BAKTAGenome Explorer: Arachnia rubra (GCA_905372475.1)
Select a Genome:
|
BAKTA Annotations for GCA_905372475.1
|
Search & Sort all 5763 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CAJPPP010000020.1 | GCA905372475_01236 | gene | open | 1052-3097 | uvrB | ||
| 2502 | CAJPPP010000020.1 | GCA905372475_01237 | gene | open | 3112-3816 | |||
| 2503 | CAJPPP010000020.1 | GCA905372475_01238 | gene | open | 3957-4652 | |||
| 2504 | CAJPPP010000020.1 | GCA905372475_01239 | gene | open | 4807-7563 | uvrA | ||
| 2505 | CAJPPP010000020.1 | GCA905372475_01240 | gene | open | 7574-8179 | |||
| 2506 | CAJPPP010000020.1 | GCA905372475_01241 | gene | open | 8230-9054 | |||
| 2507 | CAJPPP010000020.1 | GCA905372475_01242 | gene | open | 9150-9887 | |||
| 2508 | CAJPPP010000020.1 | GCA905372475_01243 | gene | open | 9884-10660 | |||
| 2509 | CAJPPP010000020.1 | GCA905372475_01244 | gene | open | 10662-11309 | |||
| 2510 | CAJPPP010000020.1 | GCA905372475_01245 | gene | open | 11395-12633 | |||
| 2511 | CAJPPP010000020.1 | GCA905372475_01246 | gene | open | 12779-15562 | glcD | ||
| 2512 | CAJPPP010000020.1 | GCA905372475_01247 | gene | open | 16123-17952 | |||
| 2513 | CAJPPP010000020.1 | GCA905372475_01248 | gene | open | 17954-18802 | |||
| 2514 | CAJPPP010000020.1 | GCA905372475_01249 | gene | open | 18814-19821 | lysR | ||
| 2515 | CAJPPP010000020.1 | GCA905372475_01250 | gene | open | 19818-21407 | ahpF | ||
| 2516 | CAJPPP010000020.1 | GCA905372475_01251 | gene | open | 21420-21983 | ahpC | ||
| 2517 | CAJPPP010000020.1 | GCA905372475_01252 | gene | open | 22191-26465 | |||
| 2518 | CAJPPP010000020.1 | GCA905372475_01253 | gene | open | 26462-27898 | gndA | ||
| 2519 | CAJPPP010000020.1 | GCA905372475_01254 | gene | open | 28126-29445 | |||
| 2520 | CAJPPP010000020.1 | GCA905372475_01255 | gene | open | 29494-30759 | allB | ||
| 2521 | CAJPPP010000020.1 | GCA905372475_01256 | gene | open | 30777-31697 | pyrB | ||
| 2522 | CAJPPP010000020.1 | GCA905372475_01257 | gene | open | 31726-34305 | pepN | ||
| 2523 | CAJPPP010000020.1 | GCA905372475_01258 | gene | open | 34396-36483 | ligA | ||
| 2524 | CAJPPP010000020.1 | GCA905372475_01259 | gene | open | 36563-39757 | |||
| 2525 | CAJPPP010000021.1 | GCA905372475_01260 | CDS | open | 183-875 | _na 230_aa | MFS transporter | |
| 2526 | CAJPPP010000021.1 | GCA905372475_01261 | CDS | open | 931-1476 | _na 181_aa | diadenosine tetraphosphate hydrolase | |
| 2527 | CAJPPP010000021.1 | GCA905372475_01262 | CDS | open | 2103-2669 | _na 188_aa | CAP domain-containing protein | |
| 2528 | CAJPPP010000021.1 | GCA905372475_01263 | CDS | open | 2837-4312 | _na 491_aa | MFS transporter | |
| 2529 | CAJPPP010000021.1 | GCA905372475_01264 | CDS | open | 4309-4881 | _na 190_aa | TetR/AcrR family transcriptional regulator | |
| 2530 | CAJPPP010000021.1 | GCA905372475_01265 | CDS | open | 4962-5270 | _na 102_aa | DUF2316 domain-containing protein | |
| 2531 | CAJPPP010000021.1 | GCA905372475_01266 | CDS | open | 5340-5678 | _na 112_aa | Carboxymuconolactone decarboxylase-like domain-containing protein | |
| 2532 | CAJPPP010000021.1 | GCA905372475_01267 | CDS | open | 5678-6103 | _na 141_aa | cupin domain-containing protein | |
| 2533 | CAJPPP010000021.1 | GCA905372475_01268 | CDS | open | 6116-6436 | _na 106_aa | putative quinol monooxygenase | |
| 2534 | CAJPPP010000021.1 | GCA905372475_01269 | CDS | open | 6601-9948 | _na 1115_aa | bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase | |
| 2535 | CAJPPP010000021.1 | GCA905372475_01270 | CDS | open | 10154-10858 | _na 234_aa | phosphotransferase | |
| 2536 | CAJPPP010000021.1 | GCA905372475_01271 | CDS | open | 11039-12532 | _na 497_aa | glutamine synthetase family protein | |
| 2537 | CAJPPP010000021.1 | GCA905372475_01272 | CDS | open | 12605-13444 | _na 279_aa | hypothetical protein | |
| 2538 | CAJPPP010000021.1 | GCA905372475_01273 | CDS | open | 13798-14193 | _na 131_aa | sdpI | SdpI family protein |
| 2539 | CAJPPP010000021.1 | GCA905372475_01274 | CDS | open | 14357-14971 | _na 204_aa | Lipoprotein | |
| 2540 | CAJPPP010000021.1 | GCA905372475_01275 | CDS | open | 15186-16922 | _na 578_aa | sfcA | NAD-dependent malic enzyme |
| 2541 | CAJPPP010000021.1 | GCA905372475_01276 | CDS | open | 17083-17424 | _na 113_aa | Imm51 family immunity protein | |
| 2542 | CAJPPP010000021.1 | GCA905372475_01277 | CDS | open | 17520-18566 | _na 348_aa | glycoside hydrolase family 76 protein | |
| 2543 | CAJPPP010000021.1 | GCA905372475_01278 | CDS | open | 18788-18994 | _na 68_aa | Antitoxin VapB32 | |
| 2544 | CAJPPP010000021.1 | GCA905372475_01279 | CDS | open | 18991-19353 | _na 120_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 2545 | CAJPPP010000021.1 | GCA905372475_01280 | CDS | open | 19440-20285 | _na 281_aa | carbohydrate ABC transporter permease | |
| 2546 | CAJPPP010000021.1 | GCA905372475_01281 | CDS | open | 20278-21216 | _na 312_aa | carbohydrate ABC transporter permease | |
| 2547 | CAJPPP010000021.1 | GCA905372475_01282 | CDS | open | 21222-22511 | _na 429_aa | sugar ABC transporter substrate-binding protein | |
| 2548 | CAJPPP010000021.1 | GCA905372475_01283 | CDS | open | 22508-24793 | _na 761_aa | ROK family protein | |
| 2549 | CAJPPP010000021.1 | GCA905372475_01284 | CDS | open | 25104-26480 | _na 458_aa | UTP--glucose-1-phosphate uridylyltransferase | |
| 2550 | CAJPPP010000021.1 | GCA905372475_01285 | CDS | open | 26483-26827 | _na 114_aa | hypothetical protein | |
| 2551 | CAJPPP010000021.1 | GCA905372475_01286 | CDS | open | 26890-27255 | _na 121_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 2552 | CAJPPP010000021.1 | GCA905372475_01287 | CDS | open | 27481-28131 | _na 216_aa | SAF domain-containing protein | |
| 2553 | CAJPPP010000021.1 | GCA905372475_01288 | CDS | open | 28160-28468 | _na 102_aa | fmdB | FmdB family zinc ribbon protein |
| 2554 | CAJPPP010000021.1 | GCA905372475_01289 | CDS | open | 28500-29075 | _na 191_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 2555 | CAJPPP010000021.1 | GCA905372475_01290 | CDS | open | 29093-30379 | _na 428_aa | glp | gephyrin-like molybdotransferase Glp |
| 2556 | CAJPPP010000021.1 | GCA905372475_01291 | CDS | open | 30449-31231 | _na 260_aa | hypothetical protein | |
| 2557 | CAJPPP010000021.1 | GCA905372475_01293 | CDS | open | 31542-31793 | _na 83_aa | Addiction module protein | |
| 2558 | CAJPPP010000021.1 | GCA905372475_01294 | CDS | open | 32729-33349 | _na 206_aa | ABC-three component system protein | |
| 2559 | CAJPPP010000021.1 | GCA905372475_01295 | CDS | open | 33574-33795 | _na 73_aa | hypothetical protein | |
| 2560 | CAJPPP010000021.1 | GCA905372475_01296 | CDS | open | 34231-35274 | _na 347_aa | ABC-three component system protein | |
| 2561 | CAJPPP010000021.1 | GCA905372475_01297 | CDS | open | 35290-36099 | _na 269_aa | hypothetical protein | |
| 2562 | CAJPPP010000021.1 | GCA905372475_01298 | CDS | open | 36129-36851 | _na 240_aa | hypothetical protein | |
| 2563 | CAJPPP010000021.1 | GCA905372475_01299 | CDS | open | 36851-37705 | _na 284_aa | Peptide ABC transporter permease | |
| 2564 | CAJPPP010000021.1 | GCA905372475_01300 | CDS | open | 37689-38687 | _na 332_aa | hypothetical protein | |
| 2565 | CAJPPP010000021.1 | GCA905372475_01301 | CDS | open | 38684-39991 | _na 435_aa | hypothetical protein | |
| 2566 | CAJPPP010000021.1 | GCA905372475_01260 | gene | open | 183-875 | |||
| 2567 | CAJPPP010000021.1 | GCA905372475_01261 | gene | open | 931-1476 | |||
| 2568 | CAJPPP010000021.1 | GCA905372475_01262 | gene | open | 2103-2669 | |||
| 2569 | CAJPPP010000021.1 | GCA905372475_01263 | gene | open | 2837-4312 | |||
| 2570 | CAJPPP010000021.1 | GCA905372475_01264 | gene | open | 4309-4881 | |||
| 2571 | CAJPPP010000021.1 | GCA905372475_01265 | gene | open | 4962-5270 | |||
| 2572 | CAJPPP010000021.1 | GCA905372475_01266 | gene | open | 5340-5678 | |||
| 2573 | CAJPPP010000021.1 | GCA905372475_01267 | gene | open | 5678-6103 | |||
| 2574 | CAJPPP010000021.1 | GCA905372475_01268 | gene | open | 6116-6436 | |||
| 2575 | CAJPPP010000021.1 | GCA905372475_01269 | gene | open | 6601-9948 | |||
| 2576 | CAJPPP010000021.1 | GCA905372475_01270 | gene | open | 10154-10858 | |||
| 2577 | CAJPPP010000021.1 | GCA905372475_01271 | gene | open | 11039-12532 | |||
| 2578 | CAJPPP010000021.1 | GCA905372475_01272 | gene | open | 12605-13444 | |||
| 2579 | CAJPPP010000021.1 | GCA905372475_01273 | gene | open | 13798-14193 | sdpI | ||
| 2580 | CAJPPP010000021.1 | GCA905372475_01274 | gene | open | 14357-14971 | |||
| 2581 | CAJPPP010000021.1 | GCA905372475_01275 | gene | open | 15186-16922 | sfcA | ||
| 2582 | CAJPPP010000021.1 | GCA905372475_01276 | gene | open | 17083-17424 | |||
| 2583 | CAJPPP010000021.1 | GCA905372475_01277 | gene | open | 17520-18566 | |||
| 2584 | CAJPPP010000021.1 | GCA905372475_01278 | gene | open | 18788-18994 | |||
| 2585 | CAJPPP010000021.1 | GCA905372475_01279 | gene | open | 18991-19353 | vapC | ||
| 2586 | CAJPPP010000021.1 | GCA905372475_01280 | gene | open | 19440-20285 | |||
| 2587 | CAJPPP010000021.1 | GCA905372475_01281 | gene | open | 20278-21216 | |||
| 2588 | CAJPPP010000021.1 | GCA905372475_01282 | gene | open | 21222-22511 | |||
| 2589 | CAJPPP010000021.1 | GCA905372475_01283 | gene | open | 22508-24793 | |||
| 2590 | CAJPPP010000021.1 | GCA905372475_01284 | gene | open | 25104-26480 | |||
| 2591 | CAJPPP010000021.1 | GCA905372475_01285 | gene | open | 26483-26827 | |||
| 2592 | CAJPPP010000021.1 | GCA905372475_01286 | gene | open | 26890-27255 | mscL | ||
| 2593 | CAJPPP010000021.1 | GCA905372475_01287 | gene | open | 27481-28131 | |||
| 2594 | CAJPPP010000021.1 | GCA905372475_01288 | gene | open | 28160-28468 | fmdB | ||
| 2595 | CAJPPP010000021.1 | GCA905372475_01289 | gene | open | 28500-29075 | |||
| 2596 | CAJPPP010000021.1 | GCA905372475_01290 | gene | open | 29093-30379 | glp | ||
| 2597 | CAJPPP010000021.1 | GCA905372475_01291 | gene | open | 30449-31231 | |||
| 2598 | CAJPPP010000021.1 | GCA905372475_01293 | gene | open | 31542-31793 | |||
| 2599 | CAJPPP010000021.1 | GCA905372475_01294 | gene | open | 32729-33349 | |||
| 2600 | CAJPPP010000021.1 | GCA905372475_01295 | gene | open | 33574-33795 | |||
| 2601 | CAJPPP010000021.1 | GCA905372475_01296 | gene | open | 34231-35274 | |||
| 2602 | CAJPPP010000021.1 | GCA905372475_01297 | gene | open | 35290-36099 | |||
| 2603 | CAJPPP010000021.1 | GCA905372475_01298 | gene | open | 36129-36851 | |||
| 2604 | CAJPPP010000021.1 | GCA905372475_01299 | gene | open | 36851-37705 | |||
| 2605 | CAJPPP010000021.1 | GCA905372475_01300 | gene | open | 37689-38687 | |||
| 2606 | CAJPPP010000021.1 | GCA905372475_01301 | gene | open | 38684-39991 | |||
| 2607 | CAJPPP010000021.1 | GCA905372475_01292 | gene | open | 31279-31351 | trnA | ||
| 2608 | CAJPPP010000021.1 | GCA905372475_01292 | tRNA | open | 31279-31351 | trnA | tRNA-Ala(cgc) | |
| 2609 | CAJPPP010000022.1 | GCA905372475_01302 | CDS | open | 399-833 | _na 144_aa | transposase family protein | |
| 2610 | CAJPPP010000022.1 | GCA905372475_01303 | CDS | open | 1199-1723 | _na 174_aa | 4'-phosphopantetheinyl transferase | |
| 2611 | CAJPPP010000022.1 | GCA905372475_01304 | CDS | open | 1769-3403 | _na 544_aa | 2%2C3-dihydroxybenzoate-AMP ligase | |
| 2612 | CAJPPP010000022.1 | GCA905372475_01305 | CDS | open | 3444-4256 | _na 270_aa | Thioesterase domain-containing protein | |
| 2613 | CAJPPP010000022.1 | GCA905372475_01306 | CDS | open | 4253-5362 | _na 369_aa | NAD-dependent epimerase/dehydratase domain-containing protein | |
| 2614 | CAJPPP010000022.1 | GCA905372475_01307 | CDS | open | 5359-10845 | _na 1828_aa | Carrier domain-containing protein | |
| 2615 | CAJPPP010000022.1 | GCA905372475_01308 | CDS | open | 10842-20864 | _na 3340_aa | Carrier domain-containing protein | |
| 2616 | CAJPPP010000022.1 | GCA905372475_01309 | CDS | open | 20890-22257 | _na 455_aa | Serine hydroxymethyltransferase | |
| 2617 | CAJPPP010000022.1 | GCA905372475_01310 | CDS | open | 22430-23188 | _na 252_aa | TetR-family transcriptional regulator | |
| 2618 | CAJPPP010000022.1 | GCA905372475_01311 | CDS | open | 23360-25183 | _na 607_aa | Putative ABC transporter%2C ATPase and permease components | |
| 2619 | CAJPPP010000022.1 | GCA905372475_01312 | CDS | open | 25180-26919 | _na 579_aa | ABC transporter | |
| 2620 | CAJPPP010000022.1 | GCA905372475_01313 | CDS | open | 27004-28479 | _na 491_aa | hypothetical protein | |
| 2621 | CAJPPP010000022.1 | GCA905372475_01314 | CDS | open | 28501-29130 | _na 209_aa | ABC transporter permease | |
| 2622 | CAJPPP010000022.1 | GCA905372475_01315 | CDS | open | 29127-29837 | _na 236_aa | ecfT | Energy-coupling factor transporter transmembrane protein EcfT |
| 2623 | CAJPPP010000022.1 | GCA905372475_01316 | CDS | open | 29834-31330 | _na 498_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 2624 | CAJPPP010000022.1 | GCA905372475_01317 | CDS | open | 31320-32057 | _na 245_aa | AB hydrolase-1 domain-containing protein | |
| 2625 | CAJPPP010000022.1 | GCA905372475_01318 | CDS | open | 32243-33649 | _na 468_aa | salicylate synthase | |
| 2626 | CAJPPP010000022.1 | GCA905372475_01319 | CDS | open | 34339-35454 | _na 371_aa | beta-ketoacyl synthase N-terminal-like domain-containing protein | |
| 2627 | CAJPPP010000022.1 | GCA905372475_01320 | CDS | open | 35417-36034 | _na 205_aa | hypothetical protein | |
| 2628 | CAJPPP010000022.1 | GCA905372475_01321 | CDS | open | 36036-36452 | _na 138_aa | hypothetical protein | |
| 2629 | CAJPPP010000022.1 | GCA905372475_01322 | CDS | open | 36475-37857 | _na 460_aa | type I polyketide synthase | |
| 2630 | CAJPPP010000022.1 | GCA905372475_01323 | CDS | open | 37936-38340 | _na 134_aa | hypothetical protein | |
| 2631 | CAJPPP010000022.1 | GCA905372475_01302 | gene | open | 399-833 | |||
| 2632 | CAJPPP010000022.1 | GCA905372475_01303 | gene | open | 1199-1723 | |||
| 2633 | CAJPPP010000022.1 | GCA905372475_01304 | gene | open | 1769-3403 | |||
| 2634 | CAJPPP010000022.1 | GCA905372475_01305 | gene | open | 3444-4256 | |||
| 2635 | CAJPPP010000022.1 | GCA905372475_01306 | gene | open | 4253-5362 | |||
| 2636 | CAJPPP010000022.1 | GCA905372475_01307 | gene | open | 5359-10845 | |||
| 2637 | CAJPPP010000022.1 | GCA905372475_01308 | gene | open | 10842-20864 | |||
| 2638 | CAJPPP010000022.1 | GCA905372475_01309 | gene | open | 20890-22257 | |||
| 2639 | CAJPPP010000022.1 | GCA905372475_01310 | gene | open | 22430-23188 | |||
| 2640 | CAJPPP010000022.1 | GCA905372475_01311 | gene | open | 23360-25183 | |||
| 2641 | CAJPPP010000022.1 | GCA905372475_01312 | gene | open | 25180-26919 | |||
| 2642 | CAJPPP010000022.1 | GCA905372475_01313 | gene | open | 27004-28479 | |||
| 2643 | CAJPPP010000022.1 | GCA905372475_01314 | gene | open | 28501-29130 | |||
| 2644 | CAJPPP010000022.1 | GCA905372475_01315 | gene | open | 29127-29837 | ecfT | ||
| 2645 | CAJPPP010000022.1 | GCA905372475_01316 | gene | open | 29834-31330 | ccmA | ||
| 2646 | CAJPPP010000022.1 | GCA905372475_01317 | gene | open | 31320-32057 | |||
| 2647 | CAJPPP010000022.1 | GCA905372475_01318 | gene | open | 32243-33649 | |||
| 2648 | CAJPPP010000022.1 | GCA905372475_01319 | gene | open | 34339-35454 | |||
| 2649 | CAJPPP010000022.1 | GCA905372475_01320 | gene | open | 35417-36034 | |||
| 2650 | CAJPPP010000022.1 | GCA905372475_01321 | gene | open | 36036-36452 | |||
| 2651 | CAJPPP010000022.1 | GCA905372475_01322 | gene | open | 36475-37857 | |||
| 2652 | CAJPPP010000022.1 | GCA905372475_01323 | gene | open | 37936-38340 | |||
| 2653 | CAJPPP010000023.1 | GCA905372475_01324 | CDS | open | 51-818 | _na 255_aa | NADH-quinone oxidoreductase subunit M | |
| 2654 | CAJPPP010000023.1 | GCA905372475_01325 | CDS | open | 818-2389 | _na 523_aa | nuoN | NADH-quinone oxidoreductase subunit NuoN |
| 2655 | CAJPPP010000023.1 | GCA905372475_01326 | CDS | open | 2404-3354 | _na 316_aa | polyprenyl synthetase family protein | |
| 2656 | CAJPPP010000023.1 | GCA905372475_01327 | CDS | open | 3428-3967 | _na 179_aa | GTP-binding protein | |
| 2657 | CAJPPP010000023.1 | GCA905372475_01328 | CDS | open | 3964-4212 | _na 82_aa | type B 50S ribosomal protein L31 | |
| 2658 | CAJPPP010000023.1 | GCA905372475_01329 | CDS | open | 4288-4524 | _na 78_aa | rpmB | 50S ribosomal protein L28 |
| 2659 | CAJPPP010000023.1 | GCA905372475_01330 | CDS | open | 4527-4694 | _na 55_aa | rpmG | 50S ribosomal protein L33 |
| 2660 | CAJPPP010000023.1 | GCA905372475_01331 | CDS | open | 4694-4999 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 2661 | CAJPPP010000023.1 | GCA905372475_01332 | CDS | open | 5198-7723 | _na 841_aa | Ig-like domain-containing protein | |
| 2662 | CAJPPP010000023.1 | GCA905372475_01333 | CDS | open | 7573-7896 | _na 107_aa | hypothetical protein | |
| 2663 | CAJPPP010000023.1 | GCA905372475_01334 | CDS | open | 7984-10329 | _na 781_aa | DUF5979 domain-containing protein | |
| 2664 | CAJPPP010000023.1 | GCA905372475_01335 | CDS | open | 10750-11097 | _na 115_aa | hypothetical protein | |
| 2665 | CAJPPP010000023.1 | GCA905372475_01336 | CDS | open | 13383-13886 | _na 167_aa | hypothetical protein | |
| 2666 | CAJPPP010000023.1 | GCA905372475_01337 | CDS | open | 13881-14714 | _na 277_aa | DUF5682 domain-containing protein | |
| 2667 | CAJPPP010000023.1 | GCA905372475_01338 | CDS | open | 14735-15070 | _na 111_aa | hypothetical protein | |
| 2668 | CAJPPP010000023.1 | GCA905372475_01339 | CDS | open | 15086-19687 | _na 1533_aa | hypothetical protein | |
| 2669 | CAJPPP010000023.1 | GCA905372475_01340 | CDS | open | 19691-20746 | _na 351_aa | DUF4132 domain-containing protein | |
| 2670 | CAJPPP010000023.1 | GCA905372475_01341 | CDS | open | 20770-22101 | _na 443_aa | hypothetical protein | |
| 2671 | CAJPPP010000023.1 | GCA905372475_01342 | CDS | open | 22175-23212 | _na 345_aa | porB | 2-oxoglutarate ferredoxin oxidoreductase subunit beta |
| 2672 | CAJPPP010000023.1 | GCA905372475_01343 | CDS | open | 23212-25050 | _na 612_aa | porG | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha |
| 2673 | CAJPPP010000023.1 | GCA905372475_01344 | CDS | open | 25158-25535 | _na 125_aa | hypothetical protein | |
| 2674 | CAJPPP010000023.1 | GCA905372475_01345 | CDS | open | 25532-27022 | _na 496_aa | mptB | polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB |
| 2675 | CAJPPP010000023.1 | GCA905372475_01346 | CDS | open | 26998-27915 | _na 305_aa | exodeoxyribonuclease III | |
| 2676 | CAJPPP010000023.1 | GCA905372475_01347 | CDS | open | 28006-28899 | _na 297_aa | DUF808 domain-containing protein | |
| 2677 | CAJPPP010000023.1 | GCA905372475_01348 | CDS | open | 28909-29529 | _na 206_aa | trans-aconitate 2-methyltransferase | |
| 2678 | CAJPPP010000023.1 | GCA905372475_01349 | CDS | open | 29537-30268 | _na 243_aa | gntR | GntR family transcriptional regulator |
| 2679 | CAJPPP010000023.1 | GCA905372475_01350 | CDS | open | 30637-31386 | _na 249_aa | deoC | deoxyribose-phosphate aldolase |
| 2680 | CAJPPP010000023.1 | GCA905372475_01351 | CDS | open | 32015-33259 | _na 414_aa | winged helix-turn-helix domain-containing protein | |
| 2681 | CAJPPP010000023.1 | GCA905372475_01352 | CDS | open | 34199-34690 | _na 163_aa | yajQ | YajQ family cyclic di-GMP-binding protein |
| 2682 | CAJPPP010000023.1 | GCA905372475_01354 | CDS | open | 34960-36324 | _na 454_aa | glycoside-pentoside-hexuronide (GPH):cation symporter | |
| 2683 | CAJPPP010000023.1 | GCA905372475_01324 | gene | open | 51-818 | |||
| 2684 | CAJPPP010000023.1 | GCA905372475_01325 | gene | open | 818-2389 | nuoN | ||
| 2685 | CAJPPP010000023.1 | GCA905372475_01326 | gene | open | 2404-3354 | |||
| 2686 | CAJPPP010000023.1 | GCA905372475_01327 | gene | open | 3428-3967 | |||
| 2687 | CAJPPP010000023.1 | GCA905372475_01328 | gene | open | 3964-4212 | |||
| 2688 | CAJPPP010000023.1 | GCA905372475_01329 | gene | open | 4288-4524 | rpmB | ||
| 2689 | CAJPPP010000023.1 | GCA905372475_01330 | gene | open | 4527-4694 | rpmG | ||
| 2690 | CAJPPP010000023.1 | GCA905372475_01331 | gene | open | 4694-4999 | rpsN | ||
| 2691 | CAJPPP010000023.1 | GCA905372475_01332 | gene | open | 5198-7723 | |||
| 2692 | CAJPPP010000023.1 | GCA905372475_01333 | gene | open | 7573-7896 | |||
| 2693 | CAJPPP010000023.1 | GCA905372475_01334 | gene | open | 7984-10329 | |||
| 2694 | CAJPPP010000023.1 | GCA905372475_01335 | gene | open | 10750-11097 | |||
| 2695 | CAJPPP010000023.1 | GCA905372475_01336 | gene | open | 13383-13886 | |||
| 2696 | CAJPPP010000023.1 | GCA905372475_01337 | gene | open | 13881-14714 | |||
| 2697 | CAJPPP010000023.1 | GCA905372475_01338 | gene | open | 14735-15070 | |||
| 2698 | CAJPPP010000023.1 | GCA905372475_01339 | gene | open | 15086-19687 | |||
| 2699 | CAJPPP010000023.1 | GCA905372475_01340 | gene | open | 19691-20746 | |||
| 2700 | CAJPPP010000023.1 | GCA905372475_01341 | gene | open | 20770-22101 | |||
| 2701 | CAJPPP010000023.1 | GCA905372475_01342 | gene | open | 22175-23212 | porB | ||
| 2702 | CAJPPP010000023.1 | GCA905372475_01343 | gene | open | 23212-25050 | porG | ||
| 2703 | CAJPPP010000023.1 | GCA905372475_01344 | gene | open | 25158-25535 | |||
| 2704 | CAJPPP010000023.1 | GCA905372475_01345 | gene | open | 25532-27022 | mptB | ||
| 2705 | CAJPPP010000023.1 | GCA905372475_01346 | gene | open | 26998-27915 | |||
| 2706 | CAJPPP010000023.1 | GCA905372475_01347 | gene | open | 28006-28899 | |||
| 2707 | CAJPPP010000023.1 | GCA905372475_01348 | gene | open | 28909-29529 | |||
| 2708 | CAJPPP010000023.1 | GCA905372475_01349 | gene | open | 29537-30268 | gntR | ||
| 2709 | CAJPPP010000023.1 | GCA905372475_01350 | gene | open | 30637-31386 | deoC | ||
| 2710 | CAJPPP010000023.1 | GCA905372475_01351 | gene | open | 32015-33259 | |||
| 2711 | CAJPPP010000023.1 | GCA905372475_01352 | gene | open | 34199-34690 | yajQ | ||
| 2712 | CAJPPP010000023.1 | GCA905372475_01354 | gene | open | 34960-36324 | |||
| 2713 | CAJPPP010000023.1 | GCA905372475_01353 | gene | open | 34802-34883 | trnY | ||
| 2714 | CAJPPP010000023.1 | GCA905372475_01353 | tRNA | open | 34802-34883 | trnY | tRNA-Tyr(gta) | |
| 2715 | CAJPPP010000024.1 | regulatory_region | open | 18058-18235 | Cobalamin riboswitch aptamer | |||
| 2716 | CAJPPP010000024.1 | GCA905372475_01355 | CDS | open | 427-579 | _na 50_aa | hypothetical protein | |
| 2717 | CAJPPP010000024.1 | GCA905372475_01356 | CDS | open | 1314-2243 | _na 309_aa | A/G-specific adenine glycosylase | |
| 2718 | CAJPPP010000024.1 | GCA905372475_01357 | CDS | open | 2251-2820 | _na 189_aa | GNAT family N-acetyltransferase | |
| 2719 | CAJPPP010000024.1 | GCA905372475_01358 | CDS | open | 2878-4149 | _na 423_aa | ATP-binding protein | |
| 2720 | CAJPPP010000024.1 | GCA905372475_01359 | CDS | open | 4172-6616 | _na 814_aa | PEP/pyruvate-binding domain-containing protein | |
| 2721 | CAJPPP010000024.1 | GCA905372475_01360 | CDS | open | 6768-7355 | _na 195_aa | TetR/AcrR family transcriptional regulator | |
| 2722 | CAJPPP010000024.1 | GCA905372475_01361 | CDS | open | 7607-8953 | _na 448_aa | nucleotide disphospho-sugar-binding domain-containing protein | |
| 2723 | CAJPPP010000024.1 | GCA905372475_01362 | CDS | open | 9085-9732 | _na 215_aa | TetR/AcrR family transcriptional regulator | |
| 2724 | CAJPPP010000024.1 | GCA905372475_01363 | CDS | open | 9747-10808 | _na 353_aa | amidohydrolase family protein | |
| 2725 | CAJPPP010000024.1 | GCA905372475_01364 | CDS | open | 11035-12060 | _na 341_aa | ABC transporter ATP-binding protein | |
| 2726 | CAJPPP010000024.1 | GCA905372475_01365 | CDS | open | 12135-12935 | _na 266_aa | ABC transporter permease | |
| 2727 | CAJPPP010000024.1 | GCA905372475_01366 | CDS | open | 13052-13528 | _na 158_aa | hypothetical protein | |
| 2728 | CAJPPP010000024.1 | GCA905372475_01367 | CDS | open | 13599-14768 | _na 389_aa | histidine kinase | |
| 2729 | CAJPPP010000024.1 | GCA905372475_01368 | CDS | open | 15060-16151 | _na 363_aa | ABC transporter substrate-binding protein | |
| 2730 | CAJPPP010000024.1 | GCA905372475_01369 | CDS | open | 16148-16963 | _na 271_aa | ABC transporter ATP-binding protein | |
| 2731 | CAJPPP010000024.1 | GCA905372475_01370 | CDS | open | 16960-18018 | _na 352_aa | iron ABC transporter permease | |
| 2732 | CAJPPP010000024.1 | GCA905372475_01371 | CDS | open | 18280-18870 | _na 196_aa | TetR/AcrR family transcriptional regulator | |
| 2733 | CAJPPP010000024.1 | GCA905372475_01372 | CDS | open | 19043-19969 | _na 308_aa | SDR family oxidoreductase | |
| 2734 | CAJPPP010000024.1 | GCA905372475_01373 | CDS | open | 19985-20860 | _na 291_aa | mshB | N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase |
| 2735 | CAJPPP010000024.1 | GCA905372475_01374 | CDS | open | 21030-21785 | _na 251_aa | hypothetical protein | |
| 2736 | CAJPPP010000024.1 | GCA905372475_01375 | CDS | open | 22152-24503 | _na 783_aa | glycogen-debranching protein | |
| 2737 | CAJPPP010000024.1 | GCA905372475_01376 | CDS | open | 24686-26191 | _na 501_aa | putP | sodium/proline symporter PutP |
| 2738 | CAJPPP010000024.1 | GCA905372475_01377 | CDS | open | 26263-29007 | _na 914_aa | penicillin acylase family protein | |
| 2739 | CAJPPP010000024.1 | GCA905372475_01378 | CDS | open | 29237-30400 | _na 387_aa | sensor histidine kinase | |
| 2740 | CAJPPP010000024.1 | GCA905372475_01379 | CDS | open | 30393-31040 | _na 215_aa | response regulator transcription factor | |
| 2741 | CAJPPP010000024.1 | GCA905372475_01380 | CDS | open | 31294-32199 | _na 301_aa | hflC | HflK protein |
| 2742 | CAJPPP010000024.1 | GCA905372475_01381 | CDS | open | 32527-34518 | _na 663_aa | serine hydrolase | |
| 2743 | CAJPPP010000024.1 | GCA905372475_01382 | CDS | open | 35147-35596 | _na 149_aa | hypothetical protein | |
| 2744 | CAJPPP010000024.1 | GCA905372475_01355 | gene | open | 427-579 | |||
| 2745 | CAJPPP010000024.1 | GCA905372475_01356 | gene | open | 1314-2243 | |||
| 2746 | CAJPPP010000024.1 | GCA905372475_01357 | gene | open | 2251-2820 | |||
| 2747 | CAJPPP010000024.1 | GCA905372475_01358 | gene | open | 2878-4149 | |||
| 2748 | CAJPPP010000024.1 | GCA905372475_01359 | gene | open | 4172-6616 | |||
| 2749 | CAJPPP010000024.1 | GCA905372475_01360 | gene | open | 6768-7355 | |||
| 2750 | CAJPPP010000024.1 | GCA905372475_01361 | gene | open | 7607-8953 | |||
| 2751 | CAJPPP010000024.1 | GCA905372475_01362 | gene | open | 9085-9732 | |||
| 2752 | CAJPPP010000024.1 | GCA905372475_01363 | gene | open | 9747-10808 | |||
| 2753 | CAJPPP010000024.1 | GCA905372475_01364 | gene | open | 11035-12060 | |||
| 2754 | CAJPPP010000024.1 | GCA905372475_01365 | gene | open | 12135-12935 | |||
| 2755 | CAJPPP010000024.1 | GCA905372475_01366 | gene | open | 13052-13528 | |||
| 2756 | CAJPPP010000024.1 | GCA905372475_01367 | gene | open | 13599-14768 | |||
| 2757 | CAJPPP010000024.1 | GCA905372475_01368 | gene | open | 15060-16151 | |||
| 2758 | CAJPPP010000024.1 | GCA905372475_01369 | gene | open | 16148-16963 | |||
| 2759 | CAJPPP010000024.1 | GCA905372475_01370 | gene | open | 16960-18018 | |||
| 2760 | CAJPPP010000024.1 | GCA905372475_01371 | gene | open | 18280-18870 | |||
| 2761 | CAJPPP010000024.1 | GCA905372475_01372 | gene | open | 19043-19969 | |||
| 2762 | CAJPPP010000024.1 | GCA905372475_01373 | gene | open | 19985-20860 | mshB | ||
| 2763 | CAJPPP010000024.1 | GCA905372475_01374 | gene | open | 21030-21785 | |||
| 2764 | CAJPPP010000024.1 | GCA905372475_01375 | gene | open | 22152-24503 | |||
| 2765 | CAJPPP010000024.1 | GCA905372475_01376 | gene | open | 24686-26191 | putP | ||
| 2766 | CAJPPP010000024.1 | GCA905372475_01377 | gene | open | 26263-29007 | |||
| 2767 | CAJPPP010000024.1 | GCA905372475_01378 | gene | open | 29237-30400 | |||
| 2768 | CAJPPP010000024.1 | GCA905372475_01379 | gene | open | 30393-31040 | |||
| 2769 | CAJPPP010000024.1 | GCA905372475_01380 | gene | open | 31294-32199 | hflC | ||
| 2770 | CAJPPP010000024.1 | GCA905372475_01381 | gene | open | 32527-34518 | |||
| 2771 | CAJPPP010000024.1 | GCA905372475_01382 | gene | open | 35147-35596 | |||
| 2772 | CAJPPP010000025.1 | repeat_region | open | 2817-4923 | CRISPR array with 29 repeats of length 36%2C consensus sequence CTTTTCCCAGCTCCAAAAGCTGGGCTCCATTGCGAC and spacer length 36 | |||
| 2773 | CAJPPP010000025.1 | GCA905372475_01383 | CDS | open | 687-2363 | _na 558_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 2774 | CAJPPP010000025.1 | GCA905372475_01384 | CDS | open | 2360-2650 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2775 | CAJPPP010000025.1 | GCA905372475_01385 | CDS | open | 5382-9032 | _na 1216_aa | hypothetical protein | |
| 2776 | CAJPPP010000025.1 | GCA905372475_01386 | CDS | open | 9029-9148 | _na 39_aa | hypothetical protein | |
| 2777 | CAJPPP010000025.1 | GCA905372475_01387 | CDS | open | 9342-11054 | _na 570_aa | TIR domain-containing protein | |
| 2778 | CAJPPP010000025.1 | GCA905372475_01388 | CDS | open | 11056-11343 | _na 95_aa | hypothetical protein | |
| 2779 | CAJPPP010000025.1 | GCA905372475_01389 | CDS | open | 11368-13809 | _na 813_aa | hypothetical protein | |
| 2780 | CAJPPP010000025.1 | GCA905372475_01390 | CDS | open | 13812-15287 | _na 491_aa | GGDEF domain-containing protein | |
| 2781 | CAJPPP010000025.1 | GCA905372475_01391 | CDS | open | 15284-15817 | _na 177_aa | RAMP superfamily | |
| 2782 | CAJPPP010000025.1 | GCA905372475_01392 | CDS | open | 15814-16998 | _na 394_aa | CRISPR-associated RAMP protein%2C Csx10 family | |
| 2783 | CAJPPP010000025.1 | GCA905372475_01393 | CDS | open | 16995-18293 | _na 432_aa | RAMP superfamily protein | |
| 2784 | CAJPPP010000025.1 | GCA905372475_01394 | CDS | open | 18286-18705 | _na 139_aa | hypothetical protein | |
| 2785 | CAJPPP010000025.1 | GCA905372475_01395 | CDS | open | 18946-21666 | _na 906_aa | adenosylhomocysteinase | |
| 2786 | CAJPPP010000025.1 | GCA905372475_01396 | CDS | open | 21749-22162 | _na 137_aa | cupin domain-containing protein | |
| 2787 | CAJPPP010000025.1 | GCA905372475_01397 | CDS | open | 22333-23190 | _na 285_aa | ABC transporter substrate-binding protein | |
| 2788 | CAJPPP010000025.1 | GCA905372475_01398 | CDS | open | 23199-24062 | _na 287_aa | hisM | Amino acid ABC transporter permease |
| 2789 | CAJPPP010000025.1 | GCA905372475_01399 | CDS | open | 24062-24832 | _na 256_aa | amino acid ABC transporter ATP-binding protein | |
| 2790 | CAJPPP010000025.1 | GCA905372475_01400 | CDS | open | 24852-25703 | _na 283_aa | kdpD | sensor histidine kinase KdpD |
| 2791 | CAJPPP010000025.1 | GCA905372475_01401 | CDS | open | 25718-26413 | _na 231_aa | ompR | Response regulator transcription factor |
| 2792 | CAJPPP010000025.1 | GCA905372475_01402 | CDS | open | 26410-27036 | _na 208_aa | DUF3060 domain-containing protein | |
| 2793 | CAJPPP010000025.1 | GCA905372475_01403 | CDS | open | 27166-27930 | _na 254_aa | DUF3060 domain-containing protein | |
| 2794 | CAJPPP010000025.1 | GCA905372475_01404 | CDS | open | 28100-29149 | _na 349_aa | lplA | Lipoate--protein ligase family protein |
| 2795 | CAJPPP010000025.1 | GCA905372475_01405 | CDS | open | 29339-31480 | _na 713_aa | hypothetical protein | |
| 2796 | CAJPPP010000025.1 | GCA905372475_01406 | CDS | open | 31490-32167 | _na 225_aa | FMN-binding negative transcriptional regulator | |
| 2797 | CAJPPP010000025.1 | GCA905372475_01407 | CDS | open | 32254-33621 | _na 455_aa | hypothetical protein | |
| 2798 | CAJPPP010000025.1 | GCA905372475_01408 | CDS | open | 33950-34234 | _na 94_aa | hypothetical protein | |
| 2799 | CAJPPP010000025.1 | GCA905372475_01409 | CDS | open | 34352-34984 | _na 210_aa | hypothetical protein | |
| 2800 | CAJPPP010000025.1 | GCA905372475_01410 | CDS | open | 34981-35565 | _na 194_aa | hypothetical protein | |
| 2801 | CAJPPP010000025.1 | GCA905372475_01383 | gene | open | 687-2363 | cas1 | ||
| 2802 | CAJPPP010000025.1 | GCA905372475_01384 | gene | open | 2360-2650 | cas2 | ||
| 2803 | CAJPPP010000025.1 | GCA905372475_01385 | gene | open | 5382-9032 | |||
| 2804 | CAJPPP010000025.1 | GCA905372475_01386 | gene | open | 9029-9148 | |||
| 2805 | CAJPPP010000025.1 | GCA905372475_01387 | gene | open | 9342-11054 | |||
| 2806 | CAJPPP010000025.1 | GCA905372475_01388 | gene | open | 11056-11343 | |||
| 2807 | CAJPPP010000025.1 | GCA905372475_01389 | gene | open | 11368-13809 | |||
| 2808 | CAJPPP010000025.1 | GCA905372475_01390 | gene | open | 13812-15287 | |||
| 2809 | CAJPPP010000025.1 | GCA905372475_01391 | gene | open | 15284-15817 | |||
| 2810 | CAJPPP010000025.1 | GCA905372475_01392 | gene | open | 15814-16998 | |||
| 2811 | CAJPPP010000025.1 | GCA905372475_01393 | gene | open | 16995-18293 | |||
| 2812 | CAJPPP010000025.1 | GCA905372475_01394 | gene | open | 18286-18705 | |||
| 2813 | CAJPPP010000025.1 | GCA905372475_01395 | gene | open | 18946-21666 | |||
| 2814 | CAJPPP010000025.1 | GCA905372475_01396 | gene | open | 21749-22162 | |||
| 2815 | CAJPPP010000025.1 | GCA905372475_01397 | gene | open | 22333-23190 | |||
| 2816 | CAJPPP010000025.1 | GCA905372475_01398 | gene | open | 23199-24062 | hisM | ||
| 2817 | CAJPPP010000025.1 | GCA905372475_01399 | gene | open | 24062-24832 | |||
| 2818 | CAJPPP010000025.1 | GCA905372475_01400 | gene | open | 24852-25703 | kdpD | ||
| 2819 | CAJPPP010000025.1 | GCA905372475_01401 | gene | open | 25718-26413 | ompR | ||
| 2820 | CAJPPP010000025.1 | GCA905372475_01402 | gene | open | 26410-27036 | |||
| 2821 | CAJPPP010000025.1 | GCA905372475_01403 | gene | open | 27166-27930 | |||
| 2822 | CAJPPP010000025.1 | GCA905372475_01404 | gene | open | 28100-29149 | lplA | ||
| 2823 | CAJPPP010000025.1 | GCA905372475_01405 | gene | open | 29339-31480 | |||
| 2824 | CAJPPP010000025.1 | GCA905372475_01406 | gene | open | 31490-32167 | |||
| 2825 | CAJPPP010000025.1 | GCA905372475_01407 | gene | open | 32254-33621 | |||
| 2826 | CAJPPP010000025.1 | GCA905372475_01408 | gene | open | 33950-34234 | |||
| 2827 | CAJPPP010000025.1 | GCA905372475_01409 | gene | open | 34352-34984 | |||
| 2828 | CAJPPP010000025.1 | GCA905372475_01410 | gene | open | 34981-35565 | |||
| 2829 | CAJPPP010000026.1 | GCA905372475_01411 | CDS | open | 153-335 | _na 60_aa | hypothetical protein | |
| 2830 | CAJPPP010000026.1 | GCA905372475_01412 | CDS | open | 1702-2352 | _na 216_aa | response regulator transcription factor | |
| 2831 | CAJPPP010000026.1 | GCA905372475_01413 | CDS | open | 2797-2997 | _na 66_aa | hypothetical protein | |
| 2832 | CAJPPP010000026.1 | GCA905372475_01414 | CDS | open | 3312-4175 | _na 287_aa | ATP-binding protein | |
| 2833 | CAJPPP010000026.1 | GCA905372475_01415 | CDS | open | 4671-5180 | _na 169_aa | DUF6553 domain-containing protein | |
| 2834 | CAJPPP010000026.1 | GCA905372475_01416 | CDS | open | 5593-6336 | _na 247_aa | N-acetyltransferase | |
| 2835 | CAJPPP010000026.1 | GCA905372475_01417 | CDS | open | 6379-8631 | _na 750_aa | recQ | RecQ family ATP-dependent DNA helicase |
| 2836 | CAJPPP010000026.1 | GCA905372475_01418 | CDS | open | 8614-8859 | _na 81_aa | hypothetical protein | |
| 2837 | CAJPPP010000026.1 | GCA905372475_01419 | CDS | open | 9430-9585 | _na 51_aa | hypothetical protein | |
| 2838 | CAJPPP010000026.1 | GCA905372475_01420 | CDS | open | 9632-11329 | _na 565_aa | dihydroxyacetone kinase family protein | |
| 2839 | CAJPPP010000026.1 | GCA905372475_01421 | CDS | open | 11509-12564 | _na 351_aa | alcohol dehydrogenase catalytic domain-containing protein | |
| 2840 | CAJPPP010000026.1 | GCA905372475_01422 | CDS | open | 12584-13636 | _na 350_aa | hypothetical protein | |
| 2841 | CAJPPP010000026.1 | GCA905372475_01423 | CDS | open | 13819-14262 | _na 147_aa | pyrimidine dimer DNA glycosylase/endonuclease V | |
| 2842 | CAJPPP010000026.1 | GCA905372475_01424 | CDS | open | 14358-14906 | _na 182_aa | NADAR family protein | |
| 2843 | CAJPPP010000026.1 | GCA905372475_01425 | CDS | open | 14938-16017 | _na 359_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 2844 | CAJPPP010000026.1 | GCA905372475_01426 | CDS | open | 16068-17801 | _na 577_aa | treZ | malto-oligosyltrehalose trehalohydrolase |
| 2845 | CAJPPP010000026.1 | GCA905372475_01427 | CDS | open | 17828-20332 | _na 834_aa | treY | malto-oligosyltrehalose synthase |
| 2846 | CAJPPP010000026.1 | GCA905372475_01428 | CDS | open | 20736-20999 | _na 87_aa | hypothetical protein | |
| 2847 | CAJPPP010000026.1 | GCA905372475_01429 | CDS | open | 21126-21308 | _na 60_aa | hypothetical protein | |
| 2848 | CAJPPP010000026.1 | GCA905372475_01430 | CDS | open | 21512-22948 | _na 478_aa | pcnB | CCA tRNA nucleotidyltransferase |
| 2849 | CAJPPP010000026.1 | GCA905372475_01431 | CDS | open | 23085-23462 | _na 125_aa | hypothetical protein | |
| 2850 | CAJPPP010000026.1 | GCA905372475_01432 | CDS | open | 23462-25207 | _na 581_aa | alpha/beta hydrolase | |
| 2851 | CAJPPP010000026.1 | GCA905372475_01433 | CDS | open | 25538-26308 | _na 256_aa | class I SAM-dependent methyltransferase | |
| 2852 | CAJPPP010000026.1 | GCA905372475_01434 | CDS | open | 26301-26948 | _na 215_aa | ABC transporter ATP-binding protein | |
| 2853 | CAJPPP010000026.1 | GCA905372475_01435 | CDS | open | 26945-27985 | _na 346_aa | ABC transporter substrate-binding protein | |
| 2854 | CAJPPP010000026.1 | GCA905372475_01436 | CDS | open | 27982-28749 | _na 255_aa | ABC transporter permease | |
| 2855 | CAJPPP010000026.1 | GCA905372475_01437 | CDS | open | 28909-30450 | _na 513_aa | MFS transporter | |
| 2856 | CAJPPP010000026.1 | GCA905372475_01438 | CDS | open | 30545-31144 | _na 199_aa | TetR/AcrR family transcriptional regulator | |
| 2857 | CAJPPP010000026.1 | GCA905372475_01411 | gene | open | 153-335 | |||
| 2858 | CAJPPP010000026.1 | GCA905372475_01412 | gene | open | 1702-2352 | |||
| 2859 | CAJPPP010000026.1 | GCA905372475_01413 | gene | open | 2797-2997 | |||
| 2860 | CAJPPP010000026.1 | GCA905372475_01414 | gene | open | 3312-4175 | |||
| 2861 | CAJPPP010000026.1 | GCA905372475_01415 | gene | open | 4671-5180 | |||
| 2862 | CAJPPP010000026.1 | GCA905372475_01416 | gene | open | 5593-6336 | |||
| 2863 | CAJPPP010000026.1 | GCA905372475_01417 | gene | open | 6379-8631 | recQ | ||
| 2864 | CAJPPP010000026.1 | GCA905372475_01418 | gene | open | 8614-8859 | |||
| 2865 | CAJPPP010000026.1 | GCA905372475_01419 | gene | open | 9430-9585 | |||
| 2866 | CAJPPP010000026.1 | GCA905372475_01420 | gene | open | 9632-11329 | |||
| 2867 | CAJPPP010000026.1 | GCA905372475_01421 | gene | open | 11509-12564 | |||
| 2868 | CAJPPP010000026.1 | GCA905372475_01422 | gene | open | 12584-13636 | |||
| 2869 | CAJPPP010000026.1 | GCA905372475_01423 | gene | open | 13819-14262 | |||
| 2870 | CAJPPP010000026.1 | GCA905372475_01424 | gene | open | 14358-14906 | |||
| 2871 | CAJPPP010000026.1 | GCA905372475_01425 | gene | open | 14938-16017 | lgt | ||
| 2872 | CAJPPP010000026.1 | GCA905372475_01426 | gene | open | 16068-17801 | treZ | ||
| 2873 | CAJPPP010000026.1 | GCA905372475_01427 | gene | open | 17828-20332 | treY | ||
| 2874 | CAJPPP010000026.1 | GCA905372475_01428 | gene | open | 20736-20999 | |||
| 2875 | CAJPPP010000026.1 | GCA905372475_01429 | gene | open | 21126-21308 | |||
| 2876 | CAJPPP010000026.1 | GCA905372475_01430 | gene | open | 21512-22948 | pcnB | ||
| 2877 | CAJPPP010000026.1 | GCA905372475_01431 | gene | open | 23085-23462 | |||
| 2878 | CAJPPP010000026.1 | GCA905372475_01432 | gene | open | 23462-25207 | |||
| 2879 | CAJPPP010000026.1 | GCA905372475_01433 | gene | open | 25538-26308 | |||
| 2880 | CAJPPP010000026.1 | GCA905372475_01434 | gene | open | 26301-26948 | |||
| 2881 | CAJPPP010000026.1 | GCA905372475_01435 | gene | open | 26945-27985 | |||
| 2882 | CAJPPP010000026.1 | GCA905372475_01436 | gene | open | 27982-28749 | |||
| 2883 | CAJPPP010000026.1 | GCA905372475_01437 | gene | open | 28909-30450 | |||
| 2884 | CAJPPP010000026.1 | GCA905372475_01438 | gene | open | 30545-31144 | |||
| 2885 | CAJPPP010000027.1 | GCA905372475_01439 | CDS | open | 48-602 | _na 184_aa | hypothetical protein | |
| 2886 | CAJPPP010000027.1 | GCA905372475_01440 | CDS | open | 599-811 | _na 70_aa | exodeoxyribonuclease VII small subunit | |
| 2887 | CAJPPP010000027.1 | GCA905372475_01441 | CDS | open | 887-1561 | _na 224_aa | Yip1 domain | |
| 2888 | CAJPPP010000027.1 | GCA905372475_01442 | CDS | open | 1558-2463 | _na 301_aa | hypothetical protein | |
| 2889 | CAJPPP010000027.1 | GCA905372475_01443 | CDS | open | 2477-3277 | _na 266_aa | uppS | isoprenyl transferase |
| 2890 | CAJPPP010000027.1 | GCA905372475_01444 | CDS | open | 3362-4999 | _na 545_aa | alpha/beta hydrolase | |
| 2891 | CAJPPP010000027.1 | GCA905372475_01445 | CDS | open | 4999-5829 | _na 276_aa | ricT | regulatory iron-sulfur-containing complex subunit RicT |
| 2892 | CAJPPP010000027.1 | GCA905372475_01446 | CDS | open | 5894-7414 | _na 506_aa | doxX | DoxX family membrane protein |
| 2893 | CAJPPP010000027.1 | GCA905372475_01447 | CDS | open | 7524-8678 | _na 384_aa | dnaX | DNA polymerase III subunit delta' |
| 2894 | CAJPPP010000027.1 | GCA905372475_01448 | CDS | open | 8722-9351 | _na 209_aa | tmk | dTMP kinase |
| 2895 | CAJPPP010000027.1 | GCA905372475_01449 | CDS | open | 9348-10670 | _na 440_aa | CHAD domain-containing protein | |
| 2896 | CAJPPP010000027.1 | GCA905372475_01450 | CDS | open | 10766-13477 | _na 903_aa | topA | type I DNA topoisomerase |
| 2897 | CAJPPP010000027.1 | GCA905372475_01451 | CDS | open | 13659-14795 | _na 378_aa | Ig-like domain-containing protein | |
| 2898 | CAJPPP010000027.1 | GCA905372475_01452 | CDS | open | 15021-15917 | _na 298_aa | hypothetical protein | |
| 2899 | CAJPPP010000027.1 | GCA905372475_01454 | CDS | open | 16237-17004 | _na 255_aa | ppgK | polyphosphate--glucose phosphotransferase |
| 2900 | CAJPPP010000027.1 | GCA905372475_01455 | CDS | open | 17238-17867 | _na 209_aa | lolD | ABC transporter ATP-binding protein |
| 2901 | CAJPPP010000027.1 | GCA905372475_01456 | CDS | open | 17878-19113 | _na 411_aa | ABC transporter permease | |
| 2902 | CAJPPP010000027.1 | GCA905372475_01457 | CDS | open | 19124-20554 | _na 476_aa | ABC transporter permease | |
| 2903 | CAJPPP010000027.1 | GCA905372475_01458 | CDS | open | 20986-22620 | _na 544_aa | argS | arginine--tRNA ligase |
| 2904 | CAJPPP010000027.1 | GCA905372475_01459 | CDS | open | 22690-23520 | _na 276_aa | aldo/keto reductase | |
| 2905 | CAJPPP010000027.1 | GCA905372475_01460 | CDS | open | 23558-24898 | _na 446_aa | UDP-glucose/GDP-mannose dehydrogenase family protein | |
| 2906 | CAJPPP010000027.1 | GCA905372475_01461 | CDS | open | 25026-25295 | _na 89_aa | hupA | HB |
| 2907 | CAJPPP010000027.1 | GCA905372475_01462 | CDS | open | 25460-26452 | _na 330_aa | mviM | Gfo/Idh/MocA family oxidoreductase |
| 2908 | CAJPPP010000027.1 | GCA905372475_01463 | CDS | open | 26449-27540 | _na 363_aa | wecE | UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase |
| 2909 | CAJPPP010000027.1 | GCA905372475_01464 | CDS | open | 27537-28142 | _na 201_aa | glmU | N-acetyltransferase |
| 2910 | CAJPPP010000027.1 | GCA905372475_01465 | CDS | open | 28371-29393 | _na 340_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 2911 | CAJPPP010000027.1 | GCA905372475_01466 | CDS | open | 29372-30097 | _na 241_aa | hypothetical protein | |
| 2912 | CAJPPP010000027.1 | GCA905372475_01439 | gene | open | 48-602 | |||
| 2913 | CAJPPP010000027.1 | GCA905372475_01440 | gene | open | 599-811 | |||
| 2914 | CAJPPP010000027.1 | GCA905372475_01441 | gene | open | 887-1561 | |||
| 2915 | CAJPPP010000027.1 | GCA905372475_01442 | gene | open | 1558-2463 | |||
| 2916 | CAJPPP010000027.1 | GCA905372475_01443 | gene | open | 2477-3277 | uppS | ||
| 2917 | CAJPPP010000027.1 | GCA905372475_01444 | gene | open | 3362-4999 | |||
| 2918 | CAJPPP010000027.1 | GCA905372475_01445 | gene | open | 4999-5829 | ricT | ||
| 2919 | CAJPPP010000027.1 | GCA905372475_01446 | gene | open | 5894-7414 | doxX | ||
| 2920 | CAJPPP010000027.1 | GCA905372475_01447 | gene | open | 7524-8678 | dnaX | ||
| 2921 | CAJPPP010000027.1 | GCA905372475_01448 | gene | open | 8722-9351 | tmk | ||
| 2922 | CAJPPP010000027.1 | GCA905372475_01449 | gene | open | 9348-10670 | |||
| 2923 | CAJPPP010000027.1 | GCA905372475_01450 | gene | open | 10766-13477 | topA | ||
| 2924 | CAJPPP010000027.1 | GCA905372475_01451 | gene | open | 13659-14795 | |||
| 2925 | CAJPPP010000027.1 | GCA905372475_01452 | gene | open | 15021-15917 | |||
| 2926 | CAJPPP010000027.1 | GCA905372475_01454 | gene | open | 16237-17004 | ppgK | ||
| 2927 | CAJPPP010000027.1 | GCA905372475_01455 | gene | open | 17238-17867 | lolD | ||
| 2928 | CAJPPP010000027.1 | GCA905372475_01456 | gene | open | 17878-19113 | |||
| 2929 | CAJPPP010000027.1 | GCA905372475_01457 | gene | open | 19124-20554 | |||
| 2930 | CAJPPP010000027.1 | GCA905372475_01458 | gene | open | 20986-22620 | argS | ||
| 2931 | CAJPPP010000027.1 | GCA905372475_01459 | gene | open | 22690-23520 | |||
| 2932 | CAJPPP010000027.1 | GCA905372475_01460 | gene | open | 23558-24898 | |||
| 2933 | CAJPPP010000027.1 | GCA905372475_01461 | gene | open | 25026-25295 | hupA | ||
| 2934 | CAJPPP010000027.1 | GCA905372475_01462 | gene | open | 25460-26452 | mviM | ||
| 2935 | CAJPPP010000027.1 | GCA905372475_01463 | gene | open | 26449-27540 | wecE | ||
| 2936 | CAJPPP010000027.1 | GCA905372475_01464 | gene | open | 27537-28142 | glmU | ||
| 2937 | CAJPPP010000027.1 | GCA905372475_01465 | gene | open | 28371-29393 | meaB | ||
| 2938 | CAJPPP010000027.1 | GCA905372475_01466 | gene | open | 29372-30097 | |||
| 2939 | CAJPPP010000027.1 | GCA905372475_01453 | gene | open | 16054-16124 | trnG | ||
| 2940 | CAJPPP010000027.1 | GCA905372475_01453 | tRNA | open | 16054-16124 | trnG | tRNA-Gly(ccc) | |
| 2941 | CAJPPP010000028.1 | GCA905372475_01467 | CDS | open | 706-3357 | _na 883_aa | lanKC | class III lanthionine synthetase LanKC |
| 2942 | CAJPPP010000028.1 | GCA905372475_01468 | CDS | open | 3406-3528 | _na 40_aa | hypothetical protein | |
| 2943 | CAJPPP010000028.1 | GCA905372475_01469 | CDS | open | 3684-3806 | _na 40_aa | hypothetical protein | |
| 2944 | CAJPPP010000028.1 | GCA905372475_01470 | CDS | open | 4118-6031 | _na 637_aa | ABC transporter ATP-binding protein | |
| 2945 | CAJPPP010000028.1 | GCA905372475_01471 | CDS | open | 6056-8047 | _na 663_aa | prolyl oligopeptidase family serine peptidase | |
| 2946 | CAJPPP010000028.1 | GCA905372475_01472 | CDS | open | 8051-9010 | _na 319_aa | ABC transporter ATP-binding protein | |
| 2947 | CAJPPP010000028.1 | GCA905372475_01473 | CDS | open | 9007-10407 | _na 466_aa | FtsX-like permease family protein | |
| 2948 | CAJPPP010000028.1 | GCA905372475_01474 | CDS | open | 10573-11244 | _na 223_aa | response regulator transcription factor | |
| 2949 | CAJPPP010000028.1 | GCA905372475_01475 | CDS | open | 11490-11753 | _na 87_aa | transposase | |
| 2950 | CAJPPP010000028.1 | GCA905372475_01476 | CDS | open | 11872-12123 | _na 83_aa | hypothetical protein | |
| 2951 | CAJPPP010000028.1 | GCA905372475_01477 | CDS | open | 12285-13295 | _na 336_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 2952 | CAJPPP010000028.1 | GCA905372475_01478 | CDS | open | 13307-13474 | _na 55_aa | hypothetical protein | |
| 2953 | CAJPPP010000028.1 | GCA905372475_01479 | CDS | open | 13560-14423 | _na 287_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 2954 | CAJPPP010000028.1 | GCA905372475_01480 | CDS | open | 14606-16246 | _na 546_aa | AMP-binding protein | |
| 2955 | CAJPPP010000028.1 | GCA905372475_01481 | CDS | open | 16263-17315 | _na 350_aa | Cytidylyltransferase family protein | |
| 2956 | CAJPPP010000028.1 | GCA905372475_01482 | CDS | open | 17720-17809 | _na 29_aa | hypothetical protein | |
| 2957 | CAJPPP010000028.1 | GCA905372475_01483 | CDS | open | 17861-18604 | _na 247_aa | helical backbone metal receptor | |
| 2958 | CAJPPP010000028.1 | GCA905372475_01484 | CDS | open | 18607-19794 | _na 395_aa | MFS transporter | |
| 2959 | CAJPPP010000028.1 | GCA905372475_01485 | CDS | open | 19954-20277 | _na 107_aa | helix-turn-helix transcriptional regulator | |
| 2960 | CAJPPP010000028.1 | GCA905372475_01486 | CDS | open | 20303-21091 | _na 262_aa | SDR family oxidoreductase | |
| 2961 | CAJPPP010000028.1 | GCA905372475_01487 | CDS | open | 21165-21740 | _na 191_aa | TetR/AcrR family transcriptional regulator | |
| 2962 | CAJPPP010000028.1 | GCA905372475_01488 | CDS | open | 21829-23541 | _na 570_aa | hypothetical protein | |
| 2963 | CAJPPP010000028.1 | GCA905372475_01489 | CDS | open | 23549-25276 | _na 575_aa | PQQ-binding-like beta-propeller repeat protein | |
| 2964 | CAJPPP010000028.1 | GCA905372475_01490 | CDS | open | 25273-25764 | _na 163_aa | hypothetical protein | |
| 2965 | CAJPPP010000028.1 | GCA905372475_01491 | CDS | open | 25847-26458 | _na 203_aa | putative membrane protein | |
| 2966 | CAJPPP010000028.1 | GCA905372475_01492 | CDS | open | 26451-28778 | _na 775_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 2967 | CAJPPP010000028.1 | GCA905372475_01493 | CDS | open | 29370-29735 | _na 121_aa | hypothetical protein | |
| 2968 | CAJPPP010000028.1 | GCA905372475_01467 | gene | open | 706-3357 | lanKC | ||
| 2969 | CAJPPP010000028.1 | GCA905372475_01468 | gene | open | 3406-3528 | |||
| 2970 | CAJPPP010000028.1 | GCA905372475_01469 | gene | open | 3684-3806 | |||
| 2971 | CAJPPP010000028.1 | GCA905372475_01470 | gene | open | 4118-6031 | |||
| 2972 | CAJPPP010000028.1 | GCA905372475_01471 | gene | open | 6056-8047 | |||
| 2973 | CAJPPP010000028.1 | GCA905372475_01472 | gene | open | 8051-9010 | |||
| 2974 | CAJPPP010000028.1 | GCA905372475_01473 | gene | open | 9007-10407 | |||
| 2975 | CAJPPP010000028.1 | GCA905372475_01474 | gene | open | 10573-11244 | |||
| 2976 | CAJPPP010000028.1 | GCA905372475_01475 | gene | open | 11490-11753 | |||
| 2977 | CAJPPP010000028.1 | GCA905372475_01476 | gene | open | 11872-12123 | |||
| 2978 | CAJPPP010000028.1 | GCA905372475_01477 | gene | open | 12285-13295 | rfbB | ||
| 2979 | CAJPPP010000028.1 | GCA905372475_01478 | gene | open | 13307-13474 | |||
| 2980 | CAJPPP010000028.1 | GCA905372475_01479 | gene | open | 13560-14423 | rfbA | ||
| 2981 | CAJPPP010000028.1 | GCA905372475_01480 | gene | open | 14606-16246 | |||
| 2982 | CAJPPP010000028.1 | GCA905372475_01481 | gene | open | 16263-17315 | |||
| 2983 | CAJPPP010000028.1 | GCA905372475_01482 | gene | open | 17720-17809 | |||
| 2984 | CAJPPP010000028.1 | GCA905372475_01483 | gene | open | 17861-18604 | |||
| 2985 | CAJPPP010000028.1 | GCA905372475_01484 | gene | open | 18607-19794 | |||
| 2986 | CAJPPP010000028.1 | GCA905372475_01485 | gene | open | 19954-20277 | |||
| 2987 | CAJPPP010000028.1 | GCA905372475_01486 | gene | open | 20303-21091 | |||
| 2988 | CAJPPP010000028.1 | GCA905372475_01487 | gene | open | 21165-21740 | |||
| 2989 | CAJPPP010000028.1 | GCA905372475_01488 | gene | open | 21829-23541 | |||
| 2990 | CAJPPP010000028.1 | GCA905372475_01489 | gene | open | 23549-25276 | |||
| 2991 | CAJPPP010000028.1 | GCA905372475_01490 | gene | open | 25273-25764 | |||
| 2992 | CAJPPP010000028.1 | GCA905372475_01491 | gene | open | 25847-26458 | |||
| 2993 | CAJPPP010000028.1 | GCA905372475_01492 | gene | open | 26451-28778 | ccmA | ||
| 2994 | CAJPPP010000028.1 | GCA905372475_01493 | gene | open | 29370-29735 | |||
| 2995 | CAJPPP010000029.1 | GCA905372475_01494 | CDS | open | 150-1805 | _na 551_aa | alpha/beta hydrolase | |
| 2996 | CAJPPP010000029.1 | GCA905372475_01495 | CDS | open | 2036-3652 | _na 538_aa | alpha/beta hydrolase | |
| 2997 | CAJPPP010000029.1 | GCA905372475_01496 | CDS | open | 3999-5963 | _na 654_aa | estB | Esterase estB |
| 2998 | CAJPPP010000029.1 | GCA905372475_01497 | CDS | open | 5986-7221 | _na 411_aa | sensor histidine kinase | |
| 2999 | CAJPPP010000029.1 | GCA905372475_01498 | CDS | open | 7218-7874 | _na 218_aa | response regulator transcription factor | |
| 3000 | CAJPPP010000029.1 | GCA905372475_01499 | CDS | open | 7976-8593 | _na 205_aa | TetR/AcrR family transcriptional regulator |

