HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Olsenella sp. HMT-807 (GCA_905371905.1)

Select a Genome:
BAKTA Annotations for GCA_905371905.1
Genome Selected: Olsenella sp. HMT-807
ContigsBases CDSrRNA tmRNAtRNA
126 2803860 2487 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5077 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 5077 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAJPMW010000039.1 GCA905371905_01506 CDS open 14940-15140 _na     66_aa ATPase AAA-type core domain-containing protein
3002 CAJPMW010000039.1 GCA905371905_01507 CDS open 15256-16626 _na     456_aa Pyridine nucleotide-disulfide oxidoreductase
3003 CAJPMW010000039.1 GCA905371905_01508 CDS open 16641-16748 _na     35_aa hypothetical protein
3004 CAJPMW010000039.1 GCA905371905_01509 CDS open 17222-18034 _na     270_aa Haloacid dehalogenase
3005 CAJPMW010000039.1 GCA905371905_01510 CDS open 18074-18841 _na     255_aa Methyltransferase
3006 CAJPMW010000039.1 GCA905371905_01511 CDS open 19023-19643 _na     206_aa CDP-alcohol phosphatidyltransferase
3007 CAJPMW010000039.1 GCA905371905_01512 CDS open 19894-20913 _na     339_aa TPM domain-containing protein
3008 CAJPMW010000039.1 GCA905371905_01513 CDS open 21578-23995 _na     805_aa Haloacid dehalogenase
3009 CAJPMW010000039.1 GCA905371905_01491 gene open 843-1739
3010 CAJPMW010000039.1 GCA905371905_01492 gene open 1890-3071
3011 CAJPMW010000039.1 GCA905371905_01493 gene open 3473-4399
3012 CAJPMW010000039.1 GCA905371905_01494 gene open 4633-4770
3013 CAJPMW010000039.1 GCA905371905_01495 gene open 4837-5007
3014 CAJPMW010000039.1 GCA905371905_01496 gene open 5064-6392
3015 CAJPMW010000039.1 GCA905371905_01497 gene open 6999-7706
3016 CAJPMW010000039.1 GCA905371905_01498 gene open 7699-9279
3017 CAJPMW010000039.1 GCA905371905_01499 gene open 9356-10006
3018 CAJPMW010000039.1 GCA905371905_01500 gene open 10019-10924
3019 CAJPMW010000039.1 GCA905371905_01501 gene open 10989-11417
3020 CAJPMW010000039.1 GCA905371905_01502 gene open 11669-12226
3021 CAJPMW010000039.1 GCA905371905_01503 gene open 12480-13079
3022 CAJPMW010000039.1 GCA905371905_01504 gene open 13094-13900
3023 CAJPMW010000039.1 GCA905371905_01505 gene open 13943-14347
3024 CAJPMW010000039.1 GCA905371905_01506 gene open 14940-15140
3025 CAJPMW010000039.1 GCA905371905_01507 gene open 15256-16626
3026 CAJPMW010000039.1 GCA905371905_01508 gene open 16641-16748
3027 CAJPMW010000039.1 GCA905371905_01509 gene open 17222-18034
3028 CAJPMW010000039.1 GCA905371905_01510 gene open 18074-18841
3029 CAJPMW010000039.1 GCA905371905_01511 gene open 19023-19643
3030 CAJPMW010000039.1 GCA905371905_01512 gene open 19894-20913
3031 CAJPMW010000039.1 GCA905371905_01513 gene open 21578-23995
3032 CAJPMW010000040.1 GCA905371905_01514 CDS open 579-1034 _na     151_aa hypothetical protein
3033 CAJPMW010000040.1 GCA905371905_01515 CDS open 1114-2136 _na     340_aa ABC transporter substrate-binding protein
3034 CAJPMW010000040.1 GCA905371905_01516 CDS open 2136-2894 _na     252_aa metal ABC transporter ATP-binding protein
3035 CAJPMW010000040.1 GCA905371905_01517 CDS open 2895-3704 _na     269_aa Metal ABC transporter permease
3036 CAJPMW010000040.1 GCA905371905_01518 CDS open 3980-4708 _na     242_aa hypothetical protein
3037 CAJPMW010000040.1 GCA905371905_01519 CDS open 4705-5241 _na     178_aa ABC transporter permease
3038 CAJPMW010000040.1 GCA905371905_01520 CDS open 5285-5560 _na     91_aa hypothetical protein
3039 CAJPMW010000040.1 GCA905371905_01521 CDS open 5639-6400 _na     253_aa hypothetical protein
3040 CAJPMW010000040.1 GCA905371905_01522 CDS open 6435-7067 _na     210_aa ABC transporter domain-containing protein
3041 CAJPMW010000040.1 GCA905371905_01523 CDS open 7076-7969 _na     297_aa ABC transporter permease
3042 CAJPMW010000040.1 GCA905371905_01524 CDS open 8209-8784 _na     191_aa SnoaL-like domain-containing protein
3043 CAJPMW010000040.1 GCA905371905_01525 CDS open 8904-9335 _na     143_aa Ferritin
3044 CAJPMW010000040.1 GCA905371905_01526 CDS open 9574-9903 _na     109_aa hypothetical protein
3045 CAJPMW010000040.1 GCA905371905_01527 CDS open 9968-10855 _na     295_aa Haloacid dehalogenase
3046 CAJPMW010000040.1 GCA905371905_01528 CDS open 10852-12363 _na     503_aa DUF3375 domain-containing protein
3047 CAJPMW010000040.1 GCA905371905_01529 CDS open 12356-13030 _na     224_aa DUF4194 domain-containing protein
3048 CAJPMW010000040.1 GCA905371905_01530 CDS open 13053-16439 _na     1128_aa ATP-binding protein
3049 CAJPMW010000040.1 GCA905371905_01531 CDS open 16444-17640 _na     398_aa hypothetical protein
3050 CAJPMW010000040.1 GCA905371905_01532 CDS open 18169-19236 _na     355_aa pheS phenylalanine--tRNA ligase subunit alpha
3051 CAJPMW010000040.1 GCA905371905_01533 CDS open 19293-21764 _na     823_aa pheT phenylalanine--tRNA ligase subunit beta
3052 CAJPMW010000040.1 GCA905371905_01534 CDS open 21778-22491 _na     237_aa Phospholipase C/D domain-containing protein
3053 CAJPMW010000040.1 GCA905371905_01514 gene open 579-1034
3054 CAJPMW010000040.1 GCA905371905_01515 gene open 1114-2136
3055 CAJPMW010000040.1 GCA905371905_01516 gene open 2136-2894
3056 CAJPMW010000040.1 GCA905371905_01517 gene open 2895-3704
3057 CAJPMW010000040.1 GCA905371905_01518 gene open 3980-4708
3058 CAJPMW010000040.1 GCA905371905_01519 gene open 4705-5241
3059 CAJPMW010000040.1 GCA905371905_01520 gene open 5285-5560
3060 CAJPMW010000040.1 GCA905371905_01521 gene open 5639-6400
3061 CAJPMW010000040.1 GCA905371905_01522 gene open 6435-7067
3062 CAJPMW010000040.1 GCA905371905_01523 gene open 7076-7969
3063 CAJPMW010000040.1 GCA905371905_01524 gene open 8209-8784
3064 CAJPMW010000040.1 GCA905371905_01525 gene open 8904-9335
3065 CAJPMW010000040.1 GCA905371905_01526 gene open 9574-9903
3066 CAJPMW010000040.1 GCA905371905_01527 gene open 9968-10855
3067 CAJPMW010000040.1 GCA905371905_01528 gene open 10852-12363
3068 CAJPMW010000040.1 GCA905371905_01529 gene open 12356-13030
3069 CAJPMW010000040.1 GCA905371905_01530 gene open 13053-16439
3070 CAJPMW010000040.1 GCA905371905_01531 gene open 16444-17640
3071 CAJPMW010000040.1 GCA905371905_01532 gene open 18169-19236 pheS
3072 CAJPMW010000040.1 GCA905371905_01533 gene open 19293-21764 pheT
3073 CAJPMW010000040.1 GCA905371905_01534 gene open 21778-22491
3074 CAJPMW010000041.1 GCA905371905_01535 CDS open 15-359 _na     114_aa hypothetical protein
3075 CAJPMW010000041.1 GCA905371905_01536 CDS open 559-1128 _na     189_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
3076 CAJPMW010000041.1 GCA905371905_01537 CDS open 1129-2067 _na     312_aa pyrB aspartate carbamoyltransferase catalytic subunit
3077 CAJPMW010000041.1 GCA905371905_01538 CDS open 2051-3346 _na     431_aa Dihydroorotase
3078 CAJPMW010000041.1 GCA905371905_01539 CDS open 3494-4207 _na     237_aa Oxidoreductase
3079 CAJPMW010000041.1 GCA905371905_01540 CDS open 4204-5127 _na     307_aa dihydroorotate dehydrogenase
3080 CAJPMW010000041.1 GCA905371905_01541 CDS open 5121-5849 _na     242_aa pyrF orotidine-5'-phosphate decarboxylase
3081 CAJPMW010000041.1 GCA905371905_01542 CDS open 6088-6396 _na     102_aa Integration host factor-like helix-two turn-helix domain-containing protein
3082 CAJPMW010000041.1 GCA905371905_01543 CDS open 6397-6990 _na     197_aa gmk guanylate kinase
3083 CAJPMW010000041.1 GCA905371905_01544 CDS open 6977-7270 _na     97_aa DNA-directed RNA polymerase subunit omega
3084 CAJPMW010000041.1 GCA905371905_01545 CDS open 7272-8507 _na     411_aa putative tRNA sulfurtransferase
3085 CAJPMW010000041.1 GCA905371905_01546 CDS open 8650-9384 _na     244_aa Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein
3086 CAJPMW010000041.1 GCA905371905_01547 CDS open 9368-11779 _na     803_aa DNA internalization-related competence protein ComEC/Rec2
3087 CAJPMW010000041.1 GCA905371905_01548 CDS open 12241-13152 _na     303_aa hypothetical protein
3088 CAJPMW010000041.1 GCA905371905_01549 CDS open 13327-14475 _na     382_aa hypothetical protein
3089 CAJPMW010000041.1 GCA905371905_01550 CDS open 14482-14685 _na     67_aa hypothetical protein
3090 CAJPMW010000041.1 GCA905371905_01551 CDS open 14640-14903 _na     87_aa rpsT 30S ribosomal protein S20
3091 CAJPMW010000041.1 GCA905371905_01552 CDS open 15047-16858 _na     603_aa lepA translation elongation factor 4
3092 CAJPMW010000041.1 GCA905371905_01553 CDS open 16855-17922 _na     355_aa tRNA-dihydrouridine synthase
3093 CAJPMW010000041.1 GCA905371905_01554 CDS open 17919-19217 _na     432_aa hemW Heme chaperone HemW
3094 CAJPMW010000041.1 GCA905371905_01555 CDS open 19329-20966 _na     545_aa hypothetical protein
3095 CAJPMW010000041.1 GCA905371905_01556 CDS open 21173-21562 _na     129_aa hypothetical protein
3096 CAJPMW010000041.1 GCA905371905_01535 gene open 15-359
3097 CAJPMW010000041.1 GCA905371905_01536 gene open 559-1128 pyrR
3098 CAJPMW010000041.1 GCA905371905_01537 gene open 1129-2067 pyrB
3099 CAJPMW010000041.1 GCA905371905_01538 gene open 2051-3346
3100 CAJPMW010000041.1 GCA905371905_01539 gene open 3494-4207
3101 CAJPMW010000041.1 GCA905371905_01540 gene open 4204-5127
3102 CAJPMW010000041.1 GCA905371905_01541 gene open 5121-5849 pyrF
3103 CAJPMW010000041.1 GCA905371905_01542 gene open 6088-6396
3104 CAJPMW010000041.1 GCA905371905_01543 gene open 6397-6990 gmk
3105 CAJPMW010000041.1 GCA905371905_01544 gene open 6977-7270
3106 CAJPMW010000041.1 GCA905371905_01545 gene open 7272-8507
3107 CAJPMW010000041.1 GCA905371905_01546 gene open 8650-9384
3108 CAJPMW010000041.1 GCA905371905_01547 gene open 9368-11779
3109 CAJPMW010000041.1 GCA905371905_01548 gene open 12241-13152
3110 CAJPMW010000041.1 GCA905371905_01549 gene open 13327-14475
3111 CAJPMW010000041.1 GCA905371905_01550 gene open 14482-14685
3112 CAJPMW010000041.1 GCA905371905_01551 gene open 14640-14903 rpsT
3113 CAJPMW010000041.1 GCA905371905_01552 gene open 15047-16858 lepA
3114 CAJPMW010000041.1 GCA905371905_01553 gene open 16855-17922
3115 CAJPMW010000041.1 GCA905371905_01554 gene open 17919-19217 hemW
3116 CAJPMW010000041.1 GCA905371905_01555 gene open 19329-20966
3117 CAJPMW010000041.1 GCA905371905_01556 gene open 21173-21562
3118 CAJPMW010000042.1 GCA905371905_01557 CDS open 192-1436 _na     414_aa fabF beta-ketoacyl-ACP synthase II
3119 CAJPMW010000042.1 GCA905371905_01558 CDS open 1517-2290 _na     257_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
3120 CAJPMW010000042.1 GCA905371905_01559 CDS open 2293-3216 _na     307_aa Malonyl CoA-acyl carrier protein transacylase
3121 CAJPMW010000042.1 GCA905371905_01560 CDS open 3204-4148 _na     314_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
3122 CAJPMW010000042.1 GCA905371905_01561 CDS open 4152-4388 _na     78_aa Acyl carrier protein
3123 CAJPMW010000042.1 GCA905371905_01562 CDS open 4491-5456 _na     321_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
3124 CAJPMW010000042.1 GCA905371905_01563 CDS open 5453-6004 _na     183_aa HTH marR-type domain-containing protein
3125 CAJPMW010000042.1 GCA905371905_01564 CDS open 6939-7595 _na     218_aa tetR TetR family transcriptional regulator
3126 CAJPMW010000042.1 GCA905371905_01565 CDS open 7570-8091 _na     173_aa Polyketide cyclase
3127 CAJPMW010000042.1 GCA905371905_01566 CDS open 8088-8972 _na     294_aa class I SAM-dependent methyltransferase
3128 CAJPMW010000042.1 GCA905371905_01567 CDS open 9579-10580 _na     333_aa asnA aspartate--ammonia ligase
3129 CAJPMW010000042.1 GCA905371905_01568 CDS open 11671-12384 _na     237_aa hypothetical protein
3130 CAJPMW010000042.1 GCA905371905_01569 CDS open 12416-13045 _na     209_aa hypothetical protein
3131 CAJPMW010000042.1 GCA905371905_01570 CDS open 13058-13432 _na     124_aa Integrase
3132 CAJPMW010000042.1 GCA905371905_01571 CDS open 13589-14713 _na     374_aa 50S ribosomal protein L31
3133 CAJPMW010000042.1 GCA905371905_01572 CDS open 14734-15315 _na     193_aa hypothetical protein
3134 CAJPMW010000042.1 GCA905371905_01573 CDS open 15391-15558 _na     55_aa hypothetical protein
3135 CAJPMW010000042.1 GCA905371905_01574 CDS open 15563-15787 _na     74_aa hypothetical protein
3136 CAJPMW010000042.1 GCA905371905_01575 CDS open 15780-16823 _na     347_aa mqsA type II TA system antitoxin MqsA family protein
3137 CAJPMW010000042.1 GCA905371905_01576 CDS open 17042-17467 _na     141_aa hypothetical protein
3138 CAJPMW010000042.1 GCA905371905_01577 CDS open 17663-18901 _na     412_aa hypothetical protein
3139 CAJPMW010000042.1 GCA905371905_01578 CDS open 19427-20665 _na     412_aa ATPase
3140 CAJPMW010000042.1 GCA905371905_01579 CDS open 20942-21448 _na     168_aa hypothetical protein
3141 CAJPMW010000042.1 GCA905371905_01557 gene open 192-1436 fabF
3142 CAJPMW010000042.1 GCA905371905_01558 gene open 1517-2290 fabG
3143 CAJPMW010000042.1 GCA905371905_01559 gene open 2293-3216
3144 CAJPMW010000042.1 GCA905371905_01560 gene open 3204-4148 fabK
3145 CAJPMW010000042.1 GCA905371905_01561 gene open 4152-4388
3146 CAJPMW010000042.1 GCA905371905_01562 gene open 4491-5456
3147 CAJPMW010000042.1 GCA905371905_01563 gene open 5453-6004
3148 CAJPMW010000042.1 GCA905371905_01564 gene open 6939-7595 tetR
3149 CAJPMW010000042.1 GCA905371905_01565 gene open 7570-8091
3150 CAJPMW010000042.1 GCA905371905_01566 gene open 8088-8972
3151 CAJPMW010000042.1 GCA905371905_01567 gene open 9579-10580 asnA
3152 CAJPMW010000042.1 GCA905371905_01568 gene open 11671-12384
3153 CAJPMW010000042.1 GCA905371905_01569 gene open 12416-13045
3154 CAJPMW010000042.1 GCA905371905_01570 gene open 13058-13432
3155 CAJPMW010000042.1 GCA905371905_01571 gene open 13589-14713
3156 CAJPMW010000042.1 GCA905371905_01572 gene open 14734-15315
3157 CAJPMW010000042.1 GCA905371905_01573 gene open 15391-15558
3158 CAJPMW010000042.1 GCA905371905_01574 gene open 15563-15787
3159 CAJPMW010000042.1 GCA905371905_01575 gene open 15780-16823 mqsA
3160 CAJPMW010000042.1 GCA905371905_01576 gene open 17042-17467
3161 CAJPMW010000042.1 GCA905371905_01577 gene open 17663-18901
3162 CAJPMW010000042.1 GCA905371905_01578 gene open 19427-20665
3163 CAJPMW010000042.1 GCA905371905_01579 gene open 20942-21448
3164 CAJPMW010000043.1 GCA905371905_01580 CDS open 127-864 _na     245_aa hypothetical protein
3165 CAJPMW010000043.1 GCA905371905_01581 CDS open 861-1532 _na     223_aa luxR LuxR family transcriptional regulator
3166 CAJPMW010000043.1 GCA905371905_01582 CDS open 1915-3342 _na     475_aa ATPase
3167 CAJPMW010000043.1 GCA905371905_01583 CDS open 4436-5005 _na     189_aa hypothetical protein
3168 CAJPMW010000043.1 GCA905371905_01584 CDS open 4998-5183 _na     61_aa vbhA Antitoxin VbhA domain-containing protein
3169 CAJPMW010000043.1 GCA905371905_01585 CDS open 5390-5998 _na     202_aa hypothetical protein
3170 CAJPMW010000043.1 GCA905371905_01586 CDS open 6856-7098 _na     80_aa hypothetical protein
3171 CAJPMW010000043.1 GCA905371905_01587 CDS open 7591-8004 _na     137_aa HTH cro/C1-type domain-containing protein
3172 CAJPMW010000043.1 GCA905371905_01588 CDS open 8138-8254 _na     38_aa hypothetical protein
3173 CAJPMW010000043.1 GCA905371905_01589 CDS open 8342-8590 _na     82_aa hypothetical protein
3174 CAJPMW010000043.1 GCA905371905_01590 CDS open 8793-9011 _na     72_aa hypothetical protein
3175 CAJPMW010000043.1 GCA905371905_01591 CDS open 9060-9608 _na     182_aa hypothetical protein
3176 CAJPMW010000043.1 GCA905371905_01592 CDS open 9626-10498 _na     290_aa Integral membrane protein
3177 CAJPMW010000043.1 GCA905371905_01593 CDS open 10596-11072 _na     158_aa hypothetical protein
3178 CAJPMW010000043.1 GCA905371905_01594 CDS open 11568-12401 _na     277_aa AB hydrolase-1 domain-containing protein
3179 CAJPMW010000043.1 GCA905371905_01595 CDS open 12898-13815 _na     305_aa Ribokinase
3180 CAJPMW010000043.1 GCA905371905_01596 CDS open 13819-14247 _na     142_aa Major facilitator superfamily (MFS) profile domain-containing protein
3181 CAJPMW010000043.1 GCA905371905_01597 CDS open 14261-14425 _na     54_aa hypothetical protein
3182 CAJPMW010000043.1 GCA905371905_01598 CDS open 14574-15137 _na     187_aa hypothetical protein
3183 CAJPMW010000043.1 GCA905371905_01599 CDS open 15145-15330 _na     61_aa hypothetical protein
3184 CAJPMW010000043.1 GCA905371905_01600 CDS open 15366-15665 _na     99_aa hypothetical protein
3185 CAJPMW010000043.1 GCA905371905_01601 CDS open 16476-17846 _na     456_aa AAA family ATPase
3186 CAJPMW010000043.1 GCA905371905_01602 CDS open 18323-19309 _na     328_aa hypothetical protein
3187 CAJPMW010000043.1 GCA905371905_01603 CDS open 19961-20629 _na     222_aa hypothetical protein
3188 CAJPMW010000043.1 GCA905371905_01604 CDS open 20626-21021 _na     131_aa nucleotidyl transferase AbiEii/AbiGii toxin family protein
3189 CAJPMW010000043.1 GCA905371905_01605 CDS open 21042-21467 _na     141_aa hypothetical protein
3190 CAJPMW010000043.1 GCA905371905_01580 gene open 127-864
3191 CAJPMW010000043.1 GCA905371905_01581 gene open 861-1532 luxR
3192 CAJPMW010000043.1 GCA905371905_01582 gene open 1915-3342
3193 CAJPMW010000043.1 GCA905371905_01583 gene open 4436-5005
3194 CAJPMW010000043.1 GCA905371905_01584 gene open 4998-5183 vbhA
3195 CAJPMW010000043.1 GCA905371905_01585 gene open 5390-5998
3196 CAJPMW010000043.1 GCA905371905_01586 gene open 6856-7098
3197 CAJPMW010000043.1 GCA905371905_01587 gene open 7591-8004
3198 CAJPMW010000043.1 GCA905371905_01588 gene open 8138-8254
3199 CAJPMW010000043.1 GCA905371905_01589 gene open 8342-8590
3200 CAJPMW010000043.1 GCA905371905_01590 gene open 8793-9011
3201 CAJPMW010000043.1 GCA905371905_01591 gene open 9060-9608
3202 CAJPMW010000043.1 GCA905371905_01592 gene open 9626-10498
3203 CAJPMW010000043.1 GCA905371905_01593 gene open 10596-11072
3204 CAJPMW010000043.1 GCA905371905_01594 gene open 11568-12401
3205 CAJPMW010000043.1 GCA905371905_01595 gene open 12898-13815
3206 CAJPMW010000043.1 GCA905371905_01596 gene open 13819-14247
3207 CAJPMW010000043.1 GCA905371905_01597 gene open 14261-14425
3208 CAJPMW010000043.1 GCA905371905_01598 gene open 14574-15137
3209 CAJPMW010000043.1 GCA905371905_01599 gene open 15145-15330
3210 CAJPMW010000043.1 GCA905371905_01600 gene open 15366-15665
3211 CAJPMW010000043.1 GCA905371905_01601 gene open 16476-17846
3212 CAJPMW010000043.1 GCA905371905_01602 gene open 18323-19309
3213 CAJPMW010000043.1 GCA905371905_01603 gene open 19961-20629
3214 CAJPMW010000043.1 GCA905371905_01604 gene open 20626-21021
3215 CAJPMW010000043.1 GCA905371905_01605 gene open 21042-21467
3216 CAJPMW010000044.1 GCA905371905_01606 CDS open 81-926 _na     281_aa DUF697 domain-containing protein
3217 CAJPMW010000044.1 GCA905371905_01607 CDS open 967-2202 _na     411_aa rodA Rod shape-determining protein RodA
3218 CAJPMW010000044.1 GCA905371905_01608 CDS open 2207-4237 _na     676_aa mrdA penicillin-binding protein 2
3219 CAJPMW010000044.1 GCA905371905_01609 CDS open 4248-4805 _na     185_aa mreD rod shape-determining protein MreD
3220 CAJPMW010000044.1 GCA905371905_01610 CDS open 4826-5851 _na     341_aa mreC rod shape-determining protein MreC
3221 CAJPMW010000044.1 GCA905371905_01611 CDS open 5858-6904 _na     348_aa mreB Cell shape-determining protein MreB
3222 CAJPMW010000044.1 GCA905371905_01612 CDS open 6946-8358 _na     470_aa hypothetical protein
3223 CAJPMW010000044.1 GCA905371905_01613 CDS open 8403-8945 _na     180_aa Peptidyl-prolyl cis-trans isomerase
3224 CAJPMW010000044.1 GCA905371905_01614 CDS open 9056-10090 _na     344_aa zinc ribbon domain-containing protein
3225 CAJPMW010000044.1 GCA905371905_01615 CDS open 10101-12806 _na     901_aa acnA aconitate hydratase AcnA
3226 CAJPMW010000044.1 GCA905371905_01617 CDS open 13078-14100 _na     340_aa bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
3227 CAJPMW010000044.1 GCA905371905_01618 CDS open 14102-14974 _na     290_aa Prephenate dehydrogenase
3228 CAJPMW010000044.1 GCA905371905_01619 CDS open 14971-16065 _na     364_aa aroB 3-dehydroquinate synthase
3229 CAJPMW010000044.1 GCA905371905_01620 CDS open 16068-17378 _na     436_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
3230 CAJPMW010000044.1 GCA905371905_01621 CDS open 17378-18547 _na     389_aa aroC chorismate synthase
3231 CAJPMW010000044.1 GCA905371905_01622 CDS open 18557-19702 _na     381_aa Bifunctional chorismate mutase/prephenate dehydratase
3232 CAJPMW010000044.1 GCA905371905_01623 CDS open 19704-20984 _na     426_aa Shikimate kinase
3233 CAJPMW010000044.1 GCA905371905_01606 gene open 81-926
3234 CAJPMW010000044.1 GCA905371905_01607 gene open 967-2202 rodA
3235 CAJPMW010000044.1 GCA905371905_01608 gene open 2207-4237 mrdA
3236 CAJPMW010000044.1 GCA905371905_01609 gene open 4248-4805 mreD
3237 CAJPMW010000044.1 GCA905371905_01610 gene open 4826-5851 mreC
3238 CAJPMW010000044.1 GCA905371905_01611 gene open 5858-6904 mreB
3239 CAJPMW010000044.1 GCA905371905_01612 gene open 6946-8358
3240 CAJPMW010000044.1 GCA905371905_01613 gene open 8403-8945
3241 CAJPMW010000044.1 GCA905371905_01614 gene open 9056-10090
3242 CAJPMW010000044.1 GCA905371905_01615 gene open 10101-12806 acnA
3243 CAJPMW010000044.1 GCA905371905_01617 gene open 13078-14100
3244 CAJPMW010000044.1 GCA905371905_01618 gene open 14102-14974
3245 CAJPMW010000044.1 GCA905371905_01619 gene open 14971-16065 aroB
3246 CAJPMW010000044.1 GCA905371905_01620 gene open 16068-17378 aroA
3247 CAJPMW010000044.1 GCA905371905_01621 gene open 17378-18547 aroC
3248 CAJPMW010000044.1 GCA905371905_01622 gene open 18557-19702
3249 CAJPMW010000044.1 GCA905371905_01623 gene open 19704-20984
3250 CAJPMW010000044.1 GCA905371905_01616 gene open 12903-12979 trnR
3251 CAJPMW010000044.1 GCA905371905_01616 tRNA open 12903-12979 trnR tRNA-Arg(ccg)
3252 CAJPMW010000045.1 repeat_region open 12442-12817 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTCCGTCCCCTCGCGGGGTTGAGCTGCATAAACC and spacer length 39
3253 CAJPMW010000045.1 GCA905371905_01624 CDS open 4-267 _na     87_aa hypothetical protein
3254 CAJPMW010000045.1 GCA905371905_01625 CDS open 331-1431 _na     366_aa Archaeal ATPase
3255 CAJPMW010000045.1 GCA905371905_01626 CDS open 1546-1770 _na     74_aa hypothetical protein
3256 CAJPMW010000045.1 GCA905371905_01627 CDS open 2190-3626 _na     478_aa Aryl-phospho-beta-D-glucosidase
3257 CAJPMW010000045.1 GCA905371905_01628 CDS open 3774-4934 _na     386_aa Aminotransferase
3258 CAJPMW010000045.1 GCA905371905_01629 CDS open 5526-5720 _na     64_aa DUF5049 domain-containing protein
3259 CAJPMW010000045.1 GCA905371905_01630 CDS open 5806-7170 _na     454_aa ATP-binding protein
3260 CAJPMW010000045.1 GCA905371905_01631 CDS open 7313-8674 _na     453_aa nuclease-related domain-containing protein
3261 CAJPMW010000045.1 GCA905371905_01632 CDS open 8843-9211 _na     122_aa EXLDI protein
3262 CAJPMW010000045.1 GCA905371905_01633 CDS open 9420-10862 _na     480_aa TFIIB-type domain-containing protein
3263 CAJPMW010000045.1 GCA905371905_01634 CDS open 10865-12241 _na     458_aa Virion core protein (Lumpy skin disease virus)
3264 CAJPMW010000045.1 GCA905371905_01635 CDS open 13178-13432 _na     84_aa hypothetical protein
3265 CAJPMW010000045.1 GCA905371905_01636 CDS open 13692-14177 _na     161_aa Nitroreductase family protein
3266 CAJPMW010000045.1 GCA905371905_01637 CDS open 14169-16412 _na     747_aa CRISPR system single-strand-specific deoxyribonuclease Cas10/Csm1 (subtype III-A)
3267 CAJPMW010000045.1 GCA905371905_01638 CDS open 16458-17222 _na     254_aa CRISPR-associated endoribonuclease Cas6
3268 CAJPMW010000045.1 GCA905371905_01639 CDS open 17773-18162 _na     129_aa hypothetical protein
3269 CAJPMW010000045.1 GCA905371905_01640 CDS open 18707-18991 _na     94_aa Type II toxin-antitoxin system RelB/DinJ family antitoxin
3270 CAJPMW010000045.1 GCA905371905_01641 CDS open 18995-19273 _na     92_aa Damage-inducible protein
3271 CAJPMW010000045.1 GCA905371905_01642 CDS open 19885-20190 _na     101_aa higA HigA family addiction module antitoxin
3272 CAJPMW010000045.1 GCA905371905_01643 CDS open 20208-20492 _na     94_aa Excinuclease ABC subunit A
3273 CAJPMW010000045.1 GCA905371905_01644 CDS open 20518-21051 _na     177_aa hypothetical protein
3274 CAJPMW010000045.1 GCA905371905_01624 gene open 4-267
3275 CAJPMW010000045.1 GCA905371905_01625 gene open 331-1431
3276 CAJPMW010000045.1 GCA905371905_01626 gene open 1546-1770
3277 CAJPMW010000045.1 GCA905371905_01627 gene open 2190-3626
3278 CAJPMW010000045.1 GCA905371905_01628 gene open 3774-4934
3279 CAJPMW010000045.1 GCA905371905_01629 gene open 5526-5720
3280 CAJPMW010000045.1 GCA905371905_01630 gene open 5806-7170
3281 CAJPMW010000045.1 GCA905371905_01631 gene open 7313-8674
3282 CAJPMW010000045.1 GCA905371905_01632 gene open 8843-9211
3283 CAJPMW010000045.1 GCA905371905_01633 gene open 9420-10862
3284 CAJPMW010000045.1 GCA905371905_01634 gene open 10865-12241
3285 CAJPMW010000045.1 GCA905371905_01635 gene open 13178-13432
3286 CAJPMW010000045.1 GCA905371905_01636 gene open 13692-14177
3287 CAJPMW010000045.1 GCA905371905_01637 gene open 14169-16412
3288 CAJPMW010000045.1 GCA905371905_01638 gene open 16458-17222
3289 CAJPMW010000045.1 GCA905371905_01639 gene open 17773-18162
3290 CAJPMW010000045.1 GCA905371905_01640 gene open 18707-18991
3291 CAJPMW010000045.1 GCA905371905_01641 gene open 18995-19273
3292 CAJPMW010000045.1 GCA905371905_01642 gene open 19885-20190 higA
3293 CAJPMW010000045.1 GCA905371905_01643 gene open 20208-20492
3294 CAJPMW010000045.1 GCA905371905_01644 gene open 20518-21051
3295 CAJPMW010000046.1 GCA905371905_01645 CDS open 982-1731 _na     249_aa Gamma-carboxymuconolactone decarboxylase
3296 CAJPMW010000046.1 GCA905371905_01646 CDS open 1778-2644 _na     288_aa 2%2C5-diketo-D-gluconic acid reductase
3297 CAJPMW010000046.1 GCA905371905_01647 CDS open 2989-3882 _na     297_aa lysR LysR family transcriptional regulator
3298 CAJPMW010000046.1 GCA905371905_01648 CDS open 3959-4540 _na     193_aa DUF308 domain-containing protein
3299 CAJPMW010000046.1 GCA905371905_01649 CDS open 4780-5262 _na     160_aa Diamine acetyltransferase
3300 CAJPMW010000046.1 GCA905371905_01650 CDS open 5412-5966 _na     184_aa hypothetical protein
3301 CAJPMW010000046.1 GCA905371905_01651 CDS open 6057-6596 _na     179_aa hypothetical protein
3302 CAJPMW010000046.1 GCA905371905_01652 CDS open 6618-6938 _na     106_aa pspE Thiosulfate sulfurtransferase PspE
3303 CAJPMW010000046.1 GCA905371905_01653 CDS open 7075-8484 _na     469_aa TrpB-like pyridoxal phosphate-dependent enzyme
3304 CAJPMW010000046.1 GCA905371905_01654 CDS open 8673-9392 _na     239_aa Lipoprotein
3305 CAJPMW010000046.1 GCA905371905_01655 CDS open 9844-11025 _na     393_aa hypothetical protein
3306 CAJPMW010000046.1 GCA905371905_01656 CDS open 11448-12224 _na     258_aa AAA family ATPase
3307 CAJPMW010000046.1 GCA905371905_01657 CDS open 12246-12650 _na     134_aa AAA domain-containing protein
3308 CAJPMW010000046.1 GCA905371905_01658 CDS open 12846-14588 _na     580_aa ABC transporter ATP-binding protein
3309 CAJPMW010000046.1 GCA905371905_01659 CDS open 14589-16388 _na     599_aa ABC transporter ATP-binding protein
3310 CAJPMW010000046.1 GCA905371905_01660 CDS open 16588-17691 _na     367_aa histidine kinase
3311 CAJPMW010000046.1 GCA905371905_01661 CDS open 17918-18577 _na     219_aa Redoxin
3312 CAJPMW010000046.1 GCA905371905_01662 CDS open 18731-19672 _na     313_aa 4Fe-4S ferredoxin
3313 CAJPMW010000046.1 GCA905371905_01663 CDS open 20044-20724 _na     226_aa cheY Chemotaxis protein CheY
3314 CAJPMW010000046.1 GCA905371905_01645 gene open 982-1731
3315 CAJPMW010000046.1 GCA905371905_01646 gene open 1778-2644
3316 CAJPMW010000046.1 GCA905371905_01647 gene open 2989-3882 lysR
3317 CAJPMW010000046.1 GCA905371905_01648 gene open 3959-4540
3318 CAJPMW010000046.1 GCA905371905_01649 gene open 4780-5262
3319 CAJPMW010000046.1 GCA905371905_01650 gene open 5412-5966
3320 CAJPMW010000046.1 GCA905371905_01651 gene open 6057-6596
3321 CAJPMW010000046.1 GCA905371905_01652 gene open 6618-6938 pspE
3322 CAJPMW010000046.1 GCA905371905_01653 gene open 7075-8484
3323 CAJPMW010000046.1 GCA905371905_01654 gene open 8673-9392
3324 CAJPMW010000046.1 GCA905371905_01655 gene open 9844-11025
3325 CAJPMW010000046.1 GCA905371905_01656 gene open 11448-12224
3326 CAJPMW010000046.1 GCA905371905_01657 gene open 12246-12650
3327 CAJPMW010000046.1 GCA905371905_01658 gene open 12846-14588
3328 CAJPMW010000046.1 GCA905371905_01659 gene open 14589-16388
3329 CAJPMW010000046.1 GCA905371905_01660 gene open 16588-17691
3330 CAJPMW010000046.1 GCA905371905_01661 gene open 17918-18577
3331 CAJPMW010000046.1 GCA905371905_01662 gene open 18731-19672
3332 CAJPMW010000046.1 GCA905371905_01663 gene open 20044-20724 cheY
3333 CAJPMW010000047.1 GCA905371905_01664 CDS open 84-2096 _na     670_aa transglycosylase domain-containing protein
3334 CAJPMW010000047.1 GCA905371905_01665 CDS open 2147-2410 _na     87_aa hypothetical protein
3335 CAJPMW010000047.1 GCA905371905_01666 CDS open 2395-4368 _na     657_aa DUF4012 domain-containing protein
3336 CAJPMW010000047.1 GCA905371905_01667 CDS open 4470-6887 _na     805_aa rlmL bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL
3337 CAJPMW010000047.1 GCA905371905_01668 CDS open 6963-8516 _na     517_aa Peptidase S10
3338 CAJPMW010000047.1 GCA905371905_01669 CDS open 8811-11108 _na     765_aa putative potassium transport system protein Kup
3339 CAJPMW010000047.1 GCA905371905_01670 CDS open 11168-11371 _na     67_aa hypothetical protein
3340 CAJPMW010000047.1 GCA905371905_01671 CDS open 11947-12825 _na     292_aa HAD-IIB family hydrolase
3341 CAJPMW010000047.1 GCA905371905_01672 CDS open 12818-14296 _na     492_aa citrate synthase (unknown stereospecificity)
3342 CAJPMW010000047.1 GCA905371905_01673 CDS open 14362-14658 _na     98_aa ACT domain-containing protein
3343 CAJPMW010000047.1 GCA905371905_01674 CDS open 15438-15935 _na     165_aa carD CarD family transcriptional regulator
3344 CAJPMW010000047.1 GCA905371905_01675 CDS open 16244-18184 _na     646_aa subtype A tannase
3345 CAJPMW010000047.1 GCA905371905_01676 CDS open 18338-18670 _na     110_aa acylphosphatase
3346 CAJPMW010000047.1 GCA905371905_01677 CDS open 19614-20132 _na     172_aa hypothetical protein
3347 CAJPMW010000047.1 GCA905371905_01678 CDS open 20364-20729 _na     121_aa hypothetical protein
3348 CAJPMW010000047.1 GCA905371905_01664 gene open 84-2096
3349 CAJPMW010000047.1 GCA905371905_01665 gene open 2147-2410
3350 CAJPMW010000047.1 GCA905371905_01666 gene open 2395-4368
3351 CAJPMW010000047.1 GCA905371905_01667 gene open 4470-6887 rlmL
3352 CAJPMW010000047.1 GCA905371905_01668 gene open 6963-8516
3353 CAJPMW010000047.1 GCA905371905_01669 gene open 8811-11108
3354 CAJPMW010000047.1 GCA905371905_01670 gene open 11168-11371
3355 CAJPMW010000047.1 GCA905371905_01671 gene open 11947-12825
3356 CAJPMW010000047.1 GCA905371905_01672 gene open 12818-14296
3357 CAJPMW010000047.1 GCA905371905_01673 gene open 14362-14658
3358 CAJPMW010000047.1 GCA905371905_01674 gene open 15438-15935 carD
3359 CAJPMW010000047.1 GCA905371905_01675 gene open 16244-18184
3360 CAJPMW010000047.1 GCA905371905_01676 gene open 18338-18670
3361 CAJPMW010000047.1 GCA905371905_01677 gene open 19614-20132
3362 CAJPMW010000047.1 GCA905371905_01678 gene open 20364-20729
3363 CAJPMW010000048.1 GCA905371905_01679 CDS open 52-834 _na     260_aa ecsC EcsC family protein
3364 CAJPMW010000048.1 GCA905371905_01680 CDS open 867-1037 _na     56_aa hypothetical protein
3365 CAJPMW010000048.1 GCA905371905_01681 CDS open 1173-1484 _na     103_aa HTH cro/C1-type domain-containing protein
3366 CAJPMW010000048.1 GCA905371905_01682 CDS open 2173-3351 _na     392_aa hypothetical protein
3367 CAJPMW010000048.1 GCA905371905_01683 CDS open 3352-5565 _na     737_aa Peptidase S8/S53 domain-containing protein
3368 CAJPMW010000048.1 GCA905371905_01684 CDS open 5558-6607 _na     349_aa AAA family ATPase
3369 CAJPMW010000048.1 GCA905371905_01685 CDS open 6788-7075 _na     95_aa hypothetical protein
3370 CAJPMW010000048.1 GCA905371905_01686 CDS open 7285-7560 _na     91_aa DUF1778 domain-containing protein
3371 CAJPMW010000048.1 GCA905371905_01687 CDS open 7900-9150 _na     416_aa AAA domain-containing protein
3372 CAJPMW010000048.1 GCA905371905_01688 CDS open 9037-9273 _na     78_aa hypothetical protein
3373 CAJPMW010000048.1 GCA905371905_01689 CDS open 9285-10109 _na     274_aa ABC transporter
3374 CAJPMW010000048.1 GCA905371905_01690 CDS open 10110-10871 _na     253_aa ABC transporter permease
3375 CAJPMW010000048.1 GCA905371905_01691 CDS open 10864-11811 _na     315_aa Bacitracin ABC transporter ATP-binding protein
3376 CAJPMW010000048.1 GCA905371905_01692 CDS open 11843-12811 _na     322_aa histidine kinase
3377 CAJPMW010000048.1 GCA905371905_01693 CDS open 12818-13513 _na     231_aa phoP PhoP family transcriptional regulator
3378 CAJPMW010000048.1 GCA905371905_01694 CDS open 13643-14428 _na     261_aa Nucleotidyltransferase
3379 CAJPMW010000048.1 GCA905371905_01695 CDS open 14338-14850 _na     170_aa hypothetical protein
3380 CAJPMW010000048.1 GCA905371905_01696 CDS open 15129-15566 _na     145_aa dps Ferritin Dps family protein
3381 CAJPMW010000048.1 GCA905371905_01697 CDS open 15669-16280 _na     203_aa Superoxide dismutase
3382 CAJPMW010000048.1 GCA905371905_01698 CDS open 16579-16785 _na     68_aa CsbD-like domain-containing protein
3383 CAJPMW010000048.1 GCA905371905_01699 CDS open 17555-18124 _na     189_aa HTH arsR-type domain-containing protein
3384 CAJPMW010000048.1 GCA905371905_01700 CDS open 18260-19489 _na     409_aa Major facilitator superfamily (MFS) profile domain-containing protein
3385 CAJPMW010000048.1 GCA905371905_01701 CDS open 19601-19807 _na     68_aa hypothetical protein
3386 CAJPMW010000048.1 GCA905371905_01702 CDS open 20170-20691 _na     173_aa hypothetical protein
3387 CAJPMW010000048.1 GCA905371905_01679 gene open 52-834 ecsC
3388 CAJPMW010000048.1 GCA905371905_01680 gene open 867-1037
3389 CAJPMW010000048.1 GCA905371905_01681 gene open 1173-1484
3390 CAJPMW010000048.1 GCA905371905_01682 gene open 2173-3351
3391 CAJPMW010000048.1 GCA905371905_01683 gene open 3352-5565
3392 CAJPMW010000048.1 GCA905371905_01684 gene open 5558-6607
3393 CAJPMW010000048.1 GCA905371905_01685 gene open 6788-7075
3394 CAJPMW010000048.1 GCA905371905_01686 gene open 7285-7560
3395 CAJPMW010000048.1 GCA905371905_01687 gene open 7900-9150
3396 CAJPMW010000048.1 GCA905371905_01688 gene open 9037-9273
3397 CAJPMW010000048.1 GCA905371905_01689 gene open 9285-10109
3398 CAJPMW010000048.1 GCA905371905_01690 gene open 10110-10871
3399 CAJPMW010000048.1 GCA905371905_01691 gene open 10864-11811
3400 CAJPMW010000048.1 GCA905371905_01692 gene open 11843-12811
3401 CAJPMW010000048.1 GCA905371905_01693 gene open 12818-13513 phoP
3402 CAJPMW010000048.1 GCA905371905_01694 gene open 13643-14428
3403 CAJPMW010000048.1 GCA905371905_01695 gene open 14338-14850
3404 CAJPMW010000048.1 GCA905371905_01696 gene open 15129-15566 dps
3405 CAJPMW010000048.1 GCA905371905_01697 gene open 15669-16280
3406 CAJPMW010000048.1 GCA905371905_01698 gene open 16579-16785
3407 CAJPMW010000048.1 GCA905371905_01699 gene open 17555-18124
3408 CAJPMW010000048.1 GCA905371905_01700 gene open 18260-19489
3409 CAJPMW010000048.1 GCA905371905_01701 gene open 19601-19807
3410 CAJPMW010000048.1 GCA905371905_01702 gene open 20170-20691
3411 CAJPMW010000049.1 GCA905371905_01703 CDS open 132-1499 _na     455_aa thiamine diphosphokinase
3412 CAJPMW010000049.1 GCA905371905_01704 CDS open 1665-1913 _na     82_aa fmdB FmdB family transcriptional regulator
3413 CAJPMW010000049.1 GCA905371905_01705 CDS open 2869-4236 _na     455_aa RsmB/NOP family class I SAM-dependent RNA methyltransferase
3414 CAJPMW010000049.1 GCA905371905_01706 CDS open 4310-5224 _na     304_aa fmt methionyl-tRNA formyltransferase
3415 CAJPMW010000049.1 GCA905371905_01707 CDS open 5232-5783 _na     183_aa def peptide deformylase
3416 CAJPMW010000049.1 GCA905371905_01708 CDS open 6117-7226 _na     369_aa Orc1-like AAA ATPase domain-containing protein
3417 CAJPMW010000049.1 GCA905371905_01709 CDS open 7383-9695 _na     770_aa priA primosomal protein N'
3418 CAJPMW010000049.1 GCA905371905_01710 CDS open 9820-11277 _na     485_aa Sucrose-6-phosphate hydrolase
3419 CAJPMW010000049.1 GCA905371905_01711 CDS open 11424-12677 _na     417_aa metK methionine adenosyltransferase
3420 CAJPMW010000049.1 GCA905371905_01712 CDS open 12734-13471 _na     245_aa HTH tetR-type domain-containing protein
3421 CAJPMW010000049.1 GCA905371905_01713 CDS open 13503-16427 _na     974_aa ABC-2 type transporter transmembrane domain-containing protein
3422 CAJPMW010000049.1 GCA905371905_01714 CDS open 16429-17124 _na     231_aa ABC transporter domain-containing protein
3423 CAJPMW010000049.1 GCA905371905_01715 CDS open 17430-18935 _na     501_aa gltX glutamate--tRNA ligase
3424 CAJPMW010000049.1 GCA905371905_01716 CDS open 18906-20300 _na     464_aa lysylphosphatidylglycerol synthase transmembrane domain-containing protein
3425 CAJPMW010000049.1 GCA905371905_01703 gene open 132-1499
3426 CAJPMW010000049.1 GCA905371905_01704 gene open 1665-1913 fmdB
3427 CAJPMW010000049.1 GCA905371905_01705 gene open 2869-4236
3428 CAJPMW010000049.1 GCA905371905_01706 gene open 4310-5224 fmt
3429 CAJPMW010000049.1 GCA905371905_01707 gene open 5232-5783 def
3430 CAJPMW010000049.1 GCA905371905_01708 gene open 6117-7226
3431 CAJPMW010000049.1 GCA905371905_01709 gene open 7383-9695 priA
3432 CAJPMW010000049.1 GCA905371905_01710 gene open 9820-11277
3433 CAJPMW010000049.1 GCA905371905_01711 gene open 11424-12677 metK
3434 CAJPMW010000049.1 GCA905371905_01712 gene open 12734-13471
3435 CAJPMW010000049.1 GCA905371905_01713 gene open 13503-16427
3436 CAJPMW010000049.1 GCA905371905_01714 gene open 16429-17124
3437 CAJPMW010000049.1 GCA905371905_01715 gene open 17430-18935 gltX
3438 CAJPMW010000049.1 GCA905371905_01716 gene open 18906-20300
3439 CAJPMW010000049.1 GCA905371905_01717 gene open 20507-20580 trnQ
3440 CAJPMW010000049.1 GCA905371905_01717 tRNA open 20507-20580 trnQ tRNA-Gln(ctg)
3441 CAJPMW010000050.1 GCA905371905_01718 CDS open 513-1001 _na     162_aa hypothetical protein
3442 CAJPMW010000050.1 GCA905371905_01719 CDS open 1365-3935 _na     856_aa DUF2339 domain-containing protein
3443 CAJPMW010000050.1 GCA905371905_01720 CDS open 4140-4553 _na     137_aa hypothetical protein
3444 CAJPMW010000050.1 GCA905371905_01721 CDS open 5378-5491 _na     37_aa hypothetical protein
3445 CAJPMW010000050.1 GCA905371905_01722 CDS open 5687-5989 _na     100_aa hypothetical protein
3446 CAJPMW010000050.1 GCA905371905_01723 CDS open 6499-7605 _na     368_aa Fic family protein
3447 CAJPMW010000050.1 GCA905371905_01724 CDS open 7713-7919 _na     68_aa copG CopG family transcriptional regulator
3448 CAJPMW010000050.1 GCA905371905_01725 CDS open 8131-8274 _na     47_aa hypothetical protein
3449 CAJPMW010000050.1 GCA905371905_01726 CDS open 8637-10172 _na     511_aa Putative transcriptional regulator
3450 CAJPMW010000050.1 GCA905371905_01727 CDS open 10849-11349 _na     166_aa hypothetical protein
3451 CAJPMW010000050.1 GCA905371905_01728 CDS open 11349-12614 _na     421_aa hypothetical protein
3452 CAJPMW010000050.1 GCA905371905_01729 CDS open 12839-13150 _na     103_aa hypothetical protein
3453 CAJPMW010000050.1 GCA905371905_01730 CDS open 13272-13811 _na     179_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
3454 CAJPMW010000050.1 GCA905371905_01731 CDS open 13872-14186 _na     104_aa hypothetical protein
3455 CAJPMW010000050.1 GCA905371905_01732 CDS open 14183-14821 _na     212_aa type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein
3456 CAJPMW010000050.1 GCA905371905_01733 CDS open 15373-15543 _na     56_aa hypothetical protein
3457 CAJPMW010000050.1 GCA905371905_01734 CDS open 16038-16997 _na     319_aa Abi family protein
3458 CAJPMW010000050.1 GCA905371905_01735 CDS open 17702-19000 _na     432_aa AAA family ATPase
3459 CAJPMW010000050.1 GCA905371905_01736 CDS open 19418-20029 _na     203_aa CAAX protease
3460 CAJPMW010000050.1 GCA905371905_01737 CDS open 20064-20543 _na     159_aa hypothetical protein
3461 CAJPMW010000050.1 GCA905371905_01718 gene open 513-1001
3462 CAJPMW010000050.1 GCA905371905_01719 gene open 1365-3935
3463 CAJPMW010000050.1 GCA905371905_01720 gene open 4140-4553
3464 CAJPMW010000050.1 GCA905371905_01721 gene open 5378-5491
3465 CAJPMW010000050.1 GCA905371905_01722 gene open 5687-5989
3466 CAJPMW010000050.1 GCA905371905_01723 gene open 6499-7605
3467 CAJPMW010000050.1 GCA905371905_01724 gene open 7713-7919 copG
3468 CAJPMW010000050.1 GCA905371905_01725 gene open 8131-8274
3469 CAJPMW010000050.1 GCA905371905_01726 gene open 8637-10172
3470 CAJPMW010000050.1 GCA905371905_01727 gene open 10849-11349
3471 CAJPMW010000050.1 GCA905371905_01728 gene open 11349-12614
3472 CAJPMW010000050.1 GCA905371905_01729 gene open 12839-13150
3473 CAJPMW010000050.1 GCA905371905_01730 gene open 13272-13811
3474 CAJPMW010000050.1 GCA905371905_01731 gene open 13872-14186
3475 CAJPMW010000050.1 GCA905371905_01732 gene open 14183-14821
3476 CAJPMW010000050.1 GCA905371905_01733 gene open 15373-15543
3477 CAJPMW010000050.1 GCA905371905_01734 gene open 16038-16997
3478 CAJPMW010000050.1 GCA905371905_01735 gene open 17702-19000
3479 CAJPMW010000050.1 GCA905371905_01736 gene open 19418-20029
3480 CAJPMW010000050.1 GCA905371905_01737 gene open 20064-20543
3481 CAJPMW010000051.1 GCA905371905_01738 CDS open 38-790 _na     250_aa hypothetical protein
3482 CAJPMW010000051.1 GCA905371905_01739 CDS open 1335-1796 _na     153_aa infC translation initiation factor IF-3
3483 CAJPMW010000051.1 GCA905371905_01740 CDS open 1799-1999 _na     66_aa rpmI 50S ribosomal protein L35
3484 CAJPMW010000051.1 GCA905371905_01741 CDS open 2056-2421 _na     121_aa rplT 50S ribosomal protein L20
3485 CAJPMW010000051.1 GCA905371905_01742 CDS open 2708-5722 _na     1004_aa VWFA domain-containing protein
3486 CAJPMW010000051.1 GCA905371905_01743 CDS open 5965-7314 _na     449_aa VWFA domain-containing protein
3487 CAJPMW010000051.1 GCA905371905_01744 CDS open 7776-8972 _na     398_aa Phospho-N-acetylmuramoyl-pentapeptide-transferase
3488 CAJPMW010000051.1 GCA905371905_01745 CDS open 9512-11518 _na     668_aa rho transcription termination factor Rho
3489 CAJPMW010000051.1 GCA905371905_01746 CDS open 11790-12362 _na     190_aa hypothetical protein
3490 CAJPMW010000051.1 GCA905371905_01747 CDS open 12696-13421 _na     241_aa hypothetical protein
3491 CAJPMW010000051.1 GCA905371905_01748 CDS open 13447-13887 _na     146_aa vanZ VanZ family protein
3492 CAJPMW010000051.1 GCA905371905_01749 CDS open 14026-15231 _na     401_aa Amino acid ABC transporter substrate-binding protein
3493 CAJPMW010000051.1 GCA905371905_01750 CDS open 15357-16232 _na     291_aa ABC transporter permease
3494 CAJPMW010000051.1 GCA905371905_01751 CDS open 16243-17379 _na     378_aa ABC transporter permease
3495 CAJPMW010000051.1 GCA905371905_01752 CDS open 17372-18355 _na     327_aa Branched-chain amino acid ABC transporter ATP-binding protein
3496 CAJPMW010000051.1 GCA905371905_01753 CDS open 18356-19066 _na     236_aa Amino acid ABC transporter ATPase
3497 CAJPMW010000051.1 GCA905371905_01754 CDS open 19449-20036 _na     195_aa Suppressor of fused-like domain-containing protein
3498 CAJPMW010000051.1 GCA905371905_01755 CDS open 20053-20259 _na     68_aa hypothetical protein
3499 CAJPMW010000051.1 GCA905371905_01738 gene open 38-790
3500 CAJPMW010000051.1 GCA905371905_01739 gene open 1335-1796 infC