HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Segatella maculosa (GCA_905372425.1)

Select a Genome:
BAKTA Annotations for GCA_905372425.1
Genome Selected: Segatella maculosa
ContigsBases CDSrRNA tmRNAtRNA
165 2693241 2139 0 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4357 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4357 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAJPPA010000003.1 GCA905372425_00270 CDS open 60525-64379 _na     1284_aa hybrid sensor histidine kinase/response regulator
502 CAJPPA010000003.1 GCA905372425_00271 CDS open 64955-65464 _na     169_aa vcbS VcbS
503 CAJPPA010000003.1 GCA905372425_00232 gene open 341-3298
504 CAJPPA010000003.1 GCA905372425_00233 gene open 3252-5099
505 CAJPPA010000003.1 GCA905372425_00234 gene open 5135-6382 hflX
506 CAJPPA010000003.1 GCA905372425_00235 gene open 6829-8433
507 CAJPPA010000003.1 GCA905372425_00236 gene open 9081-13139
508 CAJPPA010000003.1 GCA905372425_00237 gene open 14114-15841
509 CAJPPA010000003.1 GCA905372425_00238 gene open 15945-17624
510 CAJPPA010000003.1 GCA905372425_00239 gene open 17665-19506
511 CAJPPA010000003.1 GCA905372425_00240 gene open 19547-21259
512 CAJPPA010000003.1 GCA905372425_00241 gene open 21279-24428
513 CAJPPA010000003.1 GCA905372425_00242 gene open 24647-27124
514 CAJPPA010000003.1 GCA905372425_00243 gene open 27206-27382
515 CAJPPA010000003.1 GCA905372425_00244 gene open 27770-28399
516 CAJPPA010000003.1 GCA905372425_00245 gene open 28612-29181
517 CAJPPA010000003.1 GCA905372425_00246 gene open 29178-30386
518 CAJPPA010000003.1 GCA905372425_00247 gene open 30417-30821
519 CAJPPA010000003.1 GCA905372425_00248 gene open 30840-31451 mntP
520 CAJPPA010000003.1 GCA905372425_00249 gene open 31477-32331
521 CAJPPA010000003.1 GCA905372425_00250 gene open 32338-33048 rsmI
522 CAJPPA010000003.1 GCA905372425_00251 gene open 33523-34305 lpxA
523 CAJPPA010000003.1 GCA905372425_00252 gene open 34407-35774 nodT
524 CAJPPA010000003.1 GCA905372425_00253 gene open 35808-39080
525 CAJPPA010000003.1 GCA905372425_00254 gene open 39091-40290
526 CAJPPA010000003.1 GCA905372425_00255 gene open 40949-41206
527 CAJPPA010000003.1 GCA905372425_00256 gene open 41213-41431
528 CAJPPA010000003.1 GCA905372425_00257 gene open 42157-43611
529 CAJPPA010000003.1 GCA905372425_00258 gene open 43743-44120
530 CAJPPA010000003.1 GCA905372425_00259 gene open 44192-44740
531 CAJPPA010000003.1 GCA905372425_00260 gene open 44748-46835 tpiA
532 CAJPPA010000003.1 GCA905372425_00261 gene open 46921-47625
533 CAJPPA010000003.1 GCA905372425_00262 gene open 47635-48276 folE
534 CAJPPA010000003.1 GCA905372425_00263 gene open 48351-48980
535 CAJPPA010000003.1 GCA905372425_00264 gene open 48977-49732
536 CAJPPA010000003.1 GCA905372425_00265 gene open 50114-51226
537 CAJPPA010000003.1 GCA905372425_00266 gene open 51424-52722
538 CAJPPA010000003.1 GCA905372425_00267 gene open 52757-55177
539 CAJPPA010000003.1 GCA905372425_00268 gene open 55422-57068
540 CAJPPA010000003.1 GCA905372425_00269 gene open 57095-60025
541 CAJPPA010000003.1 GCA905372425_00270 gene open 60525-64379
542 CAJPPA010000003.1 GCA905372425_00271 gene open 64955-65464 vcbS
543 CAJPPA010000004.1 repeat_region open 38899-41036 CRISPR array with 30 repeats of length 37%2C consensus sequence GTCTTAATCCTTGTTCTAATGGAAGATACTCACAGAG and spacer length 35
544 CAJPPA010000004.1 GCA905372425_00272 CDS open 195-485 _na     96_aa hypothetical protein
545 CAJPPA010000004.1 GCA905372425_00273 CDS open 412-1050 _na     212_aa HTH luxR-type domain-containing protein
546 CAJPPA010000004.1 GCA905372425_00274 CDS open 1163-3688 _na     841_aa Outer membrane protein beta-barrel domain-containing protein
547 CAJPPA010000004.1 GCA905372425_00275 CDS open 3706-4416 _na     236_aa HAD hydrolase%2C family IA
548 CAJPPA010000004.1 GCA905372425_00276 CDS open 4458-5375 _na     305_aa CDP-alcohol phosphatidyltransferase
549 CAJPPA010000004.1 GCA905372425_00277 CDS open 5362-5817 _na     151_aa ATP-grasp domain-containing protein
550 CAJPPA010000004.1 GCA905372425_00278 CDS open 5905-6165 _na     86_aa hypothetical protein
551 CAJPPA010000004.1 GCA905372425_00279 CDS open 6162-6884 _na     240_aa Nucleotidyl transferase domain-containing protein
552 CAJPPA010000004.1 GCA905372425_00280 CDS open 7382-7819 _na     145_aa GatB/YqeY domain-containing protein
553 CAJPPA010000004.1 GCA905372425_00281 CDS open 7926-8705 _na     259_aa Putative auto-transporter adhesin head GIN domain-containing protein
554 CAJPPA010000004.1 GCA905372425_00282 CDS open 8855-9559 _na     234_aa DNA alkylation repair enzyme
555 CAJPPA010000004.1 GCA905372425_00283 CDS open 9685-10626 _na     313_aa epsC serine O-acetyltransferase EpsC
556 CAJPPA010000004.1 GCA905372425_00284 CDS open 10610-12100 _na     496_aa THUMP domain-containing protein
557 CAJPPA010000004.1 GCA905372425_00285 CDS open 12104-14278 _na     724_aa S9 family peptidase
558 CAJPPA010000004.1 GCA905372425_00286 CDS open 14288-15556 _na     422_aa Phosphoribosylamine--glycine ligase
559 CAJPPA010000004.1 GCA905372425_00287 CDS open 15557-16495 _na     312_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
560 CAJPPA010000004.1 GCA905372425_00288 CDS open 16471-17703 _na     410_aa metal ABC transporter solute-binding protein%2C Zn/Mn family
561 CAJPPA010000004.1 GCA905372425_00289 CDS open 17700-18398 _na     232_aa ABC transporter domain-containing protein
562 CAJPPA010000004.1 GCA905372425_00290 CDS open 19017-19778 _na     253_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
563 CAJPPA010000004.1 GCA905372425_00291 CDS open 19828-20562 _na     244_aa rluA RluA family pseudouridine synthase
564 CAJPPA010000004.1 GCA905372425_00292 CDS open 20500-20682 _na     60_aa hypothetical protein
565 CAJPPA010000004.1 GCA905372425_00293 CDS open 20772-25409 _na     1545_aa Phage tail protein
566 CAJPPA010000004.1 GCA905372425_00294 CDS open 25417-27687 _na     756_aa Bacterial surface antigen (D15) domain-containing protein
567 CAJPPA010000004.1 GCA905372425_00295 CDS open 27782-28693 _na     303_aa Nucleotidyl transferase domain-containing protein
568 CAJPPA010000004.1 GCA905372425_00296 CDS open 29110-30147 _na     345_aa DDH domain-containing protein
569 CAJPPA010000004.1 GCA905372425_00297 CDS open 30258-30884 _na     208_aa DUF4827 domain-containing protein
570 CAJPPA010000004.1 GCA905372425_00298 CDS open 30898-32286 _na     462_aa glmM phosphoglucosamine mutase
571 CAJPPA010000004.1 GCA905372425_00299 CDS open 32369-32791 _na     140_aa DUF4112 domain-containing protein
572 CAJPPA010000004.1 GCA905372425_00300 CDS open 32826-33572 _na     248_aa rteC RteC protein
573 CAJPPA010000004.1 GCA905372425_00301 CDS open 33553-34572 _na     339_aa queG tRNA epoxyqueuosine(34) reductase QueG
574 CAJPPA010000004.1 GCA905372425_00302 CDS open 34550-35161 _na     203_aa NodB-like y domain-containing protein
575 CAJPPA010000004.1 GCA905372425_00303 CDS open 35184-38531 _na     1115_aa DUF2723 domain-containing protein
576 CAJPPA010000004.1 GCA905372425_00304 CDS open 41203-41499 _na     98_aa cas2 CRISPR-associated endonuclease Cas2
577 CAJPPA010000004.1 GCA905372425_00305 CDS open 41688-42704 _na     338_aa CRISPR-associated primase-polymerase type B
578 CAJPPA010000004.1 GCA905372425_00306 CDS open 42707-43684 _na     325_aa cas1 CRISPR-associated endonuclease Cas1
579 CAJPPA010000004.1 GCA905372425_00307 CDS open 43686-44042 _na     118_aa CRISPR-associated protein
580 CAJPPA010000004.1 GCA905372425_00308 CDS open 44032-45354 _na     440_aa csx2 TIGR02221 family CRISPR-associated protein
581 CAJPPA010000004.1 GCA905372425_00309 CDS open 45356-46354 _na     332_aa Card1-like endonuclease domain-containing protein
582 CAJPPA010000004.1 GCA905372425_00310 CDS open 46357-48054 _na     565_aa TIGR03986 family CRISPR-associated RAMP protein
583 CAJPPA010000004.1 GCA905372425_00311 CDS open 48054-48491 _na     145_aa TIGR04423 family type III CRISPR-associated protein
584 CAJPPA010000004.1 GCA905372425_00312 CDS open 48460-49836 _na     458_aa RAMP superfamily CRISPR-associated protein
585 CAJPPA010000004.1 GCA905372425_00313 CDS open 49850-51277 _na     475_aa CRISPR-associated RAMP protein
586 CAJPPA010000004.1 GCA905372425_00314 CDS open 51281-51832 _na     183_aa RAMP superfamily CRISPR-associated protein
587 CAJPPA010000004.1 GCA905372425_00315 CDS open 51829-53304 _na     491_aa Cas10/Cmr2 second palm domain-containing protein
588 CAJPPA010000004.1 GCA905372425_00316 CDS open 53311-53991 _na     226_aa CRISPR-associated endonuclease Cas6
589 CAJPPA010000004.1 GCA905372425_00272 gene open 195-485
590 CAJPPA010000004.1 GCA905372425_00273 gene open 412-1050
591 CAJPPA010000004.1 GCA905372425_00274 gene open 1163-3688
592 CAJPPA010000004.1 GCA905372425_00275 gene open 3706-4416
593 CAJPPA010000004.1 GCA905372425_00276 gene open 4458-5375
594 CAJPPA010000004.1 GCA905372425_00277 gene open 5362-5817
595 CAJPPA010000004.1 GCA905372425_00278 gene open 5905-6165
596 CAJPPA010000004.1 GCA905372425_00279 gene open 6162-6884
597 CAJPPA010000004.1 GCA905372425_00280 gene open 7382-7819
598 CAJPPA010000004.1 GCA905372425_00281 gene open 7926-8705
599 CAJPPA010000004.1 GCA905372425_00282 gene open 8855-9559
600 CAJPPA010000004.1 GCA905372425_00283 gene open 9685-10626 epsC
601 CAJPPA010000004.1 GCA905372425_00284 gene open 10610-12100
602 CAJPPA010000004.1 GCA905372425_00285 gene open 12104-14278
603 CAJPPA010000004.1 GCA905372425_00286 gene open 14288-15556
604 CAJPPA010000004.1 GCA905372425_00287 gene open 15557-16495
605 CAJPPA010000004.1 GCA905372425_00288 gene open 16471-17703
606 CAJPPA010000004.1 GCA905372425_00289 gene open 17700-18398
607 CAJPPA010000004.1 GCA905372425_00290 gene open 19017-19778 fabG
608 CAJPPA010000004.1 GCA905372425_00291 gene open 19828-20562 rluA
609 CAJPPA010000004.1 GCA905372425_00292 gene open 20500-20682
610 CAJPPA010000004.1 GCA905372425_00293 gene open 20772-25409
611 CAJPPA010000004.1 GCA905372425_00294 gene open 25417-27687
612 CAJPPA010000004.1 GCA905372425_00295 gene open 27782-28693
613 CAJPPA010000004.1 GCA905372425_00296 gene open 29110-30147
614 CAJPPA010000004.1 GCA905372425_00297 gene open 30258-30884
615 CAJPPA010000004.1 GCA905372425_00298 gene open 30898-32286 glmM
616 CAJPPA010000004.1 GCA905372425_00299 gene open 32369-32791
617 CAJPPA010000004.1 GCA905372425_00300 gene open 32826-33572 rteC
618 CAJPPA010000004.1 GCA905372425_00301 gene open 33553-34572 queG
619 CAJPPA010000004.1 GCA905372425_00302 gene open 34550-35161
620 CAJPPA010000004.1 GCA905372425_00303 gene open 35184-38531
621 CAJPPA010000004.1 GCA905372425_00304 gene open 41203-41499 cas2
622 CAJPPA010000004.1 GCA905372425_00305 gene open 41688-42704
623 CAJPPA010000004.1 GCA905372425_00306 gene open 42707-43684 cas1
624 CAJPPA010000004.1 GCA905372425_00307 gene open 43686-44042
625 CAJPPA010000004.1 GCA905372425_00308 gene open 44032-45354 csx2
626 CAJPPA010000004.1 GCA905372425_00309 gene open 45356-46354
627 CAJPPA010000004.1 GCA905372425_00310 gene open 46357-48054
628 CAJPPA010000004.1 GCA905372425_00311 gene open 48054-48491
629 CAJPPA010000004.1 GCA905372425_00312 gene open 48460-49836
630 CAJPPA010000004.1 GCA905372425_00313 gene open 49850-51277
631 CAJPPA010000004.1 GCA905372425_00314 gene open 51281-51832
632 CAJPPA010000004.1 GCA905372425_00315 gene open 51829-53304
633 CAJPPA010000004.1 GCA905372425_00316 gene open 53311-53991
634 CAJPPA010000005.1 regulatory_region open 34746-34804 SAM-II riboswitch aptamer (SAM-II long loop)
635 CAJPPA010000005.1 GCA905372425_00317 CDS open 317-1501 _na     394_aa DUF4861 domain-containing protein
636 CAJPPA010000005.1 GCA905372425_00318 CDS open 1539-3929 _na     796_aa DUF4955 domain-containing protein
637 CAJPPA010000005.1 GCA905372425_00319 CDS open 3926-5464 _na     512_aa Sulfatase N-terminal domain-containing protein
638 CAJPPA010000005.1 GCA905372425_00320 CDS open 5461-6654 _na     397_aa DUF4995 domain-containing protein
639 CAJPPA010000005.1 GCA905372425_00321 CDS open 6656-9664 _na     1002_aa Polysaccharide lyase family 8%2C super-sandwich domain-containing protein
640 CAJPPA010000005.1 GCA905372425_00322 CDS open 9693-10724 _na     343_aa DUF5017 domain-containing protein
641 CAJPPA010000005.1 GCA905372425_00323 CDS open 10782-12515 _na     577_aa RagB/SusD domain-containing protein
642 CAJPPA010000005.1 GCA905372425_00324 CDS open 12537-15728 _na     1063_aa SusC/RagA family TonB-linked outer membrane protein
643 CAJPPA010000005.1 GCA905372425_00325 CDS open 16395-17156 _na     253_aa ABC transporter domain-containing protein
644 CAJPPA010000005.1 GCA905372425_00326 CDS open 17344-18729 _na     461_aa MATE efflux family protein
645 CAJPPA010000005.1 GCA905372425_00327 CDS open 18836-20329 _na     497_aa AMP-dependent synthetase/ligase domain-containing protein
646 CAJPPA010000005.1 GCA905372425_00328 CDS open 20326-21150 _na     274_aa SDR family oxidoreductase
647 CAJPPA010000005.1 GCA905372425_00329 CDS open 21160-21600 _na     146_aa hypothetical protein
648 CAJPPA010000005.1 GCA905372425_00330 CDS open 21636-22127 _na     163_aa Lactoylglutathione lyase-like lyase
649 CAJPPA010000005.1 GCA905372425_00331 CDS open 22276-22860 _na     194_aa Superoxide dismutase
650 CAJPPA010000005.1 GCA905372425_00332 CDS open 23155-23703 _na     182_aa Lipocalin-like domain-containing protein
651 CAJPPA010000005.1 GCA905372425_00333 CDS open 23936-24607 _na     223_aa hypothetical protein
652 CAJPPA010000005.1 GCA905372425_00334 CDS open 24647-25906 _na     419_aa Glycoside hydrolase family 13 N-terminal domain-containing protein
653 CAJPPA010000005.1 GCA905372425_00335 CDS open 26045-27946 _na     633_aa Heavy metal translocating P-type ATPase
654 CAJPPA010000005.1 GCA905372425_00337 CDS open 28752-29450 _na     232_aa DUF4919 domain-containing protein
655 CAJPPA010000005.1 GCA905372425_00338 CDS open 29543-30844 _na     433_aa tyrS tyrosine--tRNA ligase
656 CAJPPA010000005.1 GCA905372425_00339 CDS open 31181-31582 _na     133_aa rnpA ribonuclease P protein component
657 CAJPPA010000005.1 GCA905372425_00340 CDS open 31601-32347 _na     248_aa Tetrapyrrole biosynthesis uroporphyrinogen III synthase domain-containing protein
658 CAJPPA010000005.1 GCA905372425_00341 CDS open 32354-33373 _na     339_aa DUF4271 domain-containing protein
659 CAJPPA010000005.1 GCA905372425_00342 CDS open 33433-34689 _na     418_aa metK methionine adenosyltransferase
660 CAJPPA010000005.1 GCA905372425_00343 CDS open 35144-35947 _na     267_aa gluconate 5-dehydrogenase
661 CAJPPA010000005.1 GCA905372425_00344 CDS open 36912-37853 _na     313_aa rnc ribonuclease III
662 CAJPPA010000005.1 GCA905372425_00345 CDS open 37981-39243 _na     420_aa fabF beta-ketoacyl-ACP synthase II
663 CAJPPA010000005.1 GCA905372425_00346 CDS open 39361-39597 _na     78_aa acpP acyl carrier protein
664 CAJPPA010000005.1 GCA905372425_00347 CDS open 39670-39840 _na     56_aa hypothetical protein
665 CAJPPA010000005.1 GCA905372425_00348 CDS open 39818-40822 _na     334_aa Heptosyltransferase
666 CAJPPA010000005.1 GCA905372425_00349 CDS open 40933-41535 _na     200_aa DUF4254 domain-containing protein
667 CAJPPA010000005.1 GCA905372425_00350 CDS open 41597-41764 _na     55_aa hypothetical protein
668 CAJPPA010000005.1 GCA905372425_00351 CDS open 42203-42550 _na     115_aa RelE/StbE family addiction module toxin
669 CAJPPA010000005.1 GCA905372425_00352 CDS open 42547-42864 _na     105_aa HTH cro/C1-type domain-containing protein
670 CAJPPA010000005.1 GCA905372425_00353 CDS open 43012-45645 _na     877_aa mutS DNA mismatch repair protein MutS
671 CAJPPA010000005.1 GCA905372425_00354 CDS open 46019-46975 _na     318_aa NADP-dependent oxidoreductase domain-containing protein
672 CAJPPA010000005.1 GCA905372425_00355 CDS open 47022-48881 _na     619_aa 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
673 CAJPPA010000005.1 GCA905372425_00356 CDS open 48908-49414 _na     168_aa N5-carboxyaminoimidazole ribonucleotide mutase
674 CAJPPA010000005.1 GCA905372425_00357 CDS open 49460-50077 _na     205_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
675 CAJPPA010000005.1 GCA905372425_00358 CDS open 50327-51790 _na     487_aa rpoN RNA polymerase factor sigma-54
676 CAJPPA010000005.1 GCA905372425_00359 CDS open 51736-52167 _na     143_aa hypothetical protein
677 CAJPPA010000005.1 GCA905372425_00317 gene open 317-1501
678 CAJPPA010000005.1 GCA905372425_00318 gene open 1539-3929
679 CAJPPA010000005.1 GCA905372425_00319 gene open 3926-5464
680 CAJPPA010000005.1 GCA905372425_00320 gene open 5461-6654
681 CAJPPA010000005.1 GCA905372425_00321 gene open 6656-9664
682 CAJPPA010000005.1 GCA905372425_00322 gene open 9693-10724
683 CAJPPA010000005.1 GCA905372425_00323 gene open 10782-12515
684 CAJPPA010000005.1 GCA905372425_00324 gene open 12537-15728
685 CAJPPA010000005.1 GCA905372425_00325 gene open 16395-17156
686 CAJPPA010000005.1 GCA905372425_00326 gene open 17344-18729
687 CAJPPA010000005.1 GCA905372425_00327 gene open 18836-20329
688 CAJPPA010000005.1 GCA905372425_00328 gene open 20326-21150
689 CAJPPA010000005.1 GCA905372425_00329 gene open 21160-21600
690 CAJPPA010000005.1 GCA905372425_00330 gene open 21636-22127
691 CAJPPA010000005.1 GCA905372425_00331 gene open 22276-22860
692 CAJPPA010000005.1 GCA905372425_00332 gene open 23155-23703
693 CAJPPA010000005.1 GCA905372425_00333 gene open 23936-24607
694 CAJPPA010000005.1 GCA905372425_00334 gene open 24647-25906
695 CAJPPA010000005.1 GCA905372425_00335 gene open 26045-27946
696 CAJPPA010000005.1 GCA905372425_00337 gene open 28752-29450
697 CAJPPA010000005.1 GCA905372425_00338 gene open 29543-30844 tyrS
698 CAJPPA010000005.1 GCA905372425_00339 gene open 31181-31582 rnpA
699 CAJPPA010000005.1 GCA905372425_00340 gene open 31601-32347
700 CAJPPA010000005.1 GCA905372425_00341 gene open 32354-33373
701 CAJPPA010000005.1 GCA905372425_00342 gene open 33433-34689 metK
702 CAJPPA010000005.1 GCA905372425_00343 gene open 35144-35947
703 CAJPPA010000005.1 GCA905372425_00344 gene open 36912-37853 rnc
704 CAJPPA010000005.1 GCA905372425_00345 gene open 37981-39243 fabF
705 CAJPPA010000005.1 GCA905372425_00346 gene open 39361-39597 acpP
706 CAJPPA010000005.1 GCA905372425_00347 gene open 39670-39840
707 CAJPPA010000005.1 GCA905372425_00348 gene open 39818-40822
708 CAJPPA010000005.1 GCA905372425_00349 gene open 40933-41535
709 CAJPPA010000005.1 GCA905372425_00350 gene open 41597-41764
710 CAJPPA010000005.1 GCA905372425_00351 gene open 42203-42550
711 CAJPPA010000005.1 GCA905372425_00352 gene open 42547-42864
712 CAJPPA010000005.1 GCA905372425_00353 gene open 43012-45645 mutS
713 CAJPPA010000005.1 GCA905372425_00354 gene open 46019-46975
714 CAJPPA010000005.1 GCA905372425_00355 gene open 47022-48881
715 CAJPPA010000005.1 GCA905372425_00356 gene open 48908-49414
716 CAJPPA010000005.1 GCA905372425_00357 gene open 49460-50077
717 CAJPPA010000005.1 GCA905372425_00358 gene open 50327-51790 rpoN
718 CAJPPA010000005.1 GCA905372425_00359 gene open 51736-52167
719 CAJPPA010000005.1 GCA905372425_00336 gene open 28608-28678 trnQ
720 CAJPPA010000005.1 GCA905372425_00336 tRNA open 28608-28678 trnQ tRNA-Gln(ttg)
721 CAJPPA010000006.1 GCA905372425_00360 CDS open 256-1092 _na     278_aa murI glutamate racemase
722 CAJPPA010000006.1 GCA905372425_00361 CDS open 1094-1603 _na     169_aa Outer membrane protein
723 CAJPPA010000006.1 GCA905372425_00362 CDS open 1725-2225 _na     166_aa Outer membrane protein
724 CAJPPA010000006.1 GCA905372425_00363 CDS open 2268-2807 _na     179_aa Outer membrane protein
725 CAJPPA010000006.1 GCA905372425_00364 CDS open 3013-5646 _na     877_aa Outer membrane protein%2C OMP85 family
726 CAJPPA010000006.1 GCA905372425_00365 CDS open 5674-6438 _na     254_aa isoprenyl transferase
727 CAJPPA010000006.1 GCA905372425_00366 CDS open 6447-7121 _na     224_aa DUF6089 domain-containing protein
728 CAJPPA010000006.1 GCA905372425_00367 CDS open 7131-8513 _na     460_aa DUF6242 domain-containing protein
729 CAJPPA010000006.1 GCA905372425_00368 CDS open 8895-11915 _na     1006_aa TonB-dependent receptor
730 CAJPPA010000006.1 GCA905372425_00369 CDS open 11965-13428 _na     487_aa RagB/SusD domain-containing protein
731 CAJPPA010000006.1 GCA905372425_00370 CDS open 13456-14286 _na     276_aa PKD domain-containing protein
732 CAJPPA010000006.1 GCA905372425_00371 CDS open 14800-15591 _na     263_aa HTH deoR-type domain-containing protein
733 CAJPPA010000006.1 GCA905372425_00372 CDS open 15701-16627 _na     308_aa Glycosyl hydrolase family 32 N-terminal domain-containing protein
734 CAJPPA010000006.1 GCA905372425_00373 CDS open 16713-17777 _na     354_aa Glutamine--fructose-6-phosphate aminotransferase [isomerizing]
735 CAJPPA010000006.1 GCA905372425_00374 CDS open 17774-19009 _na     411_aa Major facilitator superfamily (MFS) profile domain-containing protein
736 CAJPPA010000006.1 GCA905372425_00375 CDS open 19021-19908 _na     295_aa ROK family protein (Putative glucokinase)
737 CAJPPA010000006.1 GCA905372425_00376 CDS open 20336-23125 _na     929_aa Exo-1%2C4-beta-D-glucosaminidase
738 CAJPPA010000006.1 GCA905372425_00377 CDS open 23176-24204 _na     342_aa DUF4434 domain-containing protein
739 CAJPPA010000006.1 GCA905372425_00378 CDS open 24674-26086 _na     470_aa aspA aspartate ammonia-lyase
740 CAJPPA010000006.1 GCA905372425_00379 CDS open 26379-27572 _na     397_aa Phosphate-selective porin O and P
741 CAJPPA010000006.1 GCA905372425_00380 CDS open 27575-28621 _na     348_aa ansB L-asparaginase 2
742 CAJPPA010000006.1 GCA905372425_00381 CDS open 28652-29998 _na     448_aa dcuA Anaerobic C4-dicarboxylate transporter DcuA
743 CAJPPA010000006.1 GCA905372425_00382 CDS open 30136-30333 _na     65_aa hypothetical protein
744 CAJPPA010000006.1 GCA905372425_00383 CDS open 30379-32829 _na     816_aa Beta-galactosidase
745 CAJPPA010000006.1 GCA905372425_00384 CDS open 34450-36288 _na     612_aa yejM Inner membrane protein YejM N-terminal domain-containing protein
746 CAJPPA010000006.1 GCA905372425_00385 CDS open 36505-37734 _na     409_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
747 CAJPPA010000006.1 GCA905372425_00386 CDS open 37801-39294 _na     497_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
748 CAJPPA010000006.1 GCA905372425_00387 CDS open 39321-41507 _na     728_aa Dipeptidyl-peptidase
749 CAJPPA010000006.1 GCA905372425_00388 CDS open 41952-42110 _na     52_aa hypothetical protein
750 CAJPPA010000006.1 GCA905372425_00389 CDS open 42353-43624 _na     423_aa HTH araC/xylS-type domain-containing protein
751 CAJPPA010000006.1 GCA905372425_00390 CDS open 43650-45287 _na     545_aa C-terminal processing peptidase
752 CAJPPA010000006.1 GCA905372425_00391 CDS open 45331-47322 _na     663_aa DNA topoisomerase (ATP-hydrolyzing)
753 CAJPPA010000006.1 GCA905372425_00392 CDS open 47358-48506 _na     382_aa N-acetyltransferase domain-containing protein
754 CAJPPA010000006.1 GCA905372425_00393 CDS open 48567-49787 _na     406_aa THUMP-like domain-containing protein
755 CAJPPA010000006.1 GCA905372425_00394 CDS open 49795-50520 _na     241_aa D-alanyl-D-alanine dipeptidase
756 CAJPPA010000006.1 GCA905372425_00395 CDS open 50551-51045 _na     164_aa MgtC/SapB/SrpB/YhiD N-terminal domain-containing protein
757 CAJPPA010000006.1 GCA905372425_00360 gene open 256-1092 murI
758 CAJPPA010000006.1 GCA905372425_00361 gene open 1094-1603
759 CAJPPA010000006.1 GCA905372425_00362 gene open 1725-2225
760 CAJPPA010000006.1 GCA905372425_00363 gene open 2268-2807
761 CAJPPA010000006.1 GCA905372425_00364 gene open 3013-5646
762 CAJPPA010000006.1 GCA905372425_00365 gene open 5674-6438
763 CAJPPA010000006.1 GCA905372425_00366 gene open 6447-7121
764 CAJPPA010000006.1 GCA905372425_00367 gene open 7131-8513
765 CAJPPA010000006.1 GCA905372425_00368 gene open 8895-11915
766 CAJPPA010000006.1 GCA905372425_00369 gene open 11965-13428
767 CAJPPA010000006.1 GCA905372425_00370 gene open 13456-14286
768 CAJPPA010000006.1 GCA905372425_00371 gene open 14800-15591
769 CAJPPA010000006.1 GCA905372425_00372 gene open 15701-16627
770 CAJPPA010000006.1 GCA905372425_00373 gene open 16713-17777
771 CAJPPA010000006.1 GCA905372425_00374 gene open 17774-19009
772 CAJPPA010000006.1 GCA905372425_00375 gene open 19021-19908
773 CAJPPA010000006.1 GCA905372425_00376 gene open 20336-23125
774 CAJPPA010000006.1 GCA905372425_00377 gene open 23176-24204
775 CAJPPA010000006.1 GCA905372425_00378 gene open 24674-26086 aspA
776 CAJPPA010000006.1 GCA905372425_00379 gene open 26379-27572
777 CAJPPA010000006.1 GCA905372425_00380 gene open 27575-28621 ansB
778 CAJPPA010000006.1 GCA905372425_00381 gene open 28652-29998 dcuA
779 CAJPPA010000006.1 GCA905372425_00382 gene open 30136-30333
780 CAJPPA010000006.1 GCA905372425_00383 gene open 30379-32829
781 CAJPPA010000006.1 GCA905372425_00384 gene open 34450-36288 yejM
782 CAJPPA010000006.1 GCA905372425_00385 gene open 36505-37734
783 CAJPPA010000006.1 GCA905372425_00386 gene open 37801-39294
784 CAJPPA010000006.1 GCA905372425_00387 gene open 39321-41507
785 CAJPPA010000006.1 GCA905372425_00388 gene open 41952-42110
786 CAJPPA010000006.1 GCA905372425_00389 gene open 42353-43624
787 CAJPPA010000006.1 GCA905372425_00390 gene open 43650-45287
788 CAJPPA010000006.1 GCA905372425_00391 gene open 45331-47322
789 CAJPPA010000006.1 GCA905372425_00392 gene open 47358-48506
790 CAJPPA010000006.1 GCA905372425_00393 gene open 48567-49787
791 CAJPPA010000006.1 GCA905372425_00394 gene open 49795-50520
792 CAJPPA010000006.1 GCA905372425_00395 gene open 50551-51045
793 CAJPPA010000007.1 GCA905372425_00396 CDS open 43-681 _na     212_aa hypothetical protein
794 CAJPPA010000007.1 GCA905372425_00397 CDS open 832-2070 _na     412_aa Cysteine desulfurase
795 CAJPPA010000007.1 GCA905372425_00398 CDS open 2270-3565 _na     431_aa sufD Fe-S cluster assembly protein SufD
796 CAJPPA010000007.1 GCA905372425_00399 CDS open 3628-4374 _na     248_aa sufC Fe-S cluster assembly ATPase SufC
797 CAJPPA010000007.1 GCA905372425_00400 CDS open 4422-5867 _na     481_aa sufB Fe-S cluster assembly protein SufB
798 CAJPPA010000007.1 GCA905372425_00401 CDS open 6368-9136 _na     922_aa infB translation initiation factor IF-2
799 CAJPPA010000007.1 GCA905372425_00402 CDS open 9206-10471 _na     421_aa nusA Transcription termination/antitermination protein NusA
800 CAJPPA010000007.1 GCA905372425_00403 CDS open 10476-10943 _na     155_aa rimP ribosome assembly cofactor RimP
801 CAJPPA010000007.1 GCA905372425_00404 CDS open 12077-13597 _na     506_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
802 CAJPPA010000007.1 GCA905372425_00405 CDS open 13602-14264 _na     220_aa ung uracil-DNA glycosylase
803 CAJPPA010000007.1 GCA905372425_00406 CDS open 14411-15013 _na     200_aa DUF3109 domain-containing protein
804 CAJPPA010000007.1 GCA905372425_00407 CDS open 15165-16007 _na     280_aa DUF481 domain-containing protein
805 CAJPPA010000007.1 GCA905372425_00408 CDS open 16087-16950 _na     287_aa HTH araC/xylS-type domain-containing protein
806 CAJPPA010000007.1 GCA905372425_00409 CDS open 17033-18055 _na     340_aa Bacterial alpha-L-rhamnosidase N-terminal domain-containing protein
807 CAJPPA010000007.1 GCA905372425_00410 CDS open 18223-20193 _na     656_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
808 CAJPPA010000007.1 GCA905372425_00411 CDS open 20636-21346 _na     236_aa ABC transporter domain-containing protein
809 CAJPPA010000007.1 GCA905372425_00412 CDS open 21441-22766 _na     441_aa ABC transporter permease
810 CAJPPA010000007.1 GCA905372425_00413 CDS open 22888-25032 _na     714_aa Peptidase M3A/M3B catalytic domain-containing protein
811 CAJPPA010000007.1 GCA905372425_00414 CDS open 25604-26731 _na     375_aa Glycosyl hydrolase family 88
812 CAJPPA010000007.1 GCA905372425_00415 CDS open 26728-27915 _na     395_aa DUF4861 domain-containing protein
813 CAJPPA010000007.1 GCA905372425_00416 CDS open 27929-29179 _na     416_aa DUF2264 domain-containing protein
814 CAJPPA010000007.1 GCA905372425_00417 CDS open 29176-30957 _na     593_aa Heparinase II/III-like C-terminal domain-containing protein
815 CAJPPA010000007.1 GCA905372425_00418 CDS open 31029-32144 _na     371_aa Beta-glucanase
816 CAJPPA010000007.1 GCA905372425_00419 CDS open 32141-33874 _na     577_aa GH16 domain-containing protein
817 CAJPPA010000007.1 GCA905372425_00420 CDS open 34184-35839 _na     551_aa RagB/SusD domain-containing protein
818 CAJPPA010000007.1 GCA905372425_00421 CDS open 35902-38766 _na     954_aa SusC/RagA family TonB-linked outer membrane protein
819 CAJPPA010000007.1 GCA905372425_00422 CDS open 38806-40731 _na     641_aa RagB/SusD domain-containing protein
820 CAJPPA010000007.1 GCA905372425_00423 CDS open 40778-43936 _na     1052_aa SusC/RagA family TonB-linked outer membrane protein
821 CAJPPA010000007.1 GCA905372425_00396 gene open 43-681
822 CAJPPA010000007.1 GCA905372425_00397 gene open 832-2070
823 CAJPPA010000007.1 GCA905372425_00398 gene open 2270-3565 sufD
824 CAJPPA010000007.1 GCA905372425_00399 gene open 3628-4374 sufC
825 CAJPPA010000007.1 GCA905372425_00400 gene open 4422-5867 sufB
826 CAJPPA010000007.1 GCA905372425_00401 gene open 6368-9136 infB
827 CAJPPA010000007.1 GCA905372425_00402 gene open 9206-10471 nusA
828 CAJPPA010000007.1 GCA905372425_00403 gene open 10476-10943 rimP
829 CAJPPA010000007.1 GCA905372425_00404 gene open 12077-13597 gpmI
830 CAJPPA010000007.1 GCA905372425_00405 gene open 13602-14264 ung
831 CAJPPA010000007.1 GCA905372425_00406 gene open 14411-15013
832 CAJPPA010000007.1 GCA905372425_00407 gene open 15165-16007
833 CAJPPA010000007.1 GCA905372425_00408 gene open 16087-16950
834 CAJPPA010000007.1 GCA905372425_00409 gene open 17033-18055
835 CAJPPA010000007.1 GCA905372425_00410 gene open 18223-20193 gyrB
836 CAJPPA010000007.1 GCA905372425_00411 gene open 20636-21346
837 CAJPPA010000007.1 GCA905372425_00412 gene open 21441-22766
838 CAJPPA010000007.1 GCA905372425_00413 gene open 22888-25032
839 CAJPPA010000007.1 GCA905372425_00414 gene open 25604-26731
840 CAJPPA010000007.1 GCA905372425_00415 gene open 26728-27915
841 CAJPPA010000007.1 GCA905372425_00416 gene open 27929-29179
842 CAJPPA010000007.1 GCA905372425_00417 gene open 29176-30957
843 CAJPPA010000007.1 GCA905372425_00418 gene open 31029-32144
844 CAJPPA010000007.1 GCA905372425_00419 gene open 32141-33874
845 CAJPPA010000007.1 GCA905372425_00420 gene open 34184-35839
846 CAJPPA010000007.1 GCA905372425_00421 gene open 35902-38766
847 CAJPPA010000007.1 GCA905372425_00422 gene open 38806-40731
848 CAJPPA010000007.1 GCA905372425_00423 gene open 40778-43936
849 CAJPPA010000008.1 GCA905372425_00424 CDS open 66-1199 _na     377_aa Efflux transporter%2C RND family%2C MFP subunit
850 CAJPPA010000008.1 GCA905372425_00425 CDS open 1313-2557 _na     414_aa macB Macrolide export ATP-binding/permease protein MacB
851 CAJPPA010000008.1 GCA905372425_00426 CDS open 2587-3846 _na     419_aa ABC3 transporter permease protein domain-containing protein
852 CAJPPA010000008.1 GCA905372425_00427 CDS open 4043-4762 _na     239_aa ABC transporter domain-containing protein
853 CAJPPA010000008.1 GCA905372425_00428 CDS open 4819-6495 _na     558_aa ABC transporter ATP-binding protein
854 CAJPPA010000008.1 GCA905372425_00429 CDS open 6492-7319 _na     275_aa NAD kinase
855 CAJPPA010000008.1 GCA905372425_00430 CDS open 7386-7955 _na     189_aa DJ-1 family glyoxalase III
856 CAJPPA010000008.1 GCA905372425_00431 CDS open 7961-8629 _na     222_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
857 CAJPPA010000008.1 GCA905372425_00432 CDS open 8626-10728 _na     700_aa recG ATP-dependent DNA helicase RecG
858 CAJPPA010000008.1 GCA905372425_00433 CDS open 10946-11902 _na     318_aa lysM LysM domain-containing protein
859 CAJPPA010000008.1 GCA905372425_00434 CDS open 11958-12128 _na     56_aa hypothetical protein
860 CAJPPA010000008.1 GCA905372425_00435 CDS open 12582-13619 _na     345_aa Peptidase M28 domain-containing protein
861 CAJPPA010000008.1 GCA905372425_00436 CDS open 13626-14282 _na     218_aa DUF4294 domain-containing protein
862 CAJPPA010000008.1 GCA905372425_00437 CDS open 14488-16071 _na     527_aa Glycerol-3-phosphate dehydrogenase
863 CAJPPA010000008.1 GCA905372425_00438 CDS open 16288-17256 _na     322_aa HTH araC/xylS-type domain-containing protein
864 CAJPPA010000008.1 GCA905372425_00439 CDS open 17253-17651 _na     132_aa GtrA/DPMS transmembrane domain-containing protein
865 CAJPPA010000008.1 GCA905372425_00440 CDS open 17620-18207 _na     195_aa HAD phosphoserine phosphatase-like hydrolase%2C family IB
866 CAJPPA010000008.1 GCA905372425_00441 CDS open 18207-19094 _na     295_aa decaprenyl-phosphate phosphoribosyltransferase
867 CAJPPA010000008.1 GCA905372425_00442 CDS open 19091-20089 _na     332_aa Acyltransferase 3 domain-containing protein
868 CAJPPA010000008.1 GCA905372425_00443 CDS open 20103-21176 _na     357_aa Acyltransferase 3 domain-containing protein
869 CAJPPA010000008.1 GCA905372425_00444 CDS open 21173-23002 _na     609_aa Sulfatase N-terminal domain-containing protein
870 CAJPPA010000008.1 GCA905372425_00445 CDS open 23190-24143 _na     317_aa Lipoprotein
871 CAJPPA010000008.1 GCA905372425_00446 CDS open 24558-25142 _na     194_aa thymidine kinase
872 CAJPPA010000008.1 GCA905372425_00447 CDS open 25148-26254 _na     368_aa AI-2E family transporter
873 CAJPPA010000008.1 GCA905372425_00449 CDS open 26596-27684 _na     362_aa Calcineurin-like phosphoesterase domain-containing protein
874 CAJPPA010000008.1 GCA905372425_00450 CDS open 27748-28485 _na     245_aa Nitroreductase domain-containing protein
875 CAJPPA010000008.1 GCA905372425_00451 CDS open 29227-30675 _na     482_aa PTS EIIC type-2 domain-containing protein
876 CAJPPA010000008.1 GCA905372425_00452 CDS open 30678-31610 _na     310_aa kduI 5-dehydro-4-deoxy-D-glucuronate isomerase
877 CAJPPA010000008.1 GCA905372425_00453 CDS open 31629-33086 _na     485_aa Major facilitator superfamily (MFS) profile domain-containing protein
878 CAJPPA010000008.1 GCA905372425_00454 CDS open 33221-33622 _na     133_aa FMN-binding domain-containing protein
879 CAJPPA010000008.1 GCA905372425_00455 CDS open 33786-34310 _na     174_aa outer membrane beta-barrel protein
880 CAJPPA010000008.1 GCA905372425_00456 CDS open 34797-35012 _na     71_aa hypothetical protein
881 CAJPPA010000008.1 GCA905372425_00457 CDS open 35119-35850 _na     243_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
882 CAJPPA010000008.1 GCA905372425_00458 CDS open 35822-35992 _na     56_aa hypothetical protein
883 CAJPPA010000008.1 GCA905372425_00459 CDS open 36341-36988 _na     215_aa rlpA septal ring lytic transglycosylase RlpA family protein
884 CAJPPA010000008.1 GCA905372425_00460 CDS open 37128-37955 _na     275_aa Glycine zipper domain-containing protein
885 CAJPPA010000008.1 GCA905372425_00461 CDS open 38359-38892 _na     177_aa rplQ 50S ribosomal protein L17
886 CAJPPA010000008.1 GCA905372425_00462 CDS open 38926-39918 _na     330_aa rpoA DNA-directed RNA polymerase subunit alpha
887 CAJPPA010000008.1 GCA905372425_00463 CDS open 39931-40536 _na     201_aa rpsD 30S ribosomal protein S4
888 CAJPPA010000008.1 GCA905372425_00464 CDS open 40572-40961 _na     129_aa rpsK 30S ribosomal protein S11
889 CAJPPA010000008.1 GCA905372425_00465 CDS open 40981-41361 _na     126_aa rpsM 30S ribosomal protein S13
890 CAJPPA010000008.1 GCA905372425_00466 CDS open 41607-41825 _na     72_aa infA translation initiation factor IF-1
891 CAJPPA010000008.1 GCA905372425_00467 CDS open 41848-42633 _na     261_aa map type I methionyl aminopeptidase
892 CAJPPA010000008.1 GCA905372425_00468 CDS open 42648-43136 _na     162_aa secY Preprotein translocase subunit SecY
893 CAJPPA010000008.1 GCA905372425_00424 gene open 66-1199
894 CAJPPA010000008.1 GCA905372425_00425 gene open 1313-2557 macB
895 CAJPPA010000008.1 GCA905372425_00426 gene open 2587-3846
896 CAJPPA010000008.1 GCA905372425_00427 gene open 4043-4762
897 CAJPPA010000008.1 GCA905372425_00428 gene open 4819-6495
898 CAJPPA010000008.1 GCA905372425_00429 gene open 6492-7319
899 CAJPPA010000008.1 GCA905372425_00430 gene open 7386-7955
900 CAJPPA010000008.1 GCA905372425_00431 gene open 7961-8629
901 CAJPPA010000008.1 GCA905372425_00432 gene open 8626-10728 recG
902 CAJPPA010000008.1 GCA905372425_00433 gene open 10946-11902 lysM
903 CAJPPA010000008.1 GCA905372425_00434 gene open 11958-12128
904 CAJPPA010000008.1 GCA905372425_00435 gene open 12582-13619
905 CAJPPA010000008.1 GCA905372425_00436 gene open 13626-14282
906 CAJPPA010000008.1 GCA905372425_00437 gene open 14488-16071
907 CAJPPA010000008.1 GCA905372425_00438 gene open 16288-17256
908 CAJPPA010000008.1 GCA905372425_00439 gene open 17253-17651
909 CAJPPA010000008.1 GCA905372425_00440 gene open 17620-18207
910 CAJPPA010000008.1 GCA905372425_00441 gene open 18207-19094
911 CAJPPA010000008.1 GCA905372425_00442 gene open 19091-20089
912 CAJPPA010000008.1 GCA905372425_00443 gene open 20103-21176
913 CAJPPA010000008.1 GCA905372425_00444 gene open 21173-23002
914 CAJPPA010000008.1 GCA905372425_00445 gene open 23190-24143
915 CAJPPA010000008.1 GCA905372425_00446 gene open 24558-25142
916 CAJPPA010000008.1 GCA905372425_00447 gene open 25148-26254
917 CAJPPA010000008.1 GCA905372425_00449 gene open 26596-27684
918 CAJPPA010000008.1 GCA905372425_00450 gene open 27748-28485
919 CAJPPA010000008.1 GCA905372425_00451 gene open 29227-30675
920 CAJPPA010000008.1 GCA905372425_00452 gene open 30678-31610 kduI
921 CAJPPA010000008.1 GCA905372425_00453 gene open 31629-33086
922 CAJPPA010000008.1 GCA905372425_00454 gene open 33221-33622
923 CAJPPA010000008.1 GCA905372425_00455 gene open 33786-34310
924 CAJPPA010000008.1 GCA905372425_00456 gene open 34797-35012
925 CAJPPA010000008.1 GCA905372425_00457 gene open 35119-35850
926 CAJPPA010000008.1 GCA905372425_00458 gene open 35822-35992
927 CAJPPA010000008.1 GCA905372425_00459 gene open 36341-36988 rlpA
928 CAJPPA010000008.1 GCA905372425_00460 gene open 37128-37955
929 CAJPPA010000008.1 GCA905372425_00461 gene open 38359-38892 rplQ
930 CAJPPA010000008.1 GCA905372425_00462 gene open 38926-39918 rpoA
931 CAJPPA010000008.1 GCA905372425_00463 gene open 39931-40536 rpsD
932 CAJPPA010000008.1 GCA905372425_00464 gene open 40572-40961 rpsK
933 CAJPPA010000008.1 GCA905372425_00465 gene open 40981-41361 rpsM
934 CAJPPA010000008.1 GCA905372425_00466 gene open 41607-41825 infA
935 CAJPPA010000008.1 GCA905372425_00467 gene open 41848-42633 map
936 CAJPPA010000008.1 GCA905372425_00468 gene open 42648-43136 secY
937 CAJPPA010000008.1 GCA905372425_00448 gene open 26436-26511 trnK
938 CAJPPA010000008.1 GCA905372425_00448 tRNA open 26436-26511 trnK tRNA-Lys(ttt)
939 CAJPPA010000009.1 GCA905372425_00469 CDS open 182-1411 _na     409_aa anaerobic sulfatase-maturation protein
940 CAJPPA010000009.1 GCA905372425_00470 CDS open 1775-2434 _na     219_aa upp uracil phosphoribosyltransferase
941 CAJPPA010000009.1 GCA905372425_00471 CDS open 2677-4290 _na     537_aa pckA phosphoenolpyruvate carboxykinase (ATP)
942 CAJPPA010000009.1 GCA905372425_00472 CDS open 4693-5013 _na     106_aa Methylated-DNA-[protein]-cysteine S-methyltransferase DNA binding domain-containing protein
943 CAJPPA010000009.1 GCA905372425_00473 CDS open 5000-5812 _na     270_aa Outer membrane protein beta-barrel domain-containing protein
944 CAJPPA010000009.1 GCA905372425_00474 CDS open 5927-6523 _na     198_aa Acetyltransferase
945 CAJPPA010000009.1 GCA905372425_00475 CDS open 6838-9018 _na     726_aa Beta-xylanase
946 CAJPPA010000009.1 GCA905372425_00476 CDS open 9050-10117 _na     355_aa Adhesin
947 CAJPPA010000009.1 GCA905372425_00477 CDS open 10136-11941 _na     601_aa RagB/SusD domain-containing protein
948 CAJPPA010000009.1 GCA905372425_00478 CDS open 11967-14834 _na     955_aa SusC/RagA family TonB-linked outer membrane protein
949 CAJPPA010000009.1 GCA905372425_00479 CDS open 15211-17151 _na     646_aa RagB/SusD domain-containing protein
950 CAJPPA010000009.1 GCA905372425_00480 CDS open 17171-20317 _na     1048_aa SusC/RagA family TonB-linked outer membrane protein
951 CAJPPA010000009.1 GCA905372425_00481 CDS open 20452-23028 _na     858_aa xyl3A xylan 1%2C4-beta-xylosidase
952 CAJPPA010000009.1 GCA905372425_00482 CDS open 23151-25229 _na     692_aa Glycoside hydrolase family 5 domain-containing protein
953 CAJPPA010000009.1 GCA905372425_00483 CDS open 25377-27926 _na     849_aa Gylcosyl hydrolase 115 C-terminal domain-containing protein
954 CAJPPA010000009.1 GCA905372425_00484 CDS open 28015-29958 _na     647_aa Sialate O-acetylesterase domain-containing protein
955 CAJPPA010000009.1 GCA905372425_00485 CDS open 30210-30815 _na     201_aa Lipoprotein
956 CAJPPA010000009.1 GCA905372425_00486 CDS open 31337-32095 _na     252_aa sdhB Fumarate reductase subunit B
957 CAJPPA010000009.1 GCA905372425_00487 CDS open 32102-34084 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
958 CAJPPA010000009.1 GCA905372425_00488 CDS open 34123-34809 _na     228_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
959 CAJPPA010000009.1 GCA905372425_00489 CDS open 35057-36931 _na     624_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
960 CAJPPA010000009.1 GCA905372425_00490 CDS open 37096-37626 _na     176_aa adenine phosphoribosyltransferase
961 CAJPPA010000009.1 GCA905372425_00491 CDS open 37701-39548 _na     615_aa uvrC excinuclease ABC subunit UvrC
962 CAJPPA010000009.1 GCA905372425_00492 CDS open 39568-40020 _na     150_aa dtd D-aminoacyl-tRNA deacylase
963 CAJPPA010000009.1 GCA905372425_00493 CDS open 40275-40598 _na     107_aa nucleotide pyrophosphohydrolase
964 CAJPPA010000009.1 GCA905372425_00494 CDS open 40618-41559 _na     313_aa deoC deoxyribose-phosphate aldolase
965 CAJPPA010000009.1 GCA905372425_00495 CDS open 41656-43011 _na     451_aa WG repeat-containing protein
966 CAJPPA010000009.1 GCA905372425_00469 gene open 182-1411
967 CAJPPA010000009.1 GCA905372425_00470 gene open 1775-2434 upp
968 CAJPPA010000009.1 GCA905372425_00471 gene open 2677-4290 pckA
969 CAJPPA010000009.1 GCA905372425_00472 gene open 4693-5013
970 CAJPPA010000009.1 GCA905372425_00473 gene open 5000-5812
971 CAJPPA010000009.1 GCA905372425_00474 gene open 5927-6523
972 CAJPPA010000009.1 GCA905372425_00475 gene open 6838-9018
973 CAJPPA010000009.1 GCA905372425_00476 gene open 9050-10117
974 CAJPPA010000009.1 GCA905372425_00477 gene open 10136-11941
975 CAJPPA010000009.1 GCA905372425_00478 gene open 11967-14834
976 CAJPPA010000009.1 GCA905372425_00479 gene open 15211-17151
977 CAJPPA010000009.1 GCA905372425_00480 gene open 17171-20317
978 CAJPPA010000009.1 GCA905372425_00481 gene open 20452-23028 xyl3A
979 CAJPPA010000009.1 GCA905372425_00482 gene open 23151-25229
980 CAJPPA010000009.1 GCA905372425_00483 gene open 25377-27926
981 CAJPPA010000009.1 GCA905372425_00484 gene open 28015-29958
982 CAJPPA010000009.1 GCA905372425_00485 gene open 30210-30815
983 CAJPPA010000009.1 GCA905372425_00486 gene open 31337-32095 sdhB
984 CAJPPA010000009.1 GCA905372425_00487 gene open 32102-34084 sdhA
985 CAJPPA010000009.1 GCA905372425_00488 gene open 34123-34809
986 CAJPPA010000009.1 GCA905372425_00489 gene open 35057-36931 mnmG
987 CAJPPA010000009.1 GCA905372425_00490 gene open 37096-37626
988 CAJPPA010000009.1 GCA905372425_00491 gene open 37701-39548 uvrC
989 CAJPPA010000009.1 GCA905372425_00492 gene open 39568-40020 dtd
990 CAJPPA010000009.1 GCA905372425_00493 gene open 40275-40598
991 CAJPPA010000009.1 GCA905372425_00494 gene open 40618-41559 deoC
992 CAJPPA010000009.1 GCA905372425_00495 gene open 41656-43011
993 CAJPPA010000010.1 GCA905372425_00496 CDS open 14-1639 _na     541_aa 5'-Nucleotidase C-terminal domain-containing protein
994 CAJPPA010000010.1 GCA905372425_00497 CDS open 2184-2576 _na     130_aa DUF1573 domain-containing protein
995 CAJPPA010000010.1 GCA905372425_00498 CDS open 2576-3352 _na     258_aa 4Fe-4S ferredoxin-type domain-containing protein
996 CAJPPA010000010.1 GCA905372425_00499 CDS open 3385-5091 _na     568_aa M6 family metalloprotease domain-containing protein
997 CAJPPA010000010.1 GCA905372425_00500 CDS open 5561-5908 _na     115_aa hypothetical protein
998 CAJPPA010000010.1 GCA905372425_00501 CDS open 5735-6340 _na     201_aa HTH luxR-type domain-containing protein
999 CAJPPA010000010.1 GCA905372425_00502 CDS open 6390-7655 _na     421_aa cls cardiolipin synthase
1000 CAJPPA010000010.1 GCA905372425_00503 CDS open 7680-8657 _na     325_aa Sugar isomerase%2C KpsF/GutQ family