HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas endodontalis (GCA_905372125.1)

Select a Genome:
BAKTA Annotations for GCA_905372125.1
Genome Selected: Porphyromonas endodontalis
ContigsBases CDSrRNA tmRNAtRNA
35 1949330 1563 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3229 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3229 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAJPNL010000001.1 GCA905372125_00001 CDS open 424-2811 _na     795_aa Leucine Rich Repeat protein
2 CAJPNL010000001.1 GCA905372125_00002 CDS open 3400-3828 _na     142_aa Positive regulator of sigma(E)%2C RseC/MucC
3 CAJPNL010000001.1 GCA905372125_00003 CDS open 3834-4796 _na     320_aa Fe-S cluster domain-containing protein
4 CAJPNL010000001.1 GCA905372125_00004 CDS open 4846-6177 _na     443_aa rsxC electron transport complex subunit RsxC
5 CAJPNL010000001.1 GCA905372125_00005 CDS open 6204-7202 _na     332_aa Ion-translocating oxidoreductase complex subunit D
6 CAJPNL010000001.1 GCA905372125_00006 CDS open 7199-7924 _na     241_aa Ion-translocating oxidoreductase complex subunit G
7 CAJPNL010000001.1 GCA905372125_00007 CDS open 7921-8511 _na     196_aa Ion-translocating oxidoreductase complex subunit E
8 CAJPNL010000001.1 GCA905372125_00008 CDS open 8543-9115 _na     190_aa rsxA electron transport complex subunit RsxA
9 CAJPNL010000001.1 GCA905372125_00009 CDS open 9576-11948 _na     790_aa Outer membrane protein beta-barrel domain-containing protein
10 CAJPNL010000001.1 GCA905372125_00010 CDS open 12076-12855 _na     259_aa Phospholipase%2C patatin family
11 CAJPNL010000001.1 GCA905372125_00011 CDS open 12864-13874 _na     336_aa ABC transporter%2C ATP-binding protein
12 CAJPNL010000001.1 GCA905372125_00012 CDS open 13871-14911 _na     346_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
13 CAJPNL010000001.1 GCA905372125_00013 CDS open 14939-16108 _na     389_aa Periplasmic binding protein
14 CAJPNL010000001.1 GCA905372125_00014 CDS open 16215-17432 _na     405_aa Metallo-beta-lactamase domain protein
15 CAJPNL010000001.1 GCA905372125_00015 CDS open 17455-18321 _na     288_aa lgt prolipoprotein diacylglyceryl transferase
16 CAJPNL010000001.1 GCA905372125_00016 CDS open 18328-19230 _na     300_aa diaminopimelate dehydrogenase
17 CAJPNL010000001.1 GCA905372125_00017 CDS open 19235-20773 _na     512_aa lipB lipoyl(octanoyl) transferase LipB
18 CAJPNL010000001.1 GCA905372125_00018 CDS open 20790-21824 _na     344_aa murB UDP-N-acetylmuramate dehydrogenase
19 CAJPNL010000001.1 GCA905372125_00019 CDS open 21828-22319 _na     163_aa Sporulation and cell division repeat protein
20 CAJPNL010000001.1 GCA905372125_00020 CDS open 22514-23311 _na     265_aa truA tRNA pseudouridine(38-40) synthase TruA
21 CAJPNL010000001.1 GCA905372125_00021 CDS open 23318-25684 _na     788_aa topA type I DNA topoisomerase
22 CAJPNL010000001.1 GCA905372125_00022 CDS open 26098-27309 _na     403_aa class I SAM-dependent rRNA methyltransferase
23 CAJPNL010000001.1 GCA905372125_00023 CDS open 27368-29407 _na     679_aa DNA primase
24 CAJPNL010000001.1 GCA905372125_00024 CDS open 29434-31917 _na     827_aa bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
25 CAJPNL010000001.1 GCA905372125_00026 CDS open 32423-34852 _na     809_aa DNA 3'-5' helicase
26 CAJPNL010000001.1 GCA905372125_00027 CDS open 34849-36219 _na     456_aa SWIM zinc finger domain protein
27 CAJPNL010000001.1 GCA905372125_00028 CDS open 36367-38187 _na     606_aa AMP-binding enzyme
28 CAJPNL010000001.1 GCA905372125_00030 CDS open 39143-40759 _na     538_aa CTP synthase
29 CAJPNL010000001.1 GCA905372125_00031 CDS open 40832-42694 _na     620_aa yidC membrane protein insertase YidC
30 CAJPNL010000001.1 GCA905372125_00032 CDS open 42719-44611 _na     630_aa Class II glutamine amidotransferase
31 CAJPNL010000001.1 GCA905372125_00033 CDS open 44613-45680 _na     355_aa carbamoyl phosphate synthase small subunit
32 CAJPNL010000001.1 GCA905372125_00034 CDS open 45771-48998 _na     1075_aa carB carbamoyl-phosphate synthase large subunit
33 CAJPNL010000001.1 GCA905372125_00035 CDS open 49028-49798 _na     256_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
34 CAJPNL010000001.1 GCA905372125_00036 CDS open 50098-51249 _na     383_aa Alcohol dehydrogenase%2C iron-dependent
35 CAJPNL010000001.1 GCA905372125_00037 CDS open 51332-53881 _na     849_aa Zinc-dependent metalloprotease
36 CAJPNL010000001.1 GCA905372125_00038 CDS open 54041-54622 _na     193_aa Superoxide dismutase
37 CAJPNL010000001.1 GCA905372125_00039 CDS open 54799-55089 _na     96_aa DUF721 domain-containing protein
38 CAJPNL010000001.1 GCA905372125_00040 CDS open 55105-56223 _na     372_aa recF DNA replication/repair protein RecF
39 CAJPNL010000001.1 GCA905372125_00041 CDS open 56234-57145 _na     303_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
40 CAJPNL010000001.1 GCA905372125_00042 CDS open 57506-58528 _na     340_aa S9 family peptidase
41 CAJPNL010000001.1 GCA905372125_00043 CDS open 58806-59651 _na     281_aa hypothetical protein
42 CAJPNL010000001.1 GCA905372125_00044 CDS open 59684-60751 _na     355_aa ATPase family associated with various cellular activities (AAA)
43 CAJPNL010000001.1 GCA905372125_00045 CDS open 60748-62076 _na     442_aa VWA-like domain-containing protein
44 CAJPNL010000001.1 GCA905372125_00046 CDS open 62472-64631 _na     719_aa tetQ Tetracycline resistance protein TetQ
45 CAJPNL010000001.1 GCA905372125_00047 CDS open 64901-65611 _na     236_aa peroxiredoxin
46 CAJPNL010000001.1 GCA905372125_00048 CDS open 65790-66209 _na     139_aa 5-fold beta-flower protein
47 CAJPNL010000001.1 GCA905372125_00049 CDS open 66336-67316 _na     326_aa Glycosyltransferase%2C group 2 family protein
48 CAJPNL010000001.1 GCA905372125_00050 CDS open 67330-69648 _na     772_aa Outer membrane protein%2C OMP85 family
49 CAJPNL010000001.1 GCA905372125_00051 CDS open 69632-74536 _na     1634_aa tamB translocation/assembly module TamB domain-containing protein
50 CAJPNL010000001.1 GCA905372125_00052 CDS open 74575-76014 _na     479_aa DUF4836 domain-containing protein
51 CAJPNL010000001.1 GCA905372125_00053 CDS open 76038-76892 _na     284_aa nfo deoxyribonuclease IV
52 CAJPNL010000001.1 GCA905372125_00054 CDS open 77022-77183 _na     53_aa hypothetical protein
53 CAJPNL010000001.1 GCA905372125_00055 CDS open 77152-77721 _na     189_aa Lipoprotein
54 CAJPNL010000001.1 GCA905372125_00056 CDS open 77919-78044 _na     41_aa hypothetical protein
55 CAJPNL010000001.1 GCA905372125_00057 CDS open 78151-81426 _na     1091_aa UvrD-helicase domain-containing protein
56 CAJPNL010000001.1 GCA905372125_00058 CDS open 81454-82569 _na     371_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
57 CAJPNL010000001.1 GCA905372125_00059 CDS open 82605-83570 _na     321_aa DUF4837 domain-containing protein
58 CAJPNL010000001.1 GCA905372125_00060 CDS open 83731-84060 _na     109_aa Putative translation initiation factor SUI1
59 CAJPNL010000001.1 GCA905372125_00061 CDS open 84073-85740 _na     555_aa Phosphoribulokinase/uridine kinase family protein
60 CAJPNL010000001.1 GCA905372125_00062 CDS open 85856-87529 _na     557_aa Na/Pi-cotransporter II-like protein
61 CAJPNL010000001.1 GCA905372125_00063 CDS open 87573-88700 _na     375_aa N-acetyltransferase domain-containing protein
62 CAJPNL010000001.1 GCA905372125_00064 CDS open 88700-90637 _na     645_aa DNA topoisomerase (ATP-hydrolyzing)
63 CAJPNL010000001.1 GCA905372125_00065 CDS open 90701-91153 _na     150_aa coaD pantetheine-phosphate adenylyltransferase
64 CAJPNL010000001.1 GCA905372125_00066 CDS open 91493-91855 _na     120_aa Septum formation initiator
65 CAJPNL010000001.1 GCA905372125_00067 CDS open 91880-92239 _na     119_aa Inner membrane protein
66 CAJPNL010000001.1 GCA905372125_00068 CDS open 92236-93228 _na     330_aa S4 domain protein
67 CAJPNL010000001.1 GCA905372125_00069 CDS open 93246-95345 _na     699_aa Cytochrome C biogenesis protein transmembrane region
68 CAJPNL010000001.1 GCA905372125_00070 CDS open 95349-96143 _na     264_aa mazG nucleoside triphosphate pyrophosphohydrolase
69 CAJPNL010000001.1 GCA905372125_00071 CDS open 96217-97071 _na     284_aa Methyltransferase domain protein
70 CAJPNL010000001.1 GCA905372125_00072 CDS open 97076-98227 _na     383_aa Outer membrane insertion signal domain protein
71 CAJPNL010000001.1 GCA905372125_00073 CDS open 98289-100103 _na     604_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
72 CAJPNL010000001.1 GCA905372125_00074 CDS open 100126-101961 _na     611_aa cobM precorrin-4 C(11)-methyltransferase
73 CAJPNL010000001.1 GCA905372125_00075 CDS open 102450-102905 _na     151_aa rplM 50S ribosomal protein L13
74 CAJPNL010000001.1 GCA905372125_00076 CDS open 102914-103303 _na     129_aa rpsI 30S ribosomal protein S9
75 CAJPNL010000001.1 GCA905372125_00077 CDS open 103540-104388 _na     282_aa rpsB 30S ribosomal protein S2
76 CAJPNL010000001.1 GCA905372125_00078 CDS open 104427-105251 _na     274_aa tsf translation elongation factor Ts
77 CAJPNL010000001.1 GCA905372125_00079 CDS open 105601-106509 _na     302_aa Bacterial group 2 Ig-like protein
78 CAJPNL010000001.1 GCA905372125_00080 CDS open 106715-109339 _na     874_aa alaS alanine--tRNA ligase
79 CAJPNL010000001.1 GCA905372125_00081 CDS open 109343-110425 _na     360_aa aroB 3-dehydroquinate synthase
80 CAJPNL010000001.1 GCA905372125_00083 CDS open 111027-112619 _na     530_aa histidine kinase
81 CAJPNL010000001.1 GCA905372125_00084 CDS open 112686-113414 _na     242_aa rprY Transcriptional regulatory protein RprY
82 CAJPNL010000001.1 GCA905372125_00085 CDS open 113611-114045 _na     144_aa rpiB ribose 5-phosphate isomerase B
83 CAJPNL010000001.1 GCA905372125_00086 CDS open 114233-117919 _na     1228_aa purL phosphoribosylformylglycinamidine synthase
84 CAJPNL010000001.1 GCA905372125_00087 CDS open 117941-119047 _na     368_aa dprA DNA-processing protein DprA
85 CAJPNL010000001.1 GCA905372125_00088 CDS open 119059-120192 _na     377_aa glycosyltransferase family 1 protein
86 CAJPNL010000001.1 GCA905372125_00089 CDS open 120821-122236 _na     471_aa dnaA chromosomal replication initiator protein DnaA
87 CAJPNL010000001.1 GCA905372125_00090 CDS open 122238-122873 _na     211_aa WbqC-like protein
88 CAJPNL010000001.1 GCA905372125_00091 CDS open 122870-123433 _na     187_aa Peptidase S26 domain-containing protein
89 CAJPNL010000001.1 GCA905372125_00092 CDS open 123458-124867 _na     469_aa lepB signal peptidase I
90 CAJPNL010000001.1 GCA905372125_00093 CDS open 124910-125635 _na     241_aa 4-hydroxy-tetrahydrodipicolinate reductase
91 CAJPNL010000001.1 GCA905372125_00094 CDS open 125806-125952 _na     48_aa hypothetical protein
92 CAJPNL010000001.1 GCA905372125_00095 CDS open 125960-126535 _na     191_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
93 CAJPNL010000001.1 GCA905372125_00096 CDS open 126560-127738 _na     392_aa pncB nicotinate phosphoribosyltransferase
94 CAJPNL010000001.1 GCA905372125_00097 CDS open 127766-129511 _na     581_aa hypothetical protein
95 CAJPNL010000001.1 GCA905372125_00098 CDS open 129554-130852 _na     432_aa UPF0597 protein POREN0001_1784
96 CAJPNL010000001.1 GCA905372125_00099 CDS open 130902-131987 _na     361_aa GDP-L-fucose synthase
97 CAJPNL010000001.1 GCA905372125_00100 CDS open 132009-133175 _na     388_aa gmd GDP-mannose 4%2C6-dehydratase
98 CAJPNL010000001.1 GCA905372125_00101 CDS open 133197-133733 _na     178_aa FHA domain protein
99 CAJPNL010000001.1 GCA905372125_00102 CDS open 133740-134750 _na     336_aa K+-dependent Na+/Ca+ exchanger family protein
100 CAJPNL010000001.1 GCA905372125_00103 CDS open 134747-135652 _na     301_aa Lipid kinase%2C YegS/Rv2252/BmrU family
101 CAJPNL010000001.1 GCA905372125_00104 CDS open 135676-136137 _na     153_aa queF preQ(1) synthase
102 CAJPNL010000001.1 GCA905372125_00105 CDS open 136280-137719 _na     479_aa NOL1/NOP2/sun family protein
103 CAJPNL010000001.1 GCA905372125_00106 CDS open 137732-138445 _na     237_aa yraL Putative S-adenosylmethionine-dependent methyltransferase%2C YraL family
104 CAJPNL010000001.1 GCA905372125_00107 CDS open 138463-139158 _na     231_aa Peptidyl-prolyl cis-trans isomerase
105 CAJPNL010000001.1 GCA905372125_00108 CDS open 139155-140066 _na     303_aa DUF2179 domain-containing protein
106 CAJPNL010000001.1 GCA905372125_00109 CDS open 140186-141046 _na     286_aa Glycosyl transferase family 2
107 CAJPNL010000001.1 GCA905372125_00110 CDS open 141688-142329 _na     213_aa Uracil-DNA glycosylase-like domain-containing protein
108 CAJPNL010000001.1 GCA905372125_00111 CDS open 142343-142675 _na     110_aa DUF4190 domain-containing protein
109 CAJPNL010000001.1 GCA905372125_00112 CDS open 142734-143849 _na     371_aa DUF4221 domain-containing protein
110 CAJPNL010000001.1 GCA905372125_00113 CDS open 144540-148196 _na     1218_aa dnaE DNA polymerase III subunit alpha
111 CAJPNL010000001.1 GCA905372125_00114 CDS open 148246-148560 _na     104_aa trxA thioredoxin
112 CAJPNL010000001.1 GCA905372125_00115 CDS open 149156-149410 _na     84_aa DUF6804 domain-containing protein
113 CAJPNL010000001.1 GCA905372125_00116 CDS open 149397-149525 _na     42_aa hypothetical protein
114 CAJPNL010000001.1 GCA905372125_00117 CDS open 149655-149972 _na     105_aa hypothetical protein
115 CAJPNL010000001.1 GCA905372125_00118 CDS open 150438-151931 _na     497_aa Cation transport protein
116 CAJPNL010000001.1 GCA905372125_00119 CDS open 151945-153291 _na     448_aa trkA Trk system potassium transporter TrkA
117 CAJPNL010000001.1 GCA905372125_00120 CDS open 153288-155195 _na     635_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
118 CAJPNL010000001.1 GCA905372125_00121 CDS open 155197-156567 _na     456_aa hisS histidine--tRNA ligase
119 CAJPNL010000001.1 GCA905372125_00122 CDS open 156564-157076 _na     170_aa Dihydrofolate reductase
120 CAJPNL010000001.1 GCA905372125_00123 CDS open 157083-157847 _na     254_aa thymidylate synthase
121 CAJPNL010000001.1 GCA905372125_00124 CDS open 157927-159003 _na     358_aa Permease%2C YjgP/YjgQ family
122 CAJPNL010000001.1 GCA905372125_00126 CDS open 159320-159904 _na     194_aa Nitroreductase family protein
123 CAJPNL010000001.1 GCA905372125_00127 CDS open 160163-161086 _na     307_aa dihydroorotate dehydrogenase
124 CAJPNL010000001.1 GCA905372125_00128 CDS open 161083-161859 _na     258_aa Oxidoreductase NAD-binding domain protein
125 CAJPNL010000001.1 GCA905372125_00129 CDS open 161919-162461 _na     180_aa DNA-binding helix-turn-helix protein
126 CAJPNL010000001.1 GCA905372125_00130 CDS open 162445-162621 _na     58_aa hypothetical protein
127 CAJPNL010000001.1 GCA905372125_00131 CDS open 163385-165400 _na     671_aa ligA NAD-dependent DNA ligase LigA
128 CAJPNL010000001.1 GCA905372125_00132 CDS open 165388-165930 _na     180_aa Acetyltransferase%2C GNAT family
129 CAJPNL010000001.1 GCA905372125_00133 CDS open 165973-166593 _na     206_aa recR recombination mediator RecR
130 CAJPNL010000001.1 GCA905372125_00134 CDS open 166594-168162 _na     522_aa S1 RNA binding domain protein
131 CAJPNL010000001.1 GCA905372125_00135 CDS open 168595-168885 _na     96_aa DNA-binding protein HU
132 CAJPNL010000001.1 GCA905372125_00136 CDS open 169426-170088 _na     220_aa 3-oxoacid CoA-transferase%2C A subunit
133 CAJPNL010000001.1 GCA905372125_00137 CDS open 170133-170525 _na     130_aa Beta-alanyl-CoA:ammonia lyase
134 CAJPNL010000001.1 GCA905372125_00138 CDS open 170539-171366 _na     275_aa 3-keto-5-aminohexanoate cleavage enzyme
135 CAJPNL010000001.1 GCA905372125_00139 CDS open 171408-172451 _na     347_aa qor L-erythro-3%2C5-diaminohexanoate dehydrogenase
136 CAJPNL010000001.1 GCA905372125_00140 CDS open 172702-173958 _na     418_aa ablA lysine 2%2C3-aminomutase
137 CAJPNL010000001.1 GCA905372125_00141 CDS open 173979-174995 _na     338_aa yqeC Selenium-dependent hydroxylase accessory protein YqeC
138 CAJPNL010000001.1 GCA905372125_00142 CDS open 174992-176383 _na     463_aa mutS MutS domain V protein
139 CAJPNL010000001.1 GCA905372125_00143 CDS open 176387-177958 _na     523_aa D-Lysine 5%2C6-aminomutase alpha subunit
140 CAJPNL010000001.1 GCA905372125_00144 CDS open 177955-178758 _na     267_aa B12 binding domain protein
141 CAJPNL010000001.1 GCA905372125_00145 CDS open 178803-179465 _na     220_aa 3-oxoacid CoA-transferase%2C B subunit
142 CAJPNL010000001.1 GCA905372125_00146 CDS open 179507-180646 _na     379_aa Acyl-CoA dehydrogenase%2C C-terminal domain protein
143 CAJPNL010000001.1 GCA905372125_00147 CDS open 180662-181450 _na     262_aa Electron transfer flavoprotein domain protein
144 CAJPNL010000001.1 GCA905372125_00148 CDS open 181450-182472 _na     340_aa Electron transfer flavoprotein FAD-binding domain protein
145 CAJPNL010000001.1 GCA905372125_00149 CDS open 182494-183270 _na     258_aa 3-hydroxybutyryl-CoA dehydratase
146 CAJPNL010000001.1 GCA905372125_00150 CDS open 183333-184178 _na     281_aa 3-hydroxybutyryl-CoA dehydrogenase
147 CAJPNL010000001.1 GCA905372125_00151 CDS open 184686-185441 _na     251_aa CAAX amino terminal protease family protein
148 CAJPNL010000001.1 GCA905372125_00152 CDS open 185454-188513 _na     1019_aa PD-(D/E)XK endonuclease-like domain-containing protein
149 CAJPNL010000001.1 GCA905372125_00153 CDS open 188606-190465 _na     619_aa mutA methylmalonyl-CoA mutase small subunit
150 CAJPNL010000001.1 GCA905372125_00154 CDS open 190483-192645 _na     720_aa scpA methylmalonyl-CoA mutase
151 CAJPNL010000001.1 GCA905372125_00155 CDS open 192860-193519 _na     219_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
152 CAJPNL010000001.1 GCA905372125_00156 CDS open 193533-194168 _na     211_aa Orotate phosphoribosyltransferase
153 CAJPNL010000001.1 GCA905372125_00157 CDS open 194131-194613 _na     160_aa Polyketide cyclase/dehydrase
154 CAJPNL010000001.1 GCA905372125_00158 CDS open 194632-195090 _na     152_aa Rieske domain-containing protein
155 CAJPNL010000001.1 GCA905372125_00159 CDS open 195196-197166 _na     656_aa Porin
156 CAJPNL010000001.1 GCA905372125_00160 CDS open 197246-198271 _na     341_aa Sporulation and cell division repeat protein
157 CAJPNL010000001.1 GCA905372125_00161 CDS open 198304-199269 _na     321_aa queG tRNA epoxyqueuosine(34) reductase QueG
158 CAJPNL010000001.1 GCA905372125_00162 CDS open 199250-200008 _na     252_aa porT PorT protein
159 CAJPNL010000001.1 GCA905372125_00163 CDS open 200090-200749 _na     219_aa upp uracil phosphoribosyltransferase
160 CAJPNL010000001.1 GCA905372125_00164 CDS open 200761-202629 _na     622_aa tonB TonB family domain protein
161 CAJPNL010000001.1 GCA905372125_00165 CDS open 202762-203031 _na     89_aa rpsO 30S ribosomal protein S15
162 CAJPNL010000001.1 GCA905372125_00166 CDS open 203370-205121 _na     583_aa sppA signal peptide peptidase SppA
163 CAJPNL010000001.1 GCA905372125_00167 CDS open 205232-206308 _na     358_aa lpxK tetraacyldisaccharide 4'-kinase
164 CAJPNL010000001.1 GCA905372125_00168 CDS open 206341-207396 _na     351_aa thiL thiamine-phosphate kinase
165 CAJPNL010000001.1 GCA905372125_00169 CDS open 207412-208182 _na     256_aa ABC transporter permease
166 CAJPNL010000001.1 GCA905372125_00170 CDS open 208189-208905 _na     238_aa ABC transporter%2C ATP-binding protein
167 CAJPNL010000001.1 GCA905372125_00171 CDS open 208918-209304 _na     128_aa hypothetical protein
168 CAJPNL010000001.1 GCA905372125_00172 CDS open 209424-209897 _na     157_aa cdd cytidine deaminase
169 CAJPNL010000001.1 GCA905372125_00173 CDS open 209910-211592 _na     560_aa Outer membrane protein transport protein%2C Ompp1/FadL/TodX family
170 CAJPNL010000001.1 GCA905372125_00174 CDS open 211650-213233 _na     527_aa hypothetical protein
171 CAJPNL010000001.1 GCA905372125_00175 CDS open 213460-213636 _na     58_aa hypothetical protein
172 CAJPNL010000001.1 GCA905372125_00176 CDS open 213749-215305 _na     518_aa glycine--tRNA ligase
173 CAJPNL010000001.1 GCA905372125_00177 CDS open 215298-215852 _na     184_aa Peptidyl-prolyl cis-trans isomerase
174 CAJPNL010000001.1 GCA905372125_00178 CDS open 215900-216679 _na     259_aa surE 5'/3'-nucleotidase SurE
175 CAJPNL010000001.1 GCA905372125_00179 CDS open 216695-217840 _na     381_aa lpxB lipid-A-disaccharide synthase
176 CAJPNL010000001.1 GCA905372125_00180 CDS open 217867-219654 _na     595_aa lepA translation elongation factor 4
177 CAJPNL010000001.1 GCA905372125_00181 CDS open 219687-221180 _na     497_aa dnaB replicative DNA helicase
178 CAJPNL010000001.1 GCA905372125_00182 CDS open 221190-222527 _na     445_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
179 CAJPNL010000001.1 GCA905372125_00183 CDS open 222535-223548 _na     337_aa Glycosyltransferase%2C group 2 family protein
180 CAJPNL010000001.1 GCA905372125_00184 CDS open 223669-224379 _na     236_aa Hemerythrin HHE cation binding domain protein
181 CAJPNL010000001.1 GCA905372125_00185 CDS open 224433-225032 _na     199_aa luxR Transcriptional regulator%2C LuxR family
182 CAJPNL010000001.1 GCA905372125_00186 CDS open 225188-225640 _na     150_aa PepSY-like domain-containing protein
183 CAJPNL010000001.1 GCA905372125_00187 CDS open 226614-227093 _na     159_aa ATP synthase subunit C
184 CAJPNL010000001.1 GCA905372125_00188 CDS open 227144-228970 _na     608_aa V-type ATP synthase subunit I
185 CAJPNL010000001.1 GCA905372125_00189 CDS open 228967-229584 _na     205_aa V-type ATP synthase subunit D
186 CAJPNL010000001.1 GCA905372125_00190 CDS open 229597-230928 _na     443_aa V-type ATP synthase subunit B
187 CAJPNL010000001.1 GCA905372125_00191 CDS open 230968-232719 _na     583_aa V-type ATP synthase alpha chain
188 CAJPNL010000001.1 GCA905372125_00192 CDS open 232727-233638 _na     303_aa DUF2764 domain-containing protein
189 CAJPNL010000001.1 GCA905372125_00193 CDS open 233646-234236 _na     196_aa ATP synthase%2C subunit E
190 CAJPNL010000001.1 GCA905372125_00194 CDS open 234435-235415 _na     326_aa bifunctional methionine sulfoxide reductase B/A protein
191 CAJPNL010000001.1 GCA905372125_00195 CDS open 235633-236880 _na     415_aa SpoOJ/ParA/ParB/repB family protein
192 CAJPNL010000001.1 GCA905372125_00196 CDS open 236997-237920 _na     307_aa 4-phosphoerythronate dehydrogenase
193 CAJPNL010000001.1 GCA905372125_00197 CDS open 238021-239103 _na     360_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
194 CAJPNL010000001.1 GCA905372125_00198 CDS open 239620-240975 _na     451_aa hypothetical protein
195 CAJPNL010000001.1 GCA905372125_00199 CDS open 241564-242406 _na     280_aa Acyltransferase
196 CAJPNL010000001.1 GCA905372125_00200 CDS open 242439-243383 _na     314_aa Hemolysin
197 CAJPNL010000001.1 GCA905372125_00201 CDS open 243394-243777 _na     127_aa UPF0102 protein POREN0001_1676
198 CAJPNL010000001.1 GCA905372125_00202 CDS open 243915-244910 _na     331_aa ROK family protein
199 CAJPNL010000001.1 GCA905372125_00203 CDS open 244949-245719 _na     256_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
200 CAJPNL010000001.1 GCA905372125_00204 CDS open 246295-247749 _na     484_aa ftsA Cell division protein FtsA
201 CAJPNL010000001.1 GCA905372125_00205 CDS open 247777-249318 _na     513_aa ftsZ Cell division protein FtsZ
202 CAJPNL010000001.1 GCA905372125_00206 CDS open 249369-249824 _na     151_aa YqeY-like protein
203 CAJPNL010000001.1 GCA905372125_00207 CDS open 249875-251233 _na     452_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
204 CAJPNL010000001.1 GCA905372125_00208 CDS open 251256-252674 _na     472_aa ftsW putative peptidoglycan glycosyltransferase FtsW
205 CAJPNL010000001.1 GCA905372125_00209 CDS open 252667-253791 _na     374_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
206 CAJPNL010000001.1 GCA905372125_00210 CDS open 253813-255207 _na     464_aa murC UDP-N-acetylmuramate--L-alanine ligase
207 CAJPNL010000001.1 GCA905372125_00211 CDS open 255220-255969 _na     249_aa POTRA domain-containing protein
208 CAJPNL010000001.1 GCA905372125_00212 CDS open 256096-257460 _na     454_aa Leucine Rich Repeat protein
209 CAJPNL010000001.1 GCA905372125_00214 CDS open 257926-260094 _na     722_aa ATPase family associated with various cellular activities (AAA)
210 CAJPNL010000001.1 GCA905372125_00215 CDS open 260382-261068 _na     228_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
211 CAJPNL010000001.1 GCA905372125_00216 CDS open 261118-262380 _na     420_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
212 CAJPNL010000001.1 GCA905372125_00217 CDS open 262416-264590 _na     724_aa recQ DNA helicase RecQ
213 CAJPNL010000001.1 GCA905372125_00218 CDS open 264628-266013 _na     461_aa PPIC-type PPIASE domain protein
214 CAJPNL010000001.1 GCA905372125_00219 CDS open 266084-268063 _na     659_aa Organic solvent tolerance-like N-terminal domain-containing protein
215 CAJPNL010000001.1 GCA905372125_00220 CDS open 268383-270308 _na     641_aa mutL DNA mismatch repair endonuclease MutL
216 CAJPNL010000001.1 GCA905372125_00221 CDS open 270681-271151 _na     156_aa greA transcription elongation factor GreA
217 CAJPNL010000001.1 GCA905372125_00222 CDS open 271190-271588 _na     132_aa Histidine triad domain protein
218 CAJPNL010000001.1 GCA905372125_00223 CDS open 271853-273208 _na     451_aa DEAD/DEAH box helicase
219 CAJPNL010000001.1 GCA905372125_00224 CDS open 273245-274471 _na     408_aa ROK family protein
220 CAJPNL010000001.1 GCA905372125_00225 CDS open 274674-275261 _na     195_aa Sigma-70%2C region 4
221 CAJPNL010000001.1 GCA905372125_00226 CDS open 275660-277609 _na     649_aa rho transcription termination factor Rho
222 CAJPNL010000001.1 GCA905372125_00227 CDS open 277881-279737 _na     618_aa DUF349 domain-containing protein
223 CAJPNL010000001.1 GCA905372125_00228 CDS open 279845-280876 _na     343_aa NAD dependent epimerase/dehydratase family protein
224 CAJPNL010000001.1 GCA905372125_00229 CDS open 281089-282543 _na     484_aa RNA-directed DNA polymerase
225 CAJPNL010000001.1 GCA905372125_00230 CDS open 282747-283634 _na     295_aa Fic family protein
226 CAJPNL010000001.1 GCA905372125_00231 CDS open 283770-283904 _na     44_aa hypothetical protein
227 CAJPNL010000001.1 GCA905372125_00232 CDS open 284036-285103 _na     355_aa branched-chain amino acid aminotransferase
228 CAJPNL010000001.1 GCA905372125_00233 CDS open 285103-286458 _na     451_aa dihydroorotase
229 CAJPNL010000001.1 GCA905372125_00234 CDS open 286498-287241 _na     247_aa Glycosyltransferase%2C group 2 family protein
230 CAJPNL010000001.1 GCA905372125_00235 CDS open 287341-288597 _na     418_aa 8-amino-7-oxononanoate synthase
231 CAJPNL010000001.1 GCA905372125_00236 CDS open 288594-289283 _na     229_aa bioC Biotin synthesis protein BioC
232 CAJPNL010000001.1 GCA905372125_00237 CDS open 289276-290052 _na     258_aa bioC malonyl-ACP O-methyltransferase BioC
233 CAJPNL010000001.1 GCA905372125_00238 CDS open 290093-291133 _na     346_aa Antioxidant%2C AhpC/TSA family
234 CAJPNL010000001.1 GCA905372125_00239 CDS open 291401-291721 _na     106_aa Sulfurtransferase
235 CAJPNL010000001.1 GCA905372125_00240 CDS open 291763-293175 _na     470_aa rhodanese-like domain-containing protein
236 CAJPNL010000001.1 GCA905372125_00241 CDS open 293267-294142 _na     291_aa sulfite exporter TauE/SafE family protein
237 CAJPNL010000001.1 GCA905372125_00242 CDS open 294139-294762 _na     207_aa CRP/FNR family transcriptional regulator%2C anaerobic regulatory protein
238 CAJPNL010000001.1 GCA905372125_00243 CDS open 295043-295342 _na     99_aa DUF3784 domain-containing protein
239 CAJPNL010000001.1 GCA905372125_00001 gene open 424-2811
240 CAJPNL010000001.1 GCA905372125_00002 gene open 3400-3828
241 CAJPNL010000001.1 GCA905372125_00003 gene open 3834-4796
242 CAJPNL010000001.1 GCA905372125_00004 gene open 4846-6177 rsxC
243 CAJPNL010000001.1 GCA905372125_00005 gene open 6204-7202
244 CAJPNL010000001.1 GCA905372125_00006 gene open 7199-7924
245 CAJPNL010000001.1 GCA905372125_00007 gene open 7921-8511
246 CAJPNL010000001.1 GCA905372125_00008 gene open 8543-9115 rsxA
247 CAJPNL010000001.1 GCA905372125_00009 gene open 9576-11948
248 CAJPNL010000001.1 GCA905372125_00010 gene open 12076-12855
249 CAJPNL010000001.1 GCA905372125_00011 gene open 12864-13874
250 CAJPNL010000001.1 GCA905372125_00012 gene open 13871-14911
251 CAJPNL010000001.1 GCA905372125_00013 gene open 14939-16108
252 CAJPNL010000001.1 GCA905372125_00014 gene open 16215-17432
253 CAJPNL010000001.1 GCA905372125_00015 gene open 17455-18321 lgt
254 CAJPNL010000001.1 GCA905372125_00016 gene open 18328-19230
255 CAJPNL010000001.1 GCA905372125_00017 gene open 19235-20773 lipB
256 CAJPNL010000001.1 GCA905372125_00018 gene open 20790-21824 murB
257 CAJPNL010000001.1 GCA905372125_00019 gene open 21828-22319
258 CAJPNL010000001.1 GCA905372125_00020 gene open 22514-23311 truA
259 CAJPNL010000001.1 GCA905372125_00021 gene open 23318-25684 topA
260 CAJPNL010000001.1 GCA905372125_00022 gene open 26098-27309
261 CAJPNL010000001.1 GCA905372125_00023 gene open 27368-29407
262 CAJPNL010000001.1 GCA905372125_00024 gene open 29434-31917
263 CAJPNL010000001.1 GCA905372125_00026 gene open 32423-34852
264 CAJPNL010000001.1 GCA905372125_00027 gene open 34849-36219
265 CAJPNL010000001.1 GCA905372125_00028 gene open 36367-38187
266 CAJPNL010000001.1 GCA905372125_00030 gene open 39143-40759
267 CAJPNL010000001.1 GCA905372125_00031 gene open 40832-42694 yidC
268 CAJPNL010000001.1 GCA905372125_00032 gene open 42719-44611
269 CAJPNL010000001.1 GCA905372125_00033 gene open 44613-45680
270 CAJPNL010000001.1 GCA905372125_00034 gene open 45771-48998 carB
271 CAJPNL010000001.1 GCA905372125_00035 gene open 49028-49798
272 CAJPNL010000001.1 GCA905372125_00036 gene open 50098-51249
273 CAJPNL010000001.1 GCA905372125_00037 gene open 51332-53881
274 CAJPNL010000001.1 GCA905372125_00038 gene open 54041-54622
275 CAJPNL010000001.1 GCA905372125_00039 gene open 54799-55089
276 CAJPNL010000001.1 GCA905372125_00040 gene open 55105-56223 recF
277 CAJPNL010000001.1 GCA905372125_00041 gene open 56234-57145 dapA
278 CAJPNL010000001.1 GCA905372125_00042 gene open 57506-58528
279 CAJPNL010000001.1 GCA905372125_00043 gene open 58806-59651
280 CAJPNL010000001.1 GCA905372125_00044 gene open 59684-60751
281 CAJPNL010000001.1 GCA905372125_00045 gene open 60748-62076
282 CAJPNL010000001.1 GCA905372125_00046 gene open 62472-64631 tetQ
283 CAJPNL010000001.1 GCA905372125_00047 gene open 64901-65611
284 CAJPNL010000001.1 GCA905372125_00048 gene open 65790-66209
285 CAJPNL010000001.1 GCA905372125_00049 gene open 66336-67316
286 CAJPNL010000001.1 GCA905372125_00050 gene open 67330-69648
287 CAJPNL010000001.1 GCA905372125_00051 gene open 69632-74536 tamB
288 CAJPNL010000001.1 GCA905372125_00052 gene open 74575-76014
289 CAJPNL010000001.1 GCA905372125_00053 gene open 76038-76892 nfo
290 CAJPNL010000001.1 GCA905372125_00054 gene open 77022-77183
291 CAJPNL010000001.1 GCA905372125_00055 gene open 77152-77721
292 CAJPNL010000001.1 GCA905372125_00056 gene open 77919-78044
293 CAJPNL010000001.1 GCA905372125_00057 gene open 78151-81426
294 CAJPNL010000001.1 GCA905372125_00058 gene open 81454-82569 pdxA
295 CAJPNL010000001.1 GCA905372125_00059 gene open 82605-83570
296 CAJPNL010000001.1 GCA905372125_00060 gene open 83731-84060
297 CAJPNL010000001.1 GCA905372125_00061 gene open 84073-85740
298 CAJPNL010000001.1 GCA905372125_00062 gene open 85856-87529
299 CAJPNL010000001.1 GCA905372125_00063 gene open 87573-88700
300 CAJPNL010000001.1 GCA905372125_00064 gene open 88700-90637
301 CAJPNL010000001.1 GCA905372125_00065 gene open 90701-91153 coaD
302 CAJPNL010000001.1 GCA905372125_00066 gene open 91493-91855
303 CAJPNL010000001.1 GCA905372125_00067 gene open 91880-92239
304 CAJPNL010000001.1 GCA905372125_00068 gene open 92236-93228
305 CAJPNL010000001.1 GCA905372125_00069 gene open 93246-95345
306 CAJPNL010000001.1 GCA905372125_00070 gene open 95349-96143 mazG
307 CAJPNL010000001.1 GCA905372125_00071 gene open 96217-97071
308 CAJPNL010000001.1 GCA905372125_00072 gene open 97076-98227
309 CAJPNL010000001.1 GCA905372125_00073 gene open 98289-100103 cbiD
310 CAJPNL010000001.1 GCA905372125_00074 gene open 100126-101961 cobM
311 CAJPNL010000001.1 GCA905372125_00075 gene open 102450-102905 rplM
312 CAJPNL010000001.1 GCA905372125_00076 gene open 102914-103303 rpsI
313 CAJPNL010000001.1 GCA905372125_00077 gene open 103540-104388 rpsB
314 CAJPNL010000001.1 GCA905372125_00078 gene open 104427-105251 tsf
315 CAJPNL010000001.1 GCA905372125_00079 gene open 105601-106509
316 CAJPNL010000001.1 GCA905372125_00080 gene open 106715-109339 alaS
317 CAJPNL010000001.1 GCA905372125_00081 gene open 109343-110425 aroB
318 CAJPNL010000001.1 GCA905372125_00083 gene open 111027-112619
319 CAJPNL010000001.1 GCA905372125_00084 gene open 112686-113414 rprY
320 CAJPNL010000001.1 GCA905372125_00085 gene open 113611-114045 rpiB
321 CAJPNL010000001.1 GCA905372125_00086 gene open 114233-117919 purL
322 CAJPNL010000001.1 GCA905372125_00087 gene open 117941-119047 dprA
323 CAJPNL010000001.1 GCA905372125_00088 gene open 119059-120192
324 CAJPNL010000001.1 GCA905372125_00089 gene open 120821-122236 dnaA
325 CAJPNL010000001.1 GCA905372125_00090 gene open 122238-122873
326 CAJPNL010000001.1 GCA905372125_00091 gene open 122870-123433
327 CAJPNL010000001.1 GCA905372125_00092 gene open 123458-124867 lepB
328 CAJPNL010000001.1 GCA905372125_00093 gene open 124910-125635
329 CAJPNL010000001.1 GCA905372125_00094 gene open 125806-125952
330 CAJPNL010000001.1 GCA905372125_00095 gene open 125960-126535 nadD
331 CAJPNL010000001.1 GCA905372125_00096 gene open 126560-127738 pncB
332 CAJPNL010000001.1 GCA905372125_00097 gene open 127766-129511
333 CAJPNL010000001.1 GCA905372125_00098 gene open 129554-130852
334 CAJPNL010000001.1 GCA905372125_00099 gene open 130902-131987
335 CAJPNL010000001.1 GCA905372125_00100 gene open 132009-133175 gmd
336 CAJPNL010000001.1 GCA905372125_00101 gene open 133197-133733
337 CAJPNL010000001.1 GCA905372125_00102 gene open 133740-134750
338 CAJPNL010000001.1 GCA905372125_00103 gene open 134747-135652
339 CAJPNL010000001.1 GCA905372125_00104 gene open 135676-136137 queF
340 CAJPNL010000001.1 GCA905372125_00105 gene open 136280-137719
341 CAJPNL010000001.1 GCA905372125_00106 gene open 137732-138445 yraL
342 CAJPNL010000001.1 GCA905372125_00107 gene open 138463-139158
343 CAJPNL010000001.1 GCA905372125_00108 gene open 139155-140066
344 CAJPNL010000001.1 GCA905372125_00109 gene open 140186-141046
345 CAJPNL010000001.1 GCA905372125_00110 gene open 141688-142329
346 CAJPNL010000001.1 GCA905372125_00111 gene open 142343-142675
347 CAJPNL010000001.1 GCA905372125_00112 gene open 142734-143849
348 CAJPNL010000001.1 GCA905372125_00113 gene open 144540-148196 dnaE
349 CAJPNL010000001.1 GCA905372125_00114 gene open 148246-148560 trxA
350 CAJPNL010000001.1 GCA905372125_00115 gene open 149156-149410
351 CAJPNL010000001.1 GCA905372125_00116 gene open 149397-149525
352 CAJPNL010000001.1 GCA905372125_00117 gene open 149655-149972
353 CAJPNL010000001.1 GCA905372125_00118 gene open 150438-151931
354 CAJPNL010000001.1 GCA905372125_00119 gene open 151945-153291 trkA
355 CAJPNL010000001.1 GCA905372125_00120 gene open 153288-155195 dxs
356 CAJPNL010000001.1 GCA905372125_00121 gene open 155197-156567 hisS
357 CAJPNL010000001.1 GCA905372125_00122 gene open 156564-157076
358 CAJPNL010000001.1 GCA905372125_00123 gene open 157083-157847
359 CAJPNL010000001.1 GCA905372125_00124 gene open 157927-159003
360 CAJPNL010000001.1 GCA905372125_00126 gene open 159320-159904
361 CAJPNL010000001.1 GCA905372125_00127 gene open 160163-161086
362 CAJPNL010000001.1 GCA905372125_00128 gene open 161083-161859
363 CAJPNL010000001.1 GCA905372125_00129 gene open 161919-162461
364 CAJPNL010000001.1 GCA905372125_00130 gene open 162445-162621
365 CAJPNL010000001.1 GCA905372125_00131 gene open 163385-165400 ligA
366 CAJPNL010000001.1 GCA905372125_00132 gene open 165388-165930
367 CAJPNL010000001.1 GCA905372125_00133 gene open 165973-166593 recR
368 CAJPNL010000001.1 GCA905372125_00134 gene open 166594-168162
369 CAJPNL010000001.1 GCA905372125_00135 gene open 168595-168885
370 CAJPNL010000001.1 GCA905372125_00136 gene open 169426-170088
371 CAJPNL010000001.1 GCA905372125_00137 gene open 170133-170525
372 CAJPNL010000001.1 GCA905372125_00138 gene open 170539-171366
373 CAJPNL010000001.1 GCA905372125_00139 gene open 171408-172451 qor
374 CAJPNL010000001.1 GCA905372125_00140 gene open 172702-173958 ablA
375 CAJPNL010000001.1 GCA905372125_00141 gene open 173979-174995 yqeC
376 CAJPNL010000001.1 GCA905372125_00142 gene open 174992-176383 mutS
377 CAJPNL010000001.1 GCA905372125_00143 gene open 176387-177958
378 CAJPNL010000001.1 GCA905372125_00144 gene open 177955-178758
379 CAJPNL010000001.1 GCA905372125_00145 gene open 178803-179465
380 CAJPNL010000001.1 GCA905372125_00146 gene open 179507-180646
381 CAJPNL010000001.1 GCA905372125_00147 gene open 180662-181450
382 CAJPNL010000001.1 GCA905372125_00148 gene open 181450-182472
383 CAJPNL010000001.1 GCA905372125_00149 gene open 182494-183270
384 CAJPNL010000001.1 GCA905372125_00150 gene open 183333-184178
385 CAJPNL010000001.1 GCA905372125_00151 gene open 184686-185441
386 CAJPNL010000001.1 GCA905372125_00152 gene open 185454-188513
387 CAJPNL010000001.1 GCA905372125_00153 gene open 188606-190465 mutA
388 CAJPNL010000001.1 GCA905372125_00154 gene open 190483-192645 scpA
389 CAJPNL010000001.1 GCA905372125_00155 gene open 192860-193519 trmD
390 CAJPNL010000001.1 GCA905372125_00156 gene open 193533-194168
391 CAJPNL010000001.1 GCA905372125_00157 gene open 194131-194613
392 CAJPNL010000001.1 GCA905372125_00158 gene open 194632-195090
393 CAJPNL010000001.1 GCA905372125_00159 gene open 195196-197166
394 CAJPNL010000001.1 GCA905372125_00160 gene open 197246-198271
395 CAJPNL010000001.1 GCA905372125_00161 gene open 198304-199269 queG
396 CAJPNL010000001.1 GCA905372125_00162 gene open 199250-200008 porT
397 CAJPNL010000001.1 GCA905372125_00163 gene open 200090-200749 upp
398 CAJPNL010000001.1 GCA905372125_00164 gene open 200761-202629 tonB
399 CAJPNL010000001.1 GCA905372125_00165 gene open 202762-203031 rpsO
400 CAJPNL010000001.1 GCA905372125_00166 gene open 203370-205121 sppA
401 CAJPNL010000001.1 GCA905372125_00167 gene open 205232-206308 lpxK
402 CAJPNL010000001.1 GCA905372125_00168 gene open 206341-207396 thiL
403 CAJPNL010000001.1 GCA905372125_00169 gene open 207412-208182
404 CAJPNL010000001.1 GCA905372125_00170 gene open 208189-208905
405 CAJPNL010000001.1 GCA905372125_00171 gene open 208918-209304
406 CAJPNL010000001.1 GCA905372125_00172 gene open 209424-209897 cdd
407 CAJPNL010000001.1 GCA905372125_00173 gene open 209910-211592
408 CAJPNL010000001.1 GCA905372125_00174 gene open 211650-213233
409 CAJPNL010000001.1 GCA905372125_00175 gene open 213460-213636
410 CAJPNL010000001.1 GCA905372125_00176 gene open 213749-215305
411 CAJPNL010000001.1 GCA905372125_00177 gene open 215298-215852
412 CAJPNL010000001.1 GCA905372125_00178 gene open 215900-216679 surE
413 CAJPNL010000001.1 GCA905372125_00179 gene open 216695-217840 lpxB
414 CAJPNL010000001.1 GCA905372125_00180 gene open 217867-219654 lepA
415 CAJPNL010000001.1 GCA905372125_00181 gene open 219687-221180 dnaB
416 CAJPNL010000001.1 GCA905372125_00182 gene open 221190-222527 mtaB
417 CAJPNL010000001.1 GCA905372125_00183 gene open 222535-223548
418 CAJPNL010000001.1 GCA905372125_00184 gene open 223669-224379
419 CAJPNL010000001.1 GCA905372125_00185 gene open 224433-225032 luxR
420 CAJPNL010000001.1 GCA905372125_00186 gene open 225188-225640
421 CAJPNL010000001.1 GCA905372125_00187 gene open 226614-227093
422 CAJPNL010000001.1 GCA905372125_00188 gene open 227144-228970
423 CAJPNL010000001.1 GCA905372125_00189 gene open 228967-229584
424 CAJPNL010000001.1 GCA905372125_00190 gene open 229597-230928
425 CAJPNL010000001.1 GCA905372125_00191 gene open 230968-232719
426 CAJPNL010000001.1 GCA905372125_00192 gene open 232727-233638
427 CAJPNL010000001.1 GCA905372125_00193 gene open 233646-234236
428 CAJPNL010000001.1 GCA905372125_00194 gene open 234435-235415
429 CAJPNL010000001.1 GCA905372125_00195 gene open 235633-236880
430 CAJPNL010000001.1 GCA905372125_00196 gene open 236997-237920
431 CAJPNL010000001.1 GCA905372125_00197 gene open 238021-239103 serC
432 CAJPNL010000001.1 GCA905372125_00198 gene open 239620-240975
433 CAJPNL010000001.1 GCA905372125_00199 gene open 241564-242406
434 CAJPNL010000001.1 GCA905372125_00200 gene open 242439-243383
435 CAJPNL010000001.1 GCA905372125_00201 gene open 243394-243777
436 CAJPNL010000001.1 GCA905372125_00202 gene open 243915-244910
437 CAJPNL010000001.1 GCA905372125_00203 gene open 244949-245719
438 CAJPNL010000001.1 GCA905372125_00204 gene open 246295-247749 ftsA
439 CAJPNL010000001.1 GCA905372125_00205 gene open 247777-249318 ftsZ
440 CAJPNL010000001.1 GCA905372125_00206 gene open 249369-249824
441 CAJPNL010000001.1 GCA905372125_00207 gene open 249875-251233 murD
442 CAJPNL010000001.1 GCA905372125_00208 gene open 251256-252674 ftsW
443 CAJPNL010000001.1 GCA905372125_00209 gene open 252667-253791 murG
444 CAJPNL010000001.1 GCA905372125_00210 gene open 253813-255207 murC
445 CAJPNL010000001.1 GCA905372125_00211 gene open 255220-255969
446 CAJPNL010000001.1 GCA905372125_00212 gene open 256096-257460
447 CAJPNL010000001.1 GCA905372125_00214 gene open 257926-260094
448 CAJPNL010000001.1 GCA905372125_00215 gene open 260382-261068 clpP
449 CAJPNL010000001.1 GCA905372125_00216 gene open 261118-262380 clpX
450 CAJPNL010000001.1 GCA905372125_00217 gene open 262416-264590 recQ
451 CAJPNL010000001.1 GCA905372125_00218 gene open 264628-266013
452 CAJPNL010000001.1 GCA905372125_00219 gene open 266084-268063
453 CAJPNL010000001.1 GCA905372125_00220 gene open 268383-270308 mutL
454 CAJPNL010000001.1 GCA905372125_00221 gene open 270681-271151 greA
455 CAJPNL010000001.1 GCA905372125_00222 gene open 271190-271588
456 CAJPNL010000001.1 GCA905372125_00223 gene open 271853-273208
457 CAJPNL010000001.1 GCA905372125_00224 gene open 273245-274471
458 CAJPNL010000001.1 GCA905372125_00225 gene open 274674-275261
459 CAJPNL010000001.1 GCA905372125_00226 gene open 275660-277609 rho
460 CAJPNL010000001.1 GCA905372125_00227 gene open 277881-279737
461 CAJPNL010000001.1 GCA905372125_00228 gene open 279845-280876
462 CAJPNL010000001.1 GCA905372125_00229 gene open 281089-282543
463 CAJPNL010000001.1 GCA905372125_00230 gene open 282747-283634
464 CAJPNL010000001.1 GCA905372125_00231 gene open 283770-283904
465 CAJPNL010000001.1 GCA905372125_00232 gene open 284036-285103
466 CAJPNL010000001.1 GCA905372125_00233 gene open 285103-286458
467 CAJPNL010000001.1 GCA905372125_00234 gene open 286498-287241
468 CAJPNL010000001.1 GCA905372125_00235 gene open 287341-288597
469 CAJPNL010000001.1 GCA905372125_00236 gene open 288594-289283 bioC
470 CAJPNL010000001.1 GCA905372125_00237 gene open 289276-290052 bioC
471 CAJPNL010000001.1 GCA905372125_00238 gene open 290093-291133
472 CAJPNL010000001.1 GCA905372125_00239 gene open 291401-291721
473 CAJPNL010000001.1 GCA905372125_00240 gene open 291763-293175
474 CAJPNL010000001.1 GCA905372125_00241 gene open 293267-294142
475 CAJPNL010000001.1 GCA905372125_00242 gene open 294139-294762
476 CAJPNL010000001.1 GCA905372125_00243 gene open 295043-295342
477 CAJPNL010000001.1 GCA905372125_00025 gene open 32303-32376 trnR
478 CAJPNL010000001.1 GCA905372125_00029 gene open 38480-38553 trnA
479 CAJPNL010000001.1 GCA905372125_00082 gene open 110457-110531 trnP
480 CAJPNL010000001.1 GCA905372125_00125 gene open 159141-159211 trnQ
481 CAJPNL010000001.1 GCA905372125_00213 gene open 257654-257729 trnP
482 CAJPNL010000001.1 GCA905372125_00025 tRNA open 32303-32376 trnR tRNA-Arg(tct)
483 CAJPNL010000001.1 GCA905372125_00029 tRNA open 38480-38553 trnA tRNA-Ala(ggc)
484 CAJPNL010000001.1 GCA905372125_00082 tRNA open 110457-110531 trnP tRNA-Pro(ggg)
485 CAJPNL010000001.1 GCA905372125_00125 tRNA open 159141-159211 trnQ tRNA-Gln(ttg)
486 CAJPNL010000001.1 GCA905372125_00213 tRNA open 257654-257729 trnP tRNA-Pro(cgg)
487 CAJPNL010000002.1 repeat_region open 171720-174342 CRISPR array with 40 repeats of length 30%2C consensus sequence CTCCAAATTGTACCTTAGTGGAATTGAAAT and spacer length 35
488 CAJPNL010000002.1 GCA905372125_00244 CDS open 320-1273 _na     317_aa 4-phosphoerythronate dehydrogenase
489 CAJPNL010000002.1 GCA905372125_00248 CDS open 2187-2675 _na     162_aa Ferritin
490 CAJPNL010000002.1 GCA905372125_00249 CDS open 2784-3512 _na     242_aa mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
491 CAJPNL010000002.1 GCA905372125_00250 CDS open 3537-4016 _na     159_aa S-ribosylhomocysteine lyase
492 CAJPNL010000002.1 GCA905372125_00251 CDS open 4087-5265 _na     392_aa DNA polymerase III%2C beta subunit
493 CAJPNL010000002.1 GCA905372125_00252 CDS open 5281-6057 _na     258_aa Exonuclease
494 CAJPNL010000002.1 GCA905372125_00253 CDS open 6081-7310 _na     409_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
495 CAJPNL010000002.1 GCA905372125_00254 CDS open 7307-8215 _na     302_aa DUF4835 domain-containing protein
496 CAJPNL010000002.1 GCA905372125_00255 CDS open 8249-9919 _na     556_aa recN DNA repair protein RecN
497 CAJPNL010000002.1 GCA905372125_00256 CDS open 9912-10652 _na     246_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
498 CAJPNL010000002.1 GCA905372125_00257 CDS open 10679-11056 _na     125_aa Putative endoribonuclease L-PSP
499 CAJPNL010000002.1 GCA905372125_00258 CDS open 11244-14615 _na     1123_aa mfd transcription-repair coupling factor
500 CAJPNL010000002.1 GCA905372125_00259 CDS open 14636-15346 _na     236_aa DNA alkylation repair enzyme