HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas pasteri (GCA_905372325.1)

Select a Genome:
BAKTA Annotations for GCA_905372325.1
Genome Selected: Porphyromonas pasteri
ContigsBases CDSrRNA tmRNAtRNA
157 2168486 1674 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3453 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3453 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPOX010000006.1 GCA905372325_00240 gene open 21076-22758
502 CAJPOX010000006.1 GCA905372325_00241 gene open 22745-23695
503 CAJPOX010000006.1 GCA905372325_00242 gene open 23733-24872 nspC
504 CAJPOX010000006.1 GCA905372325_00243 gene open 25341-27554
505 CAJPOX010000006.1 GCA905372325_00244 gene open 27867-27959
506 CAJPOX010000006.1 GCA905372325_00245 gene open 28066-28557
507 CAJPOX010000006.1 GCA905372325_00246 gene open 28563-29441 ftsX
508 CAJPOX010000006.1 GCA905372325_00247 gene open 29484-29729
509 CAJPOX010000006.1 GCA905372325_00248 gene open 29729-30562 uppP
510 CAJPOX010000006.1 GCA905372325_00249 gene open 30566-31297 truB
511 CAJPOX010000006.1 GCA905372325_00250 gene open 31315-32376 queA
512 CAJPOX010000006.1 GCA905372325_00251 gene open 32394-32870 folK
513 CAJPOX010000006.1 GCA905372325_00252 gene open 32892-34715 cbiD
514 CAJPOX010000006.1 GCA905372325_00253 gene open 34728-35087
515 CAJPOX010000006.1 GCA905372325_00254 gene open 35097-36101 cbiB
516 CAJPOX010000006.1 GCA905372325_00255 gene open 36122-37036
517 CAJPOX010000006.1 GCA905372325_00256 gene open 37164-38513
518 CAJPOX010000006.1 GCA905372325_00257 gene open 38534-41080
519 CAJPOX010000006.1 GCA905372325_00258 gene open 41553-43460 dnaK
520 CAJPOX010000006.1 GCA905372325_00259 gene open 43839-44429
521 CAJPOX010000006.1 GCA905372325_00260 gene open 44598-45968
522 CAJPOX010000006.1 GCA905372325_00261 gene open 46027-46587
523 CAJPOX010000007.1 repeat_region open 25318-29470 CRISPR array with 62 repeats of length 33%2C consensus sequence GTTTCAATTCACGCACCCCGGGAGGGGTGCGAC and spacer length 34
524 CAJPOX010000007.1 GCA905372325_00262 CDS open 270-2543 _na     757_aa Putative alpha-1%2C2-mannosidase
525 CAJPOX010000007.1 GCA905372325_00263 CDS open 2627-4174 _na     515_aa Transglycosylase SLT domain protein
526 CAJPOX010000007.1 GCA905372325_00264 CDS open 4199-5470 _na     423_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
527 CAJPOX010000007.1 GCA905372325_00265 CDS open 5742-7136 _na     464_aa glmM phosphoglucosamine mutase
528 CAJPOX010000007.1 GCA905372325_00266 CDS open 7155-7787 _na     210_aa DUF4827 domain-containing protein
529 CAJPOX010000007.1 GCA905372325_00267 CDS open 7825-8865 _na     346_aa Signal peptide protein%2C YSIRK family
530 CAJPOX010000007.1 GCA905372325_00268 CDS open 8964-9902 _na     312_aa Peptidase%2C M48 family
531 CAJPOX010000007.1 GCA905372325_00269 CDS open 9945-11102 _na     385_aa Bacterial capsule synthesis protein
532 CAJPOX010000007.1 GCA905372325_00270 CDS open 11105-12058 _na     317_aa rsgA ribosome small subunit-dependent GTPase A
533 CAJPOX010000007.1 GCA905372325_00271 CDS open 12095-12658 _na     187_aa frr ribosome recycling factor
534 CAJPOX010000007.1 GCA905372325_00272 CDS open 12700-13410 _na     236_aa pyrH UMP kinase
535 CAJPOX010000007.1 GCA905372325_00273 CDS open 13761-14387 _na     208_aa DUF4230 domain-containing protein
536 CAJPOX010000007.1 GCA905372325_00274 CDS open 14384-15025 _na     213_aa DUF4230 domain-containing protein
537 CAJPOX010000007.1 GCA905372325_00275 CDS open 15009-16940 _na     643_aa abc-f ribosomal protection-like ABC-F family protein
538 CAJPOX010000007.1 GCA905372325_00276 CDS open 17381-17989 _na     202_aa DUF5063 domain-containing protein
539 CAJPOX010000007.1 GCA905372325_00277 CDS open 18192-18689 _na     165_aa 3'-5' exonuclease
540 CAJPOX010000007.1 GCA905372325_00278 CDS open 18690-19919 _na     409_aa Putative 23S rRNA methyltransferase
541 CAJPOX010000007.1 GCA905372325_00279 CDS open 19964-20617 _na     217_aa upp uracil phosphoribosyltransferase
542 CAJPOX010000007.1 GCA905372325_00280 CDS open 20601-22040 _na     479_aa SGNH hydrolase-type esterase domain-containing protein
543 CAJPOX010000007.1 GCA905372325_00281 CDS open 22024-23265 _na     413_aa GDSL-like protein
544 CAJPOX010000007.1 GCA905372325_00282 CDS open 23280-24803 _na     507_aa algI Alginate O-acetyltransferase AlgI family protein
545 CAJPOX010000007.1 GCA905372325_00283 CDS open 29720-30010 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
546 CAJPOX010000007.1 GCA905372325_00284 CDS open 30018-31046 _na     342_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
547 CAJPOX010000007.1 GCA905372325_00285 CDS open 31324-31992 _na     222_aa cas4 CRISPR-associated protein Cas4
548 CAJPOX010000007.1 GCA905372325_00286 CDS open 31999-32862 _na     287_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
549 CAJPOX010000007.1 GCA905372325_00287 CDS open 32886-34814 _na     642_aa Type I-C CRISPR-associated protein Cas8c/Csd1
550 CAJPOX010000007.1 GCA905372325_00288 CDS open 34811-35500 _na     229_aa cas5c type I-C CRISPR-associated protein Cas5c
551 CAJPOX010000007.1 GCA905372325_00289 CDS open 35531-37867 _na     778_aa CRISPR-associated helicase Cas3'
552 CAJPOX010000007.1 GCA905372325_00290 CDS open 38715-39833 _na     372_aa AAA domain-containing protein
553 CAJPOX010000007.1 GCA905372325_00291 CDS open 39872-40537 _na     221_aa Outer membrane protein beta-barrel domain-containing protein
554 CAJPOX010000007.1 GCA905372325_00292 CDS open 40629-42311 _na     560_aa Hemerythrin HHE cation binding domain protein
555 CAJPOX010000007.1 GCA905372325_00293 CDS open 42326-42607 _na     93_aa Cupin domain protein
556 CAJPOX010000007.1 GCA905372325_00294 CDS open 42859-43785 _na     308_aa DUF3078 domain-containing protein
557 CAJPOX010000007.1 GCA905372325_00262 gene open 270-2543
558 CAJPOX010000007.1 GCA905372325_00263 gene open 2627-4174
559 CAJPOX010000007.1 GCA905372325_00264 gene open 4199-5470 rlmD
560 CAJPOX010000007.1 GCA905372325_00265 gene open 5742-7136 glmM
561 CAJPOX010000007.1 GCA905372325_00266 gene open 7155-7787
562 CAJPOX010000007.1 GCA905372325_00267 gene open 7825-8865
563 CAJPOX010000007.1 GCA905372325_00268 gene open 8964-9902
564 CAJPOX010000007.1 GCA905372325_00269 gene open 9945-11102
565 CAJPOX010000007.1 GCA905372325_00270 gene open 11105-12058 rsgA
566 CAJPOX010000007.1 GCA905372325_00271 gene open 12095-12658 frr
567 CAJPOX010000007.1 GCA905372325_00272 gene open 12700-13410 pyrH
568 CAJPOX010000007.1 GCA905372325_00273 gene open 13761-14387
569 CAJPOX010000007.1 GCA905372325_00274 gene open 14384-15025
570 CAJPOX010000007.1 GCA905372325_00275 gene open 15009-16940 abc-f
571 CAJPOX010000007.1 GCA905372325_00276 gene open 17381-17989
572 CAJPOX010000007.1 GCA905372325_00277 gene open 18192-18689
573 CAJPOX010000007.1 GCA905372325_00278 gene open 18690-19919
574 CAJPOX010000007.1 GCA905372325_00279 gene open 19964-20617 upp
575 CAJPOX010000007.1 GCA905372325_00280 gene open 20601-22040
576 CAJPOX010000007.1 GCA905372325_00281 gene open 22024-23265
577 CAJPOX010000007.1 GCA905372325_00282 gene open 23280-24803 algI
578 CAJPOX010000007.1 GCA905372325_00283 gene open 29720-30010 cas2
579 CAJPOX010000007.1 GCA905372325_00284 gene open 30018-31046 cas1c
580 CAJPOX010000007.1 GCA905372325_00285 gene open 31324-31992 cas4
581 CAJPOX010000007.1 GCA905372325_00286 gene open 31999-32862 cas7c
582 CAJPOX010000007.1 GCA905372325_00287 gene open 32886-34814
583 CAJPOX010000007.1 GCA905372325_00288 gene open 34811-35500 cas5c
584 CAJPOX010000007.1 GCA905372325_00289 gene open 35531-37867
585 CAJPOX010000007.1 GCA905372325_00290 gene open 38715-39833
586 CAJPOX010000007.1 GCA905372325_00291 gene open 39872-40537
587 CAJPOX010000007.1 GCA905372325_00292 gene open 40629-42311
588 CAJPOX010000007.1 GCA905372325_00293 gene open 42326-42607
589 CAJPOX010000007.1 GCA905372325_00294 gene open 42859-43785
590 CAJPOX010000008.1 regulatory_region open 41357-41625 Cobalamin riboswitch aptamer
591 CAJPOX010000008.1 GCA905372325_00295 CDS open 43-270 _na     75_aa hypothetical protein
592 CAJPOX010000008.1 GCA905372325_00296 CDS open 366-1253 _na     295_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
593 CAJPOX010000008.1 GCA905372325_00297 CDS open 1255-2598 _na     447_aa Aspartokinase
594 CAJPOX010000008.1 GCA905372325_00298 CDS open 2667-3329 _na     220_aa ftsE Putative cell division ATP-binding protein FtsE
595 CAJPOX010000008.1 GCA905372325_00300 CDS open 3938-4309 _na     123_aa folB dihydroneopterin aldolase
596 CAJPOX010000008.1 GCA905372325_00301 CDS open 4334-5257 _na     307_aa Cation diffusion facilitator family transporter
597 CAJPOX010000008.1 GCA905372325_00302 CDS open 5247-6659 _na     470_aa hemG protoporphyrinogen oxidase
598 CAJPOX010000008.1 GCA905372325_00303 CDS open 6896-7969 _na     357_aa BACON domain-containing protein
599 CAJPOX010000008.1 GCA905372325_00304 CDS open 8017-9309 _na     430_aa DUF4987 domain-containing protein
600 CAJPOX010000008.1 GCA905372325_00305 CDS open 9312-10193 _na     293_aa Substrate import-associated zinc metallohydrolase lipoprotein
601 CAJPOX010000008.1 GCA905372325_00306 CDS open 10212-11789 _na     525_aa SusD-like N-terminal domain-containing protein
602 CAJPOX010000008.1 GCA905372325_00307 CDS open 11803-15114 _na     1103_aa TonB-dependent receptor plug domain protein
603 CAJPOX010000008.1 GCA905372325_00308 CDS open 15408-15554 _na     48_aa hypothetical protein
604 CAJPOX010000008.1 GCA905372325_00309 CDS open 15786-16511 _na     241_aa thiF ThiF family protein
605 CAJPOX010000008.1 GCA905372325_00310 CDS open 16545-17663 _na     372_aa thiH 2-iminoacetate synthase ThiH
606 CAJPOX010000008.1 GCA905372325_00311 CDS open 17660-18436 _na     258_aa Thiazole synthase
607 CAJPOX010000008.1 GCA905372325_00312 CDS open 18451-20385 _na     644_aa Thiamine-phosphate synthase
608 CAJPOX010000008.1 GCA905372325_00313 CDS open 20391-22202 _na     603_aa thiC phosphomethylpyrimidine synthase ThiC
609 CAJPOX010000008.1 GCA905372325_00314 CDS open 22242-22445 _na     67_aa thiS Thiamine biosynthesis protein ThiS
610 CAJPOX010000008.1 GCA905372325_00315 CDS open 23148-24359 _na     403_aa DNA/RNA non-specific endonuclease
611 CAJPOX010000008.1 GCA905372325_00316 CDS open 24372-26126 _na     584_aa LTD domain-containing protein
612 CAJPOX010000008.1 GCA905372325_00317 CDS open 26172-26987 _na     271_aa DUF5689 domain-containing protein
613 CAJPOX010000008.1 GCA905372325_00318 CDS open 27012-29786 _na     924_aa TonB-dependent receptor
614 CAJPOX010000008.1 GCA905372325_00319 CDS open 30010-31056 _na     348_aa Endonuclease/exonuclease/phosphatase family protein
615 CAJPOX010000008.1 GCA905372325_00320 CDS open 31139-32335 _na     398_aa PD-(D/E)XK nuclease family protein
616 CAJPOX010000008.1 GCA905372325_00321 CDS open 32523-33023 _na     166_aa HU family DNA-binding protein
617 CAJPOX010000008.1 GCA905372325_00322 CDS open 33129-33878 _na     249_aa comF ComF family protein
618 CAJPOX010000008.1 GCA905372325_00323 CDS open 33820-34326 _na     168_aa recX Regulatory protein RecX
619 CAJPOX010000008.1 GCA905372325_00324 CDS open 34323-35225 _na     300_aa peptide chain release factor N(5)-glutamine methyltransferase
620 CAJPOX010000008.1 GCA905372325_00325 CDS open 35270-36253 _na     327_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
621 CAJPOX010000008.1 GCA905372325_00326 CDS open 36958-38142 _na     394_aa Putative cytochrome d ubiquinol oxidase%2C subunit II
622 CAJPOX010000008.1 GCA905372325_00327 CDS open 38185-39765 _na     526_aa Bacterial cytochrome ubiquinol oxidase
623 CAJPOX010000008.1 GCA905372325_00328 CDS open 39819-40082 _na     87_aa DUF4492 domain-containing protein
624 CAJPOX010000008.1 GCA905372325_00330 CDS open 41238-41372 _na     44_aa hypothetical protein
625 CAJPOX010000008.1 GCA905372325_00295 gene open 43-270
626 CAJPOX010000008.1 GCA905372325_00296 gene open 366-1253 menA
627 CAJPOX010000008.1 GCA905372325_00297 gene open 1255-2598
628 CAJPOX010000008.1 GCA905372325_00298 gene open 2667-3329 ftsE
629 CAJPOX010000008.1 GCA905372325_00300 gene open 3938-4309 folB
630 CAJPOX010000008.1 GCA905372325_00301 gene open 4334-5257
631 CAJPOX010000008.1 GCA905372325_00302 gene open 5247-6659 hemG
632 CAJPOX010000008.1 GCA905372325_00303 gene open 6896-7969
633 CAJPOX010000008.1 GCA905372325_00304 gene open 8017-9309
634 CAJPOX010000008.1 GCA905372325_00305 gene open 9312-10193
635 CAJPOX010000008.1 GCA905372325_00306 gene open 10212-11789
636 CAJPOX010000008.1 GCA905372325_00307 gene open 11803-15114
637 CAJPOX010000008.1 GCA905372325_00308 gene open 15408-15554
638 CAJPOX010000008.1 GCA905372325_00309 gene open 15786-16511 thiF
639 CAJPOX010000008.1 GCA905372325_00310 gene open 16545-17663 thiH
640 CAJPOX010000008.1 GCA905372325_00311 gene open 17660-18436
641 CAJPOX010000008.1 GCA905372325_00312 gene open 18451-20385
642 CAJPOX010000008.1 GCA905372325_00313 gene open 20391-22202 thiC
643 CAJPOX010000008.1 GCA905372325_00314 gene open 22242-22445 thiS
644 CAJPOX010000008.1 GCA905372325_00315 gene open 23148-24359
645 CAJPOX010000008.1 GCA905372325_00316 gene open 24372-26126
646 CAJPOX010000008.1 GCA905372325_00317 gene open 26172-26987
647 CAJPOX010000008.1 GCA905372325_00318 gene open 27012-29786
648 CAJPOX010000008.1 GCA905372325_00319 gene open 30010-31056
649 CAJPOX010000008.1 GCA905372325_00320 gene open 31139-32335
650 CAJPOX010000008.1 GCA905372325_00321 gene open 32523-33023
651 CAJPOX010000008.1 GCA905372325_00322 gene open 33129-33878 comF
652 CAJPOX010000008.1 GCA905372325_00323 gene open 33820-34326 recX
653 CAJPOX010000008.1 GCA905372325_00324 gene open 34323-35225
654 CAJPOX010000008.1 GCA905372325_00325 gene open 35270-36253 ribD
655 CAJPOX010000008.1 GCA905372325_00326 gene open 36958-38142
656 CAJPOX010000008.1 GCA905372325_00327 gene open 38185-39765
657 CAJPOX010000008.1 GCA905372325_00328 gene open 39819-40082
658 CAJPOX010000008.1 GCA905372325_00330 gene open 41238-41372
659 CAJPOX010000008.1 GCA905372325_00299 gene open 3730-3803 trnM
660 CAJPOX010000008.1 GCA905372325_00329 gene open 40447-40529 trnL
661 CAJPOX010000008.1 GCA905372325_00299 tRNA open 3730-3803 trnM tRNA-Met(cat)
662 CAJPOX010000008.1 GCA905372325_00329 tRNA open 40447-40529 trnL tRNA-Leu(taa)
663 CAJPOX010000009.1 GCA905372325_00331 CDS open 13-3438 _na     1141_aa mfd transcription-repair coupling factor
664 CAJPOX010000009.1 GCA905372325_00332 CDS open 3469-3981 _na     170_aa Adenosylcobinamide kinase
665 CAJPOX010000009.1 GCA905372325_00333 CDS open 4008-5060 _na     350_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
666 CAJPOX010000009.1 GCA905372325_00334 CDS open 5129-6637 _na     502_aa lysM LysM domain protein
667 CAJPOX010000009.1 GCA905372325_00335 CDS open 6624-7307 _na     227_aa Outer membrane protein beta-barrel domain-containing protein
668 CAJPOX010000009.1 GCA905372325_00337 CDS open 8066-8953 _na     295_aa dinD DNA damage-inducible protein D
669 CAJPOX010000009.1 GCA905372325_00339 CDS open 9633-11642 _na     669_aa DNA topoisomerase
670 CAJPOX010000009.1 GCA905372325_00340 CDS open 11821-14667 _na     948_aa Peptidase M16 inactive domain protein
671 CAJPOX010000009.1 GCA905372325_00341 CDS open 14664-15560 _na     298_aa chaN Haem-binding uptake Tiki superfamily ChaN domain-containing protein
672 CAJPOX010000009.1 GCA905372325_00342 CDS open 15582-16112 _na     176_aa DNA polymerase III%2C epsilon subunit domain protein
673 CAJPOX010000009.1 GCA905372325_00343 CDS open 16416-17477 _na     353_aa yeiH YeiH family sulfate export transporter
674 CAJPOX010000009.1 GCA905372325_00344 CDS open 17736-18563 _na     275_aa O-methyltransferase
675 CAJPOX010000009.1 GCA905372325_00345 CDS open 18748-19917 _na     389_aa nagA N-acetylglucosamine-6-phosphate deacetylase
676 CAJPOX010000009.1 GCA905372325_00346 CDS open 19917-20522 _na     201_aa dTTP/UTP pyrophosphatase
677 CAJPOX010000009.1 GCA905372325_00347 CDS open 20536-21057 _na     173_aa yrbI 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family
678 CAJPOX010000009.1 GCA905372325_00348 CDS open 21228-21611 _na     127_aa DUF1573 domain-containing protein
679 CAJPOX010000009.1 GCA905372325_00349 CDS open 21694-22407 _na     237_aa porT PorT family protein
680 CAJPOX010000009.1 GCA905372325_00350 CDS open 22452-23033 _na     193_aa Sigma-70 region 2
681 CAJPOX010000009.1 GCA905372325_00351 CDS open 23600-24544 _na     314_aa Putative membrane protein
682 CAJPOX010000009.1 GCA905372325_00353 CDS open 25156-27537 _na     793_aa TonB-dependent receptor plug domain protein
683 CAJPOX010000009.1 GCA905372325_00354 CDS open 27870-28046 _na     58_aa hypothetical protein
684 CAJPOX010000009.1 GCA905372325_00355 CDS open 28151-28702 _na     183_aa DUF4410 domain-containing protein
685 CAJPOX010000009.1 GCA905372325_00356 CDS open 29462-29992 _na     176_aa nrfH cytochrome c nitrite reductase small subunit
686 CAJPOX010000009.1 GCA905372325_00357 CDS open 30100-31536 _na     478_aa nrfA ammonia-forming cytochrome c nitrite reductase
687 CAJPOX010000009.1 GCA905372325_00358 CDS open 31646-32878 _na     410_aa ResB-like domain-containing protein
688 CAJPOX010000009.1 GCA905372325_00359 CDS open 33203-33790 _na     195_aa cytochrome c biogenesis protein
689 CAJPOX010000009.1 GCA905372325_00360 CDS open 33890-34600 _na     236_aa hypothetical protein
690 CAJPOX010000009.1 GCA905372325_00361 CDS open 34985-36574 _na     529_aa Na+/H+ antiporter
691 CAJPOX010000009.1 GCA905372325_00362 CDS open 36840-38096 _na     418_aa Cyclically-permuted mutarotase family protein
692 CAJPOX010000009.1 GCA905372325_00331 gene open 13-3438 mfd
693 CAJPOX010000009.1 GCA905372325_00332 gene open 3469-3981
694 CAJPOX010000009.1 GCA905372325_00333 gene open 4008-5060 cobT
695 CAJPOX010000009.1 GCA905372325_00334 gene open 5129-6637 lysM
696 CAJPOX010000009.1 GCA905372325_00335 gene open 6624-7307
697 CAJPOX010000009.1 GCA905372325_00337 gene open 8066-8953 dinD
698 CAJPOX010000009.1 GCA905372325_00339 gene open 9633-11642
699 CAJPOX010000009.1 GCA905372325_00340 gene open 11821-14667
700 CAJPOX010000009.1 GCA905372325_00341 gene open 14664-15560 chaN
701 CAJPOX010000009.1 GCA905372325_00342 gene open 15582-16112
702 CAJPOX010000009.1 GCA905372325_00343 gene open 16416-17477 yeiH
703 CAJPOX010000009.1 GCA905372325_00344 gene open 17736-18563
704 CAJPOX010000009.1 GCA905372325_00345 gene open 18748-19917 nagA
705 CAJPOX010000009.1 GCA905372325_00346 gene open 19917-20522
706 CAJPOX010000009.1 GCA905372325_00347 gene open 20536-21057 yrbI
707 CAJPOX010000009.1 GCA905372325_00348 gene open 21228-21611
708 CAJPOX010000009.1 GCA905372325_00349 gene open 21694-22407 porT
709 CAJPOX010000009.1 GCA905372325_00350 gene open 22452-23033
710 CAJPOX010000009.1 GCA905372325_00351 gene open 23600-24544
711 CAJPOX010000009.1 GCA905372325_00353 gene open 25156-27537
712 CAJPOX010000009.1 GCA905372325_00354 gene open 27870-28046
713 CAJPOX010000009.1 GCA905372325_00355 gene open 28151-28702
714 CAJPOX010000009.1 GCA905372325_00356 gene open 29462-29992 nrfH
715 CAJPOX010000009.1 GCA905372325_00357 gene open 30100-31536 nrfA
716 CAJPOX010000009.1 GCA905372325_00358 gene open 31646-32878
717 CAJPOX010000009.1 GCA905372325_00359 gene open 33203-33790
718 CAJPOX010000009.1 GCA905372325_00360 gene open 33890-34600
719 CAJPOX010000009.1 GCA905372325_00361 gene open 34985-36574
720 CAJPOX010000009.1 GCA905372325_00362 gene open 36840-38096
721 CAJPOX010000009.1 GCA905372325_00336 gene open 7399-7470 trnR
722 CAJPOX010000009.1 GCA905372325_00338 gene open 9320-9395 trnG
723 CAJPOX010000009.1 GCA905372325_00352 gene open 24788-24872 trnS
724 CAJPOX010000009.1 GCA905372325_00336 tRNA open 7399-7470 trnR tRNA-Arg(cct)
725 CAJPOX010000009.1 GCA905372325_00338 tRNA open 9320-9395 trnG tRNA-Gly(gcc)
726 CAJPOX010000009.1 GCA905372325_00352 tRNA open 24788-24872 trnS tRNA-Ser(tga)
727 CAJPOX010000010.1 GCA905372325_00363 CDS open 291-3572 _na     1093_aa Tricorn protease-like protein
728 CAJPOX010000010.1 GCA905372325_00364 CDS open 3886-4326 _na     146_aa Transport energizing protein%2C ExbD/TolR family
729 CAJPOX010000010.1 GCA905372325_00365 CDS open 4365-4982 _na     205_aa Transport energizing protein%2C ExbD/TolR family
730 CAJPOX010000010.1 GCA905372325_00366 CDS open 5019-5495 _na     158_aa MotA/TolQ/ExbB proton channel domain-containing protein
731 CAJPOX010000010.1 GCA905372325_00367 CDS open 5522-6373 _na     283_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
732 CAJPOX010000010.1 GCA905372325_00368 CDS open 7091-9388 _na     765_aa TonB-dependent receptor
733 CAJPOX010000010.1 GCA905372325_00369 CDS open 9669-10874 _na     401_aa Outer membrane insertion signal domain protein
734 CAJPOX010000010.1 GCA905372325_00370 CDS open 10961-11695 _na     244_aa Superoxide dismutase
735 CAJPOX010000010.1 GCA905372325_00371 CDS open 11730-12170 _na     146_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
736 CAJPOX010000010.1 GCA905372325_00372 CDS open 12835-15000 _na     721_aa Major fimbrial subunit protein N-terminal domain-containing protein
737 CAJPOX010000010.1 GCA905372325_00373 CDS open 15172-15924 _na     250_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
738 CAJPOX010000010.1 GCA905372325_00374 CDS open 15973-16473 _na     166_aa hypothetical protein
739 CAJPOX010000010.1 GCA905372325_00375 CDS open 16653-17027 _na     124_aa MmcQ/YjbR family DNA-binding protein
740 CAJPOX010000010.1 GCA905372325_00376 CDS open 17066-17824 _na     252_aa Biotin-(Acetyl-CoA-carboxylase) ligase
741 CAJPOX010000010.1 GCA905372325_00377 CDS open 17790-18599 _na     269_aa trmH RNA methyltransferase%2C TrmH family
742 CAJPOX010000010.1 GCA905372325_00378 CDS open 19203-20396 _na     397_aa Lipoprotein
743 CAJPOX010000010.1 GCA905372325_00379 CDS open 20413-20988 _na     191_aa Lipoprotein
744 CAJPOX010000010.1 GCA905372325_00380 CDS open 20998-23469 _na     823_aa TonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein
745 CAJPOX010000010.1 GCA905372325_00381 CDS open 23483-25213 _na     576_aa Leucine Rich repeat-containing domain protein
746 CAJPOX010000010.1 GCA905372325_00382 CDS open 25188-26642 _na     484_aa Lipoprotein
747 CAJPOX010000010.1 GCA905372325_00383 CDS open 26639-27679 _na     346_aa Lipoprotein
748 CAJPOX010000010.1 GCA905372325_00384 CDS open 27688-29556 _na     622_aa BACON domain-containing protein
749 CAJPOX010000010.1 GCA905372325_00385 CDS open 29572-31416 _na     614_aa Bacterial group 2 Ig-like protein
750 CAJPOX010000010.1 GCA905372325_00386 CDS open 31442-31906 _na     154_aa Lipocalin-like domain-containing protein
751 CAJPOX010000010.1 GCA905372325_00387 CDS open 32318-33775 _na     485_aa Xaa-His dipeptidase
752 CAJPOX010000010.1 GCA905372325_00388 CDS open 34000-34215 _na     71_aa Secreted protein
753 CAJPOX010000010.1 GCA905372325_00389 CDS open 34276-34914 _na     212_aa Outer membrane protein
754 CAJPOX010000010.1 GCA905372325_00363 gene open 291-3572
755 CAJPOX010000010.1 GCA905372325_00364 gene open 3886-4326
756 CAJPOX010000010.1 GCA905372325_00365 gene open 4365-4982
757 CAJPOX010000010.1 GCA905372325_00366 gene open 5019-5495
758 CAJPOX010000010.1 GCA905372325_00367 gene open 5522-6373
759 CAJPOX010000010.1 GCA905372325_00368 gene open 7091-9388
760 CAJPOX010000010.1 GCA905372325_00369 gene open 9669-10874
761 CAJPOX010000010.1 GCA905372325_00370 gene open 10961-11695
762 CAJPOX010000010.1 GCA905372325_00371 gene open 11730-12170
763 CAJPOX010000010.1 GCA905372325_00372 gene open 12835-15000
764 CAJPOX010000010.1 GCA905372325_00373 gene open 15172-15924
765 CAJPOX010000010.1 GCA905372325_00374 gene open 15973-16473
766 CAJPOX010000010.1 GCA905372325_00375 gene open 16653-17027
767 CAJPOX010000010.1 GCA905372325_00376 gene open 17066-17824
768 CAJPOX010000010.1 GCA905372325_00377 gene open 17790-18599 trmH
769 CAJPOX010000010.1 GCA905372325_00378 gene open 19203-20396
770 CAJPOX010000010.1 GCA905372325_00379 gene open 20413-20988
771 CAJPOX010000010.1 GCA905372325_00380 gene open 20998-23469
772 CAJPOX010000010.1 GCA905372325_00381 gene open 23483-25213
773 CAJPOX010000010.1 GCA905372325_00382 gene open 25188-26642
774 CAJPOX010000010.1 GCA905372325_00383 gene open 26639-27679
775 CAJPOX010000010.1 GCA905372325_00384 gene open 27688-29556
776 CAJPOX010000010.1 GCA905372325_00385 gene open 29572-31416
777 CAJPOX010000010.1 GCA905372325_00386 gene open 31442-31906
778 CAJPOX010000010.1 GCA905372325_00387 gene open 32318-33775
779 CAJPOX010000010.1 GCA905372325_00388 gene open 34000-34215
780 CAJPOX010000010.1 GCA905372325_00389 gene open 34276-34914
781 CAJPOX010000011.1 regulatory_region open 21758-21960 Cobalamin riboswitch aptamer
782 CAJPOX010000011.1 GCA905372325_00390 CDS open 86-895 _na     269_aa hypothetical protein
783 CAJPOX010000011.1 GCA905372325_00391 CDS open 955-3381 _na     808_aa TonB-dependent receptor
784 CAJPOX010000011.1 GCA905372325_00392 CDS open 3496-3828 _na     110_aa Tat pathway signal sequence domain protein
785 CAJPOX010000011.1 GCA905372325_00393 CDS open 4448-4717 _na     89_aa Co-chaperonin GroES
786 CAJPOX010000011.1 GCA905372325_00394 CDS open 4758-6395 _na     545_aa groL chaperonin GroEL
787 CAJPOX010000011.1 GCA905372325_00395 CDS open 6571-7104 _na     177_aa Histidinol phosphate phosphatase
788 CAJPOX010000011.1 GCA905372325_00396 CDS open 7333-7572 _na     79_aa hypothetical protein
789 CAJPOX010000011.1 GCA905372325_00397 CDS open 8001-8138 _na     45_aa hypothetical protein
790 CAJPOX010000011.1 GCA905372325_00398 CDS open 8277-10580 _na     767_aa Helicase C-terminal domain-containing protein
791 CAJPOX010000011.1 GCA905372325_00399 CDS open 10547-11464 _na     305_aa Anti-bacteriophage protein A/HamA C-terminal domain-containing protein
792 CAJPOX010000011.1 GCA905372325_00400 CDS open 11915-12496 _na     193_aa rsxA electron transport complex subunit RsxA
793 CAJPOX010000011.1 GCA905372325_00401 CDS open 12502-13089 _na     195_aa Ion-translocating oxidoreductase complex subunit E
794 CAJPOX010000011.1 GCA905372325_00402 CDS open 13098-13730 _na     210_aa Ion-translocating oxidoreductase complex subunit G
795 CAJPOX010000011.1 GCA905372325_00403 CDS open 13735-14649 _na     304_aa Ion-translocating oxidoreductase complex subunit D
796 CAJPOX010000011.1 GCA905372325_00404 CDS open 14722-16062 _na     446_aa rsxC electron transport complex subunit RsxC
797 CAJPOX010000011.1 GCA905372325_00405 CDS open 16082-16996 _na     304_aa Fe-S cluster domain-containing protein
798 CAJPOX010000011.1 GCA905372325_00406 CDS open 17009-17452 _na     147_aa Positive regulator of sigma(E)%2C RseC/MucC
799 CAJPOX010000011.1 GCA905372325_00407 CDS open 17781-18965 _na     394_aa Cold-shock DNA-binding domain protein
800 CAJPOX010000011.1 GCA905372325_00408 CDS open 19781-20767 _na     328_aa dihydrouracil dehydrogenase (NAD(+))
801 CAJPOX010000011.1 GCA905372325_00409 CDS open 20822-21493 _na     223_aa ompA OmpA family protein
802 CAJPOX010000011.1 GCA905372325_00410 CDS open 22160-23332 _na     390_aa ABC transporter substrate-binding protein
803 CAJPOX010000011.1 GCA905372325_00411 CDS open 23398-27129 _na     1243_aa cobN Putative cobaltochelatase%2C CobN subunit
804 CAJPOX010000011.1 GCA905372325_00412 CDS open 27225-28193 _na     322_aa ATPase family protein
805 CAJPOX010000011.1 GCA905372325_00413 CDS open 28205-30076 _na     623_aa VWA domain-containing protein
806 CAJPOX010000011.1 GCA905372325_00414 CDS open 30089-31252 _na     387_aa adenosylcobinamide amidohydrolase
807 CAJPOX010000011.1 GCA905372325_00415 CDS open 31279-31512 _na     77_aa hypothetical protein
808 CAJPOX010000011.1 GCA905372325_00390 gene open 86-895
809 CAJPOX010000011.1 GCA905372325_00391 gene open 955-3381
810 CAJPOX010000011.1 GCA905372325_00392 gene open 3496-3828
811 CAJPOX010000011.1 GCA905372325_00393 gene open 4448-4717
812 CAJPOX010000011.1 GCA905372325_00394 gene open 4758-6395 groL
813 CAJPOX010000011.1 GCA905372325_00395 gene open 6571-7104
814 CAJPOX010000011.1 GCA905372325_00396 gene open 7333-7572
815 CAJPOX010000011.1 GCA905372325_00397 gene open 8001-8138
816 CAJPOX010000011.1 GCA905372325_00398 gene open 8277-10580
817 CAJPOX010000011.1 GCA905372325_00399 gene open 10547-11464
818 CAJPOX010000011.1 GCA905372325_00400 gene open 11915-12496 rsxA
819 CAJPOX010000011.1 GCA905372325_00401 gene open 12502-13089
820 CAJPOX010000011.1 GCA905372325_00402 gene open 13098-13730
821 CAJPOX010000011.1 GCA905372325_00403 gene open 13735-14649
822 CAJPOX010000011.1 GCA905372325_00404 gene open 14722-16062 rsxC
823 CAJPOX010000011.1 GCA905372325_00405 gene open 16082-16996
824 CAJPOX010000011.1 GCA905372325_00406 gene open 17009-17452
825 CAJPOX010000011.1 GCA905372325_00407 gene open 17781-18965
826 CAJPOX010000011.1 GCA905372325_00408 gene open 19781-20767
827 CAJPOX010000011.1 GCA905372325_00409 gene open 20822-21493 ompA
828 CAJPOX010000011.1 GCA905372325_00410 gene open 22160-23332
829 CAJPOX010000011.1 GCA905372325_00411 gene open 23398-27129 cobN
830 CAJPOX010000011.1 GCA905372325_00412 gene open 27225-28193
831 CAJPOX010000011.1 GCA905372325_00413 gene open 28205-30076
832 CAJPOX010000011.1 GCA905372325_00414 gene open 30089-31252
833 CAJPOX010000011.1 GCA905372325_00415 gene open 31279-31512
834 CAJPOX010000012.1 GCA905372325_00416 CDS open 45-419 _na     124_aa hypothetical protein
835 CAJPOX010000012.1 GCA905372325_00418 CDS open 1126-2352 _na     408_aa Tyr recombinase domain-containing protein
836 CAJPOX010000012.1 GCA905372325_00419 CDS open 2386-2862 _na     158_aa DUF1896 domain-containing protein
837 CAJPOX010000012.1 GCA905372325_00420 CDS open 2986-3333 _na     115_aa AI-2E family transporter
838 CAJPOX010000012.1 GCA905372325_00421 CDS open 3427-3603 _na     58_aa hypothetical protein
839 CAJPOX010000012.1 GCA905372325_00422 CDS open 3680-4111 _na     143_aa Molybdenum ABC transporter ATP-binding protein
840 CAJPOX010000012.1 GCA905372325_00423 CDS open 4118-4540 _na     140_aa PcfK-like protein
841 CAJPOX010000012.1 GCA905372325_00424 CDS open 4544-5809 _na     421_aa PcfJ-like protein
842 CAJPOX010000012.1 GCA905372325_00425 CDS open 5806-6909 _na     367_aa DUF4238 domain-containing protein
843 CAJPOX010000012.1 GCA905372325_00426 CDS open 7064-7495 _na     143_aa traQ Conjugative transposon protein TraQ
844 CAJPOX010000012.1 GCA905372325_00427 CDS open 7526-8098 _na     190_aa traO conjugal transfer protein TraO
845 CAJPOX010000012.1 GCA905372325_00428 CDS open 8103-9062 _na     319_aa traN conjugative transposon protein TraN
846 CAJPOX010000012.1 GCA905372325_00429 CDS open 9083-10315 _na     410_aa traM conjugative transposon protein TraM
847 CAJPOX010000012.1 GCA905372325_00430 CDS open 10308-10649 _na     113_aa PF13150 family protein
848 CAJPOX010000012.1 GCA905372325_00431 CDS open 10609-11232 _na     207_aa traK conjugative transposon protein TraK
849 CAJPOX010000012.1 GCA905372325_00432 CDS open 11257-12291 _na     344_aa traJ conjugative transposon protein TraJ
850 CAJPOX010000012.1 GCA905372325_00433 CDS open 12303-12848 _na     181_aa traI Conjugative transposon protein TraI
851 CAJPOX010000012.1 GCA905372325_00434 CDS open 12954-15461 _na     835_aa traG TraG family conjugative transposon ATPase
852 CAJPOX010000012.1 GCA905372325_00435 CDS open 15458-15787 _na     109_aa traF Conjugative transposon protein TraF
853 CAJPOX010000012.1 GCA905372325_00436 CDS open 15791-16093 _na     100_aa Signal peptide protein%2C YSIRK family
854 CAJPOX010000012.1 GCA905372325_00437 CDS open 16127-16837 _na     236_aa hypothetical protein
855 CAJPOX010000012.1 GCA905372325_00438 CDS open 16834-17268 _na     144_aa traC Conjugative transposon protein TraC family protein
856 CAJPOX010000012.1 GCA905372325_00439 CDS open 17255-18001 _na     248_aa traA Conjugative transposon protein TraA family protein
857 CAJPOX010000012.1 GCA905372325_00440 CDS open 18534-18914 _na     126_aa Mobilization protein
858 CAJPOX010000012.1 GCA905372325_00441 CDS open 18911-20197 _na     428_aa mobB conjugal transfer protein MobB
859 CAJPOX010000012.1 GCA905372325_00442 CDS open 20239-22242 _na     667_aa virD4 YWFCY domain-containing protein
860 CAJPOX010000012.1 GCA905372325_00443 CDS open 22232-23737 _na     501_aa SusD-like N-terminal domain-containing protein
861 CAJPOX010000012.1 GCA905372325_00444 CDS open 23752-25452 _na     566_aa Outer membrane protein beta-barrel domain-containing protein
862 CAJPOX010000012.1 GCA905372325_00445 CDS open 25457-26728 _na     423_aa PKD/Chitinase domain-containing protein
863 CAJPOX010000012.1 GCA905372325_00446 CDS open 26851-27876 _na     341_aa PQQ enzyme repeat protein
864 CAJPOX010000012.1 GCA905372325_00447 CDS open 27962-28432 _na     156_aa yezG immunity protein YezG family protein
865 CAJPOX010000012.1 GCA905372325_00448 CDS open 28434-30863 _na     809_aa hypothetical protein
866 CAJPOX010000012.1 GCA905372325_00416 gene open 45-419
867 CAJPOX010000012.1 GCA905372325_00418 gene open 1126-2352
868 CAJPOX010000012.1 GCA905372325_00419 gene open 2386-2862
869 CAJPOX010000012.1 GCA905372325_00420 gene open 2986-3333
870 CAJPOX010000012.1 GCA905372325_00421 gene open 3427-3603
871 CAJPOX010000012.1 GCA905372325_00422 gene open 3680-4111
872 CAJPOX010000012.1 GCA905372325_00423 gene open 4118-4540
873 CAJPOX010000012.1 GCA905372325_00424 gene open 4544-5809
874 CAJPOX010000012.1 GCA905372325_00425 gene open 5806-6909
875 CAJPOX010000012.1 GCA905372325_00426 gene open 7064-7495 traQ
876 CAJPOX010000012.1 GCA905372325_00427 gene open 7526-8098 traO
877 CAJPOX010000012.1 GCA905372325_00428 gene open 8103-9062 traN
878 CAJPOX010000012.1 GCA905372325_00429 gene open 9083-10315 traM
879 CAJPOX010000012.1 GCA905372325_00430 gene open 10308-10649
880 CAJPOX010000012.1 GCA905372325_00431 gene open 10609-11232 traK
881 CAJPOX010000012.1 GCA905372325_00432 gene open 11257-12291 traJ
882 CAJPOX010000012.1 GCA905372325_00433 gene open 12303-12848 traI
883 CAJPOX010000012.1 GCA905372325_00434 gene open 12954-15461 traG
884 CAJPOX010000012.1 GCA905372325_00435 gene open 15458-15787 traF
885 CAJPOX010000012.1 GCA905372325_00436 gene open 15791-16093
886 CAJPOX010000012.1 GCA905372325_00437 gene open 16127-16837
887 CAJPOX010000012.1 GCA905372325_00438 gene open 16834-17268 traC
888 CAJPOX010000012.1 GCA905372325_00439 gene open 17255-18001 traA
889 CAJPOX010000012.1 GCA905372325_00440 gene open 18534-18914
890 CAJPOX010000012.1 GCA905372325_00441 gene open 18911-20197 mobB
891 CAJPOX010000012.1 GCA905372325_00442 gene open 20239-22242 virD4
892 CAJPOX010000012.1 GCA905372325_00443 gene open 22232-23737
893 CAJPOX010000012.1 GCA905372325_00444 gene open 23752-25452
894 CAJPOX010000012.1 GCA905372325_00445 gene open 25457-26728
895 CAJPOX010000012.1 GCA905372325_00446 gene open 26851-27876
896 CAJPOX010000012.1 GCA905372325_00447 gene open 27962-28432 yezG
897 CAJPOX010000012.1 GCA905372325_00448 gene open 28434-30863
898 CAJPOX010000012.1 GCA905372325_00417 gene open 727-814 trnS
899 CAJPOX010000012.1 GCA905372325_00417 tRNA open 727-814 trnS tRNA-Ser(gga)
900 CAJPOX010000013.1 GCA905372325_00449 CDS open 289-1110 _na     273_aa Putative auto-transporter adhesin head GIN domain-containing protein
901 CAJPOX010000013.1 GCA905372325_00450 CDS open 1212-2762 _na     516_aa Fibronectin type-III domain-containing protein
902 CAJPOX010000013.1 GCA905372325_00451 CDS open 2776-3591 _na     271_aa Phosphatidate cytidylyltransferase
903 CAJPOX010000013.1 GCA905372325_00452 CDS open 3584-5593 _na     669_aa ftsH ATP-dependent zinc metalloprotease FtsH
904 CAJPOX010000013.1 GCA905372325_00453 CDS open 6206-6640 _na     144_aa DNA-binding helix-turn-helix protein
905 CAJPOX010000013.1 GCA905372325_00454 CDS open 6655-7011 _na     118_aa DNA-binding protein
906 CAJPOX010000013.1 GCA905372325_00455 CDS open 7021-9063 _na     680_aa Toprim domain protein
907 CAJPOX010000013.1 GCA905372325_00456 CDS open 9051-9359 _na     102_aa DNA-binding helix-turn-helix protein
908 CAJPOX010000013.1 GCA905372325_00457 CDS open 9454-10356 _na     300_aa CAAX protease
909 CAJPOX010000013.1 GCA905372325_00458 CDS open 10512-16580 _na     2022_aa site-specific DNA-methyltransferase (adenine-specific)
910 CAJPOX010000013.1 GCA905372325_00459 CDS open 16673-18754 _na     693_aa DNA topoisomerase
911 CAJPOX010000013.1 GCA905372325_00460 CDS open 18772-20172 _na     466_aa DUF3945 domain-containing protein
912 CAJPOX010000013.1 GCA905372325_00461 CDS open 20402-24901 _na     1499_aa DUF490 domain-containing protein
913 CAJPOX010000013.1 GCA905372325_00462 CDS open 24898-26967 _na     689_aa Fibronectin type III domain protein
914 CAJPOX010000013.1 GCA905372325_00463 CDS open 26964-30140 _na     1058_aa Pectate lyase parallel beta-helix repeat protein
915 CAJPOX010000013.1 GCA905372325_00449 gene open 289-1110
916 CAJPOX010000013.1 GCA905372325_00450 gene open 1212-2762
917 CAJPOX010000013.1 GCA905372325_00451 gene open 2776-3591
918 CAJPOX010000013.1 GCA905372325_00452 gene open 3584-5593 ftsH
919 CAJPOX010000013.1 GCA905372325_00453 gene open 6206-6640
920 CAJPOX010000013.1 GCA905372325_00454 gene open 6655-7011
921 CAJPOX010000013.1 GCA905372325_00455 gene open 7021-9063
922 CAJPOX010000013.1 GCA905372325_00456 gene open 9051-9359
923 CAJPOX010000013.1 GCA905372325_00457 gene open 9454-10356
924 CAJPOX010000013.1 GCA905372325_00458 gene open 10512-16580
925 CAJPOX010000013.1 GCA905372325_00459 gene open 16673-18754
926 CAJPOX010000013.1 GCA905372325_00460 gene open 18772-20172
927 CAJPOX010000013.1 GCA905372325_00461 gene open 20402-24901
928 CAJPOX010000013.1 GCA905372325_00462 gene open 24898-26967
929 CAJPOX010000013.1 GCA905372325_00463 gene open 26964-30140
930 CAJPOX010000014.1 GCA905372325_00479 gene open 15960-16146 Bacteroidales-1
931 CAJPOX010000014.1 GCA905372325_00479 ncRNA open 15960-16146 Bacteroidales-1 6S-Bacteroidales RNA suggested
932 CAJPOX010000014.1 GCA905372325_00465 CDS open 690-1373 _na     227_aa UPF0056 membrane protein
933 CAJPOX010000014.1 GCA905372325_00466 CDS open 1476-3419 _na     647_aa NAD(+) synthase
934 CAJPOX010000014.1 GCA905372325_00467 CDS open 3538-3990 _na     150_aa Lipocalin-like domain-containing protein
935 CAJPOX010000014.1 GCA905372325_00468 CDS open 4137-4472 _na     111_aa Sugar efflux transporter for intercellular exchange
936 CAJPOX010000014.1 GCA905372325_00469 CDS open 4923-5513 _na     196_aa Peptidyl-prolyl cis-trans isomerase
937 CAJPOX010000014.1 GCA905372325_00470 CDS open 5517-6323 _na     268_aa Peptidyl-prolyl cis-trans isomerase
938 CAJPOX010000014.1 GCA905372325_00471 CDS open 6375-7256 _na     293_aa Peptidyl-prolyl cis-trans isomerase
939 CAJPOX010000014.1 GCA905372325_00473 CDS open 7733-8506 _na     257_aa Threonine/serine exporter-like N-terminal domain-containing protein
940 CAJPOX010000014.1 GCA905372325_00474 CDS open 8546-9037 _na     163_aa thrE Threonine/Serine exporter ThrE domain-containing protein
941 CAJPOX010000014.1 GCA905372325_00475 CDS open 9326-10258 _na     310_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
942 CAJPOX010000014.1 GCA905372325_00476 CDS open 10236-11279 _na     347_aa N-acetyltransferase domain-containing protein
943 CAJPOX010000014.1 GCA905372325_00477 CDS open 11363-11677 _na     104_aa trxA thioredoxin
944 CAJPOX010000014.1 GCA905372325_00478 CDS open 11720-15463 _na     1247_aa dnaE DNA polymerase III subunit alpha
945 CAJPOX010000014.1 GCA905372325_00480 CDS open 16222-17556 _na     444_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
946 CAJPOX010000014.1 GCA905372325_00481 CDS open 17953-18222 _na     89_aa hypothetical protein
947 CAJPOX010000014.1 GCA905372325_00482 CDS open 18236-21277 _na     1013_aa TonB-dependent receptor plug domain protein
948 CAJPOX010000014.1 GCA905372325_00483 CDS open 21305-22858 _na     517_aa ragB Susd and RagB outer membrane lipoprotein
949 CAJPOX010000014.1 GCA905372325_00484 CDS open 22880-24037 _na     385_aa Endoglycosidase
950 CAJPOX010000014.1 GCA905372325_00485 CDS open 24047-25264 _na     405_aa LamG-like jellyroll fold domain-containing protein
951 CAJPOX010000014.1 GCA905372325_00486 CDS open 25346-26389 _na     347_aa F5/8 type C domain protein
952 CAJPOX010000014.1 GCA905372325_00487 CDS open 26481-27374 _na     297_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
953 CAJPOX010000014.1 GCA905372325_00488 CDS open 27558-28418 _na     286_aa Peptidase M3A/M3B catalytic domain-containing protein
954 CAJPOX010000014.1 GCA905372325_00465 gene open 690-1373
955 CAJPOX010000014.1 GCA905372325_00466 gene open 1476-3419
956 CAJPOX010000014.1 GCA905372325_00467 gene open 3538-3990
957 CAJPOX010000014.1 GCA905372325_00468 gene open 4137-4472
958 CAJPOX010000014.1 GCA905372325_00469 gene open 4923-5513
959 CAJPOX010000014.1 GCA905372325_00470 gene open 5517-6323
960 CAJPOX010000014.1 GCA905372325_00471 gene open 6375-7256
961 CAJPOX010000014.1 GCA905372325_00473 gene open 7733-8506
962 CAJPOX010000014.1 GCA905372325_00474 gene open 8546-9037 thrE
963 CAJPOX010000014.1 GCA905372325_00475 gene open 9326-10258
964 CAJPOX010000014.1 GCA905372325_00476 gene open 10236-11279
965 CAJPOX010000014.1 GCA905372325_00477 gene open 11363-11677 trxA
966 CAJPOX010000014.1 GCA905372325_00478 gene open 11720-15463 dnaE
967 CAJPOX010000014.1 GCA905372325_00480 gene open 16222-17556
968 CAJPOX010000014.1 GCA905372325_00481 gene open 17953-18222
969 CAJPOX010000014.1 GCA905372325_00482 gene open 18236-21277
970 CAJPOX010000014.1 GCA905372325_00483 gene open 21305-22858 ragB
971 CAJPOX010000014.1 GCA905372325_00484 gene open 22880-24037
972 CAJPOX010000014.1 GCA905372325_00485 gene open 24047-25264
973 CAJPOX010000014.1 GCA905372325_00486 gene open 25346-26389
974 CAJPOX010000014.1 GCA905372325_00487 gene open 26481-27374 folD
975 CAJPOX010000014.1 GCA905372325_00488 gene open 27558-28418
976 CAJPOX010000014.1 GCA905372325_00464 gene open 529-601 trnG
977 CAJPOX010000014.1 GCA905372325_00472 gene open 7502-7573 trnfM
978 CAJPOX010000014.1 GCA905372325_00464 tRNA open 529-601 trnG tRNA-Gly(ccc)
979 CAJPOX010000014.1 GCA905372325_00472 tRNA open 7502-7573 trnfM tRNA-fMet(cat)
980 CAJPOX010000015.1 GCA905372325_00489 CDS open 138-710 _na     190_aa Outer membrane protein beta-barrel domain-containing protein
981 CAJPOX010000015.1 GCA905372325_00490 CDS open 783-1271 _na     162_aa Lipoprotein
982 CAJPOX010000015.1 GCA905372325_00491 CDS open 1548-3341 _na     597_aa rpsA 30S ribosomal protein S1
983 CAJPOX010000015.1 GCA905372325_00492 CDS open 3464-4678 _na     404_aa hypothetical protein
984 CAJPOX010000015.1 GCA905372325_00493 CDS open 4717-5634 _na     305_aa Endonuclease/exonuclease/phosphatase family protein
985 CAJPOX010000015.1 GCA905372325_00494 CDS open 6104-6607 _na     167_aa DUF4199 domain-containing protein
986 CAJPOX010000015.1 GCA905372325_00495 CDS open 6617-7570 _na     317_aa Glycosyltransferase%2C group 2 family protein
987 CAJPOX010000015.1 GCA905372325_00496 CDS open 7588-8616 _na     342_aa FAD:protein FMN transferase
988 CAJPOX010000015.1 GCA905372325_00497 CDS open 8850-9434 _na     194_aa grpE Protein GrpE
989 CAJPOX010000015.1 GCA905372325_00498 CDS open 9453-10616 _na     387_aa dnaJ molecular chaperone DnaJ
990 CAJPOX010000015.1 GCA905372325_00499 CDS open 10726-11178 _na     150_aa DUF805 domain-containing protein
991 CAJPOX010000015.1 GCA905372325_00500 CDS open 11285-11653 _na     122_aa DUF805 domain-containing protein
992 CAJPOX010000015.1 GCA905372325_00501 CDS open 11831-13477 _na     548_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
993 CAJPOX010000015.1 GCA905372325_00502 CDS open 14055-14855 _na     266_aa Phospholipase%2C patatin family
994 CAJPOX010000015.1 GCA905372325_00503 CDS open 14877-16538 _na     553_aa Alpha amylase%2C catalytic domain protein
995 CAJPOX010000015.1 GCA905372325_00504 CDS open 16635-17981 _na     448_aa lpdA dihydrolipoyl dehydrogenase
996 CAJPOX010000015.1 GCA905372325_00505 CDS open 18018-19682 _na     554_aa formate--tetrahydrofolate ligase
997 CAJPOX010000015.1 GCA905372325_00506 CDS open 19817-21865 _na     682_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
998 CAJPOX010000015.1 GCA905372325_00507 CDS open 21902-23749 _na     615_aa DNA polymerase III subunit gamma/tau
999 CAJPOX010000015.1 GCA905372325_00508 CDS open 23915-26020 _na     701_aa Peptidase family M3
1000 CAJPOX010000015.1 GCA905372325_00509 CDS open 26063-26578 _na     171_aa nicotinamidase