HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Segatella maculosa (GCA_905372425.1)

Select a Genome:
BAKTA Annotations for GCA_905372425.1
Genome Selected: Segatella maculosa
ContigsBases CDSrRNA tmRNAtRNA
165 2693241 2139 0 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4357 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4357 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAJPPA010000029.1 GCA905372425_00998 gene open 19415-19684
2002 CAJPPA010000029.1 GCA905372425_00999 gene open 19734-20441 pssA
2003 CAJPPA010000029.1 GCA905372425_01000 gene open 20441-21133
2004 CAJPPA010000029.1 GCA905372425_01001 gene open 21271-24975 dnaE
2005 CAJPPA010000029.1 GCA905372425_01002 gene open 25066-25380 trxA
2006 CAJPPA010000030.1 GCA905372425_01003 CDS open 248-1240 _na     330_aa TIGR00374 family protein
2007 CAJPPA010000030.1 GCA905372425_01004 CDS open 1233-2315 _na     360_aa 4-hydroxythreonine-4-phosphate dehydrogenase
2008 CAJPPA010000030.1 GCA905372425_01005 CDS open 2305-2904 _na     199_aa gldD Gliding motility-associated lipoprotein GldD
2009 CAJPPA010000030.1 GCA905372425_01006 CDS open 2894-3940 _na     348_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
2010 CAJPPA010000030.1 GCA905372425_01007 CDS open 4526-8269 _na     1247_aa SpoIID/LytB domain-containing protein
2011 CAJPPA010000030.1 GCA905372425_01008 CDS open 8275-9561 _na     428_aa Major facilitator superfamily (MFS) profile domain-containing protein
2012 CAJPPA010000030.1 GCA905372425_01009 CDS open 9564-9779 _na     71_aa hypothetical protein
2013 CAJPPA010000030.1 GCA905372425_01010 CDS open 10156-10833 _na     225_aa yfcE phosphodiesterase
2014 CAJPPA010000030.1 GCA905372425_01011 CDS open 10875-11963 _na     362_aa NadR/Ttd14 AAA domain-containing protein
2015 CAJPPA010000030.1 GCA905372425_01012 CDS open 12021-12491 _na     156_aa HTH araC/xylS-type domain-containing protein
2016 CAJPPA010000030.1 GCA905372425_01013 CDS open 12680-13516 _na     278_aa C4-type zinc ribbon domain-containing protein
2017 CAJPPA010000030.1 GCA905372425_01014 CDS open 13523-14311 _na     262_aa Nif3-like dinuclear metal center hexameric protein
2018 CAJPPA010000030.1 GCA905372425_01015 CDS open 14390-15265 _na     291_aa Endonuclease
2019 CAJPPA010000030.1 GCA905372425_01016 CDS open 15262-16071 _na     269_aa TIGR00245 family protein
2020 CAJPPA010000030.1 GCA905372425_01017 CDS open 16068-16670 _na     200_aa ABC transporter domain-containing protein
2021 CAJPPA010000030.1 GCA905372425_01018 CDS open 16799-17809 _na     336_aa Agmatine deiminase
2022 CAJPPA010000030.1 GCA905372425_01019 CDS open 17806-18693 _na     295_aa CN hydrolase domain-containing protein
2023 CAJPPA010000030.1 GCA905372425_01020 CDS open 18814-19626 _na     270_aa TIGR00027 family methyltransferase
2024 CAJPPA010000030.1 GCA905372425_01021 CDS open 20174-22396 _na     740_aa anaerobic ribonucleoside triphosphate reductase
2025 CAJPPA010000030.1 GCA905372425_01022 CDS open 22456-22965 _na     169_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
2026 CAJPPA010000030.1 GCA905372425_01023 CDS open 23061-23510 _na     149_aa Type I restriction enzyme R protein N-terminal domain-containing protein
2027 CAJPPA010000030.1 GCA905372425_01024 CDS open 23622-24656 _na     344_aa holA DNA polymerase III subunit delta
2028 CAJPPA010000030.1 GCA905372425_01003 gene open 248-1240
2029 CAJPPA010000030.1 GCA905372425_01004 gene open 1233-2315
2030 CAJPPA010000030.1 GCA905372425_01005 gene open 2305-2904 gldD
2031 CAJPPA010000030.1 GCA905372425_01006 gene open 2894-3940 rlmN
2032 CAJPPA010000030.1 GCA905372425_01007 gene open 4526-8269
2033 CAJPPA010000030.1 GCA905372425_01008 gene open 8275-9561
2034 CAJPPA010000030.1 GCA905372425_01009 gene open 9564-9779
2035 CAJPPA010000030.1 GCA905372425_01010 gene open 10156-10833 yfcE
2036 CAJPPA010000030.1 GCA905372425_01011 gene open 10875-11963
2037 CAJPPA010000030.1 GCA905372425_01012 gene open 12021-12491
2038 CAJPPA010000030.1 GCA905372425_01013 gene open 12680-13516
2039 CAJPPA010000030.1 GCA905372425_01014 gene open 13523-14311
2040 CAJPPA010000030.1 GCA905372425_01015 gene open 14390-15265
2041 CAJPPA010000030.1 GCA905372425_01016 gene open 15262-16071
2042 CAJPPA010000030.1 GCA905372425_01017 gene open 16068-16670
2043 CAJPPA010000030.1 GCA905372425_01018 gene open 16799-17809
2044 CAJPPA010000030.1 GCA905372425_01019 gene open 17806-18693
2045 CAJPPA010000030.1 GCA905372425_01020 gene open 18814-19626
2046 CAJPPA010000030.1 GCA905372425_01021 gene open 20174-22396
2047 CAJPPA010000030.1 GCA905372425_01022 gene open 22456-22965 nrdG
2048 CAJPPA010000030.1 GCA905372425_01023 gene open 23061-23510
2049 CAJPPA010000030.1 GCA905372425_01024 gene open 23622-24656 holA
2050 CAJPPA010000031.1 GCA905372425_01025 CDS open 323-1300 _na     325_aa pfkA 6-phosphofructokinase
2051 CAJPPA010000031.1 GCA905372425_01026 CDS open 1426-2952 _na     508_aa atpD F0F1 ATP synthase subunit beta
2052 CAJPPA010000031.1 GCA905372425_01027 CDS open 3004-3246 _na     80_aa atpC ATP synthase F1 subunit epsilon
2053 CAJPPA010000031.1 GCA905372425_01028 CDS open 3256-3660 _na     134_aa ATP synthase I
2054 CAJPPA010000031.1 GCA905372425_01029 CDS open 3690-4739 _na     349_aa atpB F0F1 ATP synthase subunit A
2055 CAJPPA010000031.1 GCA905372425_01030 CDS open 4806-5045 _na     79_aa atpE ATP synthase F0 subunit C
2056 CAJPPA010000031.1 GCA905372425_01031 CDS open 5063-5581 _na     172_aa atpF F0F1 ATP synthase subunit B
2057 CAJPPA010000031.1 GCA905372425_01032 CDS open 5594-6130 _na     178_aa F0F1 ATP synthase subunit delta
2058 CAJPPA010000031.1 GCA905372425_01033 CDS open 6156-7739 _na     527_aa atpA F0F1 ATP synthase subunit alpha
2059 CAJPPA010000031.1 GCA905372425_01034 CDS open 7752-8720 _na     322_aa F0F1 ATP synthase subunit gamma
2060 CAJPPA010000031.1 GCA905372425_01035 CDS open 9017-9904 _na     295_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2061 CAJPPA010000031.1 GCA905372425_01036 CDS open 10193-10627 _na     144_aa SHSP domain-containing protein
2062 CAJPPA010000031.1 GCA905372425_01037 CDS open 11017-12297 _na     426_aa Serine hydroxymethyltransferase
2063 CAJPPA010000031.1 GCA905372425_01038 CDS open 12350-12805 _na     151_aa pyrI aspartate carbamoyltransferase regulatory subunit
2064 CAJPPA010000031.1 GCA905372425_01039 CDS open 12809-13765 _na     318_aa pyrB aspartate carbamoyltransferase
2065 CAJPPA010000031.1 GCA905372425_01040 CDS open 13936-16248 _na     770_aa peptidoglycan glycosyltransferase
2066 CAJPPA010000031.1 GCA905372425_01041 CDS open 16241-16921 _na     226_aa lapB lipopolysaccharide assembly protein LapB
2067 CAJPPA010000031.1 GCA905372425_01042 CDS open 16954-17838 _na     294_aa Thymidylate synthase%2C flavin-dependent
2068 CAJPPA010000031.1 GCA905372425_01043 CDS open 18337-19455 _na     372_aa DUF4876 domain-containing protein
2069 CAJPPA010000031.1 GCA905372425_01044 CDS open 19468-20895 _na     475_aa Lipoprotein
2070 CAJPPA010000031.1 GCA905372425_01045 CDS open 20926-22353 _na     475_aa Lipoprotein
2071 CAJPPA010000031.1 GCA905372425_01046 CDS open 22383-24806 _na     807_aa TonB-dependent receptor
2072 CAJPPA010000031.1 GCA905372425_01025 gene open 323-1300 pfkA
2073 CAJPPA010000031.1 GCA905372425_01026 gene open 1426-2952 atpD
2074 CAJPPA010000031.1 GCA905372425_01027 gene open 3004-3246 atpC
2075 CAJPPA010000031.1 GCA905372425_01028 gene open 3256-3660
2076 CAJPPA010000031.1 GCA905372425_01029 gene open 3690-4739 atpB
2077 CAJPPA010000031.1 GCA905372425_01030 gene open 4806-5045 atpE
2078 CAJPPA010000031.1 GCA905372425_01031 gene open 5063-5581 atpF
2079 CAJPPA010000031.1 GCA905372425_01032 gene open 5594-6130
2080 CAJPPA010000031.1 GCA905372425_01033 gene open 6156-7739 atpA
2081 CAJPPA010000031.1 GCA905372425_01034 gene open 7752-8720
2082 CAJPPA010000031.1 GCA905372425_01035 gene open 9017-9904 dapA
2083 CAJPPA010000031.1 GCA905372425_01036 gene open 10193-10627
2084 CAJPPA010000031.1 GCA905372425_01037 gene open 11017-12297
2085 CAJPPA010000031.1 GCA905372425_01038 gene open 12350-12805 pyrI
2086 CAJPPA010000031.1 GCA905372425_01039 gene open 12809-13765 pyrB
2087 CAJPPA010000031.1 GCA905372425_01040 gene open 13936-16248
2088 CAJPPA010000031.1 GCA905372425_01041 gene open 16241-16921 lapB
2089 CAJPPA010000031.1 GCA905372425_01042 gene open 16954-17838
2090 CAJPPA010000031.1 GCA905372425_01043 gene open 18337-19455
2091 CAJPPA010000031.1 GCA905372425_01044 gene open 19468-20895
2092 CAJPPA010000031.1 GCA905372425_01045 gene open 20926-22353
2093 CAJPPA010000031.1 GCA905372425_01046 gene open 22383-24806
2094 CAJPPA010000032.1 GCA905372425_01048 CDS open 154-2382 _na     742_aa Alpha-N-acetylglucosaminidase
2095 CAJPPA010000032.1 GCA905372425_01049 CDS open 2389-2613 _na     74_aa Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein
2096 CAJPPA010000032.1 GCA905372425_01050 CDS open 2737-3468 _na     243_aa DUF5009 domain-containing protein
2097 CAJPPA010000032.1 GCA905372425_01051 CDS open 3937-5478 _na     513_aa Hemin receptor
2098 CAJPPA010000032.1 GCA905372425_01052 CDS open 5503-6549 _na     348_aa Vitellogenin II
2099 CAJPPA010000032.1 GCA905372425_01053 CDS open 6690-7550 _na     286_aa prmA 50S ribosomal protein L11 methyltransferase
2100 CAJPPA010000032.1 GCA905372425_01054 CDS open 7912-9006 _na     364_aa gmd GDP-mannose 4%2C6-dehydratase
2101 CAJPPA010000032.1 GCA905372425_01055 CDS open 9014-10081 _na     355_aa Mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase
2102 CAJPPA010000032.1 GCA905372425_01056 CDS open 10713-12056 _na     447_aa tRNA(Ile)-lysidine synthase
2103 CAJPPA010000032.1 GCA905372425_01057 CDS open 12046-13233 _na     395_aa PUA domain-containing protein
2104 CAJPPA010000032.1 GCA905372425_01058 CDS open 13267-13917 _na     216_aa 3'-5' exonuclease
2105 CAJPPA010000032.1 GCA905372425_01059 CDS open 14028-16514 _na     828_aa ftsK FtsK domain-containing protein
2106 CAJPPA010000032.1 GCA905372425_01060 CDS open 16582-16728 _na     48_aa hypothetical protein
2107 CAJPPA010000032.1 GCA905372425_01061 CDS open 16780-17046 _na     88_aa pqqD PqqD family protein
2108 CAJPPA010000032.1 GCA905372425_01062 CDS open 17063-17524 _na     153_aa Peptidase S24/S26A/S26B/S26C domain-containing protein
2109 CAJPPA010000032.1 GCA905372425_01063 CDS open 17521-18408 _na     295_aa Phosphoenolpyruvate carboxykinase
2110 CAJPPA010000032.1 GCA905372425_01064 CDS open 18451-18930 _na     159_aa Lipoprotein
2111 CAJPPA010000032.1 GCA905372425_01065 CDS open 18974-19837 _na     287_aa Sigma-70 family RNA polymerase sigma factor
2112 CAJPPA010000032.1 GCA905372425_01066 CDS open 20408-20824 _na     138_aa hypothetical protein
2113 CAJPPA010000032.1 GCA905372425_01067 CDS open 20660-21739 _na     359_aa aroC chorismate synthase
2114 CAJPPA010000032.1 GCA905372425_01068 CDS open 21758-22387 _na     209_aa peptidylprolyl isomerase
2115 CAJPPA010000032.1 GCA905372425_01069 CDS open 22578-23483 _na     301_aa dihydroorotate dehydrogenase
2116 CAJPPA010000032.1 GCA905372425_01070 CDS open 23471-24247 _na     258_aa FAD-binding FR-type domain-containing protein
2117 CAJPPA010000032.1 GCA905372425_01071 CDS open 24307-24780 _na     157_aa HTH cro/C1-type domain-containing protein
2118 CAJPPA010000032.1 GCA905372425_01048 gene open 154-2382
2119 CAJPPA010000032.1 GCA905372425_01049 gene open 2389-2613
2120 CAJPPA010000032.1 GCA905372425_01050 gene open 2737-3468
2121 CAJPPA010000032.1 GCA905372425_01051 gene open 3937-5478
2122 CAJPPA010000032.1 GCA905372425_01052 gene open 5503-6549
2123 CAJPPA010000032.1 GCA905372425_01053 gene open 6690-7550 prmA
2124 CAJPPA010000032.1 GCA905372425_01054 gene open 7912-9006 gmd
2125 CAJPPA010000032.1 GCA905372425_01055 gene open 9014-10081
2126 CAJPPA010000032.1 GCA905372425_01056 gene open 10713-12056
2127 CAJPPA010000032.1 GCA905372425_01057 gene open 12046-13233
2128 CAJPPA010000032.1 GCA905372425_01058 gene open 13267-13917
2129 CAJPPA010000032.1 GCA905372425_01059 gene open 14028-16514 ftsK
2130 CAJPPA010000032.1 GCA905372425_01060 gene open 16582-16728
2131 CAJPPA010000032.1 GCA905372425_01061 gene open 16780-17046 pqqD
2132 CAJPPA010000032.1 GCA905372425_01062 gene open 17063-17524
2133 CAJPPA010000032.1 GCA905372425_01063 gene open 17521-18408
2134 CAJPPA010000032.1 GCA905372425_01064 gene open 18451-18930
2135 CAJPPA010000032.1 GCA905372425_01065 gene open 18974-19837
2136 CAJPPA010000032.1 GCA905372425_01066 gene open 20408-20824
2137 CAJPPA010000032.1 GCA905372425_01067 gene open 20660-21739 aroC
2138 CAJPPA010000032.1 GCA905372425_01068 gene open 21758-22387
2139 CAJPPA010000032.1 GCA905372425_01069 gene open 22578-23483
2140 CAJPPA010000032.1 GCA905372425_01070 gene open 23471-24247
2141 CAJPPA010000032.1 GCA905372425_01071 gene open 24307-24780
2142 CAJPPA010000032.1 GCA905372425_01047 gene open 1-50 trnK
2143 CAJPPA010000032.1 GCA905372425_01047 tRNA open 1-50 trnK tRNA-Lys(ctt)
2144 CAJPPA010000033.1 GCA905372425_01072 CDS open 356-2533 _na     725_aa recQ DNA helicase RecQ
2145 CAJPPA010000033.1 GCA905372425_01073 CDS open 2636-3874 _na     412_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
2146 CAJPPA010000033.1 GCA905372425_01074 CDS open 3878-4543 _na     221_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
2147 CAJPPA010000033.1 GCA905372425_01075 CDS open 4713-5150 _na     145_aa hypothetical protein
2148 CAJPPA010000033.1 GCA905372425_01076 CDS open 5207-6064 _na     285_aa tig trigger factor
2149 CAJPPA010000033.1 GCA905372425_01077 CDS open 6434-7069 _na     211_aa Bacterial sugar transferase domain-containing protein
2150 CAJPPA010000033.1 GCA905372425_01078 CDS open 7117-7923 _na     268_aa Glycosyltransferase 2-like domain-containing protein
2151 CAJPPA010000033.1 GCA905372425_01079 CDS open 7985-8854 _na     289_aa Glycosyl transferase family 11
2152 CAJPPA010000033.1 GCA905372425_01080 CDS open 8841-9608 _na     255_aa Glycosyltransferase 2-like domain-containing protein
2153 CAJPPA010000033.1 GCA905372425_01081 CDS open 9601-10845 _na     414_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2154 CAJPPA010000033.1 GCA905372425_01082 CDS open 11504-11974 _na     156_aa hypothetical protein
2155 CAJPPA010000033.1 GCA905372425_01083 CDS open 12075-13655 _na     526_aa Tyrosine kinase G-rich domain-containing protein
2156 CAJPPA010000033.1 GCA905372425_01084 CDS open 13666-14427 _na     253_aa Soluble ligand binding domain-containing protein
2157 CAJPPA010000033.1 GCA905372425_01085 CDS open 14424-15032 _na     202_aa hypothetical protein
2158 CAJPPA010000033.1 GCA905372425_01086 CDS open 15553-16188 _na     211_aa udk uridine kinase
2159 CAJPPA010000033.1 GCA905372425_01087 CDS open 16252-16836 _na     194_aa Uracil-DNA glycosylase-like domain-containing protein
2160 CAJPPA010000033.1 GCA905372425_01088 CDS open 16856-17962 _na     368_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2161 CAJPPA010000033.1 GCA905372425_01089 CDS open 18012-18104 _na     30_aa hypothetical protein
2162 CAJPPA010000033.1 GCA905372425_01090 CDS open 18108-20639 _na     843_aa TonB-dependent receptor
2163 CAJPPA010000033.1 GCA905372425_01091 CDS open 20659-21495 _na     278_aa DUF5689 domain-containing protein
2164 CAJPPA010000033.1 GCA905372425_01092 CDS open 21530-22843 _na     437_aa yhcR Endonuclease YhcR N-terminal domain-containing protein
2165 CAJPPA010000033.1 GCA905372425_01093 CDS open 22947-23198 _na     83_aa rpmE type B 50S ribosomal protein L31
2166 CAJPPA010000033.1 GCA905372425_01094 CDS open 23292-24260 _na     322_aa DNA/RNA non-specific endonuclease
2167 CAJPPA010000033.1 GCA905372425_01072 gene open 356-2533 recQ
2168 CAJPPA010000033.1 GCA905372425_01073 gene open 2636-3874 clpX
2169 CAJPPA010000033.1 GCA905372425_01074 gene open 3878-4543 clpP
2170 CAJPPA010000033.1 GCA905372425_01075 gene open 4713-5150
2171 CAJPPA010000033.1 GCA905372425_01076 gene open 5207-6064 tig
2172 CAJPPA010000033.1 GCA905372425_01077 gene open 6434-7069
2173 CAJPPA010000033.1 GCA905372425_01078 gene open 7117-7923
2174 CAJPPA010000033.1 GCA905372425_01079 gene open 7985-8854
2175 CAJPPA010000033.1 GCA905372425_01080 gene open 8841-9608
2176 CAJPPA010000033.1 GCA905372425_01081 gene open 9601-10845
2177 CAJPPA010000033.1 GCA905372425_01082 gene open 11504-11974
2178 CAJPPA010000033.1 GCA905372425_01083 gene open 12075-13655
2179 CAJPPA010000033.1 GCA905372425_01084 gene open 13666-14427
2180 CAJPPA010000033.1 GCA905372425_01085 gene open 14424-15032
2181 CAJPPA010000033.1 GCA905372425_01086 gene open 15553-16188 udk
2182 CAJPPA010000033.1 GCA905372425_01087 gene open 16252-16836
2183 CAJPPA010000033.1 GCA905372425_01088 gene open 16856-17962
2184 CAJPPA010000033.1 GCA905372425_01089 gene open 18012-18104
2185 CAJPPA010000033.1 GCA905372425_01090 gene open 18108-20639
2186 CAJPPA010000033.1 GCA905372425_01091 gene open 20659-21495
2187 CAJPPA010000033.1 GCA905372425_01092 gene open 21530-22843 yhcR
2188 CAJPPA010000033.1 GCA905372425_01093 gene open 22947-23198 rpmE
2189 CAJPPA010000033.1 GCA905372425_01094 gene open 23292-24260
2190 CAJPPA010000034.1 GCA905372425_01095 CDS open 463-1080 _na     205_aa ruvA Holliday junction branch migration protein RuvA
2191 CAJPPA010000034.1 GCA905372425_01096 CDS open 1136-8587 _na     2483_aa sprA cell surface protein SprA
2192 CAJPPA010000034.1 GCA905372425_01097 CDS open 8613-9245 _na     210_aa N-acetyltransferase domain-containing protein
2193 CAJPPA010000034.1 GCA905372425_01098 CDS open 9448-11520 _na     690_aa Sulfatase N-terminal domain-containing protein
2194 CAJPPA010000034.1 GCA905372425_01099 CDS open 11755-12297 _na     180_aa TonB-dependent receptor plug domain-containing protein
2195 CAJPPA010000034.1 GCA905372425_01100 CDS open 12272-14125 _na     617_aa mutS DNA mismatch repair proteins mutS family domain-containing protein
2196 CAJPPA010000034.1 GCA905372425_01101 CDS open 14774-18502 _na     1242_aa purL phosphoribosylformylglycinamidine synthase
2197 CAJPPA010000034.1 GCA905372425_01102 CDS open 18522-19058 _na     178_aa Chromate ion transporter (CHR) family chromate transporter
2198 CAJPPA010000034.1 GCA905372425_01103 CDS open 19069-19641 _na     190_aa Chromate transporter
2199 CAJPPA010000034.1 GCA905372425_01104 CDS open 19890-20789 _na     299_aa diaminopimelate dehydrogenase
2200 CAJPPA010000034.1 GCA905372425_01105 CDS open 21055-21981 _na     308_aa corA Magnesium and cobalt transporter CorA
2201 CAJPPA010000034.1 GCA905372425_01106 CDS open 22108-23916 _na     602_aa DUF349 domain-containing protein
2202 CAJPPA010000034.1 GCA905372425_01095 gene open 463-1080 ruvA
2203 CAJPPA010000034.1 GCA905372425_01096 gene open 1136-8587 sprA
2204 CAJPPA010000034.1 GCA905372425_01097 gene open 8613-9245
2205 CAJPPA010000034.1 GCA905372425_01098 gene open 9448-11520
2206 CAJPPA010000034.1 GCA905372425_01099 gene open 11755-12297
2207 CAJPPA010000034.1 GCA905372425_01100 gene open 12272-14125 mutS
2208 CAJPPA010000034.1 GCA905372425_01101 gene open 14774-18502 purL
2209 CAJPPA010000034.1 GCA905372425_01102 gene open 18522-19058
2210 CAJPPA010000034.1 GCA905372425_01103 gene open 19069-19641
2211 CAJPPA010000034.1 GCA905372425_01104 gene open 19890-20789
2212 CAJPPA010000034.1 GCA905372425_01105 gene open 21055-21981 corA
2213 CAJPPA010000034.1 GCA905372425_01106 gene open 22108-23916
2214 CAJPPA010000035.1 GCA905372425_01107 CDS open 397-1080 _na     227_aa HTH crp-type domain-containing protein
2215 CAJPPA010000035.1 GCA905372425_01108 CDS open 1241-1420 _na     59_aa DUF4250 domain-containing protein
2216 CAJPPA010000035.1 GCA905372425_01109 CDS open 1526-3235 _na     569_aa phoU PhoU domain-containing protein
2217 CAJPPA010000035.1 GCA905372425_01110 CDS open 3305-5023 _na     572_aa Phosphoribulokinase/uridine kinase domain-containing protein
2218 CAJPPA010000035.1 GCA905372425_01112 CDS open 5419-6783 _na     454_aa nhaD sodium:proton antiporter NhaD
2219 CAJPPA010000035.1 GCA905372425_01113 CDS open 6879-7481 _na     200_aa DUF6621 domain-containing protein
2220 CAJPPA010000035.1 GCA905372425_01114 CDS open 7488-8726 _na     412_aa Saccharopine dehydrogenase
2221 CAJPPA010000035.1 GCA905372425_01115 CDS open 8751-9770 _na     339_aa recA recombinase RecA
2222 CAJPPA010000035.1 GCA905372425_01116 CDS open 10445-10906 _na     153_aa Putative DNA-binding protein
2223 CAJPPA010000035.1 GCA905372425_01117 CDS open 10988-11431 _na     147_aa Peptidase M15A C-terminal domain-containing protein
2224 CAJPPA010000035.1 GCA905372425_01118 CDS open 11711-12076 _na     121_aa rteC RteC protein
2225 CAJPPA010000035.1 GCA905372425_01119 CDS open 12220-12657 _na     145_aa hypothetical protein
2226 CAJPPA010000035.1 GCA905372425_01120 CDS open 12669-13616 _na     315_aa hypothetical protein
2227 CAJPPA010000035.1 GCA905372425_01121 CDS open 14151-15212 _na     353_aa FERM and PDZ domain-containing protein 3
2228 CAJPPA010000035.1 GCA905372425_01122 CDS open 15747-16373 _na     208_aa hypothetical protein
2229 CAJPPA010000035.1 GCA905372425_01123 CDS open 16603-17985 _na     460_aa rseP RIP metalloprotease RseP
2230 CAJPPA010000035.1 GCA905372425_01124 CDS open 18034-19197 _na     387_aa 1-deoxy-D-xylulose-5-phosphate reductoisomerase
2231 CAJPPA010000035.1 GCA905372425_01125 CDS open 19214-19735 _na     173_aa rimM ribosome maturation factor RimM
2232 CAJPPA010000035.1 GCA905372425_01126 CDS open 19736-21046 _na     436_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2233 CAJPPA010000035.1 GCA905372425_01127 CDS open 21049-21651 _na     200_aa DUF4290 domain-containing protein
2234 CAJPPA010000035.1 GCA905372425_01128 CDS open 21653-22345 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
2235 CAJPPA010000035.1 GCA905372425_01129 CDS open 22435-23313 _na     292_aa TIGR00255 family protein
2236 CAJPPA010000035.1 GCA905372425_01107 gene open 397-1080
2237 CAJPPA010000035.1 GCA905372425_01108 gene open 1241-1420
2238 CAJPPA010000035.1 GCA905372425_01109 gene open 1526-3235 phoU
2239 CAJPPA010000035.1 GCA905372425_01110 gene open 3305-5023
2240 CAJPPA010000035.1 GCA905372425_01112 gene open 5419-6783 nhaD
2241 CAJPPA010000035.1 GCA905372425_01113 gene open 6879-7481
2242 CAJPPA010000035.1 GCA905372425_01114 gene open 7488-8726
2243 CAJPPA010000035.1 GCA905372425_01115 gene open 8751-9770 recA
2244 CAJPPA010000035.1 GCA905372425_01116 gene open 10445-10906
2245 CAJPPA010000035.1 GCA905372425_01117 gene open 10988-11431
2246 CAJPPA010000035.1 GCA905372425_01118 gene open 11711-12076 rteC
2247 CAJPPA010000035.1 GCA905372425_01119 gene open 12220-12657
2248 CAJPPA010000035.1 GCA905372425_01120 gene open 12669-13616
2249 CAJPPA010000035.1 GCA905372425_01121 gene open 14151-15212
2250 CAJPPA010000035.1 GCA905372425_01122 gene open 15747-16373
2251 CAJPPA010000035.1 GCA905372425_01123 gene open 16603-17985 rseP
2252 CAJPPA010000035.1 GCA905372425_01124 gene open 18034-19197
2253 CAJPPA010000035.1 GCA905372425_01125 gene open 19214-19735 rimM
2254 CAJPPA010000035.1 GCA905372425_01126 gene open 19736-21046 murA
2255 CAJPPA010000035.1 GCA905372425_01127 gene open 21049-21651
2256 CAJPPA010000035.1 GCA905372425_01128 gene open 21653-22345 tsaB
2257 CAJPPA010000035.1 GCA905372425_01129 gene open 22435-23313
2258 CAJPPA010000035.1 GCA905372425_01111 gene open 5183-5255 trnP
2259 CAJPPA010000035.1 GCA905372425_01111 tRNA open 5183-5255 trnP tRNA-Pro(ggg)
2260 CAJPPA010000036.1 GCA905372425_01130 CDS open 217-2223 _na     668_aa Peptidase M13
2261 CAJPPA010000036.1 GCA905372425_01131 CDS open 2265-4229 _na     654_aa abc-f ribosomal protection-like ABC-F family protein
2262 CAJPPA010000036.1 GCA905372425_01132 CDS open 4596-5576 _na     326_aa fmt methionyl-tRNA formyltransferase
2263 CAJPPA010000036.1 GCA905372425_01133 CDS open 5642-6211 _na     189_aa L-threonylcarbamoyladenylate synthase
2264 CAJPPA010000036.1 GCA905372425_01134 CDS open 6237-8012 _na     591_aa CBS domain-containing protein
2265 CAJPPA010000036.1 GCA905372425_01135 CDS open 8114-9094 _na     326_aa Glucokinase
2266 CAJPPA010000036.1 GCA905372425_01136 CDS open 9160-9852 _na     230_aa lysE LysE type translocator
2267 CAJPPA010000036.1 GCA905372425_01137 CDS open 9880-10431 _na     183_aa DUF4924 domain-containing protein
2268 CAJPPA010000036.1 GCA905372425_01138 CDS open 10462-11334 _na     290_aa rfbD dTDP-4-dehydrorhamnose reductase
2269 CAJPPA010000036.1 GCA905372425_01139 CDS open 11378-12964 _na     528_aa peptide chain release factor 3
2270 CAJPPA010000036.1 GCA905372425_01140 CDS open 12986-13576 _na     196_aa NusG-like N-terminal domain-containing protein
2271 CAJPPA010000036.1 GCA905372425_01141 CDS open 13600-14829 _na     409_aa hypothetical protein
2272 CAJPPA010000036.1 GCA905372425_01142 CDS open 15294-15440 _na     48_aa hypothetical protein
2273 CAJPPA010000036.1 GCA905372425_01143 CDS open 15447-18008 _na     853_aa peptidoglycan glycosyltransferase
2274 CAJPPA010000036.1 GCA905372425_01144 CDS open 18035-18475 _na     146_aa Knr4/Smi1-like domain-containing protein
2275 CAJPPA010000036.1 GCA905372425_01145 CDS open 18899-20776 _na     625_aa Sulfatase N-terminal domain-containing protein
2276 CAJPPA010000036.1 GCA905372425_01146 CDS open 20773-21450 _na     225_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
2277 CAJPPA010000036.1 GCA905372425_01147 CDS open 21447-22130 _na     227_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
2278 CAJPPA010000036.1 GCA905372425_01148 CDS open 22133-22720 _na     195_aa tatC Sec-independent protein translocase protein TatC
2279 CAJPPA010000036.1 GCA905372425_01130 gene open 217-2223
2280 CAJPPA010000036.1 GCA905372425_01131 gene open 2265-4229 abc-f
2281 CAJPPA010000036.1 GCA905372425_01132 gene open 4596-5576 fmt
2282 CAJPPA010000036.1 GCA905372425_01133 gene open 5642-6211
2283 CAJPPA010000036.1 GCA905372425_01134 gene open 6237-8012
2284 CAJPPA010000036.1 GCA905372425_01135 gene open 8114-9094
2285 CAJPPA010000036.1 GCA905372425_01136 gene open 9160-9852 lysE
2286 CAJPPA010000036.1 GCA905372425_01137 gene open 9880-10431
2287 CAJPPA010000036.1 GCA905372425_01138 gene open 10462-11334 rfbD
2288 CAJPPA010000036.1 GCA905372425_01139 gene open 11378-12964
2289 CAJPPA010000036.1 GCA905372425_01140 gene open 12986-13576
2290 CAJPPA010000036.1 GCA905372425_01141 gene open 13600-14829
2291 CAJPPA010000036.1 GCA905372425_01142 gene open 15294-15440
2292 CAJPPA010000036.1 GCA905372425_01143 gene open 15447-18008
2293 CAJPPA010000036.1 GCA905372425_01144 gene open 18035-18475
2294 CAJPPA010000036.1 GCA905372425_01145 gene open 18899-20776
2295 CAJPPA010000036.1 GCA905372425_01146 gene open 20773-21450
2296 CAJPPA010000036.1 GCA905372425_01147 gene open 21447-22130 tsaA
2297 CAJPPA010000036.1 GCA905372425_01148 gene open 22133-22720 tatC
2298 CAJPPA010000037.1 GCA905372425_01149 CDS open 332-1411 _na     359_aa carbamoyl phosphate synthase small subunit
2299 CAJPPA010000037.1 GCA905372425_01150 CDS open 1783-3684 _na     633_aa Glutamine amidotransferase type-2 domain-containing protein
2300 CAJPPA010000037.1 GCA905372425_01151 CDS open 3697-5541 _na     614_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2301 CAJPPA010000037.1 GCA905372425_01152 CDS open 5625-6422 _na     265_aa polysaccharide biosynthesis/export family protein
2302 CAJPPA010000037.1 GCA905372425_01153 CDS open 6571-7620 _na     349_aa DNA-binding protein HU
2303 CAJPPA010000037.1 GCA905372425_01154 CDS open 7613-7906 _na     97_aa DNA-binding protein HU
2304 CAJPPA010000037.1 GCA905372425_01155 CDS open 7918-9219 _na     433_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2305 CAJPPA010000037.1 GCA905372425_01156 CDS open 9227-10177 _na     316_aa ftsY signal recognition particle-docking protein FtsY
2306 CAJPPA010000037.1 GCA905372425_01157 CDS open 10423-11442 _na     339_aa spoU SpoU rRNA Methylase family
2307 CAJPPA010000037.1 GCA905372425_01158 CDS open 11481-12557 _na     358_aa hisB bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB
2308 CAJPPA010000037.1 GCA905372425_01159 CDS open 12724-13041 _na     105_aa rplU 50S ribosomal protein L21
2309 CAJPPA010000037.1 GCA905372425_01160 CDS open 13061-13342 _na     93_aa rpmA 50S ribosomal protein L27
2310 CAJPPA010000037.1 GCA905372425_01161 CDS open 13442-14842 _na     466_aa uxaC glucuronate isomerase
2311 CAJPPA010000037.1 GCA905372425_01162 CDS open 14953-16014 _na     353_aa asparaginase
2312 CAJPPA010000037.1 GCA905372425_01163 CDS open 16506-19442 _na     978_aa Outer membrane protein beta-barrel domain-containing protein
2313 CAJPPA010000037.1 GCA905372425_01164 CDS open 20123-21604 _na     493_aa Altronate oxidoreductase
2314 CAJPPA010000037.1 GCA905372425_01165 CDS open 21641-22564 _na     307_aa Peptidoglycan hydrolase
2315 CAJPPA010000037.1 GCA905372425_01149 gene open 332-1411
2316 CAJPPA010000037.1 GCA905372425_01150 gene open 1783-3684
2317 CAJPPA010000037.1 GCA905372425_01151 gene open 3697-5541 glmS
2318 CAJPPA010000037.1 GCA905372425_01152 gene open 5625-6422
2319 CAJPPA010000037.1 GCA905372425_01153 gene open 6571-7620
2320 CAJPPA010000037.1 GCA905372425_01154 gene open 7613-7906
2321 CAJPPA010000037.1 GCA905372425_01155 gene open 7918-9219 rimO
2322 CAJPPA010000037.1 GCA905372425_01156 gene open 9227-10177 ftsY
2323 CAJPPA010000037.1 GCA905372425_01157 gene open 10423-11442 spoU
2324 CAJPPA010000037.1 GCA905372425_01158 gene open 11481-12557 hisB
2325 CAJPPA010000037.1 GCA905372425_01159 gene open 12724-13041 rplU
2326 CAJPPA010000037.1 GCA905372425_01160 gene open 13061-13342 rpmA
2327 CAJPPA010000037.1 GCA905372425_01161 gene open 13442-14842 uxaC
2328 CAJPPA010000037.1 GCA905372425_01162 gene open 14953-16014
2329 CAJPPA010000037.1 GCA905372425_01163 gene open 16506-19442
2330 CAJPPA010000037.1 GCA905372425_01164 gene open 20123-21604
2331 CAJPPA010000037.1 GCA905372425_01165 gene open 21641-22564
2332 CAJPPA010000038.1 GCA905372425_01166 CDS open 163-318 _na     51_aa hypothetical protein
2333 CAJPPA010000038.1 GCA905372425_01167 CDS open 407-1003 _na     198_aa Sigma-70 family RNA polymerase sigma factor
2334 CAJPPA010000038.1 GCA905372425_01168 CDS open 1000-1650 _na     216_aa rpe ribulose-phosphate 3-epimerase
2335 CAJPPA010000038.1 GCA905372425_01169 CDS open 1669-1794 _na     41_aa hypothetical protein
2336 CAJPPA010000038.1 GCA905372425_01170 CDS open 2054-2671 _na     205_aa Peptidase S51 dipeptidase E
2337 CAJPPA010000038.1 GCA905372425_01171 CDS open 2705-3427 _na     240_aa N-(5'-phosphoribosyl)anthranilate isomerase
2338 CAJPPA010000038.1 GCA905372425_01172 CDS open 4030-5274 _na     414_aa DegT/DnrJ/EryC1/StrS aminotransferase family protein
2339 CAJPPA010000038.1 GCA905372425_01173 CDS open 5296-7242 _na     648_aa Polysaccharide biosynthesis protein CapD-like domain-containing protein
2340 CAJPPA010000038.1 GCA905372425_01174 CDS open 7292-8374 _na     360_aa Nucleotidyltransferase
2341 CAJPPA010000038.1 GCA905372425_01175 CDS open 8396-8797 _na     133_aa Lipoprotein
2342 CAJPPA010000038.1 GCA905372425_01176 CDS open 8875-9204 _na     109_aa DUF3139 domain-containing protein
2343 CAJPPA010000038.1 GCA905372425_01177 CDS open 9224-9499 _na     91_aa polysaccharide biosynthesis protein
2344 CAJPPA010000038.1 GCA905372425_01178 CDS open 9819-11120 _na     433_aa thrC threonine synthase
2345 CAJPPA010000038.1 GCA905372425_01179 CDS open 11125-12354 _na     409_aa cofactor-independent phosphoglycerate mutase
2346 CAJPPA010000038.1 GCA905372425_01180 CDS open 12361-14796 _na     811_aa thrA bifunctional aspartate kinase/homoserine dehydrogenase I
2347 CAJPPA010000038.1 GCA905372425_01181 CDS open 15052-16641 _na     529_aa NAD(P)/FAD-dependent oxidoreductase
2348 CAJPPA010000038.1 GCA905372425_01182 CDS open 16903-18105 _na     400_aa Clostripain family protease
2349 CAJPPA010000038.1 GCA905372425_01183 CDS open 18141-20840 _na     899_aa valine--tRNA ligase
2350 CAJPPA010000038.1 GCA905372425_01166 gene open 163-318
2351 CAJPPA010000038.1 GCA905372425_01167 gene open 407-1003
2352 CAJPPA010000038.1 GCA905372425_01168 gene open 1000-1650 rpe
2353 CAJPPA010000038.1 GCA905372425_01169 gene open 1669-1794
2354 CAJPPA010000038.1 GCA905372425_01170 gene open 2054-2671
2355 CAJPPA010000038.1 GCA905372425_01171 gene open 2705-3427
2356 CAJPPA010000038.1 GCA905372425_01172 gene open 4030-5274
2357 CAJPPA010000038.1 GCA905372425_01173 gene open 5296-7242
2358 CAJPPA010000038.1 GCA905372425_01174 gene open 7292-8374
2359 CAJPPA010000038.1 GCA905372425_01175 gene open 8396-8797
2360 CAJPPA010000038.1 GCA905372425_01176 gene open 8875-9204
2361 CAJPPA010000038.1 GCA905372425_01177 gene open 9224-9499
2362 CAJPPA010000038.1 GCA905372425_01178 gene open 9819-11120 thrC
2363 CAJPPA010000038.1 GCA905372425_01179 gene open 11125-12354
2364 CAJPPA010000038.1 GCA905372425_01180 gene open 12361-14796 thrA
2365 CAJPPA010000038.1 GCA905372425_01181 gene open 15052-16641
2366 CAJPPA010000038.1 GCA905372425_01182 gene open 16903-18105
2367 CAJPPA010000038.1 GCA905372425_01183 gene open 18141-20840
2368 CAJPPA010000039.1 GCA905372425_01184 CDS open 412-753 _na     113_aa Bacteroidetes PKD-like domain-containing protein
2369 CAJPPA010000039.1 GCA905372425_01185 CDS open 865-2484 _na     539_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
2370 CAJPPA010000039.1 GCA905372425_01186 CDS open 2504-5671 _na     1055_aa SusC/RagA family TonB-linked outer membrane protein
2371 CAJPPA010000039.1 GCA905372425_01187 CDS open 6286-7212 _na     308_aa SMP-30/Gluconolactonase/LRE-like region domain-containing protein
2372 CAJPPA010000039.1 GCA905372425_01188 CDS open 7263-8459 _na     398_aa Phosphate-selective porin O and P
2373 CAJPPA010000039.1 GCA905372425_01189 CDS open 8520-9413 _na     297_aa HAD hydrolase%2C family IIA
2374 CAJPPA010000039.1 GCA905372425_01190 CDS open 9417-10901 _na     494_aa Major facilitator superfamily (MFS) profile domain-containing protein
2375 CAJPPA010000039.1 GCA905372425_01191 CDS open 10926-12320 _na     464_aa G-3-P permease
2376 CAJPPA010000039.1 GCA905372425_01192 CDS open 12365-12616 _na     83_aa hypothetical protein
2377 CAJPPA010000039.1 GCA905372425_01193 CDS open 13463-14953 _na     496_aa Succinate CoA transferase
2378 CAJPPA010000039.1 GCA905372425_01194 CDS open 14911-15336 _na     141_aa hypothetical protein
2379 CAJPPA010000039.1 GCA905372425_01195 CDS open 15357-16274 _na     305_aa xerA site-specific tyrosine recombinase/integron integrase
2380 CAJPPA010000039.1 GCA905372425_01196 CDS open 16375-16809 _na     144_aa aroQ type II 3-dehydroquinate dehydratase
2381 CAJPPA010000039.1 GCA905372425_01197 CDS open 16813-17493 _na     226_aa O-methyltransferase
2382 CAJPPA010000039.1 GCA905372425_01198 CDS open 17727-20837 _na     1036_aa TonB-dependent receptor
2383 CAJPPA010000039.1 GCA905372425_01184 gene open 412-753
2384 CAJPPA010000039.1 GCA905372425_01185 gene open 865-2484
2385 CAJPPA010000039.1 GCA905372425_01186 gene open 2504-5671
2386 CAJPPA010000039.1 GCA905372425_01187 gene open 6286-7212
2387 CAJPPA010000039.1 GCA905372425_01188 gene open 7263-8459
2388 CAJPPA010000039.1 GCA905372425_01189 gene open 8520-9413
2389 CAJPPA010000039.1 GCA905372425_01190 gene open 9417-10901
2390 CAJPPA010000039.1 GCA905372425_01191 gene open 10926-12320
2391 CAJPPA010000039.1 GCA905372425_01192 gene open 12365-12616
2392 CAJPPA010000039.1 GCA905372425_01193 gene open 13463-14953
2393 CAJPPA010000039.1 GCA905372425_01194 gene open 14911-15336
2394 CAJPPA010000039.1 GCA905372425_01195 gene open 15357-16274 xerA
2395 CAJPPA010000039.1 GCA905372425_01196 gene open 16375-16809 aroQ
2396 CAJPPA010000039.1 GCA905372425_01197 gene open 16813-17493
2397 CAJPPA010000039.1 GCA905372425_01198 gene open 17727-20837
2398 CAJPPA010000040.1 GCA905372425_01199 CDS open 1146-2264 _na     372_aa GH18 domain-containing protein
2399 CAJPPA010000040.1 GCA905372425_01200 CDS open 2283-3908 _na     541_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
2400 CAJPPA010000040.1 GCA905372425_01201 CDS open 3921-7055 _na     1044_aa SusC/RagA family TonB-linked outer membrane protein
2401 CAJPPA010000040.1 GCA905372425_01202 CDS open 8119-9663 _na     514_aa F5/8 type C domain-containing protein
2402 CAJPPA010000040.1 GCA905372425_01203 CDS open 9830-11161 _na     443_aa Major facilitator superfamily (MFS) profile domain-containing protein
2403 CAJPPA010000040.1 GCA905372425_01204 CDS open 11214-12851 _na     545_aa beta-N-acetylhexosaminidase
2404 CAJPPA010000040.1 GCA905372425_01205 CDS open 13334-13513 _na     59_aa DUF4250 domain-containing protein
2405 CAJPPA010000040.1 GCA905372425_01206 CDS open 13549-14037 _na     162_aa Exonuclease domain-containing protein
2406 CAJPPA010000040.1 GCA905372425_01207 CDS open 14123-14623 _na     166_aa N-acetyltransferase domain-containing protein
2407 CAJPPA010000040.1 GCA905372425_01208 CDS open 14651-14896 _na     81_aa Glutaredoxin-related protein
2408 CAJPPA010000040.1 GCA905372425_01209 CDS open 14962-15819 _na     285_aa Cof-like hydrolase
2409 CAJPPA010000040.1 GCA905372425_01210 CDS open 16076-18781 _na     901_aa DNA 3'-5' helicase
2410 CAJPPA010000040.1 GCA905372425_01211 CDS open 18869-20203 _na     444_aa mepA Multidrug export protein MepA
2411 CAJPPA010000040.1 GCA905372425_01199 gene open 1146-2264
2412 CAJPPA010000040.1 GCA905372425_01200 gene open 2283-3908
2413 CAJPPA010000040.1 GCA905372425_01201 gene open 3921-7055
2414 CAJPPA010000040.1 GCA905372425_01202 gene open 8119-9663
2415 CAJPPA010000040.1 GCA905372425_01203 gene open 9830-11161
2416 CAJPPA010000040.1 GCA905372425_01204 gene open 11214-12851
2417 CAJPPA010000040.1 GCA905372425_01205 gene open 13334-13513
2418 CAJPPA010000040.1 GCA905372425_01206 gene open 13549-14037
2419 CAJPPA010000040.1 GCA905372425_01207 gene open 14123-14623
2420 CAJPPA010000040.1 GCA905372425_01208 gene open 14651-14896
2421 CAJPPA010000040.1 GCA905372425_01209 gene open 14962-15819
2422 CAJPPA010000040.1 GCA905372425_01210 gene open 16076-18781
2423 CAJPPA010000040.1 GCA905372425_01211 gene open 18869-20203 mepA
2424 CAJPPA010000041.1 GCA905372425_01212 CDS open 84-1130 _na     348_aa aroB 3-dehydroquinate synthase
2425 CAJPPA010000041.1 GCA905372425_01213 CDS open 1107-2087 _na     326_aa AMP-dependent synthetase/ligase domain-containing protein
2426 CAJPPA010000041.1 GCA905372425_01214 CDS open 2084-3127 _na     347_aa O-succinylbenzoate synthase
2427 CAJPPA010000041.1 GCA905372425_01215 CDS open 3127-3954 _na     275_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
2428 CAJPPA010000041.1 GCA905372425_01216 CDS open 3957-5606 _na     549_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
2429 CAJPPA010000041.1 GCA905372425_01217 CDS open 5593-6603 _na     336_aa isochorismate synthase
2430 CAJPPA010000041.1 GCA905372425_01218 CDS open 6600-7022 _na     140_aa Thioesterase domain-containing protein
2431 CAJPPA010000041.1 GCA905372425_01219 CDS open 7477-8307 _na     276_aa prephenate dehydratase
2432 CAJPPA010000041.1 GCA905372425_01220 CDS open 8294-9457 _na     387_aa Aminotransferase
2433 CAJPPA010000041.1 GCA905372425_01221 CDS open 9608-10675 _na     355_aa Phospho-2-dehydro-3-deoxyheptonate aldolase
2434 CAJPPA010000041.1 GCA905372425_01222 CDS open 10680-11465 _na     261_aa Prephenate/arogenate dehydrogenase domain-containing protein
2435 CAJPPA010000041.1 GCA905372425_01223 CDS open 11472-12413 _na     313_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2436 CAJPPA010000041.1 GCA905372425_01224 CDS open 12712-12840 _na     42_aa hypothetical protein
2437 CAJPPA010000041.1 GCA905372425_01225 CDS open 12826-13890 _na     354_aa SGNH hydrolase-type esterase domain-containing protein
2438 CAJPPA010000041.1 GCA905372425_01226 CDS open 13927-15291 _na     454_aa hisS histidine--tRNA ligase
2439 CAJPPA010000041.1 GCA905372425_01227 CDS open 15302-16579 _na     425_aa adenylosuccinate synthase
2440 CAJPPA010000041.1 GCA905372425_01228 CDS open 16609-17079 _na     156_aa Ferric uptake regulation protein
2441 CAJPPA010000041.1 GCA905372425_01229 CDS open 17149-17757 _na     202_aa Peptidase
2442 CAJPPA010000041.1 GCA905372425_01230 CDS open 18085-20028 _na     647_aa Dihydrofolate reductase
2443 CAJPPA010000041.1 GCA905372425_01212 gene open 84-1130 aroB
2444 CAJPPA010000041.1 GCA905372425_01213 gene open 1107-2087
2445 CAJPPA010000041.1 GCA905372425_01214 gene open 2084-3127
2446 CAJPPA010000041.1 GCA905372425_01215 gene open 3127-3954 menB
2447 CAJPPA010000041.1 GCA905372425_01216 gene open 3957-5606 menD
2448 CAJPPA010000041.1 GCA905372425_01217 gene open 5593-6603
2449 CAJPPA010000041.1 GCA905372425_01218 gene open 6600-7022
2450 CAJPPA010000041.1 GCA905372425_01219 gene open 7477-8307
2451 CAJPPA010000041.1 GCA905372425_01220 gene open 8294-9457
2452 CAJPPA010000041.1 GCA905372425_01221 gene open 9608-10675
2453 CAJPPA010000041.1 GCA905372425_01222 gene open 10680-11465
2454 CAJPPA010000041.1 GCA905372425_01223 gene open 11472-12413
2455 CAJPPA010000041.1 GCA905372425_01224 gene open 12712-12840
2456 CAJPPA010000041.1 GCA905372425_01225 gene open 12826-13890
2457 CAJPPA010000041.1 GCA905372425_01226 gene open 13927-15291 hisS
2458 CAJPPA010000041.1 GCA905372425_01227 gene open 15302-16579
2459 CAJPPA010000041.1 GCA905372425_01228 gene open 16609-17079
2460 CAJPPA010000041.1 GCA905372425_01229 gene open 17149-17757
2461 CAJPPA010000041.1 GCA905372425_01230 gene open 18085-20028
2462 CAJPPA010000042.1 repeat_region open 7643-9233 CRISPR array with 25 repeats of length 30%2C consensus sequence GTTTCAATTCCACTAAGGTACAATTAGAAC and spacer length 34
2463 CAJPPA010000042.1 GCA905372425_01231 CDS open 411-1370 _na     319_aa Bile acid transporter
2464 CAJPPA010000042.1 GCA905372425_01232 CDS open 1460-2305 _na     281_aa DUF3737 domain-containing protein
2465 CAJPPA010000042.1 GCA905372425_01233 CDS open 2312-3481 _na     389_aa cysteine-S-conjugate beta-lyase
2466 CAJPPA010000042.1 GCA905372425_01234 CDS open 3558-6437 _na     959_aa Peptidase M16 C-terminal domain-containing protein
2467 CAJPPA010000042.1 GCA905372425_01235 CDS open 6866-7420 _na     184_aa transporter
2468 CAJPPA010000042.1 GCA905372425_01236 CDS open 9302-9457 _na     51_aa hypothetical protein
2469 CAJPPA010000042.1 GCA905372425_01237 CDS open 9437-9700 _na     87_aa cas2 CRISPR-associated endonuclease Cas2
2470 CAJPPA010000042.1 GCA905372425_01238 CDS open 9705-10721 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
2471 CAJPPA010000042.1 GCA905372425_01239 CDS open 10718-11236 _na     172_aa cas4 CRISPR-associated protein Cas4
2472 CAJPPA010000042.1 GCA905372425_01240 CDS open 11244-13928 _na     894_aa CRISPR-associated helicase cas3
2473 CAJPPA010000042.1 GCA905372425_01241 CDS open 13931-14698 _na     255_aa cas5b type I-B CRISPR-associated protein Cas5b
2474 CAJPPA010000042.1 GCA905372425_01242 CDS open 14713-15636 _na     307_aa Ct1132 family CRISPR-associated protein
2475 CAJPPA010000042.1 GCA905372425_01243 CDS open 15649-17628 _na     659_aa CRISPR-associated protein Csh1
2476 CAJPPA010000042.1 GCA905372425_01244 CDS open 17635-18411 _na     258_aa cas6 CRISPR-associated endoribonuclease Cas6
2477 CAJPPA010000042.1 GCA905372425_01245 CDS open 18670-19311 _na     213_aa Outer membrane protein beta-barrel domain-containing protein
2478 CAJPPA010000042.1 GCA905372425_01231 gene open 411-1370
2479 CAJPPA010000042.1 GCA905372425_01232 gene open 1460-2305
2480 CAJPPA010000042.1 GCA905372425_01233 gene open 2312-3481
2481 CAJPPA010000042.1 GCA905372425_01234 gene open 3558-6437
2482 CAJPPA010000042.1 GCA905372425_01235 gene open 6866-7420
2483 CAJPPA010000042.1 GCA905372425_01236 gene open 9302-9457
2484 CAJPPA010000042.1 GCA905372425_01237 gene open 9437-9700 cas2
2485 CAJPPA010000042.1 GCA905372425_01238 gene open 9705-10721 cas1b
2486 CAJPPA010000042.1 GCA905372425_01239 gene open 10718-11236 cas4
2487 CAJPPA010000042.1 GCA905372425_01240 gene open 11244-13928
2488 CAJPPA010000042.1 GCA905372425_01241 gene open 13931-14698 cas5b
2489 CAJPPA010000042.1 GCA905372425_01242 gene open 14713-15636
2490 CAJPPA010000042.1 GCA905372425_01243 gene open 15649-17628
2491 CAJPPA010000042.1 GCA905372425_01244 gene open 17635-18411 cas6
2492 CAJPPA010000042.1 GCA905372425_01245 gene open 18670-19311
2493 CAJPPA010000043.1 GCA905372425_01246 CDS open 77-502 _na     141_aa Biotin-requiring enzyme
2494 CAJPPA010000043.1 GCA905372425_01247 CDS open 512-664 _na     50_aa NHR domain-containing protein
2495 CAJPPA010000043.1 GCA905372425_01248 CDS open 681-2246 _na     521_aa Methylmalonyl-CoA decarboxylase alpha subunit
2496 CAJPPA010000043.1 GCA905372425_01249 CDS open 2324-2911 _na     195_aa nicotinamidase
2497 CAJPPA010000043.1 GCA905372425_01250 CDS open 2928-3533 _na     201_aa HU domain-containing protein
2498 CAJPPA010000043.1 GCA905372425_01251 CDS open 3985-5538 _na     517_aa ahpF alkyl hydroperoxide reductase subunit F
2499 CAJPPA010000043.1 GCA905372425_01252 CDS open 5651-6217 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
2500 CAJPPA010000043.1 GCA905372425_01253 CDS open 6415-7584 _na     389_aa galK galactokinase