BAKTAGenome Explorer: Arachnia rubra (GCA_905372475.1)
Select a Genome:
|
BAKTA Annotations for GCA_905372475.1
|
Search & Sort all 5763 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | CAJPPP010000049.1 | GCA905372475_01987 | gene | open | 9564-9637 | trnL | ||
| 4002 | CAJPPP010000049.1 | GCA905372475_01994 | gene | open | 15007-15089 | trnH | ||
| 4003 | CAJPPP010000049.1 | GCA905372475_01987 | tRNA | open | 9564-9637 | trnL | tRNA-Leu(taa) | |
| 4004 | CAJPPP010000049.1 | GCA905372475_01994 | tRNA | open | 15007-15089 | trnH | tRNA-His(atg) | |
| 4005 | CAJPPP010000050.1 | GCA905372475_01999 | CDS | open | 17-2911 | _na 964_aa | exodeoxyribonuclease V subunit gamma | |
| 4006 | CAJPPP010000050.1 | GCA905372475_02000 | CDS | open | 3016-5064 | _na 682_aa | ATP-dependent helicase | |
| 4007 | CAJPPP010000050.1 | GCA905372475_02001 | CDS | open | 5191-6498 | _na 435_aa | zinc-dependent metalloprotease | |
| 4008 | CAJPPP010000050.1 | GCA905372475_02002 | CDS | open | 6647-7687 | _na 346_aa | PDZ domain-containing protein | |
| 4009 | CAJPPP010000050.1 | GCA905372475_02003 | CDS | open | 7680-8204 | _na 174_aa | PPA1309 family protein | |
| 4010 | CAJPPP010000050.1 | GCA905372475_02004 | CDS | open | 8201-11065 | _na 954_aa | UPF0182 family protein | |
| 4011 | CAJPPP010000050.1 | GCA905372475_02005 | CDS | open | 11174-12514 | _na 446_aa | pitrilysin family protein | |
| 4012 | CAJPPP010000050.1 | GCA905372475_02006 | CDS | open | 12511-13779 | _na 422_aa | pitrilysin family protein | |
| 4013 | CAJPPP010000050.1 | GCA905372475_02007 | CDS | open | 13783-14172 | _na 129_aa | DUF3040 domain-containing protein | |
| 4014 | CAJPPP010000050.1 | GCA905372475_02008 | CDS | open | 14266-16431 | _na 721_aa | transglutaminase domain-containing protein | |
| 4015 | CAJPPP010000050.1 | GCA905372475_02009 | CDS | open | 16428-17678 | _na 416_aa | DUF58 domain-containing protein | |
| 4016 | CAJPPP010000050.1 | GCA905372475_02010 | CDS | open | 17680-18651 | _na 323_aa | mMP0363 | Magnesium chelatase subunit D |
| 4017 | CAJPPP010000050.1 | GCA905372475_01999 | gene | open | 17-2911 | |||
| 4018 | CAJPPP010000050.1 | GCA905372475_02000 | gene | open | 3016-5064 | |||
| 4019 | CAJPPP010000050.1 | GCA905372475_02001 | gene | open | 5191-6498 | |||
| 4020 | CAJPPP010000050.1 | GCA905372475_02002 | gene | open | 6647-7687 | |||
| 4021 | CAJPPP010000050.1 | GCA905372475_02003 | gene | open | 7680-8204 | |||
| 4022 | CAJPPP010000050.1 | GCA905372475_02004 | gene | open | 8201-11065 | |||
| 4023 | CAJPPP010000050.1 | GCA905372475_02005 | gene | open | 11174-12514 | |||
| 4024 | CAJPPP010000050.1 | GCA905372475_02006 | gene | open | 12511-13779 | |||
| 4025 | CAJPPP010000050.1 | GCA905372475_02007 | gene | open | 13783-14172 | |||
| 4026 | CAJPPP010000050.1 | GCA905372475_02008 | gene | open | 14266-16431 | |||
| 4027 | CAJPPP010000050.1 | GCA905372475_02009 | gene | open | 16428-17678 | |||
| 4028 | CAJPPP010000050.1 | GCA905372475_02010 | gene | open | 17680-18651 | mMP0363 | ||
| 4029 | CAJPPP010000051.1 | GCA905372475_02011 | CDS | open | 1-375 | _na 124_aa | phosphoserine phosphatase | |
| 4030 | CAJPPP010000051.1 | GCA905372475_02012 | CDS | open | 482-1993 | _na 503_aa | acetyl-CoA hydrolase/transferase family protein | |
| 4031 | CAJPPP010000051.1 | GCA905372475_02013 | CDS | open | 2052-2597 | _na 181_aa | thpR | 2'-5' RNA ligase family protein |
| 4032 | CAJPPP010000051.1 | GCA905372475_02014 | CDS | open | 2695-3912 | _na 405_aa | M20 family metallopeptidase | |
| 4033 | CAJPPP010000051.1 | GCA905372475_02015 | CDS | open | 3925-4620 | _na 231_aa | Runt domain-containing protein | |
| 4034 | CAJPPP010000051.1 | GCA905372475_02016 | CDS | open | 4655-5470 | _na 271_aa | MetQ/NlpA family ABC transporter substrate-binding protein | |
| 4035 | CAJPPP010000051.1 | GCA905372475_02017 | CDS | open | 5537-6208 | _na 223_aa | methionine ABC transporter permease | |
| 4036 | CAJPPP010000051.1 | GCA905372475_02018 | CDS | open | 6208-7218 | _na 336_aa | methionine ABC transporter ATP-binding protein | |
| 4037 | CAJPPP010000051.1 | GCA905372475_02019 | CDS | open | 7312-7890 | _na 192_aa | type II toxin-antitoxin system PemK/MazF family toxin | |
| 4038 | CAJPPP010000051.1 | GCA905372475_02020 | CDS | open | 8582-9166 | _na 194_aa | hypothetical protein | |
| 4039 | CAJPPP010000051.1 | GCA905372475_02021 | CDS | open | 9200-10342 | _na 380_aa | hypothetical protein | |
| 4040 | CAJPPP010000051.1 | GCA905372475_02022 | CDS | open | 10776-11828 | _na 350_aa | SH3 domain-containing protein | |
| 4041 | CAJPPP010000051.1 | GCA905372475_02023 | CDS | open | 11922-13508 | _na 528_aa | glycosyltransferase family 39 protein | |
| 4042 | CAJPPP010000051.1 | GCA905372475_02024 | CDS | open | 13499-15064 | _na 521_aa | glycosyltransferase family 2 protein | |
| 4043 | CAJPPP010000051.1 | GCA905372475_02025 | CDS | open | 15061-15441 | _na 126_aa | hypothetical protein | |
| 4044 | CAJPPP010000051.1 | GCA905372475_02026 | CDS | open | 15928-17601 | _na 557_aa | pgi | glucose-6-phosphate isomerase |
| 4045 | CAJPPP010000051.1 | GCA905372475_02027 | CDS | open | 17598-18287 | _na 229_aa | sanA | Vancomycin high temperature exclusion protein |
| 4046 | CAJPPP010000051.1 | GCA905372475_02011 | gene | open | 1-375 | |||
| 4047 | CAJPPP010000051.1 | GCA905372475_02012 | gene | open | 482-1993 | |||
| 4048 | CAJPPP010000051.1 | GCA905372475_02013 | gene | open | 2052-2597 | thpR | ||
| 4049 | CAJPPP010000051.1 | GCA905372475_02014 | gene | open | 2695-3912 | |||
| 4050 | CAJPPP010000051.1 | GCA905372475_02015 | gene | open | 3925-4620 | |||
| 4051 | CAJPPP010000051.1 | GCA905372475_02016 | gene | open | 4655-5470 | |||
| 4052 | CAJPPP010000051.1 | GCA905372475_02017 | gene | open | 5537-6208 | |||
| 4053 | CAJPPP010000051.1 | GCA905372475_02018 | gene | open | 6208-7218 | |||
| 4054 | CAJPPP010000051.1 | GCA905372475_02019 | gene | open | 7312-7890 | |||
| 4055 | CAJPPP010000051.1 | GCA905372475_02020 | gene | open | 8582-9166 | |||
| 4056 | CAJPPP010000051.1 | GCA905372475_02021 | gene | open | 9200-10342 | |||
| 4057 | CAJPPP010000051.1 | GCA905372475_02022 | gene | open | 10776-11828 | |||
| 4058 | CAJPPP010000051.1 | GCA905372475_02023 | gene | open | 11922-13508 | |||
| 4059 | CAJPPP010000051.1 | GCA905372475_02024 | gene | open | 13499-15064 | |||
| 4060 | CAJPPP010000051.1 | GCA905372475_02025 | gene | open | 15061-15441 | |||
| 4061 | CAJPPP010000051.1 | GCA905372475_02026 | gene | open | 15928-17601 | pgi | ||
| 4062 | CAJPPP010000051.1 | GCA905372475_02027 | gene | open | 17598-18287 | sanA | ||
| 4063 | CAJPPP010000051.1 | GCA905372475_02028 | gene | open | 18374-18450 | trnF | ||
| 4064 | CAJPPP010000051.1 | GCA905372475_02029 | gene | open | 18476-18549 | trnD | ||
| 4065 | CAJPPP010000051.1 | GCA905372475_02028 | tRNA | open | 18374-18450 | trnF | tRNA-Phe(gaa) | |
| 4066 | CAJPPP010000051.1 | GCA905372475_02029 | tRNA | open | 18476-18549 | trnD | tRNA-Asp(gtc) | |
| 4067 | CAJPPP010000052.1 | GCA905372475_02030 | CDS | open | 104-310 | _na 68_aa | hypothetical protein | |
| 4068 | CAJPPP010000052.1 | GCA905372475_02031 | CDS | open | 483-800 | _na 105_aa | hypothetical protein | |
| 4069 | CAJPPP010000052.1 | GCA905372475_02032 | CDS | open | 797-1492 | _na 231_aa | hypothetical protein | |
| 4070 | CAJPPP010000052.1 | GCA905372475_02033 | CDS | open | 1759-2505 | _na 248_aa | hypothetical protein | |
| 4071 | CAJPPP010000052.1 | GCA905372475_02034 | CDS | open | 2844-4598 | _na 584_aa | hypothetical protein | |
| 4072 | CAJPPP010000052.1 | GCA905372475_02035 | CDS | open | 4644-5678 | _na 344_aa | ABC transporter substrate-binding protein | |
| 4073 | CAJPPP010000052.1 | GCA905372475_02036 | CDS | open | 5675-6688 | _na 337_aa | iron ABC transporter permease | |
| 4074 | CAJPPP010000052.1 | GCA905372475_02037 | CDS | open | 6688-7518 | _na 276_aa | ABC transporter ATP-binding protein | |
| 4075 | CAJPPP010000052.1 | GCA905372475_02038 | CDS | open | 7515-11234 | _na 1239_aa | cobN | cobaltochelatase subunit CobN |
| 4076 | CAJPPP010000052.1 | GCA905372475_02039 | CDS | open | 11258-11824 | _na 188_aa | hypothetical protein | |
| 4077 | CAJPPP010000052.1 | GCA905372475_02040 | CDS | open | 11826-13754 | _na 642_aa | VWA domain-containing protein | |
| 4078 | CAJPPP010000052.1 | GCA905372475_02041 | CDS | open | 13751-14743 | _na 330_aa | ATP-binding protein | |
| 4079 | CAJPPP010000052.1 | GCA905372475_02042 | CDS | open | 15165-15404 | _na 79_aa | Toxin | |
| 4080 | CAJPPP010000052.1 | GCA905372475_02043 | CDS | open | 15714-16517 | _na 267_aa | hypothetical protein | |
| 4081 | CAJPPP010000052.1 | GCA905372475_02030 | gene | open | 104-310 | |||
| 4082 | CAJPPP010000052.1 | GCA905372475_02031 | gene | open | 483-800 | |||
| 4083 | CAJPPP010000052.1 | GCA905372475_02032 | gene | open | 797-1492 | |||
| 4084 | CAJPPP010000052.1 | GCA905372475_02033 | gene | open | 1759-2505 | |||
| 4085 | CAJPPP010000052.1 | GCA905372475_02034 | gene | open | 2844-4598 | |||
| 4086 | CAJPPP010000052.1 | GCA905372475_02035 | gene | open | 4644-5678 | |||
| 4087 | CAJPPP010000052.1 | GCA905372475_02036 | gene | open | 5675-6688 | |||
| 4088 | CAJPPP010000052.1 | GCA905372475_02037 | gene | open | 6688-7518 | |||
| 4089 | CAJPPP010000052.1 | GCA905372475_02038 | gene | open | 7515-11234 | cobN | ||
| 4090 | CAJPPP010000052.1 | GCA905372475_02039 | gene | open | 11258-11824 | |||
| 4091 | CAJPPP010000052.1 | GCA905372475_02040 | gene | open | 11826-13754 | |||
| 4092 | CAJPPP010000052.1 | GCA905372475_02041 | gene | open | 13751-14743 | |||
| 4093 | CAJPPP010000052.1 | GCA905372475_02042 | gene | open | 15165-15404 | |||
| 4094 | CAJPPP010000052.1 | GCA905372475_02043 | gene | open | 15714-16517 | |||
| 4095 | CAJPPP010000053.1 | GCA905372475_02045 | CDS | open | 237-1799 | _na 520_aa | hypothetical protein | |
| 4096 | CAJPPP010000053.1 | GCA905372475_02046 | CDS | open | 1957-2412 | _na 151_aa | hypothetical protein | |
| 4097 | CAJPPP010000053.1 | GCA905372475_02047 | CDS | open | 2870-5281 | _na 803_aa | DUF5979 domain-containing protein | |
| 4098 | CAJPPP010000053.1 | GCA905372475_02048 | CDS | open | 5566-6579 | _na 337_aa | LLM class flavin-dependent oxidoreductase | |
| 4099 | CAJPPP010000053.1 | GCA905372475_02049 | CDS | open | 6660-7613 | _na 317_aa | alpha/beta hydrolase | |
| 4100 | CAJPPP010000053.1 | GCA905372475_02050 | CDS | open | 7626-7844 | _na 72_aa | DUF3073 domain-containing protein | |
| 4101 | CAJPPP010000053.1 | GCA905372475_02051 | CDS | open | 7997-10204 | _na 735_aa | NADP-dependent isocitrate dehydrogenase | |
| 4102 | CAJPPP010000053.1 | GCA905372475_02052 | CDS | open | 10364-10996 | _na 210_aa | TetR/AcrR family transcriptional regulator C-terminal domain-containing protein | |
| 4103 | CAJPPP010000053.1 | GCA905372475_02053 | CDS | open | 11071-12651 | _na 526_aa | MFS transporter | |
| 4104 | CAJPPP010000053.1 | GCA905372475_02054 | CDS | open | 12661-13701 | _na 346_aa | phosphoribosylformylglycinamidine cyclo-ligase | |
| 4105 | CAJPPP010000053.1 | GCA905372475_02055 | CDS | open | 13698-15326 | _na 542_aa | purF | amidophosphoribosyltransferase |
| 4106 | CAJPPP010000053.1 | GCA905372475_02056 | CDS | open | 15724-17046 | _na 440_aa | dipeptidase | |
| 4107 | CAJPPP010000053.1 | GCA905372475_02057 | CDS | open | 17068-17565 | _na 165_aa | ABC-type maltose/maltodextrin transport system%2C permease component | |
| 4108 | CAJPPP010000053.1 | GCA905372475_02045 | gene | open | 237-1799 | |||
| 4109 | CAJPPP010000053.1 | GCA905372475_02046 | gene | open | 1957-2412 | |||
| 4110 | CAJPPP010000053.1 | GCA905372475_02047 | gene | open | 2870-5281 | |||
| 4111 | CAJPPP010000053.1 | GCA905372475_02048 | gene | open | 5566-6579 | |||
| 4112 | CAJPPP010000053.1 | GCA905372475_02049 | gene | open | 6660-7613 | |||
| 4113 | CAJPPP010000053.1 | GCA905372475_02050 | gene | open | 7626-7844 | |||
| 4114 | CAJPPP010000053.1 | GCA905372475_02051 | gene | open | 7997-10204 | |||
| 4115 | CAJPPP010000053.1 | GCA905372475_02052 | gene | open | 10364-10996 | |||
| 4116 | CAJPPP010000053.1 | GCA905372475_02053 | gene | open | 11071-12651 | |||
| 4117 | CAJPPP010000053.1 | GCA905372475_02054 | gene | open | 12661-13701 | |||
| 4118 | CAJPPP010000053.1 | GCA905372475_02055 | gene | open | 13698-15326 | purF | ||
| 4119 | CAJPPP010000053.1 | GCA905372475_02056 | gene | open | 15724-17046 | |||
| 4120 | CAJPPP010000053.1 | GCA905372475_02057 | gene | open | 17068-17565 | |||
| 4121 | CAJPPP010000053.1 | GCA905372475_02044 | gene | open | 2-69 | trnE | ||
| 4122 | CAJPPP010000053.1 | GCA905372475_02044 | tRNA | open | 2-69 | trnE | tRNA-Glu(ttc) | |
| 4123 | CAJPPP010000054.1 | GCA905372475_02058 | CDS | open | 39-1433 | _na 464_aa | DUF2029 domain-containing protein | |
| 4124 | CAJPPP010000054.1 | GCA905372475_02059 | CDS | open | 1530-3902 | _na 790_aa | transglycosylase domain-containing protein | |
| 4125 | CAJPPP010000054.1 | GCA905372475_02060 | CDS | open | 4097-5314 | _na 405_aa | YibE/F family protein | |
| 4126 | CAJPPP010000054.1 | GCA905372475_02061 | CDS | open | 5433-6350 | _na 305_aa | rhomboid family intramembrane serine protease | |
| 4127 | CAJPPP010000054.1 | GCA905372475_02062 | CDS | open | 6343-8229 | _na 628_aa | penicillin-binding transpeptidase domain-containing protein | |
| 4128 | CAJPPP010000054.1 | GCA905372475_02063 | CDS | open | 8463-9644 | _na 393_aa | terC | TerC family protein |
| 4129 | CAJPPP010000054.1 | GCA905372475_02064 | CDS | open | 9717-10661 | _na 314_aa | NAD(P)-binding domain-containing protein | |
| 4130 | CAJPPP010000054.1 | GCA905372475_02065 | CDS | open | 10763-11479 | _na 238_aa | TetR/AcrR family transcriptional regulator | |
| 4131 | CAJPPP010000054.1 | GCA905372475_02066 | CDS | open | 11588-12391 | _na 267_aa | hypothetical protein | |
| 4132 | CAJPPP010000054.1 | GCA905372475_02067 | CDS | open | 12825-14468 | _na 547_aa | Na+/H+ antiporter | |
| 4133 | CAJPPP010000054.1 | GCA905372475_02068 | CDS | open | 14550-14906 | _na 118_aa | DUF2185 domain-containing protein | |
| 4134 | CAJPPP010000054.1 | GCA905372475_02069 | CDS | open | 15112-15693 | _na 193_aa | TetR/AcrR family transcriptional regulator | |
| 4135 | CAJPPP010000054.1 | GCA905372475_02070 | CDS | open | 15690-16049 | _na 119_aa | doxX | DoxX family protein |
| 4136 | CAJPPP010000054.1 | GCA905372475_02071 | CDS | open | 16168-16884 | _na 238_aa | hypothetical protein | |
| 4137 | CAJPPP010000054.1 | GCA905372475_02072 | CDS | open | 17208-17468 | _na 86_aa | Transposase IS4-like domain-containing protein | |
| 4138 | CAJPPP010000054.1 | GCA905372475_02058 | gene | open | 39-1433 | |||
| 4139 | CAJPPP010000054.1 | GCA905372475_02059 | gene | open | 1530-3902 | |||
| 4140 | CAJPPP010000054.1 | GCA905372475_02060 | gene | open | 4097-5314 | |||
| 4141 | CAJPPP010000054.1 | GCA905372475_02061 | gene | open | 5433-6350 | |||
| 4142 | CAJPPP010000054.1 | GCA905372475_02062 | gene | open | 6343-8229 | |||
| 4143 | CAJPPP010000054.1 | GCA905372475_02063 | gene | open | 8463-9644 | terC | ||
| 4144 | CAJPPP010000054.1 | GCA905372475_02064 | gene | open | 9717-10661 | |||
| 4145 | CAJPPP010000054.1 | GCA905372475_02065 | gene | open | 10763-11479 | |||
| 4146 | CAJPPP010000054.1 | GCA905372475_02066 | gene | open | 11588-12391 | |||
| 4147 | CAJPPP010000054.1 | GCA905372475_02067 | gene | open | 12825-14468 | |||
| 4148 | CAJPPP010000054.1 | GCA905372475_02068 | gene | open | 14550-14906 | |||
| 4149 | CAJPPP010000054.1 | GCA905372475_02069 | gene | open | 15112-15693 | |||
| 4150 | CAJPPP010000054.1 | GCA905372475_02070 | gene | open | 15690-16049 | doxX | ||
| 4151 | CAJPPP010000054.1 | GCA905372475_02071 | gene | open | 16168-16884 | |||
| 4152 | CAJPPP010000054.1 | GCA905372475_02072 | gene | open | 17208-17468 | |||
| 4153 | CAJPPP010000055.1 | GCA905372475_02073 | CDS | open | 1141-1689 | _na 182_aa | hypothetical protein | |
| 4154 | CAJPPP010000055.1 | GCA905372475_02074 | CDS | open | 1677-2363 | _na 228_aa | ATP-binding cassette domain-containing protein | |
| 4155 | CAJPPP010000055.1 | GCA905372475_02075 | CDS | open | 2347-3279 | _na 310_aa | hypothetical protein | |
| 4156 | CAJPPP010000055.1 | GCA905372475_02076 | CDS | open | 3688-4392 | _na 234_aa | TetR/AcrR family transcriptional regulator | |
| 4157 | CAJPPP010000055.1 | GCA905372475_02077 | CDS | open | 4423-4764 | _na 113_aa | hypothetical protein | |
| 4158 | CAJPPP010000055.1 | GCA905372475_02079 | CDS | open | 5319-5702 | _na 127_aa | hypothetical protein | |
| 4159 | CAJPPP010000055.1 | GCA905372475_02080 | CDS | open | 5681-6514 | _na 277_aa | lysR | LysR family transcriptional regulator |
| 4160 | CAJPPP010000055.1 | GCA905372475_02081 | CDS | open | 6476-6601 | _na 41_aa | hypothetical protein | |
| 4161 | CAJPPP010000055.1 | GCA905372475_02082 | CDS | open | 6992-7462 | _na 156_aa | osmC | OsmC family protein |
| 4162 | CAJPPP010000055.1 | GCA905372475_02083 | CDS | open | 7473-7574 | _na 33_aa | hypothetical protein | |
| 4163 | CAJPPP010000055.1 | GCA905372475_02084 | CDS | open | 7763-7912 | _na 49_aa | hypothetical protein | |
| 4164 | CAJPPP010000055.1 | GCA905372475_02085 | CDS | open | 7918-8322 | _na 134_aa | Histidine kinase | |
| 4165 | CAJPPP010000055.1 | GCA905372475_02086 | CDS | open | 8319-8591 | _na 90_aa | Sigma-70%2C region 4 | |
| 4166 | CAJPPP010000055.1 | GCA905372475_02087 | CDS | open | 8597-8761 | _na 54_aa | hypothetical protein | |
| 4167 | CAJPPP010000055.1 | GCA905372475_02088 | CDS | open | 8867-8959 | _na 30_aa | hypothetical protein | |
| 4168 | CAJPPP010000055.1 | GCA905372475_02089 | CDS | open | 9543-9938 | _na 131_aa | hypothetical protein | |
| 4169 | CAJPPP010000055.1 | GCA905372475_02090 | CDS | open | 9911-10504 | _na 197_aa | hypothetical protein | |
| 4170 | CAJPPP010000055.1 | GCA905372475_02091 | CDS | open | 10916-11017 | _na 33_aa | hypothetical protein | |
| 4171 | CAJPPP010000055.1 | GCA905372475_02092 | CDS | open | 11014-11502 | _na 162_aa | hypothetical protein | |
| 4172 | CAJPPP010000055.1 | GCA905372475_02093 | CDS | open | 11475-11729 | _na 84_aa | hypothetical protein | |
| 4173 | CAJPPP010000055.1 | GCA905372475_02094 | CDS | open | 12014-12970 | _na 318_aa | alpha/beta hydrolase | |
| 4174 | CAJPPP010000055.1 | GCA905372475_02095 | CDS | open | 13047-13640 | _na 197_aa | tetR | TetR family transcriptional regulator |
| 4175 | CAJPPP010000055.1 | GCA905372475_02096 | CDS | open | 13759-14454 | _na 231_aa | HXXEE domain-containing protein | |
| 4176 | CAJPPP010000055.1 | GCA905372475_02097 | CDS | open | 14462-14719 | _na 85_aa | hypothetical protein | |
| 4177 | CAJPPP010000055.1 | GCA905372475_02098 | CDS | open | 14901-16388 | _na 495_aa | class I SAM-dependent methyltransferase | |
| 4178 | CAJPPP010000055.1 | GCA905372475_02099 | CDS | open | 16385-17344 | _na 319_aa | Restriction endonuclease | |
| 4179 | CAJPPP010000055.1 | GCA905372475_02073 | gene | open | 1141-1689 | |||
| 4180 | CAJPPP010000055.1 | GCA905372475_02074 | gene | open | 1677-2363 | |||
| 4181 | CAJPPP010000055.1 | GCA905372475_02075 | gene | open | 2347-3279 | |||
| 4182 | CAJPPP010000055.1 | GCA905372475_02076 | gene | open | 3688-4392 | |||
| 4183 | CAJPPP010000055.1 | GCA905372475_02077 | gene | open | 4423-4764 | |||
| 4184 | CAJPPP010000055.1 | GCA905372475_02079 | gene | open | 5319-5702 | |||
| 4185 | CAJPPP010000055.1 | GCA905372475_02080 | gene | open | 5681-6514 | lysR | ||
| 4186 | CAJPPP010000055.1 | GCA905372475_02081 | gene | open | 6476-6601 | |||
| 4187 | CAJPPP010000055.1 | GCA905372475_02082 | gene | open | 6992-7462 | osmC | ||
| 4188 | CAJPPP010000055.1 | GCA905372475_02083 | gene | open | 7473-7574 | |||
| 4189 | CAJPPP010000055.1 | GCA905372475_02084 | gene | open | 7763-7912 | |||
| 4190 | CAJPPP010000055.1 | GCA905372475_02085 | gene | open | 7918-8322 | |||
| 4191 | CAJPPP010000055.1 | GCA905372475_02086 | gene | open | 8319-8591 | |||
| 4192 | CAJPPP010000055.1 | GCA905372475_02087 | gene | open | 8597-8761 | |||
| 4193 | CAJPPP010000055.1 | GCA905372475_02088 | gene | open | 8867-8959 | |||
| 4194 | CAJPPP010000055.1 | GCA905372475_02089 | gene | open | 9543-9938 | |||
| 4195 | CAJPPP010000055.1 | GCA905372475_02090 | gene | open | 9911-10504 | |||
| 4196 | CAJPPP010000055.1 | GCA905372475_02091 | gene | open | 10916-11017 | |||
| 4197 | CAJPPP010000055.1 | GCA905372475_02092 | gene | open | 11014-11502 | |||
| 4198 | CAJPPP010000055.1 | GCA905372475_02093 | gene | open | 11475-11729 | |||
| 4199 | CAJPPP010000055.1 | GCA905372475_02094 | gene | open | 12014-12970 | |||
| 4200 | CAJPPP010000055.1 | GCA905372475_02095 | gene | open | 13047-13640 | tetR | ||
| 4201 | CAJPPP010000055.1 | GCA905372475_02096 | gene | open | 13759-14454 | |||
| 4202 | CAJPPP010000055.1 | GCA905372475_02097 | gene | open | 14462-14719 | |||
| 4203 | CAJPPP010000055.1 | GCA905372475_02098 | gene | open | 14901-16388 | |||
| 4204 | CAJPPP010000055.1 | GCA905372475_02099 | gene | open | 16385-17344 | |||
| 4205 | CAJPPP010000055.1 | GCA905372475_02078 | gene | open | 4857-4932 | trnA | ||
| 4206 | CAJPPP010000055.1 | GCA905372475_02078 | tRNA | open | 4857-4932 | trnA | tRNA-Ala(tgc) | |
| 4207 | CAJPPP010000056.1 | GCA905372475_02103 | gene | open | 7159-7233 | ASpks | ||
| 4208 | CAJPPP010000056.1 | GCA905372475_02103 | ncRNA | open | 7159-7233 | ASpks TB sRNA | ||
| 4209 | CAJPPP010000056.1 | GCA905372475_02100 | CDS | open | 14-1435 | _na 473_aa | hypothetical protein | |
| 4210 | CAJPPP010000056.1 | GCA905372475_02101 | CDS | open | 1455-6119 | _na 1554_aa | type I polyketide synthase | |
| 4211 | CAJPPP010000056.1 | GCA905372475_02102 | CDS | open | 6136-15762 | _na 3208_aa | fabD | ACP S-malonyltransferase |
| 4212 | CAJPPP010000056.1 | GCA905372475_02104 | CDS | open | 15759-16514 | _na 251_aa | 4'-phosphopantetheinyl transferase | |
| 4213 | CAJPPP010000056.1 | GCA905372475_02100 | gene | open | 14-1435 | |||
| 4214 | CAJPPP010000056.1 | GCA905372475_02101 | gene | open | 1455-6119 | |||
| 4215 | CAJPPP010000056.1 | GCA905372475_02102 | gene | open | 6136-15762 | fabD | ||
| 4216 | CAJPPP010000056.1 | GCA905372475_02104 | gene | open | 15759-16514 | |||
| 4217 | CAJPPP010000057.1 | GCA905372475_02105 | CDS | open | 113-976 | _na 287_aa | ycjR | Inosose dehydratase |
| 4218 | CAJPPP010000057.1 | GCA905372475_02106 | CDS | open | 973-1968 | _na 331_aa | iolG | inositol 2-dehydrogenase |
| 4219 | CAJPPP010000057.1 | GCA905372475_02107 | CDS | open | 2138-3217 | _na 359_aa | talA | Transaldolase |
| 4220 | CAJPPP010000057.1 | GCA905372475_02108 | CDS | open | 3336-4004 | _na 222_aa | response regulator transcription factor | |
| 4221 | CAJPPP010000057.1 | GCA905372475_02109 | CDS | open | 4215-5561 | _na 448_aa | sensor histidine kinase | |
| 4222 | CAJPPP010000057.1 | GCA905372475_02110 | CDS | open | 5704-6387 | _na 227_aa | response regulator transcription factor | |
| 4223 | CAJPPP010000057.1 | GCA905372475_02111 | CDS | open | 6410-7201 | _na 263_aa | ABC transporter permease | |
| 4224 | CAJPPP010000057.1 | GCA905372475_02112 | CDS | open | 7198-7968 | _na 256_aa | ABC transporter permease | |
| 4225 | CAJPPP010000057.1 | GCA905372475_02113 | CDS | open | 7965-8966 | _na 333_aa | ABC transporter ATP-binding protein | |
| 4226 | CAJPPP010000057.1 | GCA905372475_02114 | CDS | open | 8969-10243 | _na 424_aa | sensor histidine kinase | |
| 4227 | CAJPPP010000057.1 | GCA905372475_02115 | CDS | open | 10291-10464 | _na 57_aa | hypothetical protein | |
| 4228 | CAJPPP010000057.1 | GCA905372475_02116 | CDS | open | 10707-12821 | _na 704_aa | peptidase domain-containing ABC transporter | |
| 4229 | CAJPPP010000057.1 | GCA905372475_02117 | CDS | open | 12818-15598 | _na 926_aa | lanM | type 2 lanthipeptide synthetase LanM family protein |
| 4230 | CAJPPP010000057.1 | GCA905372475_02118 | CDS | open | 15952-16107 | _na 51_aa | lacticin 481 family lantibiotic | |
| 4231 | CAJPPP010000057.1 | GCA905372475_02105 | gene | open | 113-976 | ycjR | ||
| 4232 | CAJPPP010000057.1 | GCA905372475_02106 | gene | open | 973-1968 | iolG | ||
| 4233 | CAJPPP010000057.1 | GCA905372475_02107 | gene | open | 2138-3217 | talA | ||
| 4234 | CAJPPP010000057.1 | GCA905372475_02108 | gene | open | 3336-4004 | |||
| 4235 | CAJPPP010000057.1 | GCA905372475_02109 | gene | open | 4215-5561 | |||
| 4236 | CAJPPP010000057.1 | GCA905372475_02110 | gene | open | 5704-6387 | |||
| 4237 | CAJPPP010000057.1 | GCA905372475_02111 | gene | open | 6410-7201 | |||
| 4238 | CAJPPP010000057.1 | GCA905372475_02112 | gene | open | 7198-7968 | |||
| 4239 | CAJPPP010000057.1 | GCA905372475_02113 | gene | open | 7965-8966 | |||
| 4240 | CAJPPP010000057.1 | GCA905372475_02114 | gene | open | 8969-10243 | |||
| 4241 | CAJPPP010000057.1 | GCA905372475_02115 | gene | open | 10291-10464 | |||
| 4242 | CAJPPP010000057.1 | GCA905372475_02116 | gene | open | 10707-12821 | |||
| 4243 | CAJPPP010000057.1 | GCA905372475_02117 | gene | open | 12818-15598 | lanM | ||
| 4244 | CAJPPP010000057.1 | GCA905372475_02118 | gene | open | 15952-16107 | |||
| 4245 | CAJPPP010000058.1 | GCA905372475_02132 | gene | open | 15221-15587 | ssrA | ||
| 4246 | CAJPPP010000058.1 | GCA905372475_02132 | tmRNA | open | 15221-15587 | ssrA | transfer-messenger RNA%2C SsrA | |
| 4247 | CAJPPP010000058.1 | GCA905372475_02119 | CDS | open | 701-2101 | _na 466_aa | ABC transporter substrate-binding protein | |
| 4248 | CAJPPP010000058.1 | GCA905372475_02120 | CDS | open | 2246-5008 | _na 920_aa | aceE | pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type |
| 4249 | CAJPPP010000058.1 | GCA905372475_02121 | CDS | open | 5131-5514 | _na 127_aa | DUF3052 domain-containing protein | |
| 4250 | CAJPPP010000058.1 | GCA905372475_02122 | CDS | open | 5540-7753 | _na 737_aa | 6-phosphofructokinase | |
| 4251 | CAJPPP010000058.1 | GCA905372475_02123 | CDS | open | 7775-8989 | _na 404_aa | hypothetical protein | |
| 4252 | CAJPPP010000058.1 | GCA905372475_02125 | CDS | open | 9253-9720 | _na 155_aa | GatB/YqeY domain-containing protein | |
| 4253 | CAJPPP010000058.1 | GCA905372475_02126 | CDS | open | 9792-10907 | _na 371_aa | prfB | peptide chain release factor 2 |
| 4254 | CAJPPP010000058.1 | GCA905372475_02127 | CDS | open | 11028-11714 | _na 228_aa | ftsE | cell division ATP-binding protein FtsE |
| 4255 | CAJPPP010000058.1 | GCA905372475_02128 | CDS | open | 11734-12636 | _na 300_aa | ftsX | permease-like cell division protein FtsX |
| 4256 | CAJPPP010000058.1 | GCA905372475_02129 | CDS | open | 12654-14027 | _na 457_aa | M23 family metallopeptidase | |
| 4257 | CAJPPP010000058.1 | GCA905372475_02130 | CDS | open | 14052-14537 | _na 161_aa | smpB | SsrA-binding protein SmpB |
| 4258 | CAJPPP010000058.1 | GCA905372475_02131 | CDS | open | 14607-15182 | _na 191_aa | DUF1707 domain-containing protein | |
| 4259 | CAJPPP010000058.1 | GCA905372475_02119 | gene | open | 701-2101 | |||
| 4260 | CAJPPP010000058.1 | GCA905372475_02120 | gene | open | 2246-5008 | aceE | ||
| 4261 | CAJPPP010000058.1 | GCA905372475_02121 | gene | open | 5131-5514 | |||
| 4262 | CAJPPP010000058.1 | GCA905372475_02122 | gene | open | 5540-7753 | |||
| 4263 | CAJPPP010000058.1 | GCA905372475_02123 | gene | open | 7775-8989 | |||
| 4264 | CAJPPP010000058.1 | GCA905372475_02125 | gene | open | 9253-9720 | |||
| 4265 | CAJPPP010000058.1 | GCA905372475_02126 | gene | open | 9792-10907 | prfB | ||
| 4266 | CAJPPP010000058.1 | GCA905372475_02127 | gene | open | 11028-11714 | ftsE | ||
| 4267 | CAJPPP010000058.1 | GCA905372475_02128 | gene | open | 11734-12636 | ftsX | ||
| 4268 | CAJPPP010000058.1 | GCA905372475_02129 | gene | open | 12654-14027 | |||
| 4269 | CAJPPP010000058.1 | GCA905372475_02130 | gene | open | 14052-14537 | smpB | ||
| 4270 | CAJPPP010000058.1 | GCA905372475_02131 | gene | open | 14607-15182 | |||
| 4271 | CAJPPP010000058.1 | GCA905372475_02124 | gene | open | 9135-9208 | trnV | ||
| 4272 | CAJPPP010000058.1 | GCA905372475_02124 | tRNA | open | 9135-9208 | trnV | tRNA-Val(tac) | |
| 4273 | CAJPPP010000059.1 | GCA905372475_02133 | CDS | open | 538-1614 | _na 358_aa | branched-chain amino acid aminotransferase | |
| 4274 | CAJPPP010000059.1 | GCA905372475_02134 | CDS | open | 1623-2105 | _na 160_aa | 8-oxo-dGTP diphosphatase | |
| 4275 | CAJPPP010000059.1 | GCA905372475_02135 | CDS | open | 2577-3548 | _na 323_aa | peptidoglycan recognition family protein | |
| 4276 | CAJPPP010000059.1 | GCA905372475_02136 | CDS | open | 4535-5068 | _na 177_aa | hypothetical protein | |
| 4277 | CAJPPP010000059.1 | GCA905372475_02137 | CDS | open | 5281-5733 | _na 150_aa | hypothetical protein | |
| 4278 | CAJPPP010000059.1 | GCA905372475_02138 | CDS | open | 5878-7143 | _na 421_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 4279 | CAJPPP010000059.1 | GCA905372475_02139 | CDS | open | 7140-7853 | _na 237_aa | type 1 glutamine amidotransferase | |
| 4280 | CAJPPP010000059.1 | GCA905372475_02140 | CDS | open | 7893-8687 | _na 264_aa | hypothetical protein | |
| 4281 | CAJPPP010000059.1 | GCA905372475_02141 | CDS | open | 9073-9660 | _na 195_aa | hypothetical protein | |
| 4282 | CAJPPP010000059.1 | GCA905372475_02142 | CDS | open | 9896-10375 | _na 159_aa | peptidoglycan-binding protein | |
| 4283 | CAJPPP010000059.1 | GCA905372475_02143 | CDS | open | 10977-11402 | _na 141_aa | carboxypeptidase-like regulatory domain-containing protein | |
| 4284 | CAJPPP010000059.1 | GCA905372475_02144 | CDS | open | 11739-12101 | _na 120_aa | hypothetical protein | |
| 4285 | CAJPPP010000059.1 | GCA905372475_02145 | CDS | open | 12101-12748 | _na 215_aa | vapB | type II toxin-antitoxin system VapB family antitoxin |
| 4286 | CAJPPP010000059.1 | GCA905372475_02146 | CDS | open | 13291-13851 | _na 186_aa | hypothetical protein | |
| 4287 | CAJPPP010000059.1 | GCA905372475_02147 | CDS | open | 13855-14934 | _na 359_aa | hypothetical protein | |
| 4288 | CAJPPP010000059.1 | GCA905372475_02148 | CDS | open | 15232-15585 | _na 117_aa | hypothetical protein | |
| 4289 | CAJPPP010000059.1 | GCA905372475_02133 | gene | open | 538-1614 | |||
| 4290 | CAJPPP010000059.1 | GCA905372475_02134 | gene | open | 1623-2105 | |||
| 4291 | CAJPPP010000059.1 | GCA905372475_02135 | gene | open | 2577-3548 | |||
| 4292 | CAJPPP010000059.1 | GCA905372475_02136 | gene | open | 4535-5068 | |||
| 4293 | CAJPPP010000059.1 | GCA905372475_02137 | gene | open | 5281-5733 | |||
| 4294 | CAJPPP010000059.1 | GCA905372475_02138 | gene | open | 5878-7143 | murT | ||
| 4295 | CAJPPP010000059.1 | GCA905372475_02139 | gene | open | 7140-7853 | |||
| 4296 | CAJPPP010000059.1 | GCA905372475_02140 | gene | open | 7893-8687 | |||
| 4297 | CAJPPP010000059.1 | GCA905372475_02141 | gene | open | 9073-9660 | |||
| 4298 | CAJPPP010000059.1 | GCA905372475_02142 | gene | open | 9896-10375 | |||
| 4299 | CAJPPP010000059.1 | GCA905372475_02143 | gene | open | 10977-11402 | |||
| 4300 | CAJPPP010000059.1 | GCA905372475_02144 | gene | open | 11739-12101 | |||
| 4301 | CAJPPP010000059.1 | GCA905372475_02145 | gene | open | 12101-12748 | vapB | ||
| 4302 | CAJPPP010000059.1 | GCA905372475_02146 | gene | open | 13291-13851 | |||
| 4303 | CAJPPP010000059.1 | GCA905372475_02147 | gene | open | 13855-14934 | |||
| 4304 | CAJPPP010000059.1 | GCA905372475_02148 | gene | open | 15232-15585 | |||
| 4305 | CAJPPP010000060.1 | GCA905372475_02149 | CDS | open | 406-1329 | _na 307_aa | DUF368 domain-containing protein | |
| 4306 | CAJPPP010000060.1 | GCA905372475_02150 | CDS | open | 1391-2005 | _na 204_aa | lemA | LemA family protein |
| 4307 | CAJPPP010000060.1 | GCA905372475_02151 | CDS | open | 2076-2615 | _na 179_aa | orotate phosphoribosyltransferase | |
| 4308 | CAJPPP010000060.1 | GCA905372475_02152 | CDS | open | 2654-3463 | _na 269_aa | spermidine synthase | |
| 4309 | CAJPPP010000060.1 | GCA905372475_02153 | CDS | open | 3803-4051 | _na 82_aa | hypothetical protein | |
| 4310 | CAJPPP010000060.1 | GCA905372475_02154 | CDS | open | 4059-5642 | _na 527_aa | serine/threonine-protein kinase | |
| 4311 | CAJPPP010000060.1 | GCA905372475_02155 | CDS | open | 5642-6742 | _na 366_aa | FHA domain-containing protein | |
| 4312 | CAJPPP010000060.1 | GCA905372475_02156 | CDS | open | 6742-7545 | _na 267_aa | PP2C family serine/threonine-protein phosphatase | |
| 4313 | CAJPPP010000060.1 | GCA905372475_02157 | CDS | open | 7542-9089 | _na 515_aa | FHA domain-containing protein | |
| 4314 | CAJPPP010000060.1 | GCA905372475_02158 | CDS | open | 9100-11445 | _na 781_aa | transglutaminase domain-containing protein | |
| 4315 | CAJPPP010000060.1 | GCA905372475_02159 | CDS | open | 11442-12614 | _na 390_aa | DUF58 domain-containing protein | |
| 4316 | CAJPPP010000060.1 | GCA905372475_02160 | CDS | open | 12668-13639 | _na 323_aa | mMP0363 | MoxR family ATPase |
| 4317 | CAJPPP010000060.1 | GCA905372475_02161 | CDS | open | 13673-15472 | _na 599_aa | hypothetical protein | |
| 4318 | CAJPPP010000060.1 | GCA905372475_02149 | gene | open | 406-1329 | |||
| 4319 | CAJPPP010000060.1 | GCA905372475_02150 | gene | open | 1391-2005 | lemA | ||
| 4320 | CAJPPP010000060.1 | GCA905372475_02151 | gene | open | 2076-2615 | |||
| 4321 | CAJPPP010000060.1 | GCA905372475_02152 | gene | open | 2654-3463 | |||
| 4322 | CAJPPP010000060.1 | GCA905372475_02153 | gene | open | 3803-4051 | |||
| 4323 | CAJPPP010000060.1 | GCA905372475_02154 | gene | open | 4059-5642 | |||
| 4324 | CAJPPP010000060.1 | GCA905372475_02155 | gene | open | 5642-6742 | |||
| 4325 | CAJPPP010000060.1 | GCA905372475_02156 | gene | open | 6742-7545 | |||
| 4326 | CAJPPP010000060.1 | GCA905372475_02157 | gene | open | 7542-9089 | |||
| 4327 | CAJPPP010000060.1 | GCA905372475_02158 | gene | open | 9100-11445 | |||
| 4328 | CAJPPP010000060.1 | GCA905372475_02159 | gene | open | 11442-12614 | |||
| 4329 | CAJPPP010000060.1 | GCA905372475_02160 | gene | open | 12668-13639 | mMP0363 | ||
| 4330 | CAJPPP010000060.1 | GCA905372475_02161 | gene | open | 13673-15472 | |||
| 4331 | CAJPPP010000061.1 | GCA905372475_02162 | CDS | open | 799-1437 | _na 212_aa | VOC family protein | |
| 4332 | CAJPPP010000061.1 | GCA905372475_02163 | CDS | open | 1490-2869 | _na 459_aa | radA | DNA repair protein RadA |
| 4333 | CAJPPP010000061.1 | GCA905372475_02164 | CDS | open | 3399-4460 | _na 353_aa | disA | DNA integrity scanning diadenylate cyclase DisA |
| 4334 | CAJPPP010000061.1 | GCA905372475_02165 | CDS | open | 4550-7042 | _na 830_aa | clpA | ATP-dependent Clp protease ATP-binding subunit |
| 4335 | CAJPPP010000061.1 | GCA905372475_02166 | CDS | open | 7744-8079 | _na 111_aa | Lsr2 family protein | |
| 4336 | CAJPPP010000061.1 | GCA905372475_02167 | CDS | open | 9142-9663 | _na 173_aa | hypothetical protein | |
| 4337 | CAJPPP010000061.1 | GCA905372475_02168 | CDS | open | 9957-10373 | _na 138_aa | DUF3180 domain-containing protein | |
| 4338 | CAJPPP010000061.1 | GCA905372475_02169 | CDS | open | 10451-11014 | _na 187_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 4339 | CAJPPP010000061.1 | GCA905372475_02170 | CDS | open | 10995-11363 | _na 122_aa | folB | dihydroneopterin aldolase |
| 4340 | CAJPPP010000061.1 | GCA905372475_02171 | CDS | open | 11441-12244 | _na 267_aa | folP | dihydropteroate synthase |
| 4341 | CAJPPP010000061.1 | GCA905372475_02172 | CDS | open | 12250-12816 | _na 188_aa | folE | GTP cyclohydrolase I FolE |
| 4342 | CAJPPP010000061.1 | GCA905372475_02173 | CDS | open | 12813-14822 | _na 669_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 4343 | CAJPPP010000061.1 | GCA905372475_02162 | gene | open | 799-1437 | |||
| 4344 | CAJPPP010000061.1 | GCA905372475_02163 | gene | open | 1490-2869 | radA | ||
| 4345 | CAJPPP010000061.1 | GCA905372475_02164 | gene | open | 3399-4460 | disA | ||
| 4346 | CAJPPP010000061.1 | GCA905372475_02165 | gene | open | 4550-7042 | clpA | ||
| 4347 | CAJPPP010000061.1 | GCA905372475_02166 | gene | open | 7744-8079 | |||
| 4348 | CAJPPP010000061.1 | GCA905372475_02167 | gene | open | 9142-9663 | |||
| 4349 | CAJPPP010000061.1 | GCA905372475_02168 | gene | open | 9957-10373 | |||
| 4350 | CAJPPP010000061.1 | GCA905372475_02169 | gene | open | 10451-11014 | folK | ||
| 4351 | CAJPPP010000061.1 | GCA905372475_02170 | gene | open | 10995-11363 | folB | ||
| 4352 | CAJPPP010000061.1 | GCA905372475_02171 | gene | open | 11441-12244 | folP | ||
| 4353 | CAJPPP010000061.1 | GCA905372475_02172 | gene | open | 12250-12816 | folE | ||
| 4354 | CAJPPP010000061.1 | GCA905372475_02173 | gene | open | 12813-14822 | ftsH | ||
| 4355 | CAJPPP010000062.1 | GCA905372475_02174 | CDS | open | 41-478 | _na 145_aa | hypothetical protein | |
| 4356 | CAJPPP010000062.1 | GCA905372475_02175 | CDS | open | 486-2576 | _na 696_aa | hypothetical protein | |
| 4357 | CAJPPP010000062.1 | GCA905372475_02176 | CDS | open | 2663-3052 | _na 129_aa | nuclear transport factor 2 family protein | |
| 4358 | CAJPPP010000062.1 | GCA905372475_02177 | CDS | open | 3229-4395 | _na 388_aa | hypothetical protein | |
| 4359 | CAJPPP010000062.1 | GCA905372475_02178 | CDS | open | 4937-5185 | _na 82_aa | antitoxin | |
| 4360 | CAJPPP010000062.1 | GCA905372475_02179 | CDS | open | 5185-5616 | _na 143_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 4361 | CAJPPP010000062.1 | GCA905372475_02180 | CDS | open | 5726-7006 | _na 426_aa | alpha/beta fold hydrolase | |
| 4362 | CAJPPP010000062.1 | GCA905372475_02181 | CDS | open | 7234-8421 | _na 395_aa | glycosyltransferase family protein | |
| 4363 | CAJPPP010000062.1 | GCA905372475_02182 | CDS | open | 8418-9617 | _na 399_aa | glycosyltransferase | |
| 4364 | CAJPPP010000062.1 | GCA905372475_02183 | CDS | open | 9617-10741 | _na 374_aa | glycosyltransferase family 4 protein | |
| 4365 | CAJPPP010000062.1 | GCA905372475_02184 | CDS | open | 10758-12608 | _na 616_aa | ABC transporter ATP-binding protein | |
| 4366 | CAJPPP010000062.1 | GCA905372475_02185 | CDS | open | 12605-13711 | _na 368_aa | phosphotransferase family protein | |
| 4367 | CAJPPP010000062.1 | GCA905372475_02186 | CDS | open | 13708-14724 | _na 338_aa | aminoglycoside phosphotransferase family protein | |
| 4368 | CAJPPP010000062.1 | GCA905372475_02174 | gene | open | 41-478 | |||
| 4369 | CAJPPP010000062.1 | GCA905372475_02175 | gene | open | 486-2576 | |||
| 4370 | CAJPPP010000062.1 | GCA905372475_02176 | gene | open | 2663-3052 | |||
| 4371 | CAJPPP010000062.1 | GCA905372475_02177 | gene | open | 3229-4395 | |||
| 4372 | CAJPPP010000062.1 | GCA905372475_02178 | gene | open | 4937-5185 | |||
| 4373 | CAJPPP010000062.1 | GCA905372475_02179 | gene | open | 5185-5616 | vapC | ||
| 4374 | CAJPPP010000062.1 | GCA905372475_02180 | gene | open | 5726-7006 | |||
| 4375 | CAJPPP010000062.1 | GCA905372475_02181 | gene | open | 7234-8421 | |||
| 4376 | CAJPPP010000062.1 | GCA905372475_02182 | gene | open | 8418-9617 | |||
| 4377 | CAJPPP010000062.1 | GCA905372475_02183 | gene | open | 9617-10741 | |||
| 4378 | CAJPPP010000062.1 | GCA905372475_02184 | gene | open | 10758-12608 | |||
| 4379 | CAJPPP010000062.1 | GCA905372475_02185 | gene | open | 12605-13711 | |||
| 4380 | CAJPPP010000062.1 | GCA905372475_02186 | gene | open | 13708-14724 | |||
| 4381 | CAJPPP010000063.1 | GCA905372475_02187 | CDS | open | 83-196 | _na 37_aa | hypothetical protein | |
| 4382 | CAJPPP010000063.1 | GCA905372475_02188 | CDS | open | 1107-2294 | _na 395_aa | ychF | redox-regulated ATPase YchF |
| 4383 | CAJPPP010000063.1 | GCA905372475_02189 | CDS | open | 2409-3680 | _na 423_aa | M18 family aminopeptidase | |
| 4384 | CAJPPP010000063.1 | GCA905372475_02190 | CDS | open | 3833-5020 | _na 395_aa | rmuC | DNA recombination protein RmuC |
| 4385 | CAJPPP010000063.1 | GCA905372475_02191 | CDS | open | 5259-6536 | _na 425_aa | ilvA | threonine ammonia-lyase IlvA |
| 4386 | CAJPPP010000063.1 | GCA905372475_02192 | CDS | open | 6619-6951 | _na 110_aa | hypothetical protein | |
| 4387 | CAJPPP010000063.1 | GCA905372475_02193 | CDS | open | 6862-9216 | _na 784_aa | S8 family peptidase | |
| 4388 | CAJPPP010000063.1 | GCA905372475_02194 | CDS | open | 9389-10357 | _na 322_aa | AAA family ATPase | |
| 4389 | CAJPPP010000063.1 | GCA905372475_02195 | CDS | open | 10511-11101 | _na 196_aa | hypothetical protein | |
| 4390 | CAJPPP010000063.1 | GCA905372475_02196 | CDS | open | 11455-12072 | _na 205_aa | hypothetical protein | |
| 4391 | CAJPPP010000063.1 | GCA905372475_02197 | CDS | open | 12242-13294 | _na 350_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 4392 | CAJPPP010000063.1 | GCA905372475_02198 | CDS | open | 13348-14079 | _na 243_aa | YwiC-like family protein | |
| 4393 | CAJPPP010000063.1 | GCA905372475_02199 | CDS | open | 14251-14628 | _na 125_aa | DUF1707 domain-containing protein | |
| 4394 | CAJPPP010000063.1 | GCA905372475_02187 | gene | open | 83-196 | |||
| 4395 | CAJPPP010000063.1 | GCA905372475_02188 | gene | open | 1107-2294 | ychF | ||
| 4396 | CAJPPP010000063.1 | GCA905372475_02189 | gene | open | 2409-3680 | |||
| 4397 | CAJPPP010000063.1 | GCA905372475_02190 | gene | open | 3833-5020 | rmuC | ||
| 4398 | CAJPPP010000063.1 | GCA905372475_02191 | gene | open | 5259-6536 | ilvA | ||
| 4399 | CAJPPP010000063.1 | GCA905372475_02192 | gene | open | 6619-6951 | |||
| 4400 | CAJPPP010000063.1 | GCA905372475_02193 | gene | open | 6862-9216 | |||
| 4401 | CAJPPP010000063.1 | GCA905372475_02194 | gene | open | 9389-10357 | |||
| 4402 | CAJPPP010000063.1 | GCA905372475_02195 | gene | open | 10511-11101 | |||
| 4403 | CAJPPP010000063.1 | GCA905372475_02196 | gene | open | 11455-12072 | |||
| 4404 | CAJPPP010000063.1 | GCA905372475_02197 | gene | open | 12242-13294 | |||
| 4405 | CAJPPP010000063.1 | GCA905372475_02198 | gene | open | 13348-14079 | |||
| 4406 | CAJPPP010000063.1 | GCA905372475_02199 | gene | open | 14251-14628 | |||
| 4407 | CAJPPP010000064.1 | GCA905372475_02200 | CDS | open | 140-382 | _na 80_aa | vapB | type II toxin-antitoxin system VapB family antitoxin |
| 4408 | CAJPPP010000064.1 | GCA905372475_02201 | CDS | open | 379-759 | _na 126_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 4409 | CAJPPP010000064.1 | GCA905372475_02202 | CDS | open | 856-1593 | _na 245_aa | sulfite exporter TauE/SafE family protein | |
| 4410 | CAJPPP010000064.1 | GCA905372475_02203 | CDS | open | 1635-2822 | _na 395_aa | mviM | 1%2C5-anhydro-D-fructose reductase |
| 4411 | CAJPPP010000064.1 | GCA905372475_02204 | CDS | open | 3024-3953 | _na 309_aa | Inosose dehydratase | |
| 4412 | CAJPPP010000064.1 | GCA905372475_02205 | CDS | open | 3962-4966 | _na 334_aa | Inositol 2-dehydrogenase | |
| 4413 | CAJPPP010000064.1 | GCA905372475_02206 | CDS | open | 4977-5846 | _na 289_aa | Sugar phosphate isomerase/epimerase | |
| 4414 | CAJPPP010000064.1 | GCA905372475_02207 | CDS | open | 6065-6523 | _na 152_aa | peptidoglycan-binding domain-containing protein | |
| 4415 | CAJPPP010000064.1 | GCA905372475_02208 | CDS | open | 6617-6706 | _na 29_aa | hypothetical protein | |
| 4416 | CAJPPP010000064.1 | GCA905372475_02209 | CDS | open | 6730-8334 | _na 534_aa | Na+/H+ antiporter | |
| 4417 | CAJPPP010000064.1 | GCA905372475_02210 | CDS | open | 8648-9658 | _na 336_aa | sugar ABC transporter substrate-binding protein | |
| 4418 | CAJPPP010000064.1 | GCA905372475_02211 | CDS | open | 9708-11231 | _na 507_aa | sugar ABC transporter ATP-binding protein | |
| 4419 | CAJPPP010000064.1 | GCA905372475_02212 | CDS | open | 11224-12204 | _na 326_aa | ABC transporter permease | |
| 4420 | CAJPPP010000064.1 | GCA905372475_02213 | CDS | open | 12310-13419 | _na 369_aa | alpha/beta hydrolase family protein | |
| 4421 | CAJPPP010000064.1 | GCA905372475_02214 | CDS | open | 13792-14550 | _na 252_aa | alpha/beta hydrolase-fold protein | |
| 4422 | CAJPPP010000064.1 | GCA905372475_02215 | CDS | open | 14605-14931 | _na 108_aa | hypothetical protein | |
| 4423 | CAJPPP010000064.1 | GCA905372475_02200 | gene | open | 140-382 | vapB | ||
| 4424 | CAJPPP010000064.1 | GCA905372475_02201 | gene | open | 379-759 | vapC | ||
| 4425 | CAJPPP010000064.1 | GCA905372475_02202 | gene | open | 856-1593 | |||
| 4426 | CAJPPP010000064.1 | GCA905372475_02203 | gene | open | 1635-2822 | mviM | ||
| 4427 | CAJPPP010000064.1 | GCA905372475_02204 | gene | open | 3024-3953 | |||
| 4428 | CAJPPP010000064.1 | GCA905372475_02205 | gene | open | 3962-4966 | |||
| 4429 | CAJPPP010000064.1 | GCA905372475_02206 | gene | open | 4977-5846 | |||
| 4430 | CAJPPP010000064.1 | GCA905372475_02207 | gene | open | 6065-6523 | |||
| 4431 | CAJPPP010000064.1 | GCA905372475_02208 | gene | open | 6617-6706 | |||
| 4432 | CAJPPP010000064.1 | GCA905372475_02209 | gene | open | 6730-8334 | |||
| 4433 | CAJPPP010000064.1 | GCA905372475_02210 | gene | open | 8648-9658 | |||
| 4434 | CAJPPP010000064.1 | GCA905372475_02211 | gene | open | 9708-11231 | |||
| 4435 | CAJPPP010000064.1 | GCA905372475_02212 | gene | open | 11224-12204 | |||
| 4436 | CAJPPP010000064.1 | GCA905372475_02213 | gene | open | 12310-13419 | |||
| 4437 | CAJPPP010000064.1 | GCA905372475_02214 | gene | open | 13792-14550 | |||
| 4438 | CAJPPP010000064.1 | GCA905372475_02215 | gene | open | 14605-14931 | |||
| 4439 | CAJPPP010000065.1 | GCA905372475_02216 | CDS | open | 108-530 | _na 140_aa | hypothetical protein | |
| 4440 | CAJPPP010000065.1 | GCA905372475_02217 | CDS | open | 586-3963 | _na 1125_aa | PPi-type phosphoenolpyruvate carboxykinase | |
| 4441 | CAJPPP010000065.1 | GCA905372475_02218 | CDS | open | 4143-5255 | _na 370_aa | dprA | DNA-processing protein DprA |
| 4442 | CAJPPP010000065.1 | GCA905372475_02219 | CDS | open | 5255-6790 | _na 511_aa | yifB | YifB family Mg chelatase-like AAA ATPase |
| 4443 | CAJPPP010000065.1 | GCA905372475_02220 | CDS | open | 6787-7161 | _na 124_aa | yraN | YraN family protein |
| 4444 | CAJPPP010000065.1 | GCA905372475_02221 | CDS | open | 7224-7535 | _na 103_aa | Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII | |
| 4445 | CAJPPP010000065.1 | GCA905372475_02222 | CDS | open | 7541-8155 | _na 204_aa | ribonuclease HII | |
| 4446 | CAJPPP010000065.1 | GCA905372475_02223 | CDS | open | 8149-8856 | _na 235_aa | lepB | signal peptidase I |
| 4447 | CAJPPP010000065.1 | GCA905372475_02224 | CDS | open | 9007-9357 | _na 116_aa | rplS | 50S ribosomal protein L19 |
| 4448 | CAJPPP010000065.1 | GCA905372475_02225 | CDS | open | 9685-10584 | _na 299_aa | serine protease | |
| 4449 | CAJPPP010000065.1 | GCA905372475_02226 | CDS | open | 10595-11008 | _na 137_aa | hypothetical protein | |
| 4450 | CAJPPP010000065.1 | GCA905372475_02227 | CDS | open | 11085-11834 | _na 249_aa | succinate dehydrogenase/fumarate reductase iron-sulfur subunit | |
| 4451 | CAJPPP010000065.1 | GCA905372475_02228 | CDS | open | 11831-13846 | _na 671_aa | sdhA | Fumarate reductase flavoprotein subunit |
| 4452 | CAJPPP010000065.1 | GCA905372475_02229 | CDS | open | 13843-14490 | _na 215_aa | succinate dehydrogenase cytochrome b subunit | |
| 4453 | CAJPPP010000065.1 | GCA905372475_02230 | CDS | open | 14688-15209 | _na 173_aa | trmD | tRNA (Guanosine(37)-N1)-methyltransferase TrmD |
| 4454 | CAJPPP010000065.1 | GCA905372475_02216 | gene | open | 108-530 | |||
| 4455 | CAJPPP010000065.1 | GCA905372475_02217 | gene | open | 586-3963 | |||
| 4456 | CAJPPP010000065.1 | GCA905372475_02218 | gene | open | 4143-5255 | dprA | ||
| 4457 | CAJPPP010000065.1 | GCA905372475_02219 | gene | open | 5255-6790 | yifB | ||
| 4458 | CAJPPP010000065.1 | GCA905372475_02220 | gene | open | 6787-7161 | yraN | ||
| 4459 | CAJPPP010000065.1 | GCA905372475_02221 | gene | open | 7224-7535 | |||
| 4460 | CAJPPP010000065.1 | GCA905372475_02222 | gene | open | 7541-8155 | |||
| 4461 | CAJPPP010000065.1 | GCA905372475_02223 | gene | open | 8149-8856 | lepB | ||
| 4462 | CAJPPP010000065.1 | GCA905372475_02224 | gene | open | 9007-9357 | rplS | ||
| 4463 | CAJPPP010000065.1 | GCA905372475_02225 | gene | open | 9685-10584 | |||
| 4464 | CAJPPP010000065.1 | GCA905372475_02226 | gene | open | 10595-11008 | |||
| 4465 | CAJPPP010000065.1 | GCA905372475_02227 | gene | open | 11085-11834 | |||
| 4466 | CAJPPP010000065.1 | GCA905372475_02228 | gene | open | 11831-13846 | sdhA | ||
| 4467 | CAJPPP010000065.1 | GCA905372475_02229 | gene | open | 13843-14490 | |||
| 4468 | CAJPPP010000065.1 | GCA905372475_02230 | gene | open | 14688-15209 | trmD | ||
| 4469 | CAJPPP010000066.1 | GCA905372475_02231 | CDS | open | 86-949 | _na 287_aa | peptidoglycan-binding protein | |
| 4470 | CAJPPP010000066.1 | GCA905372475_02232 | CDS | open | 1047-1985 | _na 312_aa | Multidrug DMT transporter permease | |
| 4471 | CAJPPP010000066.1 | GCA905372475_02233 | CDS | open | 1972-2583 | _na 203_aa | hypothetical protein | |
| 4472 | CAJPPP010000066.1 | GCA905372475_02234 | CDS | open | 2813-3787 | _na 324_aa | DUF4192 domain-containing protein | |
| 4473 | CAJPPP010000066.1 | GCA905372475_02235 | CDS | open | 3792-4721 | _na 309_aa | carbohydrate kinase | |
| 4474 | CAJPPP010000066.1 | GCA905372475_02236 | CDS | open | 4821-5417 | _na 198_aa | response regulator transcription factor | |
| 4475 | CAJPPP010000066.1 | GCA905372475_02237 | CDS | open | 5414-6586 | _na 390_aa | sensor histidine kinase | |
| 4476 | CAJPPP010000066.1 | GCA905372475_02238 | CDS | open | 6673-7836 | _na 387_aa | acyltransferase family protein | |
| 4477 | CAJPPP010000066.1 | GCA905372475_02239 | CDS | open | 7795-9840 | _na 681_aa | bifunctional UDP-sugar hydrolase/5'-nucleotidase | |
| 4478 | CAJPPP010000066.1 | GCA905372475_02240 | CDS | open | 10038-10841 | _na 267_aa | helix-hairpin-helix domain-containing protein | |
| 4479 | CAJPPP010000066.1 | GCA905372475_02241 | CDS | open | 10838-13150 | _na 770_aa | ComEC/Rec2 family competence protein | |
| 4480 | CAJPPP010000066.1 | GCA905372475_02242 | CDS | open | 13128-14132 | _na 334_aa | holA | DNA polymerase III subunit delta |
| 4481 | CAJPPP010000066.1 | GCA905372475_02243 | CDS | open | 14129-14287 | _na 52_aa | hypothetical protein | |
| 4482 | CAJPPP010000066.1 | GCA905372475_02244 | CDS | open | 14320-14967 | _na 215_aa | hypothetical protein | |
| 4483 | CAJPPP010000066.1 | GCA905372475_02231 | gene | open | 86-949 | |||
| 4484 | CAJPPP010000066.1 | GCA905372475_02232 | gene | open | 1047-1985 | |||
| 4485 | CAJPPP010000066.1 | GCA905372475_02233 | gene | open | 1972-2583 | |||
| 4486 | CAJPPP010000066.1 | GCA905372475_02234 | gene | open | 2813-3787 | |||
| 4487 | CAJPPP010000066.1 | GCA905372475_02235 | gene | open | 3792-4721 | |||
| 4488 | CAJPPP010000066.1 | GCA905372475_02236 | gene | open | 4821-5417 | |||
| 4489 | CAJPPP010000066.1 | GCA905372475_02237 | gene | open | 5414-6586 | |||
| 4490 | CAJPPP010000066.1 | GCA905372475_02238 | gene | open | 6673-7836 | |||
| 4491 | CAJPPP010000066.1 | GCA905372475_02239 | gene | open | 7795-9840 | |||
| 4492 | CAJPPP010000066.1 | GCA905372475_02240 | gene | open | 10038-10841 | |||
| 4493 | CAJPPP010000066.1 | GCA905372475_02241 | gene | open | 10838-13150 | |||
| 4494 | CAJPPP010000066.1 | GCA905372475_02242 | gene | open | 13128-14132 | holA | ||
| 4495 | CAJPPP010000066.1 | GCA905372475_02243 | gene | open | 14129-14287 | |||
| 4496 | CAJPPP010000066.1 | GCA905372475_02244 | gene | open | 14320-14967 | |||
| 4497 | CAJPPP010000067.1 | repeat_region | open | 13826-14829 | CRISPR array with 17 repeats of length 28%2C consensus sequence ATTTTCCCCGCGCGAGTGGGGATGAACC and spacer length 33 | |||
| 4498 | CAJPPP010000067.1 | GCA905372475_02245 | CDS | open | 883-1194 | _na 103_aa | hypothetical protein | |
| 4499 | CAJPPP010000067.1 | GCA905372475_02246 | CDS | open | 1649-3391 | _na 580_aa | ABC transporter ATP-binding protein | |
| 4500 | CAJPPP010000067.1 | GCA905372475_02247 | CDS | open | 3388-3975 | _na 195_aa | TetR/AcrR family transcriptional regulator |

