxyribonuclease
2089 CAJPLX010000009.1 GCA905371675_01075 CDS open 70501-71583 _na     360_aa restriction endonuclease subunit S
2090 CAJPLX010000009.1 GCA905371675_01011 gene open 277-1281
2091 CAJPLX010000009.1 GCA905371675_01012 gene open 1338-2030 rnhB
2092 CAJPLX010000009.1 GCA905371675_01013 gene open 2086-3231
2093 CAJPLX010000009.1 GCA905371675_01015 gene open 3771-5660 thiC
2094 CAJPLX010000009.1 GCA905371675_01016 gene open 5752-7290 murJ
2095 CAJPLX010000009.1 GCA905371675_01017 gene open 7300-8475 lpxB
2096 CAJPLX010000009.1 GCA905371675_01018 gene open 8638-9414 lpxA
2097 CAJPLX010000009.1 GCA905371675_01019 gene open 9489-9938 fabZ
2098 CAJPLX010000009.1 GCA905371675_01020 gene open 10012-11052 lpxD
2099 CAJPLX010000009.1 GCA905371675_01021 gene open 11154-11663
2100 CAJPLX010000009.1 GCA905371675_01022 gene open 11775-14171 bamA
2101 CAJPLX010000009.1 GCA905371675_01023 gene open 14175-15515 rseP
2102 CAJPLX010000009.1 GCA905371675_01024 gene open 15647-16864 ispC
2103 CAJPLX010000009.1 GCA905371675_01025 gene open 16946-17695
2104 CAJPLX010000009.1 GCA905371675_01026 gene open 17729-18496
2105 CAJPLX010000009.1 GCA905371675_01027 gene open 18529-19275
2106 CAJPLX010000009.1 GCA905371675_01028 gene open 19333-19890 frr
2107 CAJPLX010000009.1 GCA905371675_01029 gene open 20423-21028
2108 CAJPLX010000009.1 GCA905371675_01030 gene open 21339-21638
2109 CAJPLX010000009.1 GCA905371675_01031 gene open 21859-23301 nuoN
2110 CAJPLX010000009.1 GCA905371675_01032 gene open 23311-24807 nuoM
2111 CAJPLX010000009.1 GCA905371675_01033 gene open 24903-26927 nuoL
2112 CAJPLX010000009.1 GCA905371675_01034 gene open 26930-27235 nuoK
2113 CAJPLX010000009.1 GCA905371675_01035 gene open 27232-27903 nuoJ
2114 CAJPLX010000009.1 GCA905371675_01036 gene open 27915-28394 nuoI
2115 CAJPLX010000009.1 GCA905371675_01037 gene open 28492-28650
2116 CAJPLX010000009.1 GCA905371675_01038 gene open 29184-30260 nuoH
2117 CAJPLX010000009.1 GCA905371675_01039 gene open 30263-32524 nuoG
2118 CAJPLX010000009.1 GCA905371675_01040 gene open 32905-33261
2119 CAJPLX010000009.1 GCA905371675_01041 gene open 33447-34742 nuoF
2120 CAJPLX010000009.1 GCA905371675_01042 gene open 35097-35225
2121 CAJPLX010000009.1 GCA905371675_01043 gene open 35349-36044
2122 CAJPLX010000009.1 GCA905371675_01044 gene open 36139-36612 nuoE
2123 CAJPLX010000009.1 GCA905371675_01045 gene open 36612-37868 nuoD
2124 CAJPLX010000009.1 GCA905371675_01046 gene open 37858-38451 nuoC
2125 CAJPLX010000009.1 GCA905371675_01047 gene open 38464-38946 nuoB
2126 CAJPLX010000009.1 GCA905371675_01048 gene open 38937-39293 nuoA
2127 CAJPLX010000009.1 GCA905371675_01049 gene open 39631-41088
2128 CAJPLX010000009.1 GCA905371675_01050 gene open 41539-42642 prfB
2129 CAJPLX010000009.1 GCA905371675_01051 gene open 42740-43456 truC
2130 CAJPLX010000009.1 GCA905371675_01052 gene open 43597-44325 ppnN
2131 CAJPLX010000009.1 GCA905371675_01053 gene open 44422-44913
2132 CAJPLX010000009.1 GCA905371675_01054 gene open 44915-45562
2133 CAJPLX010000009.1 GCA905371675_01055 gene open 45688-47544 mdlB
2134 CAJPLX010000009.1 GCA905371675_01056 gene open 47772-48995 sstT
2135 CAJPLX010000009.1 GCA905371675_01057 gene open 49443-51284 tamA
2136 CAJPLX010000009.1 GCA905371675_01058 gene open 51365-55513 tamB
2137 CAJPLX010000009.1 GCA905371675_01059 gene open 55753-55926
2138 CAJPLX010000009.1 GCA905371675_01060 gene open 55939-56517
2139 CAJPLX010000009.1 GCA905371675_01061 gene open 56519-56713
2140 CAJPLX010000009.1 GCA905371675_01062 gene open 56660-57346
2141 CAJPLX010000009.1 GCA905371675_01063 gene open 57336-58178
2142 CAJPLX010000009.1 GCA905371675_01064 gene open 58265-58582
2143 CAJPLX010000009.1 GCA905371675_01065 gene open 58666-59115 doxX
2144 CAJPLX010000009.1 GCA905371675_01066 gene open 59339-61648 recQ
2145 CAJPLX010000009.1 GCA905371675_01067 gene open 61865-62200 phnA
2146 CAJPLX010000009.1 GCA905371675_01068 gene open 62260-62598
2147 CAJPLX010000009.1 GCA905371675_01069 gene open 62890-64284 gltX
2148 CAJPLX010000009.1 GCA905371675_01070 gene open 64449-65543
2149 CAJPLX010000009.1 GCA905371675_01071 gene open 65614-66270
2150 CAJPLX010000009.1 GCA905371675_01072 gene open 66296-66655 arsC
2151 CAJPLX010000009.1 GCA905371675_01073 gene open 66825-67307
2152 CAJPLX010000009.1 GCA905371675_01074 gene open 67386-70406
2153 CAJPLX010000009.1 GCA905371675_01075 gene open 70501-71583
2154 CAJPLX010000009.1 GCA905371675_01014 gene open 3391-3467 trnfM
2155 CAJPLX010000009.1 GCA905371675_01014 tRNA open 3391-3467 trnfM tRNA-fMet(cat)
2156 CAJPLX010000010.1 GCA905371675_01113 gene open 40656-40742 NmsRb
2157 CAJPLX010000010.1 GCA905371675_01114 gene open 40850-40940 NmsRb
2158 CAJPLX010000010.1 GCA905371675_01113 ncRNA open 40656-40742 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
2159 CAJPLX010000010.1 GCA905371675_01114 ncRNA open 40850-40940 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
2160 CAJPLX010000010.1 GCA905371675_01076 CDS open 367-1359 _na     330_aa Slam-dependent surface lipoprotein
2161 CAJPLX010000010.1 GCA905371675_01077 CDS open 1414-3831 _na     805_aa cirA TonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein
2162 CAJPLX010000010.1 GCA905371675_01078 CDS open 4041-5651 _na     536_aa FAD dependent oxidoreductase domain-containing protein
2163 CAJPLX010000010.1 GCA905371675_01079 CDS open 5777-6367 _na     196_aa diphosphoinositol-polyphosphate diphosphatase
2164 CAJPLX010000010.1 GCA905371675_01080 CDS open 6441-7259 _na     272_aa cysE serine O-acetyltransferase
2165 CAJPLX010000010.1 GCA905371675_01081 CDS open 7420-7971 _na     183_aa grpE Protein GrpE
2166 CAJPLX010000010.1 GCA905371675_01082 CDS open 8276-10204 _na     642_aa dnaK molecular chaperone DnaK
2167 CAJPLX010000010.1 GCA905371675_01083 CDS open 10473-10691 _na     72_aa Acid shock protein
2168 CAJPLX010000010.1 GCA905371675_01084 CDS open 10765-12105 _na     446_aa DUF2868 domain-containing protein
2169 CAJPLX010000010.1 GCA905371675_01086 CDS open 12510-13175 _na     221_aa GAF domain-containing protein
2170 CAJPLX010000010.1 GCA905371675_01087 CDS open 13168-13761 _na     197_aa GTP cyclohydrolase-2
2171 CAJPLX010000010.1 GCA905371675_01090 CDS open 14263-16287 _na     674_aa parE DNA topoisomerase IV subunit B
2172 CAJPLX010000010.1 GCA905371675_01091 CDS open 16317-16838 _na     173_aa RNA pyrophosphohydrolase
2173 CAJPLX010000010.1 GCA905371675_01092 CDS open 17182-18327 _na     381_aa Putrescine-binding periplasmic protein
2174 CAJPLX010000010.1 GCA905371675_01093 CDS open 18435-18707 _na     90_aa aCT ACT domain-containing protein
2175 CAJPLX010000010.1 GCA905371675_01094 CDS open 18723-20078 _na     451_aa UPF0210 protein NMA1908
2176 CAJPLX010000010.1 GCA905371675_01095 CDS open 20147-21676 _na     509_aa cedB AAA+ ATPase domain-containing protein
2177 CAJPLX010000010.1 GCA905371675_01096 CDS open 21920-23149 _na     409_aa Bcr/CflA family efflux transporter
2178 CAJPLX010000010.1 GCA905371675_01097 CDS open 23211-24020 _na     269_aa murI glutamate racemase
2179 CAJPLX010000010.1 GCA905371675_01098 CDS open 24125-24223 _na     32_aa UvrB/UvrC motif-containing protein
2180 CAJPLX010000010.1 GCA905371675_01099 CDS open 24295-24546 _na     83_aa Anaerobic benzoate catabolism transcriptional regulator
2181 CAJPLX010000010.1 GCA905371675_01100 CDS open 24709-24927 _na     72_aa hypothetical protein
2182 CAJPLX010000010.1 GCA905371675_01101 CDS open 24899-25117 _na     72_aa Stress-induced protein
2183 CAJPLX010000010.1 GCA905371675_01102 CDS open 25120-25257 _na     45_aa hypothetical protein
2184 CAJPLX010000010.1 GCA905371675_01103 CDS open 25767-26432 _na     221_aa pgmB beta-phosphoglucomutase
2185 CAJPLX010000010.1 GCA905371675_01104 CDS open 26445-28703 _na     752_aa aTH1 Family 65 glycosyl hydrolase
2186 CAJPLX010000010.1 GCA905371675_01105 CDS open 28778-30130 _na     450_aa melB Sugar transporter
2187 CAJPLX010000010.1 GCA905371675_01106 CDS open 30177-30287 _na     36_aa hypothetical protein
2188 CAJPLX010000010.1 GCA905371675_01107 CDS open 30471-32147 _na     558_aa ettA energy-dependent translational throttle protein EttA
2189 CAJPLX010000010.1 GCA905371675_01108 CDS open 32211-32846 _na     211_aa mtrR HTH-type transcriptional regulator MtrR
2190 CAJPLX010000010.1 GCA905371675_01109 CDS open 33072-34340 _na     422_aa acrE Multidrug export protein AcrE
2191 CAJPLX010000010.1 GCA905371675_01110 CDS open 34352-37564 _na     1070_aa Efflux pump membrane transporter
2192 CAJPLX010000010.1 GCA905371675_01111 CDS open 37620-39026 _na     468_aa oprM Outer membrane protein OprM
2193 CAJPLX010000010.1 GCA905371675_01112 CDS open 39100-40437 _na     445_aa G domain-containing protein
2194 CAJPLX010000010.1 GCA905371675_01115 CDS open 41011-41496 _na     161_aa Putative AsnC-family transcriptional regulator
2195 CAJPLX010000010.1 GCA905371675_01116 CDS open 41689-42747 _na     352_aa alr alanine racemase
2196 CAJPLX010000010.1 GCA905371675_01117 CDS open 42807-43550 _na     247_aa rsuA Dual-specificity RNA pseudouridine synthase RluF
2197 CAJPLX010000010.1 GCA905371675_01118 CDS open 43881-45962 _na     693_aa cstA Carbon starvation protein A
2198 CAJPLX010000010.1 GCA905371675_01119 CDS open 45952-46146 _na     64_aa ybdD Small protein yjiX
2199 CAJPLX010000010.1 GCA905371675_01120 CDS open 46267-46557 _na     96_aa merR MerR family transcriptional regulator
2200 CAJPLX010000010.1 GCA905371675_01121 CDS open 46573-47532 _na     319_aa dnaJ Curved DNA-binding protein
2201 CAJPLX010000010.1 GCA905371675_01122 CDS open 47738-48220 _na     160_aa DUF4410 domain-containing protein
2202 CAJPLX010000010.1 GCA905371675_01123 CDS open 48393-49097 _na     234_aa lysM LysM domain-containing protein
2203 CAJPLX010000010.1 GCA905371675_01124 CDS open 49368-51752 _na     794_aa ppsA phosphoenolpyruvate synthase
2204 CAJPLX010000010.1 GCA905371675_01125 CDS open 52169-52990 _na     273_aa ppsR Putative phosphoenolpyruvate synthase regulatory protein
2205 CAJPLX010000010.1 GCA905371675_01126 CDS open 53046-53612 _na     188_aa dcd dCTP deaminase
2206 CAJPLX010000010.1 GCA905371675_01127 CDS open 53738-54166 _na     142_aa MORN repeat protein
2207 CAJPLX010000010.1 GCA905371675_01128 CDS open 54195-54977 _na     260_aa ADP-ribosylglycohydrolase
2208 CAJPLX010000010.1 GCA905371675_01129 CDS open 55056-55955 _na     299_aa rdgC Recombination-associated protein RdgC
2209 CAJPLX010000010.1 GCA905371675_01131 CDS open 56287-57582 _na     431_aa serS serine--tRNA ligase
2210 CAJPLX010000010.1 GCA905371675_01132 CDS open 57649-57888 _na     79_aa Hemolysin
2211 CAJPLX010000010.1 GCA905371675_01133 CDS open 58018-58821 _na     267_aa ABC transporter arginine-binding protein 2
2212 CAJPLX010000010.1 GCA905371675_01134 CDS open 58898-59149 _na     83_aa NGO1151 family protein
2213 CAJPLX010000010.1 GCA905371675_01135 CDS open 59312-60112 _na     266_aa DUF2894 domain-containing protein
2214 CAJPLX010000010.1 GCA905371675_01136 CDS open 60272-60793 _na     173_aa DUF3465 domain-containing protein
2215 CAJPLX010000010.1 GCA905371675_01137 CDS open 60865-62076 _na     403_aa metZ O-succinylhomoserine sulfhydrylase
2216 CAJPLX010000010.1 GCA905371675_01138 CDS open 62166-62372 _na     68_aa DUF2788 domain-containing protein
2217 CAJPLX010000010.1 GCA905371675_01139 CDS open 62442-62693 _na     83_aa HAD-IIB family hydrolase
2218 CAJPLX010000010.1 GCA905371675_01076 gene open 367-1359
2219 CAJPLX010000010.1 GCA905371675_01077 gene open 1414-3831 cirA
2220 CAJPLX010000010.1 GCA905371675_01078 gene open 4041-5651
2221 CAJPLX010000010.1 GCA905371675_01079 gene open 5777-6367
2222 CAJPLX010000010.1 GCA905371675_01080 gene open 6441-7259 cysE
2223 CAJPLX010000010.1 GCA905371675_01081 gene open 7420-7971 grpE
2224 CAJPLX010000010.1 GCA905371675_01082 gene open 8276-10204 dnaK
2225 CAJPLX010000010.1 GCA905371675_01083 gene open 10473-10691
2226 CAJPLX010000010.1 GCA905371675_01084 gene open 10765-12105
2227 CAJPLX010000010.1 GCA905371675_01086 gene open 12510-13175
2228 CAJPLX010000010.1 GCA905371675_01087 gene open 13168-13761
2229 CAJPLX010000010.1 GCA905371675_01090 gene open 14263-16287 parE
2230 CAJPLX010000010.1 GCA905371675_01091 gene open 16317-16838
2231 CAJPLX010000010.1 GCA905371675_01092 gene open 17182-18327
2232 CAJPLX010000010.1 GCA905371675_01093 gene open 18435-18707 aCT
2233 CAJPLX010000010.1 GCA905371675_01094 gene open 18723-20078
2234 CAJPLX010000010.1 GCA905371675_01095 gene open 20147-21676 cedB
2235 CAJPLX010000010.1 GCA905371675_01096 gene open 21920-23149
2236 CAJPLX010000010.1 GCA905371675_01097 gene open 23211-24020 murI
2237 CAJPLX010000010.1 GCA905371675_01098 gene open 24125-24223
2238 CAJPLX010000010.1 GCA905371675_01099 gene open 24295-24546
2239 CAJPLX010000010.1 GCA905371675_01100 gene open 24709-24927
2240 CAJPLX010000010.1 GCA905371675_01101 gene open 24899-25117
2241 CAJPLX010000010.1 GCA905371675_01102 gene open 25120-25257
2242 CAJPLX010000010.1 GCA905371675_01103 gene open 25767-26432 pgmB
2243 CAJPLX010000010.1 GCA905371675_01104 gene open 26445-28703 aTH1
2244 CAJPLX010000010.1 GCA905371675_01105 gene open 28778-30130 melB
2245 CAJPLX010000010.1 GCA905371675_01106 gene open 30177-30287
2246 CAJPLX010000010.1 GCA905371675_01107 gene open 30471-32147 ettA
2247 CAJPLX010000010.1 GCA905371675_01108 gene open 32211-32846 mtrR
2248 CAJPLX010000010.1 GCA905371675_01109 gene open 33072-34340 acrE
2249 CAJPLX010000010.1 GCA905371675_01110 gene open 34352-37564
2250 CAJPLX010000010.1 GCA905371675_01111 gene open 37620-39026 oprM
2251 CAJPLX010000010.1 GCA905371675_01112 gene open 39100-40437
2252 CAJPLX010000010.1 GCA905371675_01115 gene open 41011-41496
2253 CAJPLX010000010.1 GCA905371675_01116 gene open 41689-42747 alr
2254 CAJPLX010000010.1 GCA905371675_01117 gene open 42807-43550 rsuA
2255 CAJPLX010000010.1 GCA905371675_01118 gene open 43881-45962 cstA
2256 CAJPLX010000010.1 GCA905371675_01119 gene open 45952-46146 ybdD
2257 CAJPLX010000010.1 GCA905371675_01120 gene open 46267-46557 merR
2258 CAJPLX010000010.1 GCA905371675_01121 gene open 46573-47532 dnaJ
2259 CAJPLX010000010.1 GCA905371675_01122 gene open 47738-48220
2260 CAJPLX010000010.1 GCA905371675_01123 gene open 48393-49097 lysM
2261 CAJPLX010000010.1 GCA905371675_01124 gene open 49368-51752 ppsA
2262 CAJPLX010000010.1 GCA905371675_01125 gene open 52169-52990 ppsR
2263 CAJPLX010000010.1 GCA905371675_01126 gene open 53046-53612 dcd
2264 CAJPLX010000010.1 GCA905371675_01127 gene open 53738-54166
2265 CAJPLX010000010.1 GCA905371675_01128 gene open 54195-54977
2266 CAJPLX010000010.1 GCA905371675_01129 gene open 55056-55955 rdgC
2267 CAJPLX010000010.1 GCA905371675_01131 gene open 56287-57582 serS
2268 CAJPLX010000010.1 GCA905371675_01132 gene open 57649-57888
2269 CAJPLX010000010.1 GCA905371675_01133 gene open 58018-58821
2270 CAJPLX010000010.1 GCA905371675_01134 gene open 58898-59149
2271 CAJPLX010000010.1 GCA905371675_01135 gene open 59312-60112
2272 CAJPLX010000010.1 GCA905371675_01136 gene open 60272-60793
2273 CAJPLX010000010.1 GCA905371675_01137 gene open 60865-62076 metZ
2274 CAJPLX010000010.1 GCA905371675_01138 gene open 62166-62372
2275 CAJPLX010000010.1 GCA905371675_01139 gene open 62442-62693
2276 CAJPLX010000010.1 GCA905371675_01085 gene open 12264-12348 trnL
2277 CAJPLX010000010.1 GCA905371675_01088 gene open 13887-13962 trnV
2278 CAJPLX010000010.1 GCA905371675_01089 gene open 13995-14071 trnD
2279 CAJPLX010000010.1 GCA905371675_01130 gene open 56087-56162 trnE
2280 CAJPLX010000010.1 GCA905371675_01085 tRNA open 12264-12348 trnL tRNA-Leu(tag)
2281 CAJPLX010000010.1 GCA905371675_01088 tRNA open 13887-13962 trnV tRNA-Val(tac)
2282 CAJPLX010000010.1 GCA905371675_01089 tRNA open 13995-14071 trnD tRNA-Asp(gtc)
2283 CAJPLX010000010.1 GCA905371675_01130 tRNA open 56087-56162 trnE tRNA-Glu(ttc)
2284 CAJPLX010000011.1 GCA905371675_01152 gene open 13621-13982 RNaseP_bact_a
2285 CAJPLX010000011.1 GCA905371675_01152 ncRNA open 13621-13982 Bacterial RNase P class A
2286 CAJPLX010000011.1 GCA905371675_01140 CDS open 106-1875 _na     589_aa ggt gamma-glutamyltransferase
2287 CAJPLX010000011.1 GCA905371675_01141 CDS open 2357-3805 _na     482_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
2288 CAJPLX010000011.1 GCA905371675_01142 CDS open 4001-4951 _na     316_aa 4-phosphoerythronate dehydrogenase
2289 CAJPLX010000011.1 GCA905371675_01143 CDS open 5080-5298 _na     72_aa DUF2061 domain-containing protein
2290 CAJPLX010000011.1 GCA905371675_01144 CDS open 5463-7613 _na     716_aa dinG ATP-dependent DNA helicase DinG
2291 CAJPLX010000011.1 GCA905371675_01145 CDS open 7683-8138 _na     151_aa Acetyltransferase%2C GNAT family
2292 CAJPLX010000011.1 GCA905371675_01146 CDS open 8135-8539 _na     134_aa hypothetical protein
2293 CAJPLX010000011.1 GCA905371675_01147 CDS open 8655-9137 _na     160_aa Dihydrofolate reductase
2294 CAJPLX010000011.1 GCA905371675_01148 CDS open 9331-10131 _na     266_aa factor H-binding protein
2295 CAJPLX010000011.1 GCA905371675_01149 CDS open 10222-11337 _na     371_aa Aspartate-semialdehyde dehydrogenase
2296 CAJPLX010000011.1 GCA905371675_01150 CDS open 11511-12101 _na     196_aa RDD family protein
2297 CAJPLX010000011.1 GCA905371675_01151 CDS open 12191-13513 _na     440_aa mltA peptidoglycan lytic exotransglycosylase
2298 CAJPLX010000011.1 GCA905371675_01153 CDS open 14035-14742 _na     235_aa Lipoprotein
2299 CAJPLX010000011.1 GCA905371675_01154 CDS open 14797-15030 _na     77_aa Methionine-binding protein
2300 CAJPLX010000011.1 GCA905371675_01155 CDS open 15044-15628 _na     194_aa ruvA Holliday junction branch migration protein RuvA
2301 CAJPLX010000011.1 GCA905371675_01156 CDS open 15727-16443 _na     238_aa rlpA Endolytic peptidoglycan transglycosylase RlpA
2302 CAJPLX010000011.1 GCA905371675_01157 CDS open 16492-16956 _na     154_aa trmL tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL
2303 CAJPLX010000011.1 GCA905371675_01158 CDS open 17021-17518 _na     165_aa Competence protein
2304 CAJPLX010000011.1 GCA905371675_01159 CDS open 17736-18482 _na     248_aa bioH pimeloyl-ACP methyl ester esterase BioH
2305 CAJPLX010000011.1 GCA905371675_01160 CDS open 18574-22497 _na     1307_aa DNA helicase
2306 CAJPLX010000011.1 GCA905371675_01161 CDS open 22497-24506 _na     669_aa PIN domain-containing protein
2307 CAJPLX010000011.1 GCA905371675_01162 CDS open 24499-24996 _na     165_aa PIN domain-containing protein
2308 CAJPLX010000011.1 GCA905371675_01163 CDS open 25037-26143 _na     368_aa DUF1351 domain-containing protein
2309 CAJPLX010000011.1 GCA905371675_01164 CDS open 26153-27988 _na     611_aa ATPase
2310 CAJPLX010000011.1 GCA905371675_01165 CDS open 27988-28572 _na     194_aa Anaerobic ribonucleoside-triphosphate reductase-activating protein
2311 CAJPLX010000011.1 GCA905371675_01166 CDS open 28657-29451 _na     264_aa Methyltransferase type 11 domain-containing protein
2312 CAJPLX010000011.1 GCA905371675_01167 CDS open 29566-29814 _na     82_aa BolA-like protein
2313 CAJPLX010000011.1 GCA905371675_01168 CDS open 29941-30267 _na     108_aa fbp FK506-binding protein
2314 CAJPLX010000011.1 GCA905371675_01169 CDS open 30410-31585 _na     391_aa Cytochrome c peroxidase
2315 CAJPLX010000011.1 GCA905371675_01170 CDS open 31966-32790 _na     274_aa efeU iron uptake transporter permease EfeU
2316 CAJPLX010000011.1 GCA905371675_01171 CDS open 32803-33969 _na     388_aa efeO iron uptake system protein EfeO
2317 CAJPLX010000011.1 GCA905371675_01172 CDS open 34105-35370 _na     421_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
2318 CAJPLX010000011.1 GCA905371675_01173 CDS open 35453-35920 _na     155_aa pncC Nicotinamide-nucleotide amidohydrolase PncC
2319 CAJPLX010000011.1 GCA905371675_01174 CDS open 35996-36841 _na     281_aa Small-conductance mechanosensitive channel
2320 CAJPLX010000011.1 GCA905371675_01175 CDS open 36955-37956 _na     333_aa Thiamine-binding periplasmic protein
2321 CAJPLX010000011.1 GCA905371675_01176 CDS open 38021-38668 _na     215_aa pyrimidine 5'-nucleotidase
2322 CAJPLX010000011.1 GCA905371675_01177 CDS open 38730-39014 _na     94_aa Spore cortex protein
2323 CAJPLX010000011.1 GCA905371675_01178 CDS open 39113-40486 _na     457_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2324 CAJPLX010000011.1 GCA905371675_01179 CDS open 40810-41208 _na     132_aa hypothetical protein
2325 CAJPLX010000011.1 GCA905371675_01180 CDS open 41371-43209 _na     612_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2326 CAJPLX010000011.1 GCA905371675_01181 CDS open 43283-44140 _na     285_aa hypothetical protein
2327 CAJPLX010000011.1 GCA905371675_01182 CDS open 44171-44353 _na     60_aa hypothetical protein
2328 CAJPLX010000011.1 GCA905371675_01183 CDS open 44437-45306 _na     289_aa hypothetical protein
2329 CAJPLX010000011.1 GCA905371675_01184 CDS open 45327-46700 _na     457_aa calcium-binding protein
2330 CAJPLX010000011.1 GCA905371675_01185 CDS open 46839-48137 _na     432_aa Zinc protease
2331 CAJPLX010000011.1 GCA905371675_01186 CDS open 48196-49545 _na     449_aa Zinc protease
2332 CAJPLX010000011.1 GCA905371675_01187 CDS open 49739-50917 _na     392_aa pgk Phosphoglycerate kinase
2333 CAJPLX010000011.1 GCA905371675_01188 CDS open 51083-53218 _na     711_aa yccS Integral membrane protein YccS N-terminal domain-containing protein
2334 CAJPLX010000011.1 GCA905371675_01189 CDS open 53384-54613 _na     409_aa Twitching mobility protein
2335 CAJPLX010000011.1 GCA905371675_01190 CDS open 54700-55746 _na     348_aa pilT Twitching motility protein PilT
2336 CAJPLX010000011.1 GCA905371675_01191 CDS open 55864-56559 _na     231_aa Pyridoxal phosphate homeostasis protein
2337 CAJPLX010000011.1 GCA905371675_01192 CDS open 56636-57433 _na     265_aa proC pyrroline-5-carboxylate reductase
2338 CAJPLX010000011.1 GCA905371675_01193 CDS open 57436-57993 _na     185_aa YGGT family protein
2339 CAJPLX010000011.1 GCA905371675_01194 CDS open 58227-58643 _na     138_aa dksA RNA polymerase-binding protein DksA
2340 CAJPLX010000011.1 GCA905371675_01140 gene open 106-1875 ggt
2341 CAJPLX010000011.1 GCA905371675_01141 gene open 2357-3805 gnd
2342 CAJPLX010000011.1 GCA905371675_01142 gene open 4001-4951
2343 CAJPLX010000011.1 GCA905371675_01143 gene open 5080-5298
2344 CAJPLX010000011.1 GCA905371675_01144 gene open 5463-7613 dinG
2345 CAJPLX010000011.1 GCA905371675_01145 gene open 7683-8138
2346 CAJPLX010000011.1 GCA905371675_01146 gene open 8135-8539
2347 CAJPLX010000011.1 GCA905371675_01147 gene open 8655-9137
2348 CAJPLX010000011.1 GCA905371675_01148 gene open 9331-10131
2349 CAJPLX010000011.1 GCA905371675_01149 gene open 10222-11337
2350 CAJPLX010000011.1 GCA905371675_01150 gene open 11511-12101
2351 CAJPLX010000011.1 GCA905371675_01151 gene open 12191-13513 mltA
2352 CAJPLX010000011.1 GCA905371675_01153 gene open 14035-14742
2353 CAJPLX010000011.1 GCA905371675_01154 gene open 14797-15030
2354 CAJPLX010000011.1 GCA905371675_01155 gene open 15044-15628 ruvA
2355 CAJPLX010000011.1 GCA905371675_01156 gene open 15727-16443 rlpA
2356 CAJPLX010000011.1 GCA905371675_01157 gene open 16492-16956 trmL
2357 CAJPLX010000011.1 GCA905371675_01158 gene open 17021-17518
2358 CAJPLX010000011.1 GCA905371675_01159 gene open 17736-18482 bioH
2359 CAJPLX010000011.1 GCA905371675_01160 gene open 18574-22497
2360 CAJPLX010000011.1 GCA905371675_01161 gene open 22497-24506
2361 CAJPLX010000011.1 GCA905371675_01162 gene open 24499-24996
2362 CAJPLX010000011.1 GCA905371675_01163 gene open 25037-26143
2363 CAJPLX010000011.1 GCA905371675_01164 gene open 26153-27988
2364 CAJPLX010000011.1 GCA905371675_01165 gene open 27988-28572
2365 CAJPLX010000011.1 GCA905371675_01166 gene open 28657-29451
2366 CAJPLX010000011.1 GCA905371675_01167 gene open 29566-29814
2367 CAJPLX010000011.1 GCA905371675_01168 gene open 29941-30267 fbp
2368 CAJPLX010000011.1 GCA905371675_01169 gene open 30410-31585
2369 CAJPLX010000011.1 GCA905371675_01170 gene open 31966-32790 efeU
2370 CAJPLX010000011.1 GCA905371675_01171 gene open 32803-33969 efeO
2371 CAJPLX010000011.1 GCA905371675_01172 gene open 34105-35370 efeB
2372 CAJPLX010000011.1 GCA905371675_01173 gene open 35453-35920 pncC
2373 CAJPLX010000011.1 GCA905371675_01174 gene open 35996-36841
2374 CAJPLX010000011.1 GCA905371675_01175 gene open 36955-37956
2375 CAJPLX010000011.1 GCA905371675_01176 gene open 38021-38668
2376 CAJPLX010000011.1 GCA905371675_01177 gene open 38730-39014
2377 CAJPLX010000011.1 GCA905371675_01178 gene open 39113-40486 glmU
2378 CAJPLX010000011.1 GCA905371675_01179 gene open 40810-41208
2379 CAJPLX010000011.1 GCA905371675_01180 gene open 41371-43209 glmS
2380 CAJPLX010000011.1 GCA905371675_01181 gene open 43283-44140
2381 CAJPLX010000011.1 GCA905371675_01182 gene open 44171-44353
2382 CAJPLX010000011.1 GCA905371675_01183 gene open 44437-45306
2383 CAJPLX010000011.1 GCA905371675_01184 gene open 45327-46700
2384 CAJPLX010000011.1 GCA905371675_01185 gene open 46839-48137
2385 CAJPLX010000011.1 GCA905371675_01186 gene open 48196-49545
2386 CAJPLX010000011.1 GCA905371675_01187 gene open 49739-50917 pgk
2387 CAJPLX010000011.1 GCA905371675_01188 gene open 51083-53218 yccS
2388 CAJPLX010000011.1 GCA905371675_01189 gene open 53384-54613
2389 CAJPLX010000011.1 GCA905371675_01190 gene open 54700-55746 pilT
2390 CAJPLX010000011.1 GCA905371675_01191 gene open 55864-56559
2391 CAJPLX010000011.1 GCA905371675_01192 gene open 56636-57433 proC
2392 CAJPLX010000011.1 GCA905371675_01193 gene open 57436-57993
2393 CAJPLX010000011.1 GCA905371675_01194 gene open 58227-58643 dksA
2394 CAJPLX010000012.1 repeat_region open 15102-16401 CRISPR array with 20 repeats of length 36%2C consensus sequence GTTGTAGCTCCCTTTCTCATTTCGCAGTGCTACAAT and spacer length 30
2395 CAJPLX010000012.1 GCA905371675_01195 CDS open 73-384 _na     103_aa Small ribosomal subunit protein uS10
2396 CAJPLX010000012.1 GCA905371675_01196 CDS open 636-1280 _na     214_aa rplC 50S ribosomal protein L3
2397 CAJPLX010000012.1 GCA905371675_01197 CDS open 1280-1900 _na     206_aa rplD 50S ribosomal protein L4
2398 CAJPLX010000012.1 GCA905371675_01198 CDS open 1897-2211 _na     104_aa rplW 50S ribosomal protein L23
2399 CAJPLX010000012.1 GCA905371675_01199 CDS open 2217-3050 _na     277_aa rplB 50S ribosomal protein L2
2400 CAJPLX010000012.1 GCA905371675_01200 CDS open 3056-3334 _na     92_aa rpsS 30S ribosomal protein S19
2401 CAJPLX010000012.1 GCA905371675_01201 CDS open 3343-3672 _na     109_aa rplV 50S ribosomal protein L22
2402 CAJPLX010000012.1 GCA905371675_01202 CDS open 3682-4374 _na     230_aa rpsC 30S ribosomal protein S3
2403 CAJPLX010000012.1 GCA905371675_01203 CDS open 4358-4774 _na     138_aa rplP 50S ribosomal protein L16
2404 CAJPLX010000012.1 GCA905371675_01204 CDS open 4774-4965 _na     63_aa rpmC 50S ribosomal protein L29
2405 CAJPLX010000012.1 GCA905371675_01205 CDS open 4965-5228 _na     87_aa rpsQ 30S ribosomal protein S17
2406 CAJPLX010000012.1 GCA905371675_01206 CDS open 5456-5824 _na     122_aa rplN 50S ribosomal protein L14
2407 CAJPLX010000012.1 GCA905371675_01207 CDS open 5836-6159 _na     107_aa rplX 50S ribosomal protein L24
2408 CAJPLX010000012.1 GCA905371675_01208 CDS open 6169-6708 _na     179_aa rplE 50S ribosomal protein L5
2409 CAJPLX010000012.1 GCA905371675_01209 CDS open 6711-7016 _na     101_aa rpsN 30S ribosomal protein S14
2410 CAJPLX010000012.1 GCA905371675_01210 CDS open 7031-7423 _na     130_aa rpsH 30S ribosomal protein S8
2411 CAJPLX010000012.1 GCA905371675_01211 CDS open 7437-7970 _na     177_aa rplF 50S ribosomal protein L6
2412 CAJPLX010000012.1 GCA905371675_01212 CDS open 7984-8337 _na     117_aa rplR 50S ribosomal protein L18
2413 CAJPLX010000012.1 GCA905371675_01213 CDS open 8355-8873 _na     172_aa rpsE 30S ribosomal protein S5
2414 CAJPLX010000012.1 GCA905371675_01214 CDS open 8866-9051 _na     61_aa rpmD 50S ribosomal protein L30
2415 CAJPLX010000012.1 GCA905371675_01215 CDS open 9053-9487 _na     144_aa rplO 50S ribosomal protein L15
2416 CAJPLX010000012.1 GCA905371675_01216 CDS open 9501-10814 _na     437_aa secY preprotein translocase subunit SecY
2417 CAJPLX010000012.1 GCA905371675_01217 CDS open 10819-11037 _na     72_aa infA translation initiation factor IF-1
2418 CAJPLX010000012.1 GCA905371675_01218 CDS open 11056-11169 _na     37_aa rpmJ 50S ribosomal protein L36
2419 CAJPLX010000012.1 GCA905371675_01219 CDS open 11237-11599 _na     120_aa rpsM 30S ribosomal protein S13
2420 CAJPLX010000012.1 GCA905371675_01220 CDS open 11619-12014 _na     131_aa rpsK 30S ribosomal protein S11
2421 CAJPLX010000012.1 GCA905371675_01221 CDS open 12034-12654 _na     206_aa rpsD 30S ribosomal protein S4
2422 CAJPLX010000012.1 GCA905371675_01222 CDS open 12680-13666 _na     328_aa rpoA DNA-directed RNA polymerase subunit alpha
2423 CAJPLX010000012.1 GCA905371675_01223 CDS open 13691-14065 _na     124_aa rplQ 50S ribosomal protein L17
2424 CAJPLX010000012.1 GCA905371675_01224 CDS open 16455-16763 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
2425 CAJPLX010000012.1 GCA905371675_01225 CDS open 16774-17688 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
2426 CAJPLX010000012.1 GCA905371675_01226 CDS open 17755-21036 _na     1093_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2427 CAJPLX010000012.1 GCA905371675_01227 CDS open 21273-22697 _na     474_aa alsT Amino acid carrier protein
2428 CAJPLX010000012.1 GCA905371675_01228 CDS open 22960-24471 _na     503_aa lysS lysine--tRNA ligase
2429 CAJPLX010000012.1 GCA905371675_01229 CDS open 24651-26093 _na     480_aa aldA aldehyde dehydrogenase
2430 CAJPLX010000012.1 GCA905371675_01231 CDS open 26653-27051 _na     132_aa Ag473 family lipoprotein
2431 CAJPLX010000012.1 GCA905371675_01232 CDS open 27115-28089 _na     324_aa terC Tellurium resistance protein TerC
2432 CAJPLX010000012.1 GCA905371675_01233 CDS open 28123-28572 _na     149_aa Integral membrane protein
2433 CAJPLX010000012.1 GCA905371675_01234 CDS open 28827-29039 _na     70_aa Glycine zipper 2TM domain-containing protein
2434 CAJPLX010000012.1 GCA905371675_01235 CDS open 29104-30024 _na     306_aa lysR Hydrogen peroxide-inducible genes activator
2435 CAJPLX010000012.1 GCA905371675_01236 CDS open 30028-30291 _na     87_aa minE cell division topological specificity factor MinE
2436 CAJPLX010000012.1 GCA905371675_01237 CDS open 30295-31110 _na     271_aa minD septum site-determining protein MinD
2437 CAJPLX010000012.1 GCA905371675_01238 CDS open 31137-31856 _na     239_aa minC septum site-determining protein MinC
2438 CAJPLX010000012.1 GCA905371675_01239 CDS open 32004-33239 _na     411_aa Deoxyribodipyrimidine photolyase
2439 CAJPLX010000012.1 GCA905371675_01240 CDS open 33366-34223 _na     285_aa ATP-grasp domain-containing protein
2440 CAJPLX010000012.1 GCA905371675_01241 CDS open 34594-35985 _na     463_aa alsT Amino acid carrier protein
2441 CAJPLX010000012.1 GCA905371675_01242 CDS open 36069-37325 _na     418_aa dadA D-amino acid dehydrogenase
2442 CAJPLX010000012.1 GCA905371675_01243 CDS open 37506-38315 _na     269_aa zupT zinc transporter ZupT
2443 CAJPLX010000012.1 GCA905371675_01244 CDS open 38412-41243 _na     943_aa valS valine--tRNA ligase
2444 CAJPLX010000012.1 GCA905371675_01245 CDS open 41299-41757 _na     152_aa lipocalin family protein
2445 CAJPLX010000012.1 GCA905371675_01246 CDS open 41857-42330 _na     157_aa lipocalin family protein
2446 CAJPLX010000012.1 GCA905371675_01247 CDS open 42439-43380 _na     313_aa potA Spermidine/putrescine import ATP-binding protein PotA
2447 CAJPLX010000012.1 GCA905371675_01248 CDS open 43396-44286 _na     296_aa Isopentenyl-diphosphate Delta-isomerase
2448 CAJPLX010000012.1 GCA905371675_01249 CDS open 44407-45012 _na     201_aa Carbonate dehydratase
2449 CAJPLX010000012.1 GCA905371675_01250 CDS open 45009-45614 _na     201_aa nadD nicotinate-nucleotide adenylyltransferase
2450 CAJPLX010000012.1 GCA905371675_01251 CDS open 45673-46059 _na     128_aa rsfS ribosome silencing factor
2451 CAJPLX010000012.1 GCA905371675_01252 CDS open 46168-47562 _na     464_aa hrpA ATP-dependent RNA helicase HrpA
2452 CAJPLX010000012.1 GCA905371675_01253 CDS open 47881-49293 _na     470_aa Fido domain-containing protein
2453 CAJPLX010000012.1 GCA905371675_01254 CDS open 49655-51232 _na     525_aa opgE Sulfatase
2454 CAJPLX010000012.1 GCA905371675_01255 CDS open 51334-54543 _na     1069_aa hrpA ATP-dependent RNA helicase HrpA
2455 CAJPLX010000012.1 GCA905371675_01256 CDS open 54566-54988 _na     140_aa vsr Type II nicking enzyme V-NmeAIP
2456 CAJPLX010000012.1 GCA905371675_01257 CDS open 54994-55728 _na     244_aa hypothetical protein
2457 CAJPLX010000012.1 GCA905371675_01195 gene open 73-384
2458 CAJPLX010000012.1 GCA905371675_01196 gene open 636-1280 rplC
2459 CAJPLX010000012.1 GCA905371675_01197 gene open 1280-1900 rplD
2460 CAJPLX010000012.1 GCA905371675_01198 gene open 1897-2211 rplW
2461 CAJPLX010000012.1 GCA905371675_01199 gene open 2217-3050 rplB
2462 CAJPLX010000012.1 GCA905371675_01200 gene open 3056-3334 rpsS
2463 CAJPLX010000012.1 GCA905371675_01201 gene open 3343-3672 rplV
2464 CAJPLX010000012.1 GCA905371675_01202 gene open 3682-4374 rpsC
2465 CAJPLX010000012.1 GCA905371675_01203 gene open 4358-4774 rplP
2466 CAJPLX010000012.1 GCA905371675_01204 gene open 4774-4965 rpmC
2467 CAJPLX010000012.1 GCA905371675_01205 gene open 4965-5228 rpsQ
2468 CAJPLX010000012.1 GCA905371675_01206 gene open 5456-5824 rplN
2469 CAJPLX010000012.1 GCA905371675_01207 gene open 5836-6159 rplX
2470 CAJPLX010000012.1 GCA905371675_01208 gene open 6169-6708 rplE
2471 CAJPLX010000012.1 GCA905371675_01209 gene open 6711-7016 rpsN
2472 CAJPLX010000012.1 GCA905371675_01210 gene open 7031-7423 rpsH
2473 CAJPLX010000012.1 GCA905371675_01211 gene open 7437-7970 rplF
2474 CAJPLX010000012.1 GCA905371675_01212 gene open 7984-8337 rplR
2475 CAJPLX010000012.1 GCA905371675_01213 gene open 8355-8873 rpsE
2476 CAJPLX010000012.1 GCA905371675_01214 gene open 8866-9051 rpmD
2477 CAJPLX010000012.1 GCA905371675_01215 gene open 9053-9487 rplO
2478 CAJPLX010000012.1 GCA905371675_01216 gene open 9501-10814 secY
2479 CAJPLX010000012.1 GCA905371675_01217 gene open 10819-11037 infA
2480 CAJPLX010000012.1 GCA905371675_01218 gene open 11056-11169 rpmJ
2481 CAJPLX010000012.1 GCA905371675_01219 gene open 11237-11599 rpsM
2482 CAJPLX010000012.1 GCA905371675_01220 gene open 11619-12014 rpsK
2483 CAJPLX010000012.1 GCA905371675_01221 gene open 12034-12654 rpsD
2484 CAJPLX010000012.1 GCA905371675_01222 gene open 12680-13666 rpoA
2485 CAJPLX010000012.1 GCA905371675_01223 gene open 13691-14065 rplQ
2486 CAJPLX010000012.1 GCA905371675_01224 gene open 16455-16763 cas2
2487 CAJPLX010000012.1 GCA905371675_01225 gene open 16774-17688 cas1
2488 CAJPLX010000012.1 GCA905371675_01226 gene open 17755-21036 cas9
2489 CAJPLX010000012.1 GCA905371675_01227 gene open 21273-22697 alsT
2490 CAJPLX010000012.1 GCA905371675_01228 gene open 22960-24471 lysS
2491 CAJPLX010000012.1 GCA905371675_01229 gene open 24651-26093 aldA
2492 CAJPLX010000012.1 GCA905371675_01231 gene open 26653-27051
2493 CAJPLX010000012.1 GCA905371675_01232 gene open 27115-28089 terC
2494 CAJPLX010000012.1 GCA905371675_01233 gene open 28123-28572
2495 CAJPLX010000012.1 GCA905371675_01234 gene open 28827-29039
2496 CAJPLX010000012.1 GCA905371675_01235 gene open 29104-30024 lysR
2497 CAJPLX010000012.1 GCA905371675_01236 gene open 30028-30291 minE
2498 CAJPLX010000012.1 GCA905371675_01237 gene open 30295-31110 minD
2499 CAJPLX010000012.1 GCA905371675_01238 gene open 31137-31856 minC
2500 CAJPLX010000012.1 GCA905371675_01239 gene open 32004-33239