HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hornefia nodatum (GCA_905372015.1)

Select a Genome:
BAKTA Annotations for GCA_905372015.1
Genome Selected: Hornefia nodatum
ContigsBases CDSrRNA tmRNAtRNA
94 1840341 1674 1 2 24
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3429 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3429 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPNO010000027.1 GCA905372015_00987 gene open 8485-9753
2002 CAJPNO010000027.1 GCA905372015_00988 gene open 9767-10951
2003 CAJPNO010000027.1 GCA905372015_00989 gene open 10951-11670
2004 CAJPNO010000027.1 GCA905372015_00990 gene open 11670-12260 purN
2005 CAJPNO010000027.1 GCA905372015_00991 gene open 12254-13294
2006 CAJPNO010000027.1 GCA905372015_00992 gene open 13312-13806
2007 CAJPNO010000027.1 GCA905372015_00993 gene open 13967-14392 ruvX
2008 CAJPNO010000027.1 GCA905372015_00994 gene open 14445-14690 ireB
2009 CAJPNO010000027.1 GCA905372015_00995 gene open 14817-17435 alaS
2010 CAJPNO010000027.1 GCA905372015_00996 gene open 17466-19130
2011 CAJPNO010000027.1 GCA905372015_00997 gene open 19275-20192
2012 CAJPNO010000027.1 GCA905372015_00998 gene open 20411-21787
2013 CAJPNO010000027.1 GCA905372015_00999 gene open 21780-22637 nadC
2014 CAJPNO010000027.1 GCA905372015_01000 gene open 22809-23255 nifU
2015 CAJPNO010000027.1 GCA905372015_01001 gene open 23257-24444 nifS
2016 CAJPNO010000028.1 GCA905372015_01002 CDS open 183-551 _na     122_aa hypothetical protein
2017 CAJPNO010000028.1 GCA905372015_01003 CDS open 737-1066 _na     109_aa hypothetical protein
2018 CAJPNO010000028.1 GCA905372015_01004 CDS open 1078-1449 _na     123_aa hypothetical protein
2019 CAJPNO010000028.1 GCA905372015_01005 CDS open 2442-3980 _na     512_aa Trypsin-like peptidase domain protein
2020 CAJPNO010000028.1 GCA905372015_01006 CDS open 4164-6146 _na     660_aa Efflux ABC transporter%2C permease protein
2021 CAJPNO010000028.1 GCA905372015_01007 CDS open 6149-6907 _na     252_aa ABC transporter%2C ATP-binding protein
2022 CAJPNO010000028.1 GCA905372015_01008 CDS open 7119-8048 _na     309_aa histidine kinase
2023 CAJPNO010000028.1 GCA905372015_01009 CDS open 8050-8727 _na     225_aa Stage 0 sporulation A-like protein
2024 CAJPNO010000028.1 GCA905372015_01010 CDS open 9053-9742 _na     229_aa HTH gntR-type domain-containing protein
2025 CAJPNO010000028.1 GCA905372015_01011 CDS open 9761-10741 _na     326_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2026 CAJPNO010000028.1 GCA905372015_01012 CDS open 10817-11719 _na     300_aa Ig-like protein
2027 CAJPNO010000028.1 GCA905372015_01013 CDS open 11716-12291 _na     191_aa tadA tRNA adenosine(34) deaminase TadA
2028 CAJPNO010000028.1 GCA905372015_01014 CDS open 12381-13658 _na     425_aa Dihydro-orotase-like protein
2029 CAJPNO010000028.1 GCA905372015_01015 CDS open 13694-14557 _na     287_aa Putative dihydroorotate oxidase%2C electron transfer subunit
2030 CAJPNO010000028.1 GCA905372015_01016 CDS open 14551-15504 _na     317_aa dihydroorotate dehydrogenase
2031 CAJPNO010000028.1 GCA905372015_01017 CDS open 15504-16202 _na     232_aa pyrF orotidine-5'-phosphate decarboxylase
2032 CAJPNO010000028.1 GCA905372015_01018 CDS open 16271-16906 _na     211_aa Orotate phosphoribosyltransferase
2033 CAJPNO010000028.1 GCA905372015_01019 CDS open 17049-17969 _na     306_aa pyrB aspartate carbamoyltransferase
2034 CAJPNO010000028.1 GCA905372015_01020 CDS open 18020-18439 _na     139_aa aspartate carbamoyltransferase regulatory subunit
2035 CAJPNO010000028.1 GCA905372015_01021 CDS open 18682-18912 _na     76_aa vbhA Antitoxin VbhA domain-containing protein
2036 CAJPNO010000028.1 GCA905372015_01022 CDS open 19412-21019 _na     535_aa Repeat%2C PF09479
2037 CAJPNO010000028.1 GCA905372015_01023 CDS open 21041-21802 _na     253_aa hypothetical protein
2038 CAJPNO010000028.1 GCA905372015_01024 CDS open 22296-22499 _na     67_aa hypothetical protein
2039 CAJPNO010000028.1 GCA905372015_01025 CDS open 22674-22853 _na     59_aa HTH cro/C1-type domain-containing protein
2040 CAJPNO010000028.1 GCA905372015_01026 CDS open 22855-23316 _na     153_aa hypothetical protein
2041 CAJPNO010000028.1 GCA905372015_01027 CDS open 23345-23659 _na     104_aa hypothetical protein
2042 CAJPNO010000028.1 GCA905372015_01002 gene open 183-551
2043 CAJPNO010000028.1 GCA905372015_01003 gene open 737-1066
2044 CAJPNO010000028.1 GCA905372015_01004 gene open 1078-1449
2045 CAJPNO010000028.1 GCA905372015_01005 gene open 2442-3980
2046 CAJPNO010000028.1 GCA905372015_01006 gene open 4164-6146
2047 CAJPNO010000028.1 GCA905372015_01007 gene open 6149-6907
2048 CAJPNO010000028.1 GCA905372015_01008 gene open 7119-8048
2049 CAJPNO010000028.1 GCA905372015_01009 gene open 8050-8727
2050 CAJPNO010000028.1 GCA905372015_01010 gene open 9053-9742
2051 CAJPNO010000028.1 GCA905372015_01011 gene open 9761-10741 ispE
2052 CAJPNO010000028.1 GCA905372015_01012 gene open 10817-11719
2053 CAJPNO010000028.1 GCA905372015_01013 gene open 11716-12291 tadA
2054 CAJPNO010000028.1 GCA905372015_01014 gene open 12381-13658
2055 CAJPNO010000028.1 GCA905372015_01015 gene open 13694-14557
2056 CAJPNO010000028.1 GCA905372015_01016 gene open 14551-15504
2057 CAJPNO010000028.1 GCA905372015_01017 gene open 15504-16202 pyrF
2058 CAJPNO010000028.1 GCA905372015_01018 gene open 16271-16906
2059 CAJPNO010000028.1 GCA905372015_01019 gene open 17049-17969 pyrB
2060 CAJPNO010000028.1 GCA905372015_01020 gene open 18020-18439
2061 CAJPNO010000028.1 GCA905372015_01021 gene open 18682-18912 vbhA
2062 CAJPNO010000028.1 GCA905372015_01022 gene open 19412-21019
2063 CAJPNO010000028.1 GCA905372015_01023 gene open 21041-21802
2064 CAJPNO010000028.1 GCA905372015_01024 gene open 22296-22499
2065 CAJPNO010000028.1 GCA905372015_01025 gene open 22674-22853
2066 CAJPNO010000028.1 GCA905372015_01026 gene open 22855-23316
2067 CAJPNO010000028.1 GCA905372015_01027 gene open 23345-23659
2068 CAJPNO010000029.1 GCA905372015_01028 CDS open 83-481 _na     132_aa rpsH 30S ribosomal protein S8
2069 CAJPNO010000029.1 GCA905372015_01029 CDS open 493-1038 _na     181_aa rplF 50S ribosomal protein L6
2070 CAJPNO010000029.1 GCA905372015_01030 CDS open 1055-1420 _na     121_aa rplR 50S ribosomal protein L18
2071 CAJPNO010000029.1 GCA905372015_01031 CDS open 1435-1938 _na     167_aa rpsE 30S ribosomal protein S5
2072 CAJPNO010000029.1 GCA905372015_01032 CDS open 1952-2134 _na     60_aa rpmD 50S ribosomal protein L30
2073 CAJPNO010000029.1 GCA905372015_01033 CDS open 2153-2593 _na     146_aa rplO 50S ribosomal protein L15
2074 CAJPNO010000029.1 GCA905372015_01034 CDS open 2593-3876 _na     427_aa secY preprotein translocase subunit SecY
2075 CAJPNO010000029.1 GCA905372015_01035 CDS open 3911-4558 _na     215_aa adenylate kinase
2076 CAJPNO010000029.1 GCA905372015_01036 CDS open 4565-5311 _na     248_aa map type I methionyl aminopeptidase
2077 CAJPNO010000029.1 GCA905372015_01037 CDS open 5328-5552 _na     74_aa infA translation initiation factor IF-1
2078 CAJPNO010000029.1 GCA905372015_01038 CDS open 5849-6217 _na     122_aa rpsM 30S ribosomal protein S13
2079 CAJPNO010000029.1 GCA905372015_01039 CDS open 6230-6628 _na     132_aa rpsK 30S ribosomal protein S11
2080 CAJPNO010000029.1 GCA905372015_01040 CDS open 6649-7236 _na     195_aa rpsD 30S ribosomal protein S4
2081 CAJPNO010000029.1 GCA905372015_01041 CDS open 7286-8230 _na     314_aa DNA-directed RNA polymerase subunit alpha
2082 CAJPNO010000029.1 GCA905372015_01042 CDS open 8369-8710 _na     113_aa rplQ 50S ribosomal protein L17
2083 CAJPNO010000029.1 GCA905372015_01043 CDS open 8770-9192 _na     140_aa Lipoprotein
2084 CAJPNO010000029.1 GCA905372015_01044 CDS open 9472-10839 _na     455_aa fumC class II fumarate hydratase
2085 CAJPNO010000029.1 GCA905372015_01045 CDS open 10931-12097 _na     388_aa Malic enzyme%2C NAD-binding domain protein
2086 CAJPNO010000029.1 GCA905372015_01046 CDS open 12142-12645 _na     167_aa hypothetical protein
2087 CAJPNO010000029.1 GCA905372015_01047 CDS open 12780-13805 _na     341_aa Pyridoxal phosphate-dependent enzyme%2C D-cysteine desulfhydrase family
2088 CAJPNO010000029.1 GCA905372015_01048 CDS open 13815-14828 _na     337_aa Radical SAM domain protein
2089 CAJPNO010000029.1 GCA905372015_01049 CDS open 14839-15114 _na     91_aa ACT domain-containing protein
2090 CAJPNO010000029.1 GCA905372015_01050 CDS open 15126-16484 _na     452_aa UPF0210 protein HMPREF0378_1129
2091 CAJPNO010000029.1 GCA905372015_01051 CDS open 16625-19177 _na     850_aa Copper-exporting P-type ATPase
2092 CAJPNO010000029.1 GCA905372015_01052 CDS open 19331-19639 _na     102_aa Metal-sensitive transcriptional repressor
2093 CAJPNO010000029.1 GCA905372015_01053 CDS open 19886-21307 _na     473_aa Sodium:neurotransmitter symporter domain protein
2094 CAJPNO010000029.1 GCA905372015_01054 CDS open 21516-22418 _na     300_aa PF10035 family protein
2095 CAJPNO010000029.1 GCA905372015_01055 CDS open 22535-23392 _na     285_aa folD Bifunctional protein FolD
2096 CAJPNO010000029.1 GCA905372015_01028 gene open 83-481 rpsH
2097 CAJPNO010000029.1 GCA905372015_01029 gene open 493-1038 rplF
2098 CAJPNO010000029.1 GCA905372015_01030 gene open 1055-1420 rplR
2099 CAJPNO010000029.1 GCA905372015_01031 gene open 1435-1938 rpsE
2100 CAJPNO010000029.1 GCA905372015_01032 gene open 1952-2134 rpmD
2101 CAJPNO010000029.1 GCA905372015_01033 gene open 2153-2593 rplO
2102 CAJPNO010000029.1 GCA905372015_01034 gene open 2593-3876 secY
2103 CAJPNO010000029.1 GCA905372015_01035 gene open 3911-4558
2104 CAJPNO010000029.1 GCA905372015_01036 gene open 4565-5311 map
2105 CAJPNO010000029.1 GCA905372015_01037 gene open 5328-5552 infA
2106 CAJPNO010000029.1 GCA905372015_01038 gene open 5849-6217 rpsM
2107 CAJPNO010000029.1 GCA905372015_01039 gene open 6230-6628 rpsK
2108 CAJPNO010000029.1 GCA905372015_01040 gene open 6649-7236 rpsD
2109 CAJPNO010000029.1 GCA905372015_01041 gene open 7286-8230
2110 CAJPNO010000029.1 GCA905372015_01042 gene open 8369-8710 rplQ
2111 CAJPNO010000029.1 GCA905372015_01043 gene open 8770-9192
2112 CAJPNO010000029.1 GCA905372015_01044 gene open 9472-10839 fumC
2113 CAJPNO010000029.1 GCA905372015_01045 gene open 10931-12097
2114 CAJPNO010000029.1 GCA905372015_01046 gene open 12142-12645
2115 CAJPNO010000029.1 GCA905372015_01047 gene open 12780-13805
2116 CAJPNO010000029.1 GCA905372015_01048 gene open 13815-14828
2117 CAJPNO010000029.1 GCA905372015_01049 gene open 14839-15114
2118 CAJPNO010000029.1 GCA905372015_01050 gene open 15126-16484
2119 CAJPNO010000029.1 GCA905372015_01051 gene open 16625-19177
2120 CAJPNO010000029.1 GCA905372015_01052 gene open 19331-19639
2121 CAJPNO010000029.1 GCA905372015_01053 gene open 19886-21307
2122 CAJPNO010000029.1 GCA905372015_01054 gene open 21516-22418
2123 CAJPNO010000029.1 GCA905372015_01055 gene open 22535-23392 folD
2124 CAJPNO010000030.1 GCA905372015_01068 gene open 13506-13840 ssrA
2125 CAJPNO010000030.1 GCA905372015_01069 gene open 13746-14267 ssrA
2126 CAJPNO010000030.1 GCA905372015_01068 tmRNA open 13506-13840 ssrA transfer-messenger RNA%2C SsrA
2127 CAJPNO010000030.1 GCA905372015_01069 tmRNA open 13746-14267 ssrA transfer-messenger RNA%2C SsrA
2128 CAJPNO010000030.1 GCA905372015_01056 CDS open 170-880 _na     236_aa pflA pyruvate formate-lyase-activating protein
2129 CAJPNO010000030.1 GCA905372015_01057 CDS open 893-3124 _na     743_aa pflB formate C-acetyltransferase
2130 CAJPNO010000030.1 GCA905372015_01058 CDS open 3482-4513 _na     343_aa Putative membrane protein
2131 CAJPNO010000030.1 GCA905372015_01059 CDS open 4517-4729 _na     70_aa DUF4366 domain-containing protein
2132 CAJPNO010000030.1 GCA905372015_01060 CDS open 4713-5360 _na     215_aa Cytidylate kinase-like family protein
2133 CAJPNO010000030.1 GCA905372015_01061 CDS open 5489-6982 _na     497_aa glpK glycerol kinase GlpK
2134 CAJPNO010000030.1 GCA905372015_01062 CDS open 7434-8978 _na     514_aa FMN-binding domain protein
2135 CAJPNO010000030.1 GCA905372015_01063 CDS open 9213-10100 _na     295_aa Alpha/beta hydrolase
2136 CAJPNO010000030.1 GCA905372015_01064 CDS open 10343-11281 _na     312_aa SPFH domain/Band 7 family protein
2137 CAJPNO010000030.1 GCA905372015_01065 CDS open 11294-11743 _na     149_aa nfeD Nodulation efficiency protein NfeD
2138 CAJPNO010000030.1 GCA905372015_01066 CDS open 11865-12587 _na     240_aa Ribosomal RNA small subunit methyltransferase E
2139 CAJPNO010000030.1 GCA905372015_01067 CDS open 12713-13288 _na     191_aa Uracil-DNA glycosylase family protein
2140 CAJPNO010000030.1 GCA905372015_01070 CDS open 14657-15247 _na     196_aa PF13338 domain protein
2141 CAJPNO010000030.1 GCA905372015_01071 CDS open 15247-15834 _na     195_aa nucleotidyl transferase AbiEii/AbiGii toxin family protein
2142 CAJPNO010000030.1 GCA905372015_01072 CDS open 15831-16109 _na     92_aa hypothetical protein
2143 CAJPNO010000030.1 GCA905372015_01073 CDS open 16870-17583 _na     237_aa DNA-binding helix-turn-helix protein
2144 CAJPNO010000030.1 GCA905372015_01074 CDS open 18000-18617 _na     205_aa Plasmid pRiA4b Orf3-like domain-containing protein
2145 CAJPNO010000030.1 GCA905372015_01075 CDS open 18903-19580 _na     225_aa Putative membrane protein
2146 CAJPNO010000030.1 GCA905372015_01076 CDS open 19610-20242 _na     210_aa thiT energy-coupled thiamine transporter ThiT
2147 CAJPNO010000030.1 GCA905372015_01077 CDS open 20395-22431 _na     678_aa thrS threonine--tRNA ligase
2148 CAJPNO010000030.1 GCA905372015_01056 gene open 170-880 pflA
2149 CAJPNO010000030.1 GCA905372015_01057 gene open 893-3124 pflB
2150 CAJPNO010000030.1 GCA905372015_01058 gene open 3482-4513
2151 CAJPNO010000030.1 GCA905372015_01059 gene open 4517-4729
2152 CAJPNO010000030.1 GCA905372015_01060 gene open 4713-5360
2153 CAJPNO010000030.1 GCA905372015_01061 gene open 5489-6982 glpK
2154 CAJPNO010000030.1 GCA905372015_01062 gene open 7434-8978
2155 CAJPNO010000030.1 GCA905372015_01063 gene open 9213-10100
2156 CAJPNO010000030.1 GCA905372015_01064 gene open 10343-11281
2157 CAJPNO010000030.1 GCA905372015_01065 gene open 11294-11743 nfeD
2158 CAJPNO010000030.1 GCA905372015_01066 gene open 11865-12587
2159 CAJPNO010000030.1 GCA905372015_01067 gene open 12713-13288
2160 CAJPNO010000030.1 GCA905372015_01070 gene open 14657-15247
2161 CAJPNO010000030.1 GCA905372015_01071 gene open 15247-15834
2162 CAJPNO010000030.1 GCA905372015_01072 gene open 15831-16109
2163 CAJPNO010000030.1 GCA905372015_01073 gene open 16870-17583
2164 CAJPNO010000030.1 GCA905372015_01074 gene open 18000-18617
2165 CAJPNO010000030.1 GCA905372015_01075 gene open 18903-19580
2166 CAJPNO010000030.1 GCA905372015_01076 gene open 19610-20242 thiT
2167 CAJPNO010000030.1 GCA905372015_01077 gene open 20395-22431 thrS
2168 CAJPNO010000031.1 GCA905372015_01078 CDS open 296-2896 _na     866_aa Putative calcium-translocating P-type ATPase%2C PMCA-type
2169 CAJPNO010000031.1 GCA905372015_01079 CDS open 2918-3169 _na     83_aa TIGR03905 family protein
2170 CAJPNO010000031.1 GCA905372015_01080 CDS open 3391-5178 _na     595_aa AMP-binding enzyme
2171 CAJPNO010000031.1 GCA905372015_01081 CDS open 5277-5573 _na     98_aa hypothetical protein
2172 CAJPNO010000031.1 GCA905372015_01082 CDS open 5570-6199 _na     209_aa Formiminotransferase-cyclodeaminase
2173 CAJPNO010000031.1 GCA905372015_01083 CDS open 6239-7918 _na     559_aa formate--tetrahydrofolate ligase
2174 CAJPNO010000031.1 GCA905372015_01084 CDS open 7933-8577 _na     214_aa Ribonuclease HII
2175 CAJPNO010000031.1 GCA905372015_01085 CDS open 8574-9407 _na     277_aa ylqF ribosome biogenesis GTPase YlqF
2176 CAJPNO010000031.1 GCA905372015_01086 CDS open 9624-9971 _na     115_aa rplS 50S ribosomal protein L19
2177 CAJPNO010000031.1 GCA905372015_01087 CDS open 10094-11548 _na     484_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
2178 CAJPNO010000031.1 GCA905372015_01088 CDS open 11574-12479 _na     301_aa Site-specific recombinase%2C phage integrase family
2179 CAJPNO010000031.1 GCA905372015_01089 CDS open 12507-13064 _na     185_aa NUDIX domain protein
2180 CAJPNO010000031.1 GCA905372015_01090 CDS open 13318-14319 _na     333_aa Rnase H family
2181 CAJPNO010000031.1 GCA905372015_01091 CDS open 14321-15142 _na     273_aa Iron-sulfur cluster carrier protein
2182 CAJPNO010000031.1 GCA905372015_01092 CDS open 15157-15717 _na     186_aa 5-formyltetrahydrofolate cyclo-ligase
2183 CAJPNO010000031.1 GCA905372015_01093 CDS open 16193-17800 _na     535_aa hypothetical protein
2184 CAJPNO010000031.1 GCA905372015_01094 CDS open 17814-20267 _na     817_aa Peptidase%2C S8/S53 family
2185 CAJPNO010000031.1 GCA905372015_01095 CDS open 20548-20883 _na     111_aa DUF3846 domain-containing protein
2186 CAJPNO010000031.1 GCA905372015_01096 CDS open 20900-21319 _na     139_aa Lipoprotein
2187 CAJPNO010000031.1 GCA905372015_01097 CDS open 21408-21902 _na     164_aa Sigma-70%2C region 4
2188 CAJPNO010000031.1 GCA905372015_01098 CDS open 21904-22539 _na     211_aa DUF4367 domain-containing protein
2189 CAJPNO010000031.1 GCA905372015_01078 gene open 296-2896
2190 CAJPNO010000031.1 GCA905372015_01079 gene open 2918-3169
2191 CAJPNO010000031.1 GCA905372015_01080 gene open 3391-5178
2192 CAJPNO010000031.1 GCA905372015_01081 gene open 5277-5573
2193 CAJPNO010000031.1 GCA905372015_01082 gene open 5570-6199
2194 CAJPNO010000031.1 GCA905372015_01083 gene open 6239-7918
2195 CAJPNO010000031.1 GCA905372015_01084 gene open 7933-8577
2196 CAJPNO010000031.1 GCA905372015_01085 gene open 8574-9407 ylqF
2197 CAJPNO010000031.1 GCA905372015_01086 gene open 9624-9971 rplS
2198 CAJPNO010000031.1 GCA905372015_01087 gene open 10094-11548
2199 CAJPNO010000031.1 GCA905372015_01088 gene open 11574-12479
2200 CAJPNO010000031.1 GCA905372015_01089 gene open 12507-13064
2201 CAJPNO010000031.1 GCA905372015_01090 gene open 13318-14319
2202 CAJPNO010000031.1 GCA905372015_01091 gene open 14321-15142
2203 CAJPNO010000031.1 GCA905372015_01092 gene open 15157-15717
2204 CAJPNO010000031.1 GCA905372015_01093 gene open 16193-17800
2205 CAJPNO010000031.1 GCA905372015_01094 gene open 17814-20267
2206 CAJPNO010000031.1 GCA905372015_01095 gene open 20548-20883
2207 CAJPNO010000031.1 GCA905372015_01096 gene open 20900-21319
2208 CAJPNO010000031.1 GCA905372015_01097 gene open 21408-21902
2209 CAJPNO010000031.1 GCA905372015_01098 gene open 21904-22539
2210 CAJPNO010000032.1 GCA905372015_01099 CDS open 305-1093 _na     262_aa 3-hydroxybutyrate dehydrogenase
2211 CAJPNO010000032.1 GCA905372015_01100 CDS open 1156-2541 _na     461_aa Citrate transporter
2212 CAJPNO010000032.1 GCA905372015_01101 CDS open 2577-3509 _na     310_aa Putative 3-hydroxybutyryl-CoA dehydrogenase
2213 CAJPNO010000032.1 GCA905372015_01102 CDS open 3672-5630 _na     652_aa Collagen adhesin family protein
2214 CAJPNO010000032.1 GCA905372015_01103 CDS open 5996-6835 _na     279_aa energy-coupling factor transporter ATPase
2215 CAJPNO010000032.1 GCA905372015_01104 CDS open 6820-7686 _na     288_aa energy-coupling factor transporter ATPase
2216 CAJPNO010000032.1 GCA905372015_01105 CDS open 7683-8489 _na     268_aa Cobalt transport protein
2217 CAJPNO010000032.1 GCA905372015_01106 CDS open 8486-9115 _na     209_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2218 CAJPNO010000032.1 GCA905372015_01107 CDS open 9255-10520 _na     421_aa Aminotransferase%2C class I/II
2219 CAJPNO010000032.1 GCA905372015_01109 CDS open 11044-11415 _na     123_aa Iron dependent repressor%2C metal binding/dimerization domain protein
2220 CAJPNO010000032.1 GCA905372015_01110 CDS open 11830-12042 _na     70_aa feoA FeoA domain protein
2221 CAJPNO010000032.1 GCA905372015_01111 CDS open 12051-12272 _na     73_aa feoA FeoA domain protein
2222 CAJPNO010000032.1 GCA905372015_01112 CDS open 12336-14483 _na     715_aa feoB ferrous iron transport protein B
2223 CAJPNO010000032.1 GCA905372015_01113 CDS open 14496-14615 _na     39_aa hypothetical protein
2224 CAJPNO010000032.1 GCA905372015_01114 CDS open 14652-14816 _na     54_aa Attachment protein p12 family protein
2225 CAJPNO010000032.1 GCA905372015_01115 CDS open 14998-15255 _na     85_aa DUF6110 domain-containing protein
2226 CAJPNO010000032.1 GCA905372015_01116 CDS open 15264-17336 _na     690_aa Cd(2+)-exporting ATPase
2227 CAJPNO010000032.1 GCA905372015_01117 CDS open 17517-17834 _na     105_aa PF10087 family protein
2228 CAJPNO010000032.1 GCA905372015_01118 CDS open 17857-18417 _na     186_aa PF12672 family protein
2229 CAJPNO010000032.1 GCA905372015_01119 CDS open 18444-18866 _na     140_aa flavodoxin
2230 CAJPNO010000032.1 GCA905372015_01120 CDS open 19077-19775 _na     232_aa ABC transporter%2C ATP-binding protein
2231 CAJPNO010000032.1 GCA905372015_01099 gene open 305-1093
2232 CAJPNO010000032.1 GCA905372015_01100 gene open 1156-2541
2233 CAJPNO010000032.1 GCA905372015_01101 gene open 2577-3509
2234 CAJPNO010000032.1 GCA905372015_01102 gene open 3672-5630
2235 CAJPNO010000032.1 GCA905372015_01103 gene open 5996-6835
2236 CAJPNO010000032.1 GCA905372015_01104 gene open 6820-7686
2237 CAJPNO010000032.1 GCA905372015_01105 gene open 7683-8489
2238 CAJPNO010000032.1 GCA905372015_01106 gene open 8486-9115 trmB
2239 CAJPNO010000032.1 GCA905372015_01107 gene open 9255-10520
2240 CAJPNO010000032.1 GCA905372015_01109 gene open 11044-11415
2241 CAJPNO010000032.1 GCA905372015_01110 gene open 11830-12042 feoA
2242 CAJPNO010000032.1 GCA905372015_01111 gene open 12051-12272 feoA
2243 CAJPNO010000032.1 GCA905372015_01112 gene open 12336-14483 feoB
2244 CAJPNO010000032.1 GCA905372015_01113 gene open 14496-14615
2245 CAJPNO010000032.1 GCA905372015_01114 gene open 14652-14816
2246 CAJPNO010000032.1 GCA905372015_01115 gene open 14998-15255
2247 CAJPNO010000032.1 GCA905372015_01116 gene open 15264-17336
2248 CAJPNO010000032.1 GCA905372015_01117 gene open 17517-17834
2249 CAJPNO010000032.1 GCA905372015_01118 gene open 17857-18417
2250 CAJPNO010000032.1 GCA905372015_01119 gene open 18444-18866
2251 CAJPNO010000032.1 GCA905372015_01120 gene open 19077-19775
2252 CAJPNO010000032.1 GCA905372015_01108 gene open 10663-10736 trnG
2253 CAJPNO010000032.1 GCA905372015_01108 tRNA open 10663-10736 trnG tRNA-Gly(ccc)
2254 CAJPNO010000033.1 GCA905372015_01121 CDS open 72-443 _na     123_aa hypothetical protein
2255 CAJPNO010000033.1 GCA905372015_01122 CDS open 618-1268 _na     216_aa Type I restriction enzyme R protein C-terminal domain-containing protein
2256 CAJPNO010000033.1 GCA905372015_01123 CDS open 1682-2152 _na     156_aa DUF4367 domain-containing protein
2257 CAJPNO010000033.1 GCA905372015_01124 CDS open 2156-2350 _na     64_aa hypothetical protein
2258 CAJPNO010000033.1 GCA905372015_01125 CDS open 2542-3231 _na     229_aa Flavodoxin domain protein
2259 CAJPNO010000033.1 GCA905372015_01126 CDS open 3249-3767 _na     172_aa DNA-binding domain%2C methylated-DNA-[protein]-cysteine S-methyltransferase family protein
2260 CAJPNO010000033.1 GCA905372015_01127 CDS open 4042-4257 _na     71_aa Cro/C1-type HTH DNA-binding domain protein
2261 CAJPNO010000033.1 GCA905372015_01128 CDS open 4322-5809 _na     495_aa tRNA(Ile)-lysidine synthase
2262 CAJPNO010000033.1 GCA905372015_01129 CDS open 5886-8045 _na     719_aa ftsH ATP-dependent zinc metalloprotease FtsH
2263 CAJPNO010000033.1 GCA905372015_01130 CDS open 8073-9629 _na     518_aa Purine catabolism regulator-like protein
2264 CAJPNO010000033.1 GCA905372015_01131 CDS open 9645-10493 _na     282_aa type III pantothenate kinase
2265 CAJPNO010000033.1 GCA905372015_01132 CDS open 10486-11436 _na     316_aa dusB tRNA dihydrouridine synthase DusB
2266 CAJPNO010000033.1 GCA905372015_01133 CDS open 11444-12040 _na     198_aa precorrin-2 dehydrogenase
2267 CAJPNO010000033.1 GCA905372015_01134 CDS open 12037-12891 _na     284_aa hemC hydroxymethylbilane synthase
2268 CAJPNO010000033.1 GCA905372015_01135 CDS open 12894-14351 _na     485_aa uroporphyrinogen-III C-methyltransferase
2269 CAJPNO010000033.1 GCA905372015_01136 CDS open 14505-15230 _na     241_aa cobI precorrin-2 C(20)-methyltransferase
2270 CAJPNO010000033.1 GCA905372015_01137 CDS open 15250-15906 _na     218_aa ABC-2 family transporter protein
2271 CAJPNO010000033.1 GCA905372015_01138 CDS open 16011-16649 _na     212_aa ABC-2 family transporter protein
2272 CAJPNO010000033.1 GCA905372015_01139 CDS open 16660-17538 _na     292_aa ABC transporter%2C ATP-binding protein
2273 CAJPNO010000033.1 GCA905372015_01140 CDS open 17535-17912 _na     125_aa gntR Transcriptional regulator%2C GntR family
2274 CAJPNO010000033.1 GCA905372015_01141 CDS open 18158-19252 _na     364_aa Iron transport-associated domain protein
2275 CAJPNO010000033.1 GCA905372015_01142 CDS open 19330-20172 _na     280_aa ABC transporter%2C ATP-binding protein
2276 CAJPNO010000033.1 GCA905372015_01143 CDS open 20182-20913 _na     243_aa Transport permease protein
2277 CAJPNO010000033.1 GCA905372015_01144 CDS open 20965-21540 _na     191_aa hypothetical protein
2278 CAJPNO010000033.1 GCA905372015_01121 gene open 72-443
2279 CAJPNO010000033.1 GCA905372015_01122 gene open 618-1268
2280 CAJPNO010000033.1 GCA905372015_01123 gene open 1682-2152
2281 CAJPNO010000033.1 GCA905372015_01124 gene open 2156-2350
2282 CAJPNO010000033.1 GCA905372015_01125 gene open 2542-3231
2283 CAJPNO010000033.1 GCA905372015_01126 gene open 3249-3767
2284 CAJPNO010000033.1 GCA905372015_01127 gene open 4042-4257
2285 CAJPNO010000033.1 GCA905372015_01128 gene open 4322-5809
2286 CAJPNO010000033.1 GCA905372015_01129 gene open 5886-8045 ftsH
2287 CAJPNO010000033.1 GCA905372015_01130 gene open 8073-9629
2288 CAJPNO010000033.1 GCA905372015_01131 gene open 9645-10493
2289 CAJPNO010000033.1 GCA905372015_01132 gene open 10486-11436 dusB
2290 CAJPNO010000033.1 GCA905372015_01133 gene open 11444-12040
2291 CAJPNO010000033.1 GCA905372015_01134 gene open 12037-12891 hemC
2292 CAJPNO010000033.1 GCA905372015_01135 gene open 12894-14351
2293 CAJPNO010000033.1 GCA905372015_01136 gene open 14505-15230 cobI
2294 CAJPNO010000033.1 GCA905372015_01137 gene open 15250-15906
2295 CAJPNO010000033.1 GCA905372015_01138 gene open 16011-16649
2296 CAJPNO010000033.1 GCA905372015_01139 gene open 16660-17538
2297 CAJPNO010000033.1 GCA905372015_01140 gene open 17535-17912 gntR
2298 CAJPNO010000033.1 GCA905372015_01141 gene open 18158-19252
2299 CAJPNO010000033.1 GCA905372015_01142 gene open 19330-20172
2300 CAJPNO010000033.1 GCA905372015_01143 gene open 20182-20913
2301 CAJPNO010000033.1 GCA905372015_01144 gene open 20965-21540
2302 CAJPNO010000034.1 GCA905372015_01164 gene open 19665-20470 rrs
2303 CAJPNO010000034.1 GCA905372015_01164 rRNA open 19665-20470 rrs 16S ribosomal RNA
2304 CAJPNO010000034.1 repeat_region open 2373-3561 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTTGAGAGTAGTGTAATTTCATACGATAGTAAAAC and spacer length 30
2305 CAJPNO010000034.1 repeat_region open 2901-3561 CRISPR array with 10 repeats of length 36%2C consensus sequence GTTTGAGAGTAGTGTAATTTCATACGATAGTAAAAC and spacer length 30
2306 CAJPNO010000034.1 GCA905372015_01145 CDS open 240-467 _na     75_aa hypothetical protein
2307 CAJPNO010000034.1 GCA905372015_01146 CDS open 464-1342 _na     292_aa CRISPR-associated endonuclease Cas1
2308 CAJPNO010000034.1 GCA905372015_01147 CDS open 1347-1652 _na     101_aa CRISPR-associated endoribonuclease Cas2
2309 CAJPNO010000034.1 GCA905372015_01148 CDS open 1649-2317 _na     222_aa hypothetical protein
2310 CAJPNO010000034.1 GCA905372015_01149 CDS open 3703-3909 _na     68_aa 2Fe-2S iron-sulfur cluster-binding domain protein
2311 CAJPNO010000034.1 GCA905372015_01150 CDS open 4083-4616 _na     177_aa Aminoacyl-tRNA editing domain protein
2312 CAJPNO010000034.1 GCA905372015_01151 CDS open 4598-6031 _na     477_aa pyk pyruvate kinase
2313 CAJPNO010000034.1 GCA905372015_01152 CDS open 6069-6875 _na     268_aa purR pur operon repressor
2314 CAJPNO010000034.1 GCA905372015_01153 CDS open 7028-7303 _na     91_aa spoVG septation regulator SpoVG
2315 CAJPNO010000034.1 GCA905372015_01154 CDS open 7486-8046 _na     186_aa 3H domain protein
2316 CAJPNO010000034.1 GCA905372015_01155 CDS open 8138-9517 _na     459_aa murC UDP-N-acetylmuramate--L-alanine ligase
2317 CAJPNO010000034.1 GCA905372015_01156 CDS open 9518-10213 _na     231_aa Transferase hexapeptide repeat protein
2318 CAJPNO010000034.1 GCA905372015_01157 CDS open 10243-11193 _na     316_aa Ribose-phosphate pyrophosphokinase
2319 CAJPNO010000034.1 GCA905372015_01158 CDS open 11234-11827 _na     197_aa pth aminoacyl-tRNA hydrolase
2320 CAJPNO010000034.1 GCA905372015_01159 CDS open 11820-15245 _na     1141_aa mfd transcription-repair coupling factor
2321 CAJPNO010000034.1 GCA905372015_01160 CDS open 15235-16530 _na     431_aa Amidohydrolase family protein
2322 CAJPNO010000034.1 GCA905372015_01161 CDS open 16560-18203 _na     547_aa Polysaccharide biosynthesis protein
2323 CAJPNO010000034.1 GCA905372015_01162 CDS open 18377-18655 _na     92_aa hupA DNA-binding protein HU
2324 CAJPNO010000034.1 GCA905372015_01163 CDS open 18838-19080 _na     80_aa S4 domain protein
2325 CAJPNO010000034.1 GCA905372015_01145 gene open 240-467
2326 CAJPNO010000034.1 GCA905372015_01146 gene open 464-1342
2327 CAJPNO010000034.1 GCA905372015_01147 gene open 1347-1652
2328 CAJPNO010000034.1 GCA905372015_01148 gene open 1649-2317
2329 CAJPNO010000034.1 GCA905372015_01149 gene open 3703-3909
2330 CAJPNO010000034.1 GCA905372015_01150 gene open 4083-4616
2331 CAJPNO010000034.1 GCA905372015_01151 gene open 4598-6031 pyk
2332 CAJPNO010000034.1 GCA905372015_01152 gene open 6069-6875 purR
2333 CAJPNO010000034.1 GCA905372015_01153 gene open 7028-7303 spoVG
2334 CAJPNO010000034.1 GCA905372015_01154 gene open 7486-8046
2335 CAJPNO010000034.1 GCA905372015_01155 gene open 8138-9517 murC
2336 CAJPNO010000034.1 GCA905372015_01156 gene open 9518-10213
2337 CAJPNO010000034.1 GCA905372015_01157 gene open 10243-11193
2338 CAJPNO010000034.1 GCA905372015_01158 gene open 11234-11827 pth
2339 CAJPNO010000034.1 GCA905372015_01159 gene open 11820-15245 mfd
2340 CAJPNO010000034.1 GCA905372015_01160 gene open 15235-16530
2341 CAJPNO010000034.1 GCA905372015_01161 gene open 16560-18203
2342 CAJPNO010000034.1 GCA905372015_01162 gene open 18377-18655 hupA
2343 CAJPNO010000034.1 GCA905372015_01163 gene open 18838-19080
2344 CAJPNO010000035.1 GCA905372015_01165 CDS open 23-280 _na     85_aa hypothetical protein
2345 CAJPNO010000035.1 GCA905372015_01166 CDS open 281-1150 _na     289_aa hypothetical protein
2346 CAJPNO010000035.1 GCA905372015_01167 CDS open 1393-2757 _na     454_aa Radical SAM domain protein
2347 CAJPNO010000035.1 GCA905372015_01168 CDS open 3102-4031 _na     309_aa cysK cysteine synthase A
2348 CAJPNO010000035.1 GCA905372015_01169 CDS open 4124-5113 _na     329_aa hypothetical protein
2349 CAJPNO010000035.1 GCA905372015_01170 CDS open 5310-7052 _na     580_aa AMP-binding enzyme
2350 CAJPNO010000035.1 GCA905372015_01171 CDS open 7454-8455 _na     333_aa bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
2351 CAJPNO010000035.1 GCA905372015_01172 CDS open 8452-9315 _na     287_aa Prephenate dehydrogenase
2352 CAJPNO010000035.1 GCA905372015_01173 CDS open 9319-10518 _na     399_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
2353 CAJPNO010000035.1 GCA905372015_01174 CDS open 10628-11623 _na     331_aa aroC chorismate synthase
2354 CAJPNO010000035.1 GCA905372015_01175 CDS open 11624-12301 _na     225_aa DNA alkylation repair enzyme
2355 CAJPNO010000035.1 GCA905372015_01176 CDS open 12419-12967 _na     182_aa Chromate transport protein
2356 CAJPNO010000035.1 GCA905372015_01177 CDS open 12968-13525 _na     185_aa Chromate transport protein
2357 CAJPNO010000035.1 GCA905372015_01178 CDS open 13543-14697 _na     384_aa Bifunctional chorismate mutase/prephenate dehydratase
2358 CAJPNO010000035.1 GCA905372015_01179 CDS open 14714-14980 _na     88_aa Putative chorismate mutase
2359 CAJPNO010000035.1 GCA905372015_01180 CDS open 15058-16296 _na     412_aa Multifunctional fusion protein
2360 CAJPNO010000035.1 GCA905372015_01181 CDS open 16407-16844 _na     145_aa aroQ type II 3-dehydroquinate dehydratase
2361 CAJPNO010000035.1 GCA905372015_01182 CDS open 16993-18189 _na     398_aa Alanine-glyoxylate amino-transferase
2362 CAJPNO010000035.1 GCA905372015_01183 CDS open 18405-19355 _na     316_aa PF10728 domain protein
2363 CAJPNO010000035.1 GCA905372015_01184 CDS open 19389-20216 _na     275_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2364 CAJPNO010000035.1 GCA905372015_01165 gene open 23-280
2365 CAJPNO010000035.1 GCA905372015_01166 gene open 281-1150
2366 CAJPNO010000035.1 GCA905372015_01167 gene open 1393-2757
2367 CAJPNO010000035.1 GCA905372015_01168 gene open 3102-4031 cysK
2368 CAJPNO010000035.1 GCA905372015_01169 gene open 4124-5113
2369 CAJPNO010000035.1 GCA905372015_01170 gene open 5310-7052
2370 CAJPNO010000035.1 GCA905372015_01171 gene open 7454-8455
2371 CAJPNO010000035.1 GCA905372015_01172 gene open 8452-9315
2372 CAJPNO010000035.1 GCA905372015_01173 gene open 9319-10518 aroA
2373 CAJPNO010000035.1 GCA905372015_01174 gene open 10628-11623 aroC
2374 CAJPNO010000035.1 GCA905372015_01175 gene open 11624-12301
2375 CAJPNO010000035.1 GCA905372015_01176 gene open 12419-12967
2376 CAJPNO010000035.1 GCA905372015_01177 gene open 12968-13525
2377 CAJPNO010000035.1 GCA905372015_01178 gene open 13543-14697
2378 CAJPNO010000035.1 GCA905372015_01179 gene open 14714-14980
2379 CAJPNO010000035.1 GCA905372015_01180 gene open 15058-16296
2380 CAJPNO010000035.1 GCA905372015_01181 gene open 16407-16844 aroQ
2381 CAJPNO010000035.1 GCA905372015_01182 gene open 16993-18189
2382 CAJPNO010000035.1 GCA905372015_01183 gene open 18405-19355
2383 CAJPNO010000035.1 GCA905372015_01184 gene open 19389-20216 panB
2384 CAJPNO010000036.1 GCA905372015_01185 CDS open 931-2211 _na     426_aa hypothetical protein
2385 CAJPNO010000036.1 GCA905372015_01186 CDS open 2214-3665 _na     483_aa hypothetical protein
2386 CAJPNO010000036.1 GCA905372015_01187 CDS open 3708-4208 _na     166_aa hypothetical protein
2387 CAJPNO010000036.1 GCA905372015_01188 CDS open 5747-7105 _na     452_aa TIGR00366 family protein
2388 CAJPNO010000036.1 GCA905372015_01189 CDS open 7422-9611 _na     729_aa Peptidase%2C U32 family
2389 CAJPNO010000036.1 GCA905372015_01190 CDS open 9865-10806 _na     313_aa arcC carbamate kinase
2390 CAJPNO010000036.1 GCA905372015_01191 CDS open 10834-12054 _na     406_aa arcA arginine deiminase
2391 CAJPNO010000036.1 GCA905372015_01192 CDS open 12130-13125 _na     331_aa argF ornithine carbamoyltransferase
2392 CAJPNO010000036.1 GCA905372015_01193 CDS open 13275-14753 _na     492_aa gntR Transcriptional regulator%2C GntR family
2393 CAJPNO010000036.1 GCA905372015_01194 CDS open 14756-15883 _na     375_aa RNA methylase%2C PF01170 family
2394 CAJPNO010000036.1 GCA905372015_01195 CDS open 15948-17696 _na     582_aa Putative Na/Pi-cotransporter II-like protein
2395 CAJPNO010000036.1 GCA905372015_01196 CDS open 17750-18331 _na     193_aa Putative dihydroxyacetone kinase regulator
2396 CAJPNO010000036.1 GCA905372015_01197 CDS open 18333-19595 _na     420_aa 50S ribosome-binding GTPase
2397 CAJPNO010000036.1 GCA905372015_01185 gene open 931-2211
2398 CAJPNO010000036.1 GCA905372015_01186 gene open 2214-3665
2399 CAJPNO010000036.1 GCA905372015_01187 gene open 3708-4208
2400 CAJPNO010000036.1 GCA905372015_01188 gene open 5747-7105
2401 CAJPNO010000036.1 GCA905372015_01189 gene open 7422-9611
2402 CAJPNO010000036.1 GCA905372015_01190 gene open 9865-10806 arcC
2403 CAJPNO010000036.1 GCA905372015_01191 gene open 10834-12054 arcA
2404 CAJPNO010000036.1 GCA905372015_01192 gene open 12130-13125 argF
2405 CAJPNO010000036.1 GCA905372015_01193 gene open 13275-14753 gntR
2406 CAJPNO010000036.1 GCA905372015_01194 gene open 14756-15883
2407 CAJPNO010000036.1 GCA905372015_01195 gene open 15948-17696
2408 CAJPNO010000036.1 GCA905372015_01196 gene open 17750-18331
2409 CAJPNO010000036.1 GCA905372015_01197 gene open 18333-19595
2410 CAJPNO010000037.1 GCA905372015_01198 CDS open 221-1054 _na     277_aa Alpha/beta hydrolase family protein
2411 CAJPNO010000037.1 GCA905372015_01199 CDS open 1305-3230 _na     641_aa metG methionine--tRNA ligase
2412 CAJPNO010000037.1 GCA905372015_01200 CDS open 3234-4073 _na     279_aa tatD Hydrolase%2C TatD family
2413 CAJPNO010000037.1 GCA905372015_01201 CDS open 4274-6508 _na     744_aa Fibronectin type III domain protein
2414 CAJPNO010000037.1 GCA905372015_01202 CDS open 6598-7206 _na     202_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
2415 CAJPNO010000037.1 GCA905372015_01203 CDS open 7279-9624 _na     781_aa anaerobic ribonucleoside triphosphate reductase
2416 CAJPNO010000037.1 GCA905372015_01204 CDS open 9901-13455 _na     1184_aa menE o-succinylbenzoate--CoA ligase
2417 CAJPNO010000037.1 GCA905372015_01205 CDS open 13536-14021 _na     161_aa greA transcription elongation factor GreA
2418 CAJPNO010000037.1 GCA905372015_01206 CDS open 14031-15974 _na     647_aa lysS lysine--tRNA ligase
2419 CAJPNO010000037.1 GCA905372015_01207 CDS open 16158-17009 _na     283_aa Lipoprotein
2420 CAJPNO010000037.1 GCA905372015_01208 CDS open 17256-17624 _na     122_aa arsR Transcriptional regulator%2C ArsR family
2421 CAJPNO010000037.1 GCA905372015_01209 CDS open 17740-17958 _na     72_aa Heavy metal-associated domain protein
2422 CAJPNO010000037.1 GCA905372015_01210 CDS open 18017-19885 _na     622_aa Cd(2+)-exporting ATPase
2423 CAJPNO010000037.1 GCA905372015_01198 gene open 221-1054
2424 CAJPNO010000037.1 GCA905372015_01199 gene open 1305-3230 metG
2425 CAJPNO010000037.1 GCA905372015_01200 gene open 3234-4073 tatD
2426 CAJPNO010000037.1 GCA905372015_01201 gene open 4274-6508
2427 CAJPNO010000037.1 GCA905372015_01202 gene open 6598-7206 nrdG
2428 CAJPNO010000037.1 GCA905372015_01203 gene open 7279-9624
2429 CAJPNO010000037.1 GCA905372015_01204 gene open 9901-13455 menE
2430 CAJPNO010000037.1 GCA905372015_01205 gene open 13536-14021 greA
2431 CAJPNO010000037.1 GCA905372015_01206 gene open 14031-15974 lysS
2432 CAJPNO010000037.1 GCA905372015_01207 gene open 16158-17009
2433 CAJPNO010000037.1 GCA905372015_01208 gene open 17256-17624 arsR
2434 CAJPNO010000037.1 GCA905372015_01209 gene open 17740-17958
2435 CAJPNO010000037.1 GCA905372015_01210 gene open 18017-19885
2436 CAJPNO010000038.1 GCA905372015_01211 CDS open 637-1149 _na     170_aa hypothetical protein
2437 CAJPNO010000038.1 GCA905372015_01212 CDS open 1708-1818 _na     36_aa hypothetical protein
2438 CAJPNO010000038.1 GCA905372015_01213 CDS open 1968-3884 _na     638_aa ABC transporter
2439 CAJPNO010000038.1 GCA905372015_01214 CDS open 3888-5624 _na     578_aa mdlB ABC transporter%2C ATP-binding protein
2440 CAJPNO010000038.1 GCA905372015_01215 CDS open 5912-6367 _na     151_aa Acetyltransferase (GNAT) domain protein
2441 CAJPNO010000038.1 GCA905372015_01216 CDS open 6430-6576 _na     48_aa hypothetical protein
2442 CAJPNO010000038.1 GCA905372015_01217 CDS open 6593-6754 _na     53_aa Phage-related minor tail protein
2443 CAJPNO010000038.1 GCA905372015_01218 CDS open 6847-7476 _na     209_aa Lipoprotein
2444 CAJPNO010000038.1 GCA905372015_01219 CDS open 7501-7941 _na     146_aa hypothetical protein
2445 CAJPNO010000038.1 GCA905372015_01220 CDS open 8041-8733 _na     230_aa Amidase domain protein
2446 CAJPNO010000038.1 GCA905372015_01221 CDS open 8804-8926 _na     40_aa hypothetical protein
2447 CAJPNO010000038.1 GCA905372015_01222 CDS open 9312-9644 _na     110_aa DNA-binding helix-turn-helix protein
2448 CAJPNO010000038.1 GCA905372015_01223 CDS open 9772-10038 _na     88_aa ATP synthase%2C delta/epsilon subunit%2C beta-sandwich domain protein
2449 CAJPNO010000038.1 GCA905372015_01224 CDS open 10122-11522 _na     466_aa atpD F0F1 ATP synthase subunit beta
2450 CAJPNO010000038.1 GCA905372015_01225 CDS open 11540-12409 _na     289_aa atpG ATP synthase F1 subunit gamma
2451 CAJPNO010000038.1 GCA905372015_01226 CDS open 12402-13916 _na     504_aa atpA F0F1 ATP synthase subunit alpha
2452 CAJPNO010000038.1 GCA905372015_01227 CDS open 13933-14472 _na     179_aa F0F1 ATP synthase subunit delta
2453 CAJPNO010000038.1 GCA905372015_01228 CDS open 14463-14972 _na     169_aa atpF F0F1 ATP synthase subunit B
2454 CAJPNO010000038.1 GCA905372015_01229 CDS open 14999-15220 _na     73_aa atpE ATP synthase F0 subunit C
2455 CAJPNO010000038.1 GCA905372015_01230 CDS open 15274-16077 _na     267_aa atpB F0F1 ATP synthase subunit A
2456 CAJPNO010000038.1 GCA905372015_01231 CDS open 16352-17014 _na     220_aa Putative bacteriocin ABC transporter
2457 CAJPNO010000038.1 GCA905372015_01232 CDS open 17015-18169 _na     384_aa hypothetical protein
2458 CAJPNO010000038.1 GCA905372015_01233 CDS open 18179-19228 _na     349_aa Efflux ABC transporter%2C permease protein
2459 CAJPNO010000038.1 GCA905372015_01211 gene open 637-1149
2460 CAJPNO010000038.1 GCA905372015_01212 gene open 1708-1818
2461 CAJPNO010000038.1 GCA905372015_01213 gene open 1968-3884
2462 CAJPNO010000038.1 GCA905372015_01214 gene open 3888-5624 mdlB
2463 CAJPNO010000038.1 GCA905372015_01215 gene open 5912-6367
2464 CAJPNO010000038.1 GCA905372015_01216 gene open 6430-6576
2465 CAJPNO010000038.1 GCA905372015_01217 gene open 6593-6754
2466 CAJPNO010000038.1 GCA905372015_01218 gene open 6847-7476
2467 CAJPNO010000038.1 GCA905372015_01219 gene open 7501-7941
2468 CAJPNO010000038.1 GCA905372015_01220 gene open 8041-8733
2469 CAJPNO010000038.1 GCA905372015_01221 gene open 8804-8926
2470 CAJPNO010000038.1 GCA905372015_01222 gene open 9312-9644
2471 CAJPNO010000038.1 GCA905372015_01223 gene open 9772-10038
2472 CAJPNO010000038.1 GCA905372015_01224 gene open 10122-11522 atpD
2473 CAJPNO010000038.1 GCA905372015_01225 gene open 11540-12409 atpG
2474 CAJPNO010000038.1 GCA905372015_01226 gene open 12402-13916 atpA
2475 CAJPNO010000038.1 GCA905372015_01227 gene open 13933-14472
2476 CAJPNO010000038.1 GCA905372015_01228 gene open 14463-14972 atpF
2477 CAJPNO010000038.1 GCA905372015_01229 gene open 14999-15220 atpE
2478 CAJPNO010000038.1 GCA905372015_01230 gene open 15274-16077 atpB
2479 CAJPNO010000038.1 GCA905372015_01231 gene open 16352-17014
2480 CAJPNO010000038.1 GCA905372015_01232 gene open 17015-18169
2481 CAJPNO010000038.1 GCA905372015_01233 gene open 18179-19228
2482 CAJPNO010000039.1 GCA905372015_01234 CDS open 191-499 _na     102_aa trxA thioredoxin
2483 CAJPNO010000039.1 GCA905372015_01235 CDS open 535-1263 _na     242_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
2484 CAJPNO010000039.1 GCA905372015_01236 CDS open 1362-1478 _na     38_aa hypothetical protein
2485 CAJPNO010000039.1 GCA905372015_01237 CDS open 1465-1779 _na     104_aa UPF0145 protein HMPREF0378_0708
2486 CAJPNO010000039.1 GCA905372015_01238 CDS open 1751-2419 _na     222_aa PAP2 family protein
2487 CAJPNO010000039.1 GCA905372015_01239 CDS open 2455-2613 _na     52_aa Rubredoxin
2488 CAJPNO010000039.1 GCA905372015_01240 CDS open 2628-2735 _na     35_aa hypothetical protein
2489 CAJPNO010000039.1 GCA905372015_01241 CDS open 2699-2986 _na     95_aa Rubredoxin
2490 CAJPNO010000039.1 GCA905372015_01242 CDS open 3118-5046 _na     642_aa Papain family cysteine protease
2491 CAJPNO010000039.1 GCA905372015_01243 CDS open 5066-6334 _na     422_aa Repeat%2C PF09479
2492 CAJPNO010000039.1 GCA905372015_01244 CDS open 6423-9623 _na     1066_aa Ig-like domain%2C group 2
2493 CAJPNO010000039.1 GCA905372015_01245 CDS open 9798-9941 _na     47_aa hypothetical protein
2494 CAJPNO010000039.1 GCA905372015_01246 CDS open 10038-10661 _na     207_aa tetR Transcriptional regulator%2C TetR family
2495 CAJPNO010000039.1 GCA905372015_01247 CDS open 10756-12501 _na     581_aa ABC transporter%2C ATP-binding protein
2496 CAJPNO010000039.1 GCA905372015_01248 CDS open 12495-14228 _na     577_aa ABC transporter%2C ATP-binding protein
2497 CAJPNO010000039.1 GCA905372015_01249 CDS open 14312-14893 _na     193_aa TIGR02185 family protein
2498 CAJPNO010000039.1 GCA905372015_01250 CDS open 14893-15627 _na     244_aa Cobalt transport protein
2499 CAJPNO010000039.1 GCA905372015_01251 CDS open 15631-17106 _na     491_aa energy-coupling factor transporter ATPase
2500 CAJPNO010000039.1 GCA905372015_01252 CDS open 17137-17595 _na     152_aa MATE domain protein