HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_905372255.1)

Select a Genome:
BAKTA Annotations for GCA_905372255.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
75 2550728 2138 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4386 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4386 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPOK010000002.1 GCA905372255_00242 gene open 115544-116770 ywqK
502 CAJPOK010000002.1 GCA905372255_00243 gene open 116935-117174
503 CAJPOK010000002.1 GCA905372255_00244 gene open 117219-117926
504 CAJPOK010000002.1 GCA905372255_00245 gene open 117941-119296
505 CAJPOK010000002.1 GCA905372255_00246 gene open 119325-119975
506 CAJPOK010000002.1 GCA905372255_00247 gene open 119959-120645
507 CAJPOK010000002.1 GCA905372255_00248 gene open 120832-121485
508 CAJPOK010000002.1 GCA905372255_00249 gene open 121482-121772
509 CAJPOK010000002.1 GCA905372255_00252 gene open 122107-122709
510 CAJPOK010000002.1 GCA905372255_00253 gene open 122693-123676
511 CAJPOK010000002.1 GCA905372255_00254 gene open 124317-125102
512 CAJPOK010000002.1 GCA905372255_00255 gene open 125107-125388
513 CAJPOK010000002.1 GCA905372255_00256 gene open 125405-126844 pyk
514 CAJPOK010000002.1 GCA905372255_00257 gene open 126981-127418
515 CAJPOK010000002.1 GCA905372255_00258 gene open 127476-129491
516 CAJPOK010000002.1 GCA905372255_00259 gene open 129695-130462
517 CAJPOK010000002.1 GCA905372255_00260 gene open 130531-130683
518 CAJPOK010000002.1 GCA905372255_00261 gene open 130981-132081
519 CAJPOK010000002.1 GCA905372255_00262 gene open 132341-132889
520 CAJPOK010000002.1 GCA905372255_00263 gene open 132912-133610
521 CAJPOK010000002.1 GCA905372255_00264 gene open 133703-134788
522 CAJPOK010000002.1 GCA905372255_00265 gene open 134792-135025
523 CAJPOK010000002.1 GCA905372255_00266 gene open 135039-135221
524 CAJPOK010000002.1 GCA905372255_00267 gene open 135303-136187 folD
525 CAJPOK010000002.1 GCA905372255_00268 gene open 136228-137580 ffh
526 CAJPOK010000002.1 GCA905372255_00269 gene open 137796-138698
527 CAJPOK010000002.1 GCA905372255_00142 gene open 5321-5393 trnK
528 CAJPOK010000002.1 GCA905372255_00206 gene open 80599-80672 trnH
529 CAJPOK010000002.1 GCA905372255_00222 gene open 91651-91724 trnT
530 CAJPOK010000002.1 GCA905372255_00250 gene open 121815-121896 trnY
531 CAJPOK010000002.1 GCA905372255_00251 gene open 121899-121976 trnV
532 CAJPOK010000002.1 GCA905372255_00142 tRNA open 5321-5393 trnK tRNA-Lys(ttt)
533 CAJPOK010000002.1 GCA905372255_00206 tRNA open 80599-80672 trnH tRNA-His(gtg)
534 CAJPOK010000002.1 GCA905372255_00222 tRNA open 91651-91724 trnT tRNA-Thr(tgt)
535 CAJPOK010000002.1 GCA905372255_00250 tRNA open 121815-121896 trnY tRNA-Tyr(gta)
536 CAJPOK010000002.1 GCA905372255_00251 tRNA open 121899-121976 trnV tRNA-Val(tac)
537 CAJPOK010000003.1 regulatory_region open 44307-44490 Cobalamin riboswitch aptamer
538 CAJPOK010000003.1 regulatory_region open 54823-54898 L13-Bacteroidia ribosomal protein leader
539 CAJPOK010000003.1 repeat_region open 110986-113794 CRISPR array with 37 repeats of length 47%2C consensus sequence GTTGTATTTACTAATGCAAAGATACTAATTTTAAAGCTAATCACAAC and spacer length 29
540 CAJPOK010000003.1 GCA905372255_00270 CDS open 305-673 _na     122_aa Desulfoferrodoxin
541 CAJPOK010000003.1 GCA905372255_00271 CDS open 761-1675 _na     304_aa DUF4835 domain-containing protein
542 CAJPOK010000003.1 GCA905372255_00272 CDS open 1672-2403 _na     243_aa hypothetical protein
543 CAJPOK010000003.1 GCA905372255_00273 CDS open 2400-2903 _na     167_aa RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein
544 CAJPOK010000003.1 GCA905372255_00274 CDS open 3101-3547 _na     148_aa Lipocalin-like domain-containing protein
545 CAJPOK010000003.1 GCA905372255_00275 CDS open 4038-5045 _na     335_aa Acyltransferase 3 domain-containing protein
546 CAJPOK010000003.1 GCA905372255_00276 CDS open 5821-8469 _na     882_aa histidine kinase
547 CAJPOK010000003.1 GCA905372255_00277 CDS open 8811-11120 _na     769_aa Fructan beta-(2%2C6)-fructosidase
548 CAJPOK010000003.1 GCA905372255_00278 CDS open 11147-13045 _na     632_aa Glycosyl hydrolase family 32 N-terminal domain-containing protein
549 CAJPOK010000003.1 GCA905372255_00279 CDS open 13063-14217 _na     384_aa MFS transporter
550 CAJPOK010000003.1 GCA905372255_00280 CDS open 14229-15110 _na     293_aa pfkB Carbohydrate kinase PfkB domain-containing protein
551 CAJPOK010000003.1 GCA905372255_00281 CDS open 15286-16506 _na     406_aa Aminoacetone oxidase family FAD-binding enzyme
552 CAJPOK010000003.1 GCA905372255_00282 CDS open 17172-19865 _na     897_aa malQ 4-alpha-glucanotransferase
553 CAJPOK010000003.1 GCA905372255_00283 CDS open 19941-22142 _na     733_aa Alpha-glucosidase
554 CAJPOK010000003.1 GCA905372255_00284 CDS open 22202-24115 _na     637_aa pulA type I pullulanase
555 CAJPOK010000003.1 GCA905372255_00285 CDS open 24125-25975 _na     616_aa Glycosyl hydrolase family 13 catalytic domain-containing protein
556 CAJPOK010000003.1 GCA905372255_00286 CDS open 26125-26895 _na     256_aa Lipocalin-like domain-containing protein
557 CAJPOK010000003.1 GCA905372255_00287 CDS open 27196-27984 _na     262_aa Lipocalin-like domain-containing protein
558 CAJPOK010000003.1 GCA905372255_00288 CDS open 28603-29295 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
559 CAJPOK010000003.1 GCA905372255_00289 CDS open 29349-29951 _na     200_aa DUF4290 domain-containing protein
560 CAJPOK010000003.1 GCA905372255_00290 CDS open 29956-31269 _na     437_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
561 CAJPOK010000003.1 GCA905372255_00291 CDS open 31282-31803 _na     173_aa rimM ribosome maturation factor RimM
562 CAJPOK010000003.1 GCA905372255_00292 CDS open 31813-32967 _na     384_aa 1-deoxy-D-xylulose-5-phosphate reductoisomerase
563 CAJPOK010000003.1 GCA905372255_00293 CDS open 33021-34421 _na     466_aa rseP RIP metalloprotease RseP
564 CAJPOK010000003.1 GCA905372255_00294 CDS open 34429-35265 _na     278_aa Lipopolysaccharide cholinephosphotransferase
565 CAJPOK010000003.1 GCA905372255_00295 CDS open 35309-36028 _na     239_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
566 CAJPOK010000003.1 GCA905372255_00296 CDS open 36031-37065 _na     344_aa NAD-dependent epimerase/dehydratase domain-containing protein
567 CAJPOK010000003.1 GCA905372255_00297 CDS open 37069-37974 _na     301_aa Rhamnan synthesis protein F
568 CAJPOK010000003.1 GCA905372255_00298 CDS open 38433-44108 _na     1891_aa Secretion protein
569 CAJPOK010000003.1 GCA905372255_00299 CDS open 44588-45013 _na     141_aa hypothetical protein
570 CAJPOK010000003.1 GCA905372255_00300 CDS open 45035-45496 _na     153_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
571 CAJPOK010000003.1 GCA905372255_00301 CDS open 45553-46731 _na     392_aa porV type IX secretion system outer membrane channel protein PorV
572 CAJPOK010000003.1 GCA905372255_00302 CDS open 46820-50365 _na     1181_aa Gingipain domain-containing protein
573 CAJPOK010000003.1 GCA905372255_00303 CDS open 50408-51025 _na     205_aa Fumarylacetoacetate hydrolase
574 CAJPOK010000003.1 GCA905372255_00304 CDS open 51744-52742 _na     332_aa tsf translation elongation factor Ts
575 CAJPOK010000003.1 GCA905372255_00305 CDS open 52856-53698 _na     280_aa Small ribosomal subunit protein uS2
576 CAJPOK010000003.1 GCA905372255_00306 CDS open 53905-54291 _na     128_aa rpsI 30S ribosomal protein S9
577 CAJPOK010000003.1 GCA905372255_00307 CDS open 54306-54770 _na     154_aa rplM 50S ribosomal protein L13
578 CAJPOK010000003.1 GCA905372255_00308 CDS open 55037-57670 _na     877_aa DUF3943 domain-containing protein
579 CAJPOK010000003.1 GCA905372255_00309 CDS open 58795-59127 _na     110_aa hxsD His-Xaa-Ser system protein HxsD
580 CAJPOK010000003.1 GCA905372255_00310 CDS open 59124-60554 _na     476_aa Radical SAM core domain-containing protein
581 CAJPOK010000003.1 GCA905372255_00311 CDS open 60562-61674 _na     370_aa Radical SAM core domain-containing protein
582 CAJPOK010000003.1 GCA905372255_00312 CDS open 61742-62002 _na     86_aa hypothetical protein
583 CAJPOK010000003.1 GCA905372255_00313 CDS open 62312-64330 _na     672_aa Alpha-amylase
584 CAJPOK010000003.1 GCA905372255_00314 CDS open 64537-65571 _na     344_aa Outer membrane protein SusF/SusE-like C-terminal domain-containing protein
585 CAJPOK010000003.1 GCA905372255_00315 CDS open 65599-66783 _na     394_aa susE SusE outer membrane protein domain-containing protein
586 CAJPOK010000003.1 GCA905372255_00316 CDS open 66841-68484 _na     547_aa RagB/SusD domain-containing protein
587 CAJPOK010000003.1 GCA905372255_00317 CDS open 68527-71625 _na     1032_aa TonB-dependent receptor plug domain-containing protein
588 CAJPOK010000003.1 GCA905372255_00318 CDS open 71900-72925 _na     341_aa lacI LacI family transcriptional regulator
589 CAJPOK010000003.1 GCA905372255_00319 CDS open 72978-74315 _na     445_aa MFS transporter
590 CAJPOK010000003.1 GCA905372255_00320 CDS open 74636-76396 _na     586_aa SIR2-like domain-containing protein
591 CAJPOK010000003.1 GCA905372255_00321 CDS open 76620-76883 _na     87_aa ABC transporter permease
592 CAJPOK010000003.1 GCA905372255_00322 CDS open 77035-78195 _na     386_aa oprP Phosphate-specific outer membrane porin OprP
593 CAJPOK010000003.1 GCA905372255_00323 CDS open 78297-79088 _na     263_aa pgpB Acid phosphatase
594 CAJPOK010000003.1 GCA905372255_00324 CDS open 79239-82421 _na     1060_aa fliS Flagellar protein FliS
595 CAJPOK010000003.1 GCA905372255_00325 CDS open 82545-82922 _na     125_aa hypothetical protein
596 CAJPOK010000003.1 GCA905372255_00326 CDS open 83133-84059 _na     308_aa Thioredoxin domain-containing protein
597 CAJPOK010000003.1 GCA905372255_00327 CDS open 84071-85807 _na     578_aa putative ABC transporter ATP-binding protein
598 CAJPOK010000003.1 GCA905372255_00328 CDS open 85857-86744 _na     295_aa NAD kinase
599 CAJPOK010000003.1 GCA905372255_00329 CDS open 86981-87550 _na     189_aa DJ-1 family glyoxalase III
600 CAJPOK010000003.1 GCA905372255_00330 CDS open 87576-88250 _na     224_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
601 CAJPOK010000003.1 GCA905372255_00331 CDS open 88272-90368 _na     698_aa recG ATP-dependent DNA helicase RecG
602 CAJPOK010000003.1 GCA905372255_00332 CDS open 90635-91636 _na     333_aa lysM LysM peptidoglycan-binding domain-containing protein
603 CAJPOK010000003.1 GCA905372255_00333 CDS open 92060-92905 _na     281_aa GLPGLI family protein
604 CAJPOK010000003.1 GCA905372255_00334 CDS open 92919-95528 _na     869_aa TonB-dependent receptor
605 CAJPOK010000003.1 GCA905372255_00335 CDS open 95782-96567 _na     261_aa TIGR02757 family protein
606 CAJPOK010000003.1 GCA905372255_00336 CDS open 96578-97039 _na     153_aa bcp thioredoxin-dependent thiol peroxidase
607 CAJPOK010000003.1 GCA905372255_00337 CDS open 97393-98709 _na     438_aa Anaerobic C4-dicarboxylate uptake (Dcu) family transporter
608 CAJPOK010000003.1 GCA905372255_00338 CDS open 98769-99824 _na     351_aa ansB L-asparaginase 2
609 CAJPOK010000003.1 GCA905372255_00339 CDS open 99933-101129 _na     398_aa Porin
610 CAJPOK010000003.1 GCA905372255_00340 CDS open 101530-102954 _na     474_aa Aspartate ammonia-lyase
611 CAJPOK010000003.1 GCA905372255_00341 CDS open 103244-104575 _na     443_aa ATP-binding protein
612 CAJPOK010000003.1 GCA905372255_00342 CDS open 104637-104798 _na     53_aa hypothetical protein
613 CAJPOK010000003.1 GCA905372255_00343 CDS open 105430-109572 _na     1380_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
614 CAJPOK010000003.1 GCA905372255_00344 CDS open 109585-110517 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
615 CAJPOK010000003.1 GCA905372255_00345 CDS open 110569-110865 _na     98_aa cas2 CRISPR-associated endonuclease Cas2
616 CAJPOK010000003.1 GCA905372255_00270 gene open 305-673
617 CAJPOK010000003.1 GCA905372255_00271 gene open 761-1675
618 CAJPOK010000003.1 GCA905372255_00272 gene open 1672-2403
619 CAJPOK010000003.1 GCA905372255_00273 gene open 2400-2903
620 CAJPOK010000003.1 GCA905372255_00274 gene open 3101-3547
621 CAJPOK010000003.1 GCA905372255_00275 gene open 4038-5045
622 CAJPOK010000003.1 GCA905372255_00276 gene open 5821-8469
623 CAJPOK010000003.1 GCA905372255_00277 gene open 8811-11120
624 CAJPOK010000003.1 GCA905372255_00278 gene open 11147-13045
625 CAJPOK010000003.1 GCA905372255_00279 gene open 13063-14217
626 CAJPOK010000003.1 GCA905372255_00280 gene open 14229-15110 pfkB
627 CAJPOK010000003.1 GCA905372255_00281 gene open 15286-16506
628 CAJPOK010000003.1 GCA905372255_00282 gene open 17172-19865 malQ
629 CAJPOK010000003.1 GCA905372255_00283 gene open 19941-22142
630 CAJPOK010000003.1 GCA905372255_00284 gene open 22202-24115 pulA
631 CAJPOK010000003.1 GCA905372255_00285 gene open 24125-25975
632 CAJPOK010000003.1 GCA905372255_00286 gene open 26125-26895
633 CAJPOK010000003.1 GCA905372255_00287 gene open 27196-27984
634 CAJPOK010000003.1 GCA905372255_00288 gene open 28603-29295 tsaB
635 CAJPOK010000003.1 GCA905372255_00289 gene open 29349-29951
636 CAJPOK010000003.1 GCA905372255_00290 gene open 29956-31269 murA
637 CAJPOK010000003.1 GCA905372255_00291 gene open 31282-31803 rimM
638 CAJPOK010000003.1 GCA905372255_00292 gene open 31813-32967
639 CAJPOK010000003.1 GCA905372255_00293 gene open 33021-34421 rseP
640 CAJPOK010000003.1 GCA905372255_00294 gene open 34429-35265
641 CAJPOK010000003.1 GCA905372255_00295 gene open 35309-36028
642 CAJPOK010000003.1 GCA905372255_00296 gene open 36031-37065
643 CAJPOK010000003.1 GCA905372255_00297 gene open 37069-37974
644 CAJPOK010000003.1 GCA905372255_00298 gene open 38433-44108
645 CAJPOK010000003.1 GCA905372255_00299 gene open 44588-45013
646 CAJPOK010000003.1 GCA905372255_00300 gene open 45035-45496
647 CAJPOK010000003.1 GCA905372255_00301 gene open 45553-46731 porV
648 CAJPOK010000003.1 GCA905372255_00302 gene open 46820-50365
649 CAJPOK010000003.1 GCA905372255_00303 gene open 50408-51025
650 CAJPOK010000003.1 GCA905372255_00304 gene open 51744-52742 tsf
651 CAJPOK010000003.1 GCA905372255_00305 gene open 52856-53698
652 CAJPOK010000003.1 GCA905372255_00306 gene open 53905-54291 rpsI
653 CAJPOK010000003.1 GCA905372255_00307 gene open 54306-54770 rplM
654 CAJPOK010000003.1 GCA905372255_00308 gene open 55037-57670
655 CAJPOK010000003.1 GCA905372255_00309 gene open 58795-59127 hxsD
656 CAJPOK010000003.1 GCA905372255_00310 gene open 59124-60554
657 CAJPOK010000003.1 GCA905372255_00311 gene open 60562-61674
658 CAJPOK010000003.1 GCA905372255_00312 gene open 61742-62002
659 CAJPOK010000003.1 GCA905372255_00313 gene open 62312-64330
660 CAJPOK010000003.1 GCA905372255_00314 gene open 64537-65571
661 CAJPOK010000003.1 GCA905372255_00315 gene open 65599-66783 susE
662 CAJPOK010000003.1 GCA905372255_00316 gene open 66841-68484
663 CAJPOK010000003.1 GCA905372255_00317 gene open 68527-71625
664 CAJPOK010000003.1 GCA905372255_00318 gene open 71900-72925 lacI
665 CAJPOK010000003.1 GCA905372255_00319 gene open 72978-74315
666 CAJPOK010000003.1 GCA905372255_00320 gene open 74636-76396
667 CAJPOK010000003.1 GCA905372255_00321 gene open 76620-76883
668 CAJPOK010000003.1 GCA905372255_00322 gene open 77035-78195 oprP
669 CAJPOK010000003.1 GCA905372255_00323 gene open 78297-79088 pgpB
670 CAJPOK010000003.1 GCA905372255_00324 gene open 79239-82421 fliS
671 CAJPOK010000003.1 GCA905372255_00325 gene open 82545-82922
672 CAJPOK010000003.1 GCA905372255_00326 gene open 83133-84059
673 CAJPOK010000003.1 GCA905372255_00327 gene open 84071-85807
674 CAJPOK010000003.1 GCA905372255_00328 gene open 85857-86744
675 CAJPOK010000003.1 GCA905372255_00329 gene open 86981-87550
676 CAJPOK010000003.1 GCA905372255_00330 gene open 87576-88250
677 CAJPOK010000003.1 GCA905372255_00331 gene open 88272-90368 recG
678 CAJPOK010000003.1 GCA905372255_00332 gene open 90635-91636 lysM
679 CAJPOK010000003.1 GCA905372255_00333 gene open 92060-92905
680 CAJPOK010000003.1 GCA905372255_00334 gene open 92919-95528
681 CAJPOK010000003.1 GCA905372255_00335 gene open 95782-96567
682 CAJPOK010000003.1 GCA905372255_00336 gene open 96578-97039 bcp
683 CAJPOK010000003.1 GCA905372255_00337 gene open 97393-98709
684 CAJPOK010000003.1 GCA905372255_00338 gene open 98769-99824 ansB
685 CAJPOK010000003.1 GCA905372255_00339 gene open 99933-101129
686 CAJPOK010000003.1 GCA905372255_00340 gene open 101530-102954
687 CAJPOK010000003.1 GCA905372255_00341 gene open 103244-104575
688 CAJPOK010000003.1 GCA905372255_00342 gene open 104637-104798
689 CAJPOK010000003.1 GCA905372255_00343 gene open 105430-109572 cas9
690 CAJPOK010000003.1 GCA905372255_00344 gene open 109585-110517 cas1
691 CAJPOK010000003.1 GCA905372255_00345 gene open 110569-110865 cas2
692 CAJPOK010000004.1 GCA905372255_00346 CDS open 78-2744 _na     888_aa mutS DNA mismatch repair protein MutS
693 CAJPOK010000004.1 GCA905372255_00347 CDS open 2876-4369 _na     497_aa DUF3943 domain-containing protein
694 CAJPOK010000004.1 GCA905372255_00348 CDS open 4889-5206 _na     105_aa UPF0145 protein NCTC13043_00094
695 CAJPOK010000004.1 GCA905372255_00349 CDS open 5301-6788 _na     495_aa cysS cysteine--tRNA ligase
696 CAJPOK010000004.1 GCA905372255_00350 CDS open 6923-8143 _na     406_aa pncB nicotinate phosphoribosyltransferase
697 CAJPOK010000004.1 GCA905372255_00351 CDS open 8232-8915 _na     227_aa mjaI MjaI family restriction endonuclease
698 CAJPOK010000004.1 GCA905372255_00352 CDS open 8926-9255 _na     109_aa Restriction system protein Mrr-like N-terminal domain-containing protein
699 CAJPOK010000004.1 GCA905372255_00353 CDS open 9260-10534 _na     424_aa Methyltransferase
700 CAJPOK010000004.1 GCA905372255_00354 CDS open 10595-11152 _na     185_aa spoU tRNA/rRNA methyltransferase SpoU type domain-containing protein
701 CAJPOK010000004.1 GCA905372255_00355 CDS open 11149-11571 _na     140_aa Fe-S metabolism associated domain-containing protein
702 CAJPOK010000004.1 GCA905372255_00356 CDS open 11592-12056 _na     154_aa doxX DoxX family protein
703 CAJPOK010000004.1 GCA905372255_00357 CDS open 12083-13330 _na     415_aa Collagenase
704 CAJPOK010000004.1 GCA905372255_00358 CDS open 13691-16453 _na     920_aa polA DNA polymerase I
705 CAJPOK010000004.1 GCA905372255_00359 CDS open 16543-17520 _na     325_aa Octaprenyl-diphosphate synthase
706 CAJPOK010000004.1 GCA905372255_00360 CDS open 17580-17816 _na     78_aa hypothetical protein
707 CAJPOK010000004.1 GCA905372255_00361 CDS open 18091-19002 _na     303_aa deoC deoxyribose-phosphate aldolase
708 CAJPOK010000004.1 GCA905372255_00362 CDS open 19047-19418 _na     123_aa NTP pyrophosphohydrolase MazG-like domain-containing protein
709 CAJPOK010000004.1 GCA905372255_00363 CDS open 19423-19875 _na     150_aa dtd D-aminoacyl-tRNA deacylase
710 CAJPOK010000004.1 GCA905372255_00364 CDS open 19906-21741 _na     611_aa uvrC excinuclease ABC subunit UvrC
711 CAJPOK010000004.1 GCA905372255_00365 CDS open 22078-22608 _na     176_aa adenine phosphoribosyltransferase
712 CAJPOK010000004.1 GCA905372255_00366 CDS open 22667-24565 _na     632_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
713 CAJPOK010000004.1 GCA905372255_00367 CDS open 24733-25158 _na     141_aa Nucleotidyltransferase
714 CAJPOK010000004.1 GCA905372255_00368 CDS open 25161-25466 _na     101_aa FHA domain-containing protein
715 CAJPOK010000004.1 GCA905372255_00369 CDS open 26188-26322 _na     44_aa hypothetical protein
716 CAJPOK010000004.1 GCA905372255_00370 CDS open 26447-27133 _na     228_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
717 CAJPOK010000004.1 GCA905372255_00371 CDS open 27166-29148 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
718 CAJPOK010000004.1 GCA905372255_00372 CDS open 29195-29950 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
719 CAJPOK010000004.1 GCA905372255_00373 CDS open 30150-31430 _na     426_aa Clostripain family protein
720 CAJPOK010000004.1 GCA905372255_00374 CDS open 31501-31971 _na     156_aa coaD pantetheine-phosphate adenylyltransferase
721 CAJPOK010000004.1 GCA905372255_00375 CDS open 31984-32394 _na     136_aa ybeY rRNA maturation RNase YbeY
722 CAJPOK010000004.1 GCA905372255_00376 CDS open 32825-34471 _na     548_aa putative cell surface protein/luecine rich repeat protein
723 CAJPOK010000004.1 GCA905372255_00377 CDS open 34816-36405 _na     529_aa PDZ domain-containing protein
724 CAJPOK010000004.1 GCA905372255_00378 CDS open 36477-38423 _na     648_aa DNA topoisomerase (ATP-hydrolyzing)
725 CAJPOK010000004.1 GCA905372255_00379 CDS open 38456-39601 _na     381_aa N-acetyltransferase domain-containing protein
726 CAJPOK010000004.1 GCA905372255_00380 CDS open 39672-40901 _na     409_aa SAM-dependent methyltransferases
727 CAJPOK010000004.1 GCA905372255_00381 CDS open 40929-41696 _na     255_aa D-alanyl-D-alanine dipeptidase
728 CAJPOK010000004.1 GCA905372255_00382 CDS open 42066-43220 _na     384_aa Peroxiredoxin
729 CAJPOK010000004.1 GCA905372255_00383 CDS open 43323-43862 _na     179_aa yfcE phosphodiesterase
730 CAJPOK010000004.1 GCA905372255_00384 CDS open 43994-44938 _na     314_aa Acetyltransferase
731 CAJPOK010000004.1 GCA905372255_00385 CDS open 44981-46111 _na     376_aa dprA DNA-processing protein DprA
732 CAJPOK010000004.1 GCA905372255_00386 CDS open 46141-46560 _na     139_aa Thioesterase
733 CAJPOK010000004.1 GCA905372255_00387 CDS open 46557-47867 _na     436_aa DUF2851 domain-containing protein
734 CAJPOK010000004.1 GCA905372255_00388 CDS open 48392-49666 _na     424_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
735 CAJPOK010000004.1 GCA905372255_00389 CDS open 49985-50710 _na     241_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
736 CAJPOK010000004.1 GCA905372255_00390 CDS open 50760-52298 _na     512_aa lepB signal peptidase I
737 CAJPOK010000004.1 GCA905372255_00391 CDS open 52407-53033 _na     208_aa WbqC-like protein
738 CAJPOK010000004.1 GCA905372255_00392 CDS open 53141-53746 _na     201_aa PEGA domain-containing protein
739 CAJPOK010000004.1 GCA905372255_00393 CDS open 54098-54439 _na     113_aa Integrase catalytic domain-containing protein
740 CAJPOK010000004.1 GCA905372255_00394 CDS open 54636-55292 _na     218_aa hypothetical protein
741 CAJPOK010000004.1 GCA905372255_00396 CDS open 55900-56847 _na     315_aa bifunctional riboflavin kinase/FAD synthetase
742 CAJPOK010000004.1 GCA905372255_00397 CDS open 56872-57708 _na     278_aa CPBP family intramembrane metalloprotease
743 CAJPOK010000004.1 GCA905372255_00398 CDS open 58141-58764 _na     207_aa Agmatine deiminase
744 CAJPOK010000004.1 GCA905372255_00399 CDS open 59191-59490 _na     99_aa hypothetical protein
745 CAJPOK010000004.1 GCA905372255_00400 CDS open 59697-61823 _na     708_aa tonB Putative TonB dependent receptor
746 CAJPOK010000004.1 GCA905372255_00401 CDS open 62086-62820 _na     244_aa Lipoprotein
747 CAJPOK010000004.1 GCA905372255_00402 CDS open 62877-63902 _na     341_aa Lipoprotein
748 CAJPOK010000004.1 GCA905372255_00403 CDS open 64735-64926 _na     63_aa hypothetical protein
749 CAJPOK010000004.1 GCA905372255_00404 CDS open 64942-68532 _na     1196_aa IgGFc-binding protein N-terminal domain-containing protein
750 CAJPOK010000004.1 GCA905372255_00405 CDS open 68849-69988 _na     379_aa HTH araC/xylS-type domain-containing protein
751 CAJPOK010000004.1 GCA905372255_00406 CDS open 69998-71782 _na     594_aa TPR domain protein with HTH18 domain
752 CAJPOK010000004.1 GCA905372255_00407 CDS open 71857-73158 _na     433_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
753 CAJPOK010000004.1 GCA905372255_00408 CDS open 73862-76078 _na     738_aa pnp polyribonucleotide nucleotidyltransferase
754 CAJPOK010000004.1 GCA905372255_00409 CDS open 76428-78314 _na     628_aa Cadmium-translocating P-type ATPase
755 CAJPOK010000004.1 GCA905372255_00410 CDS open 78501-79421 _na     306_aa DUF2179 domain-containing protein
756 CAJPOK010000004.1 GCA905372255_00411 CDS open 79931-80902 _na     323_aa dusB tRNA dihydrouridine synthase DusB
757 CAJPOK010000004.1 GCA905372255_00412 CDS open 81028-82062 _na     344_aa ruvB Holliday junction branch migration DNA helicase RuvB
758 CAJPOK010000004.1 GCA905372255_00413 CDS open 82231-82701 _na     156_aa DUF4252 domain-containing protein
759 CAJPOK010000004.1 GCA905372255_00414 CDS open 82706-83206 _na     166_aa DUF4252 domain-containing protein
760 CAJPOK010000004.1 GCA905372255_00415 CDS open 83230-83730 _na     166_aa RNA polymerase sigma factor
761 CAJPOK010000004.1 GCA905372255_00416 CDS open 83730-84221 _na     163_aa Pyruvate ferredoxin oxidoreductase
762 CAJPOK010000004.1 GCA905372255_00417 CDS open 84224-84673 _na     149_aa DUF4252 domain-containing protein
763 CAJPOK010000004.1 GCA905372255_00418 CDS open 85154-87499 _na     781_aa topA type I DNA topoisomerase
764 CAJPOK010000004.1 GCA905372255_00419 CDS open 87599-88111 _na     170_aa shikimate kinase
765 CAJPOK010000004.1 GCA905372255_00420 CDS open 88220-90112 _na     630_aa speA biosynthetic arginine decarboxylase
766 CAJPOK010000004.1 GCA905372255_00421 CDS open 90267-90776 _na     169_aa RNA polymerase ECF-type sigma factor
767 CAJPOK010000004.1 GCA905372255_00422 CDS open 90766-91245 _na     159_aa Pyruvate ferredoxin oxidoreductase
768 CAJPOK010000004.1 GCA905372255_00423 CDS open 91716-92408 _na     230_aa radC DNA repair protein RadC
769 CAJPOK010000004.1 GCA905372255_00424 CDS open 92421-93473 _na     350_aa Poly-beta-1%2C6-N-acetyl-D-glucosamine synthase
770 CAJPOK010000004.1 GCA905372255_00425 CDS open 93573-94139 _na     188_aa efp elongation factor P
771 CAJPOK010000004.1 GCA905372255_00426 CDS open 94361-94516 _na     51_aa rpmH 50S ribosomal protein L34
772 CAJPOK010000004.1 GCA905372255_00427 CDS open 94632-95411 _na     259_aa PASTA domain-containing protein
773 CAJPOK010000004.1 GCA905372255_00428 CDS open 95417-96505 _na     362_aa Pseudouridine synthase
774 CAJPOK010000004.1 GCA905372255_00429 CDS open 96554-97549 _na     331_aa D-alanine--D-alanine ligase
775 CAJPOK010000004.1 GCA905372255_00430 CDS open 97645-98802 _na     385_aa Phospholipid/glycerol acyltransferase domain-containing protein
776 CAJPOK010000004.1 GCA905372255_00431 CDS open 98795-99469 _na     224_aa NigD-like C-terminal beta sandwich domain-containing protein
777 CAJPOK010000004.1 GCA905372255_00433 CDS open 100084-101313 _na     409_aa ABC transporter permease
778 CAJPOK010000004.1 GCA905372255_00434 CDS open 101313-101648 _na     111_aa rbfA 30S ribosome-binding factor RbfA
779 CAJPOK010000004.1 GCA905372255_00435 CDS open 102278-103129 _na     283_aa ABC transporter ATP-binding protein
780 CAJPOK010000004.1 GCA905372255_00436 CDS open 103148-104152 _na     334_aa DUF4435 domain-containing protein
781 CAJPOK010000004.1 GCA905372255_00437 CDS open 104458-105915 _na     485_aa trkH TrkH family potassium uptake protein
782 CAJPOK010000004.1 GCA905372255_00438 CDS open 105937-107277 _na     446_aa trkA Trk system potassium transporter TrkA
783 CAJPOK010000004.1 GCA905372255_00439 CDS open 107300-109237 _na     645_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
784 CAJPOK010000004.1 GCA905372255_00440 CDS open 109824-110426 _na     200_aa DUF4840 domain-containing protein
785 CAJPOK010000004.1 GCA905372255_00441 CDS open 110594-111313 _na     239_aa BAX inhibitor (BI)-1/YccA family protein
786 CAJPOK010000004.1 GCA905372255_00346 gene open 78-2744 mutS
787 CAJPOK010000004.1 GCA905372255_00347 gene open 2876-4369
788 CAJPOK010000004.1 GCA905372255_00348 gene open 4889-5206
789 CAJPOK010000004.1 GCA905372255_00349 gene open 5301-6788 cysS
790 CAJPOK010000004.1 GCA905372255_00350 gene open 6923-8143 pncB
791 CAJPOK010000004.1 GCA905372255_00351 gene open 8232-8915 mjaI
792 CAJPOK010000004.1 GCA905372255_00352 gene open 8926-9255
793 CAJPOK010000004.1 GCA905372255_00353 gene open 9260-10534
794 CAJPOK010000004.1 GCA905372255_00354 gene open 10595-11152 spoU
795 CAJPOK010000004.1 GCA905372255_00355 gene open 11149-11571
796 CAJPOK010000004.1 GCA905372255_00356 gene open 11592-12056 doxX
797 CAJPOK010000004.1 GCA905372255_00357 gene open 12083-13330
798 CAJPOK010000004.1 GCA905372255_00358 gene open 13691-16453 polA
799 CAJPOK010000004.1 GCA905372255_00359 gene open 16543-17520
800 CAJPOK010000004.1 GCA905372255_00360 gene open 17580-17816
801 CAJPOK010000004.1 GCA905372255_00361 gene open 18091-19002 deoC
802 CAJPOK010000004.1 GCA905372255_00362 gene open 19047-19418
803 CAJPOK010000004.1 GCA905372255_00363 gene open 19423-19875 dtd
804 CAJPOK010000004.1 GCA905372255_00364 gene open 19906-21741 uvrC
805 CAJPOK010000004.1 GCA905372255_00365 gene open 22078-22608
806 CAJPOK010000004.1 GCA905372255_00366 gene open 22667-24565 mnmG
807 CAJPOK010000004.1 GCA905372255_00367 gene open 24733-25158
808 CAJPOK010000004.1 GCA905372255_00368 gene open 25161-25466
809 CAJPOK010000004.1 GCA905372255_00369 gene open 26188-26322
810 CAJPOK010000004.1 GCA905372255_00370 gene open 26447-27133
811 CAJPOK010000004.1 GCA905372255_00371 gene open 27166-29148 sdhA
812 CAJPOK010000004.1 GCA905372255_00372 gene open 29195-29950
813 CAJPOK010000004.1 GCA905372255_00373 gene open 30150-31430
814 CAJPOK010000004.1 GCA905372255_00374 gene open 31501-31971 coaD
815 CAJPOK010000004.1 GCA905372255_00375 gene open 31984-32394 ybeY
816 CAJPOK010000004.1 GCA905372255_00376 gene open 32825-34471
817 CAJPOK010000004.1 GCA905372255_00377 gene open 34816-36405
818 CAJPOK010000004.1 GCA905372255_00378 gene open 36477-38423
819 CAJPOK010000004.1 GCA905372255_00379 gene open 38456-39601
820 CAJPOK010000004.1 GCA905372255_00380 gene open 39672-40901
821 CAJPOK010000004.1 GCA905372255_00381 gene open 40929-41696
822 CAJPOK010000004.1 GCA905372255_00382 gene open 42066-43220
823 CAJPOK010000004.1 GCA905372255_00383 gene open 43323-43862 yfcE
824 CAJPOK010000004.1 GCA905372255_00384 gene open 43994-44938
825 CAJPOK010000004.1 GCA905372255_00385 gene open 44981-46111 dprA
826 CAJPOK010000004.1 GCA905372255_00386 gene open 46141-46560
827 CAJPOK010000004.1 GCA905372255_00387 gene open 46557-47867
828 CAJPOK010000004.1 GCA905372255_00388 gene open 48392-49666
829 CAJPOK010000004.1 GCA905372255_00389 gene open 49985-50710 dapB
830 CAJPOK010000004.1 GCA905372255_00390 gene open 50760-52298 lepB
831 CAJPOK010000004.1 GCA905372255_00391 gene open 52407-53033
832 CAJPOK010000004.1 GCA905372255_00392 gene open 53141-53746
833 CAJPOK010000004.1 GCA905372255_00393 gene open 54098-54439
834 CAJPOK010000004.1 GCA905372255_00394 gene open 54636-55292
835 CAJPOK010000004.1 GCA905372255_00396 gene open 55900-56847
836 CAJPOK010000004.1 GCA905372255_00397 gene open 56872-57708
837 CAJPOK010000004.1 GCA905372255_00398 gene open 58141-58764
838 CAJPOK010000004.1 GCA905372255_00399 gene open 59191-59490
839 CAJPOK010000004.1 GCA905372255_00400 gene open 59697-61823 tonB
840 CAJPOK010000004.1 GCA905372255_00401 gene open 62086-62820
841 CAJPOK010000004.1 GCA905372255_00402 gene open 62877-63902
842 CAJPOK010000004.1 GCA905372255_00403 gene open 64735-64926
843 CAJPOK010000004.1 GCA905372255_00404 gene open 64942-68532
844 CAJPOK010000004.1 GCA905372255_00405 gene open 68849-69988
845 CAJPOK010000004.1 GCA905372255_00406 gene open 69998-71782
846 CAJPOK010000004.1 GCA905372255_00407 gene open 71857-73158
847 CAJPOK010000004.1 GCA905372255_00408 gene open 73862-76078 pnp
848 CAJPOK010000004.1 GCA905372255_00409 gene open 76428-78314
849 CAJPOK010000004.1 GCA905372255_00410 gene open 78501-79421
850 CAJPOK010000004.1 GCA905372255_00411 gene open 79931-80902 dusB
851 CAJPOK010000004.1 GCA905372255_00412 gene open 81028-82062 ruvB
852 CAJPOK010000004.1 GCA905372255_00413 gene open 82231-82701
853 CAJPOK010000004.1 GCA905372255_00414 gene open 82706-83206
854 CAJPOK010000004.1 GCA905372255_00415 gene open 83230-83730
855 CAJPOK010000004.1 GCA905372255_00416 gene open 83730-84221
856 CAJPOK010000004.1 GCA905372255_00417 gene open 84224-84673
857 CAJPOK010000004.1 GCA905372255_00418 gene open 85154-87499 topA
858 CAJPOK010000004.1 GCA905372255_00419 gene open 87599-88111
859 CAJPOK010000004.1 GCA905372255_00420 gene open 88220-90112 speA
860 CAJPOK010000004.1 GCA905372255_00421 gene open 90267-90776
861 CAJPOK010000004.1 GCA905372255_00422 gene open 90766-91245
862 CAJPOK010000004.1 GCA905372255_00423 gene open 91716-92408 radC
863 CAJPOK010000004.1 GCA905372255_00424 gene open 92421-93473
864 CAJPOK010000004.1 GCA905372255_00425 gene open 93573-94139 efp
865 CAJPOK010000004.1 GCA905372255_00426 gene open 94361-94516 rpmH
866 CAJPOK010000004.1 GCA905372255_00427 gene open 94632-95411
867 CAJPOK010000004.1 GCA905372255_00428 gene open 95417-96505
868 CAJPOK010000004.1 GCA905372255_00429 gene open 96554-97549
869 CAJPOK010000004.1 GCA905372255_00430 gene open 97645-98802
870 CAJPOK010000004.1 GCA905372255_00431 gene open 98795-99469
871 CAJPOK010000004.1 GCA905372255_00433 gene open 100084-101313
872 CAJPOK010000004.1 GCA905372255_00434 gene open 101313-101648 rbfA
873 CAJPOK010000004.1 GCA905372255_00435 gene open 102278-103129
874 CAJPOK010000004.1 GCA905372255_00436 gene open 103148-104152
875 CAJPOK010000004.1 GCA905372255_00437 gene open 104458-105915 trkH
876 CAJPOK010000004.1 GCA905372255_00438 gene open 105937-107277 trkA
877 CAJPOK010000004.1 GCA905372255_00439 gene open 107300-109237 dxs
878 CAJPOK010000004.1 GCA905372255_00440 gene open 109824-110426
879 CAJPOK010000004.1 GCA905372255_00441 gene open 110594-111313
880 CAJPOK010000004.1 GCA905372255_00395 gene open 55588-55661 trnI
881 CAJPOK010000004.1 GCA905372255_00432 gene open 99894-99966 trnP
882 CAJPOK010000004.1 GCA905372255_00395 tRNA open 55588-55661 trnI tRNA-Ile2(cat)
883 CAJPOK010000004.1 GCA905372255_00432 tRNA open 99894-99966 trnP tRNA-Pro(cgg)
884 CAJPOK010000005.1 GCA905372255_00442 CDS open 15-281 _na     88_aa rpsS 30S ribosomal protein S19
885 CAJPOK010000005.1 GCA905372255_00443 CDS open 313-723 _na     136_aa rplV 50S ribosomal protein L22
886 CAJPOK010000005.1 GCA905372255_00444 CDS open 732-1463 _na     243_aa rpsC 30S ribosomal protein S3
887 CAJPOK010000005.1 GCA905372255_00445 CDS open 1478-1906 _na     142_aa rplP 50S ribosomal protein L16
888 CAJPOK010000005.1 GCA905372255_00446 CDS open 1912-2106 _na     64_aa rpmC 50S ribosomal protein L29
889 CAJPOK010000005.1 GCA905372255_00447 CDS open 2118-2375 _na     85_aa rpsQ 30S ribosomal protein S17
890 CAJPOK010000005.1 GCA905372255_00448 CDS open 2378-2743 _na     121_aa rplN 50S ribosomal protein L14
891 CAJPOK010000005.1 GCA905372255_00449 CDS open 2764-3081 _na     105_aa rplX 50S ribosomal protein L24
892 CAJPOK010000005.1 GCA905372255_00450 CDS open 3081-3635 _na     184_aa rplE 50S ribosomal protein L5
893 CAJPOK010000005.1 GCA905372255_00451 CDS open 3641-3943 _na     100_aa rpsN 30S ribosomal protein S14
894 CAJPOK010000005.1 GCA905372255_00452 CDS open 4051-4446 _na     131_aa rpsH 30S ribosomal protein S8
895 CAJPOK010000005.1 GCA905372255_00453 CDS open 4461-5027 _na     188_aa rplF 50S ribosomal protein L6
896 CAJPOK010000005.1 GCA905372255_00454 CDS open 5049-5393 _na     114_aa rplR 50S ribosomal protein L18
897 CAJPOK010000005.1 GCA905372255_00455 CDS open 5400-5912 _na     170_aa rpsE 30S ribosomal protein S5
898 CAJPOK010000005.1 GCA905372255_00456 CDS open 5931-6107 _na     58_aa rpmD 50S ribosomal protein L30
899 CAJPOK010000005.1 GCA905372255_00457 CDS open 6133-6579 _na     148_aa rplO 50S ribosomal protein L15
900 CAJPOK010000005.1 GCA905372255_00458 CDS open 6584-7924 _na     446_aa secY preprotein translocase subunit SecY
901 CAJPOK010000005.1 GCA905372255_00459 CDS open 8122-8340 _na     72_aa infA translation initiation factor IF-1
902 CAJPOK010000005.1 GCA905372255_00460 CDS open 8354-8470 _na     38_aa ykgO type B 50S ribosomal protein L36
903 CAJPOK010000005.1 GCA905372255_00461 CDS open 8565-8945 _na     126_aa rpsM 30S ribosomal protein S13
904 CAJPOK010000005.1 GCA905372255_00462 CDS open 9029-9418 _na     129_aa rpsK 30S ribosomal protein S11
905 CAJPOK010000005.1 GCA905372255_00463 CDS open 9457-10065 _na     202_aa rpsD 30S ribosomal protein S4
906 CAJPOK010000005.1 GCA905372255_00464 CDS open 10080-11078 _na     332_aa rpoA DNA-directed RNA polymerase subunit alpha
907 CAJPOK010000005.1 GCA905372255_00465 CDS open 11151-11618 _na     155_aa rplQ 50S ribosomal protein L17
908 CAJPOK010000005.1 GCA905372255_00466 CDS open 11903-12442 _na     179_aa Outer membrane protein beta-barrel domain-containing protein
909 CAJPOK010000005.1 GCA905372255_00467 CDS open 12590-14011 _na     473_aa cls cardiolipin synthase
910 CAJPOK010000005.1 GCA905372255_00468 CDS open 14050-15981 _na     643_aa DNA primase
911 CAJPOK010000005.1 GCA905372255_00469 CDS open 16617-17366 _na     249_aa DUF4468 domain-containing protein
912 CAJPOK010000005.1 GCA905372255_00470 CDS open 17781-18641 _na     286_aa dinD DNA damage-inducible protein D
913 CAJPOK010000005.1 GCA905372255_00471 CDS open 18993-20972 _na     659_aa Cell surface protein
914 CAJPOK010000005.1 GCA905372255_00472 CDS open 21018-22457 _na     479_aa Alpha/beta hydrolase
915 CAJPOK010000005.1 GCA905372255_00473 CDS open 22781-24682 _na     633_aa dnaK molecular chaperone DnaK
916 CAJPOK010000005.1 GCA905372255_00474 CDS open 24749-25555 _na     268_aa DUF2157 domain-containing protein
917 CAJPOK010000005.1 GCA905372255_00475 CDS open 25552-26010 _na     152_aa DUF6078 domain-containing protein
918 CAJPOK010000005.1 GCA905372255_00476 CDS open 26192-26938 _na     248_aa hypothetical protein
919 CAJPOK010000005.1 GCA905372255_00477 CDS open 27171-27668 _na     165_aa IS982 family transposase
920 CAJPOK010000005.1 GCA905372255_00478 CDS open 27680-27889 _na     69_aa Transposase
921 CAJPOK010000005.1 GCA905372255_00479 CDS open 28018-29100 _na     360_aa hypothetical protein
922 CAJPOK010000005.1 GCA905372255_00480 CDS open 29389-29556 _na     55_aa Ferredoxin
923 CAJPOK010000005.1 GCA905372255_00481 CDS open 29789-30535 _na     248_aa porT PorT family protein
924 CAJPOK010000005.1 GCA905372255_00482 CDS open 30601-31440 _na     279_aa Calcineurin-like phosphoesterase domain-containing protein
925 CAJPOK010000005.1 GCA905372255_00483 CDS open 31478-32275 _na     265_aa 5'-Nucleotidase C-terminal domain-containing protein
926 CAJPOK010000005.1 GCA905372255_00484 CDS open 32532-32900 _na     122_aa rplS 50S ribosomal protein L19
927 CAJPOK010000005.1 GCA905372255_00485 CDS open 32993-33292 _na     99_aa Transposase
928 CAJPOK010000005.1 GCA905372255_00486 CDS open 33398-34297 _na     299_aa diaminopimelate dehydrogenase
929 CAJPOK010000005.1 GCA905372255_00487 CDS open 34819-35724 _na     301_aa araC putative AraC family transcriptional regulator
930 CAJPOK010000005.1 GCA905372255_00488 CDS open 35937-37175 _na     412_aa Outer membrane efflux protein
931 CAJPOK010000005.1 GCA905372255_00489 CDS open 37193-38209 _na     338_aa hlyD HlyD family secretion protein
932 CAJPOK010000005.1 GCA905372255_00490 CDS open 38225-39691 _na     488_aa lptB LPS export ABC transporter ATP-binding protein
933 CAJPOK010000005.1 GCA905372255_00491 CDS open 39723-40781 _na     352_aa Transport permease protein
934 CAJPOK010000005.1 GCA905372255_00492 CDS open 40788-41873 _na     361_aa Putative ABC transporter permease protein
935 CAJPOK010000005.1 GCA905372255_00493 CDS open 42207-44873 _na     888_aa alaS alanine--tRNA ligase
936 CAJPOK010000005.1 GCA905372255_00494 CDS open 44964-45302 _na     112_aa HTH merR-type domain-containing protein
937 CAJPOK010000005.1 GCA905372255_00495 CDS open 45406-46239 _na     277_aa pgeF peptidoglycan editing factor PgeF
938 CAJPOK010000005.1 GCA905372255_00496 CDS open 46211-47383 _na     390_aa obgE GTPase ObgE
939 CAJPOK010000005.1 GCA905372255_00497 CDS open 47524-48096 _na     190_aa adk adenylate kinase
940 CAJPOK010000005.1 GCA905372255_00498 CDS open 48096-48635 _na     179_aa hpt hypoxanthine phosphoribosyltransferase
941 CAJPOK010000005.1 GCA905372255_00499 CDS open 48727-50244 _na     505_aa Bifunctional NAD(P)H-hydrate repair enzyme
942 CAJPOK010000005.1 GCA905372255_00500 CDS open 50830-51843 _na     337_aa class II fructose-bisphosphate aldolase
943 CAJPOK010000005.1 GCA905372255_00501 CDS open 51950-52948 _na     332_aa sialate O-acetylesterase
944 CAJPOK010000005.1 GCA905372255_00502 CDS open 53104-54852 _na     582_aa GH25 family lysozyme
945 CAJPOK010000005.1 GCA905372255_00503 CDS open 55166-55708 _na     180_aa DUF1836 domain-containing protein
946 CAJPOK010000005.1 GCA905372255_00504 CDS open 55794-56816 _na     340_aa recA recombinase RecA
947 CAJPOK010000005.1 GCA905372255_00505 CDS open 57027-57347 _na     106_aa tfoX TfoX N-terminal domain-containing protein
948 CAJPOK010000005.1 GCA905372255_00506 CDS open 57385-58623 _na     412_aa Saccharopine dehydrogenase
949 CAJPOK010000005.1 GCA905372255_00507 CDS open 58637-59257 _na     206_aa L-selectin
950 CAJPOK010000005.1 GCA905372255_00508 CDS open 59745-60770 _na     341_aa Porin
951 CAJPOK010000005.1 GCA905372255_00509 CDS open 60897-61865 _na     322_aa DUF2179 domain-containing protein
952 CAJPOK010000005.1 GCA905372255_00510 CDS open 62480-63340 _na     286_aa Enoyl-[acyl-carrier-protein] reductase [NADH]
953 CAJPOK010000005.1 GCA905372255_00511 CDS open 63694-64152 _na     152_aa DUF6078 domain-containing protein
954 CAJPOK010000005.1 GCA905372255_00512 CDS open 64276-64629 _na     117_aa hypothetical protein
955 CAJPOK010000005.1 GCA905372255_00513 CDS open 64748-65998 _na     416_aa Phosphoglycerate kinase
956 CAJPOK010000005.1 GCA905372255_00514 CDS open 66119-66772 _na     217_aa queC 7-cyano-7-deazaguanine synthase QueC
957 CAJPOK010000005.1 GCA905372255_00515 CDS open 66900-67826 _na     308_aa DUF2179 domain-containing protein
958 CAJPOK010000005.1 GCA905372255_00516 CDS open 67836-68966 _na     376_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
959 CAJPOK010000005.1 GCA905372255_00517 CDS open 69211-70596 _na     461_aa Aminopeptidase
960 CAJPOK010000005.1 GCA905372255_00518 CDS open 71232-72884 _na     550_aa YARHG domain-containing protein
961 CAJPOK010000005.1 GCA905372255_00519 CDS open 73009-73674 _na     221_aa SprT-like domain-containing protein
962 CAJPOK010000005.1 GCA905372255_00520 CDS open 73674-75095 _na     473_aa ATP-dependent endonuclease
963 CAJPOK010000005.1 GCA905372255_00521 CDS open 75262-76074 _na     270_aa DUF3822 domain-containing protein
964 CAJPOK010000005.1 GCA905372255_00522 CDS open 76097-76627 _na     176_aa Putative methyltransferase
965 CAJPOK010000005.1 GCA905372255_00523 CDS open 76936-77538 _na     200_aa Viral histone-like protein
966 CAJPOK010000005.1 GCA905372255_00524 CDS open 77659-78276 _na     205_aa ruvA Holliday junction branch migration protein RuvA
967 CAJPOK010000005.1 GCA905372255_00525 CDS open 78386-85963 _na     2525_aa sprA cell surface protein SprA
968 CAJPOK010000005.1 GCA905372255_00526 CDS open 86108-86629 _na     173_aa Membrane protein%2C putative
969 CAJPOK010000005.1 GCA905372255_00527 CDS open 87229-87759 _na     176_aa T9SS C-terminal target domain-containing protein
970 CAJPOK010000005.1 GCA905372255_00528 CDS open 87861-88742 _na     293_aa Sulfatase-modifying factor enzyme domain-containing protein
971 CAJPOK010000005.1 GCA905372255_00529 CDS open 88958-90349 _na     463_aa Asparagine--tRNA ligase
972 CAJPOK010000005.1 GCA905372255_00530 CDS open 90430-91935 _na     501_aa Pseudouridine synthase
973 CAJPOK010000005.1 GCA905372255_00531 CDS open 92062-93408 _na     448_aa purB adenylosuccinate lyase
974 CAJPOK010000005.1 GCA905372255_00442 gene open 15-281 rpsS
975 CAJPOK010000005.1 GCA905372255_00443 gene open 313-723 rplV
976 CAJPOK010000005.1 GCA905372255_00444 gene open 732-1463 rpsC
977 CAJPOK010000005.1 GCA905372255_00445 gene open 1478-1906 rplP
978 CAJPOK010000005.1 GCA905372255_00446 gene open 1912-2106 rpmC
979 CAJPOK010000005.1 GCA905372255_00447 gene open 2118-2375 rpsQ
980 CAJPOK010000005.1 GCA905372255_00448 gene open 2378-2743 rplN
981 CAJPOK010000005.1 GCA905372255_00449 gene open 2764-3081 rplX
982 CAJPOK010000005.1 GCA905372255_00450 gene open 3081-3635 rplE
983 CAJPOK010000005.1 GCA905372255_00451 gene open 3641-3943 rpsN
984 CAJPOK010000005.1 GCA905372255_00452 gene open 4051-4446 rpsH
985 CAJPOK010000005.1 GCA905372255_00453 gene open 4461-5027 rplF
986 CAJPOK010000005.1 GCA905372255_00454 gene open 5049-5393 rplR
987 CAJPOK010000005.1 GCA905372255_00455 gene open 5400-5912 rpsE
988 CAJPOK010000005.1 GCA905372255_00456 gene open 5931-6107 rpmD
989 CAJPOK010000005.1 GCA905372255_00457 gene open 6133-6579 rplO
990 CAJPOK010000005.1 GCA905372255_00458 gene open 6584-7924 secY
991 CAJPOK010000005.1 GCA905372255_00459 gene open 8122-8340 infA
992 CAJPOK010000005.1 GCA905372255_00460 gene open 8354-8470 ykgO
993 CAJPOK010000005.1 GCA905372255_00461 gene open 8565-8945 rpsM
994 CAJPOK010000005.1 GCA905372255_00462 gene open 9029-9418 rpsK
995 CAJPOK010000005.1 GCA905372255_00463 gene open 9457-10065 rpsD
996 CAJPOK010000005.1 GCA905372255_00464 gene open 10080-11078 rpoA
997 CAJPOK010000005.1 GCA905372255_00465 gene open 11151-11618 rplQ
998 CAJPOK010000005.1 GCA905372255_00466 gene open 11903-12442
999 CAJPOK010000005.1 GCA905372255_00467 gene open 12590-14011 cls
1000 CAJPOK010000005.1 GCA905372255_00468 gene open 14050-15981