HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Granulicatella adiacens (GCA_905372625.1)

Select a Genome:
BAKTA Annotations for GCA_905372625.1
Genome Selected: Granulicatella adiacens
ContigsBases CDSrRNA tmRNAtRNA
60 1843481 1808 1 1 17
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3695 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3695 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAJPPH010000001.1 GCA905372625_00003 gene open 920-1012 tracrRNA
2 CAJPPH010000001.1 GCA905372625_00012 gene open 13279-13447 RefB11
3 CAJPPH010000001.1 GCA905372625_00003 ncRNA open 920-1012 Trans-activating crRNA
4 CAJPPH010000001.1 GCA905372625_00012 ncRNA open 13279-13447 Enterococcus sRNA B11
5 CAJPPH010000001.1 regulatory_region open 106296-106391 TPP riboswitch aptamer (THI element)
6 CAJPPH010000001.1 repeat_region open 7084-8647 CRISPR array with 24 repeats of length 36%2C consensus sequence GTTTTAGAGCTGTGTTGATTTGAATGGTTACAAAAC and spacer length 30
7 CAJPPH010000001.1 GCA905372625_00001 CDS open 320-604 _na     94_aa tryptophan synthase alpha chain
8 CAJPPH010000001.1 GCA905372625_00002 CDS open 546-842 _na     98_aa helix-turn-helix domain-containing protein
9 CAJPPH010000001.1 GCA905372625_00004 CDS open 1099-5151 _na     1350_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
10 CAJPPH010000001.1 GCA905372625_00005 CDS open 5154-6020 _na     288_aa cas1 type II CRISPR-associated endonuclease Cas1
11 CAJPPH010000001.1 GCA905372625_00006 CDS open 6017-6361 _na     114_aa cas2 CRISPR-associated endonuclease Cas2
12 CAJPPH010000001.1 GCA905372625_00007 CDS open 6345-7013 _na     222_aa csn2 type II-A CRISPR-associated protein Csn2
13 CAJPPH010000001.1 GCA905372625_00008 CDS open 8751-9305 _na     184_aa Transcriptional regulator
14 CAJPPH010000001.1 GCA905372625_00009 CDS open 9441-10445 _na     334_aa hypothetical protein
15 CAJPPH010000001.1 GCA905372625_00010 CDS open 10647-11726 _na     359_aa DUF4767 domain-containing protein
16 CAJPPH010000001.1 GCA905372625_00011 CDS open 11742-12917 _na     391_aa hypothetical protein
17 CAJPPH010000001.1 GCA905372625_00013 CDS open 13698-14462 _na     254_aa Sarcosine/dimethylglycine N-methyltransferase
18 CAJPPH010000001.1 GCA905372625_00014 CDS open 14870-16258 _na     462_aa norM MATE efflux family protein
19 CAJPPH010000001.1 GCA905372625_00015 CDS open 16503-17918 _na     471_aa dinP ImpB/MucB/SamB family protein
20 CAJPPH010000001.1 GCA905372625_00016 CDS open 18035-18292 _na     85_aa hypothetical protein
21 CAJPPH010000001.1 GCA905372625_00017 CDS open 18385-19833 _na     482_aa gatA amidase
22 CAJPPH010000001.1 GCA905372625_00018 CDS open 19845-20966 _na     373_aa dadA FAD dependent oxidoreductase
23 CAJPPH010000001.1 GCA905372625_00019 CDS open 21059-21442 _na     127_aa mscL large conductance mechanosensitive channel protein MscL
24 CAJPPH010000001.1 GCA905372625_00020 CDS open 22405-23199 _na     264_aa Nucleotidyltransferase
25 CAJPPH010000001.1 GCA905372625_00021 CDS open 23323-23736 _na     137_aa eamA EamA domain-containing protein
26 CAJPPH010000001.1 GCA905372625_00022 CDS open 23777-24121 _na     114_aa hypothetical protein
27 CAJPPH010000001.1 GCA905372625_00023 CDS open 24145-24483 _na     112_aa hypothetical protein
28 CAJPPH010000001.1 GCA905372625_00024 CDS open 24498-24836 _na     112_aa hypothetical protein
29 CAJPPH010000001.1 GCA905372625_00025 CDS open 24868-25200 _na     110_aa Glucuronide permease
30 CAJPPH010000001.1 GCA905372625_00026 CDS open 25216-25608 _na     130_aa hypothetical protein
31 CAJPPH010000001.1 GCA905372625_00027 CDS open 25719-26432 _na     237_aa yaaA UPF0246 protein HMPREF0444_1681
32 CAJPPH010000001.1 GCA905372625_00028 CDS open 26610-27479 _na     289_aa hypothetical protein
33 CAJPPH010000001.1 GCA905372625_00029 CDS open 27665-28102 _na     145_aa Antitoxin
34 CAJPPH010000001.1 GCA905372625_00030 CDS open 28068-29924 _na     618_aa EndoU domain-containing protein
35 CAJPPH010000001.1 GCA905372625_00031 CDS open 30105-30845 _na     246_aa soxR TipAS antibiotic-recognition domain protein
36 CAJPPH010000001.1 GCA905372625_00032 CDS open 31251-31664 _na     137_aa def peptide deformylase
37 CAJPPH010000001.1 GCA905372625_00033 CDS open 31677-32222 _na     181_aa acrR Transcriptional regulator%2C TetR family
38 CAJPPH010000001.1 GCA905372625_00034 CDS open 32359-33060 _na     233_aa lolD ABC transporter%2C ATP-binding protein
39 CAJPPH010000001.1 GCA905372625_00035 CDS open 33075-36530 _na     1151_aa lolE Efflux ABC transporter%2C permease protein
40 CAJPPH010000001.1 GCA905372625_00036 CDS open 36865-38181 _na     438_aa brnQ branched-chain amino acid transport system II carrier protein
41 CAJPPH010000001.1 GCA905372625_00037 CDS open 38350-39288 _na     312_aa uRH1 Inosine-uridine preferring nucleoside hydrolase
42 CAJPPH010000001.1 GCA905372625_00038 CDS open 39523-40890 _na     455_aa ampC Beta-lactamase
43 CAJPPH010000001.1 GCA905372625_00039 CDS open 40904-41266 _na     120_aa DUF2620 domain-containing protein
44 CAJPPH010000001.1 GCA905372625_00040 CDS open 41287-42591 _na     434_aa yhfT YhfT family protein
45 CAJPPH010000001.1 GCA905372625_00041 CDS open 42604-43491 _na     295_aa php Phosphotriesterase family protein
46 CAJPPH010000001.1 GCA905372625_00042 CDS open 43488-44585 _na     365_aa metC aminotransferase class V-fold PLP-dependent enzyme
47 CAJPPH010000001.1 GCA905372625_00043 CDS open 44600-45523 _na     307_aa yhfZ GntR family transcriptional regulator YhfZ
48 CAJPPH010000001.1 GCA905372625_00044 CDS open 45537-45905 _na     122_aa PRD domain-containing protein
49 CAJPPH010000001.1 GCA905372625_00045 CDS open 45895-47049 _na     384_aa yhfX Alanine racemase domain protein
50 CAJPPH010000001.1 GCA905372625_00046 CDS open 47054-48268 _na     404_aa deoB phosphopentomutase
51 CAJPPH010000001.1 GCA905372625_00047 CDS open 48278-49294 _na     338_aa amidase family protein
52 CAJPPH010000001.1 GCA905372625_00048 CDS open 49416-49877 _na     153_aa dps Ferritin-like protein
53 CAJPPH010000001.1 GCA905372625_00049 CDS open 50640-51698 _na     352_aa pfoR Phosphotransferase system EIIC domain-containing protein
54 CAJPPH010000001.1 GCA905372625_00050 CDS open 51717-52643 _na     308_aa panE 2-dehydropantoate 2-reductase
55 CAJPPH010000001.1 GCA905372625_00051 CDS open 52890-53582 _na     230_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
56 CAJPPH010000001.1 GCA905372625_00052 CDS open 53586-54464 _na     292_aa nlpA NLPA lipoprotein
57 CAJPPH010000001.1 GCA905372625_00053 CDS open 54516-54989 _na     157_aa luxS S-ribosylhomocysteine lyase
58 CAJPPH010000001.1 GCA905372625_00054 CDS open 55523-56290 _na     255_aa lolD Putative bacteriocin export ABC transporter%2C lactococcin 972 group
59 CAJPPH010000001.1 GCA905372625_00055 CDS open 56283-58253 _na     656_aa ABC3 transporter permease C-terminal domain-containing protein
60 CAJPPH010000001.1 GCA905372625_00056 CDS open 58344-59189 _na     281_aa lolD Putative bacteriocin export ABC transporter%2C lactococcin 972 group
61 CAJPPH010000001.1 GCA905372625_00057 CDS open 59182-61143 _na     653_aa ABC3 transporter permease C-terminal domain-containing protein
62 CAJPPH010000001.1 GCA905372625_00058 CDS open 61377-62453 _na     358_aa malK ABC transporter%2C ATP-binding protein
63 CAJPPH010000001.1 GCA905372625_00059 CDS open 62453-63328 _na     291_aa ugpA ABC transporter%2C permease protein
64 CAJPPH010000001.1 GCA905372625_00060 CDS open 63330-64148 _na     272_aa ugpE ABC transporter%2C permease protein
65 CAJPPH010000001.1 GCA905372625_00061 CDS open 64132-65424 _na     430_aa rnjA Metallo-beta-lactamase domain-containing protein
66 CAJPPH010000001.1 GCA905372625_00062 CDS open 65452-66747 _na     431_aa ugpB ABC transporter%2C solute-binding protein
67 CAJPPH010000001.1 GCA905372625_00063 CDS open 67535-68080 _na     181_aa Phosphopentomutase
68 CAJPPH010000001.1 GCA905372625_00064 CDS open 68257-69813 _na     518_aa ushA 2'%2C3'-cyclic-nucleotide 2'-phosphodiesterase
69 CAJPPH010000001.1 GCA905372625_00065 CDS open 70798-71442 _na     214_aa Lipoprotein
70 CAJPPH010000001.1 GCA905372625_00066 CDS open 71459-72709 _na     416_aa alpha/beta hydrolase
71 CAJPPH010000001.1 GCA905372625_00067 CDS open 72716-73120 _na     134_aa hypothetical protein
72 CAJPPH010000001.1 GCA905372625_00068 CDS open 73130-73450 _na     106_aa hypothetical protein
73 CAJPPH010000001.1 GCA905372625_00069 CDS open 73650-74294 _na     214_aa Lipoprotein
74 CAJPPH010000001.1 GCA905372625_00070 CDS open 74385-75092 _na     235_aa Lipoprotein
75 CAJPPH010000001.1 GCA905372625_00071 CDS open 75154-75837 _na     227_aa ompR Response regulator receiver domain protein
76 CAJPPH010000001.1 GCA905372625_00072 CDS open 75834-76832 _na     332_aa baeS histidine kinase
77 CAJPPH010000001.1 GCA905372625_00073 CDS open 76969-77859 _na     296_aa rapZ RNase adapter RapZ
78 CAJPPH010000001.1 GCA905372625_00074 CDS open 77856-78899 _na     347_aa cofD Putative gluconeogenesis factor
79 CAJPPH010000001.1 GCA905372625_00075 CDS open 78968-79915 _na     315_aa whiA DNA-binding protein WhiA
80 CAJPPH010000001.1 GCA905372625_00076 CDS open 79964-80341 _na     125_aa ssb Single-stranded DNA-binding protein
81 CAJPPH010000001.1 GCA905372625_00077 CDS open 80395-81084 _na     229_aa yqgA DUF554 domain-containing protein
82 CAJPPH010000001.1 GCA905372625_00078 CDS open 81128-82102 _na     324_aa mdh L-lactate dehydrogenase
83 CAJPPH010000001.1 GCA905372625_00079 CDS open 82303-82863 _na     186_aa pth aminoacyl-tRNA hydrolase
84 CAJPPH010000001.1 GCA905372625_00080 CDS open 82932-86471 _na     1179_aa mfd transcription-repair coupling factor
85 CAJPPH010000001.1 GCA905372625_00081 CDS open 86455-88074 _na     539_aa spoVB Polysaccharide biosynthesis protein
86 CAJPPH010000001.1 GCA905372625_00082 CDS open 88061-88336 _na     91_aa hslR RNA-binding S4 domain-containing protein
87 CAJPPH010000001.1 GCA905372625_00083 CDS open 88476-89183 _na     235_aa sapB Mg2+ transporter-C family protein
88 CAJPPH010000001.1 GCA905372625_00084 CDS open 89382-89825 _na     147_aa ftsL Putative cell division protein FtsL
89 CAJPPH010000001.1 GCA905372625_00085 CDS open 89894-90388 _na     164_aa yabR S1 domain-containing RNA-binding protein
90 CAJPPH010000001.1 GCA905372625_00086 CDS open 90452-91825 _na     457_aa ttcA tRNA(Ile)-lysidine synthase
91 CAJPPH010000001.1 GCA905372625_00087 CDS open 91812-92354 _na     180_aa hpt hypoxanthine phosphoribosyltransferase
92 CAJPPH010000001.1 GCA905372625_00088 CDS open 92456-94561 _na     701_aa ftsH ATP-dependent zinc metalloprotease FtsH
93 CAJPPH010000001.1 GCA905372625_00089 CDS open 94625-95527 _na     300_aa hslO Hsp33 family molecular chaperone HslO
94 CAJPPH010000001.1 GCA905372625_00090 CDS open 95660-96253 _na     197_aa amaP Alkaline shock response membrane anchor protein AmaP
95 CAJPPH010000001.1 GCA905372625_00091 CDS open 96262-97233 _na     323_aa Sensor histidine kinase
96 CAJPPH010000001.1 GCA905372625_00092 CDS open 97457-98254 _na     265_aa DUF5305 domain-containing protein
97 CAJPPH010000001.1 GCA905372625_00093 CDS open 98282-99247 _na     321_aa DUF2207 domain-containing protein
98 CAJPPH010000001.1 GCA905372625_00094 CDS open 99469-100218 _na     249_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
99 CAJPPH010000001.1 GCA905372625_00095 CDS open 100265-101203 _na     312_aa 2-keto-3-deoxygluconate permease
100 CAJPPH010000001.1 GCA905372625_00096 CDS open 101612-102538 _na     308_aa cysK cysteine synthase A
101 CAJPPH010000001.1 GCA905372625_00097 CDS open 102811-104106 _na     431_aa uraA Putative permease
102 CAJPPH010000001.1 GCA905372625_00098 CDS open 104434-105192 _na     252_aa glpR Transcriptional regulator%2C DeoR family
103 CAJPPH010000001.1 GCA905372625_00099 CDS open 105208-106125 _na     305_aa pfkB 1-phosphofructokinase
104 CAJPPH010000001.1 GCA905372625_00100 CDS open 106445-106996 _na     183_aa thiT energy-coupled thiamine transporter ThiT
105 CAJPPH010000001.1 GCA905372625_00101 CDS open 107472-107912 _na     146_aa marR HTH marR-type domain-containing protein
106 CAJPPH010000001.1 GCA905372625_00102 CDS open 107958-108641 _na     227_aa ompR Response regulator receiver domain protein
107 CAJPPH010000001.1 GCA905372625_00103 CDS open 108681-109919 _na     412_aa baeS histidine kinase
108 CAJPPH010000001.1 GCA905372625_00104 CDS open 109912-110217 _na     101_aa atl1 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein
109 CAJPPH010000001.1 GCA905372625_00105 CDS open 110470-111831 _na     453_aa Lipoprotein
110 CAJPPH010000001.1 GCA905372625_00106 CDS open 112045-112953 _na     302_aa ABC transporter permease
111 CAJPPH010000001.1 GCA905372625_00107 CDS open 113196-115094 _na     632_aa spoVK ATPase%2C AAA family
112 CAJPPH010000001.1 GCA905372625_00108 CDS open 115120-115605 _na     161_aa hypothetical protein
113 CAJPPH010000001.1 GCA905372625_00109 CDS open 115706-117259 _na     517_aa Carbohydrate-binding domain-containing protein
114 CAJPPH010000001.1 GCA905372625_00110 CDS open 117660-118025 _na     121_aa soxR Transcriptional regulator%2C MerR family
115 CAJPPH010000001.1 GCA905372625_00111 CDS open 118036-119367 _na     443_aa glnA type I glutamate--ammonia ligase
116 CAJPPH010000001.1 GCA905372625_00112 CDS open 119598-120902 _na     434_aa fmhB FemAB family protein
117 CAJPPH010000001.1 GCA905372625_00113 CDS open 120960-121487 _na     175_aa Heptaprenyl diphosphate synthase component I
118 CAJPPH010000001.1 GCA905372625_00114 CDS open 121582-123510 _na     642_aa ndh NADH:ubiquinone reductase (non-electrogenic)
119 CAJPPH010000001.1 GCA905372625_00115 CDS open 123582-124559 _na     325_aa ispA Polyprenyl synthetase
120 CAJPPH010000001.1 GCA905372625_00116 CDS open 124729-125265 _na     178_aa tpp15 FMN-binding domain protein
121 CAJPPH010000001.1 GCA905372625_00117 CDS open 125418-126521 _na     367_aa apbE FAD:protein FMN transferase
122 CAJPPH010000001.1 GCA905372625_00118 CDS open 126518-127468 _na     316_aa menA 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
123 CAJPPH010000001.1 GCA905372625_00119 CDS open 127540-127692 _na     50_aa rpmG 50S ribosomal protein L33
124 CAJPPH010000001.1 GCA905372625_00120 CDS open 127713-127883 _na     56_aa secE preprotein translocase subunit SecE
125 CAJPPH010000001.1 GCA905372625_00121 CDS open 127992-128537 _na     181_aa nusG transcription termination/antitermination protein NusG
126 CAJPPH010000001.1 GCA905372625_00122 CDS open 128524-129783 _na     419_aa pepT peptidase T
127 CAJPPH010000001.1 GCA905372625_00123 CDS open 129957-130838 _na     293_aa lCB5 Lipid kinase%2C YegS/Rv2252/BmrU family
128 CAJPPH010000001.1 GCA905372625_00001 gene open 320-604
129 CAJPPH010000001.1 GCA905372625_00002 gene open 546-842
130 CAJPPH010000001.1 GCA905372625_00004 gene open 1099-5151 cas9
131 CAJPPH010000001.1 GCA905372625_00005 gene open 5154-6020 cas1
132 CAJPPH010000001.1 GCA905372625_00006 gene open 6017-6361 cas2
133 CAJPPH010000001.1 GCA905372625_00007 gene open 6345-7013 csn2
134 CAJPPH010000001.1 GCA905372625_00008 gene open 8751-9305
135 CAJPPH010000001.1 GCA905372625_00009 gene open 9441-10445
136 CAJPPH010000001.1 GCA905372625_00010 gene open 10647-11726
137 CAJPPH010000001.1 GCA905372625_00011 gene open 11742-12917
138 CAJPPH010000001.1 GCA905372625_00013 gene open 13698-14462
139 CAJPPH010000001.1 GCA905372625_00014 gene open 14870-16258 norM
140 CAJPPH010000001.1 GCA905372625_00015 gene open 16503-17918 dinP
141 CAJPPH010000001.1 GCA905372625_00016 gene open 18035-18292
142 CAJPPH010000001.1 GCA905372625_00017 gene open 18385-19833 gatA
143 CAJPPH010000001.1 GCA905372625_00018 gene open 19845-20966 dadA
144 CAJPPH010000001.1 GCA905372625_00019 gene open 21059-21442 mscL
145 CAJPPH010000001.1 GCA905372625_00020 gene open 22405-23199
146 CAJPPH010000001.1 GCA905372625_00021 gene open 23323-23736 eamA
147 CAJPPH010000001.1 GCA905372625_00022 gene open 23777-24121
148 CAJPPH010000001.1 GCA905372625_00023 gene open 24145-24483
149 CAJPPH010000001.1 GCA905372625_00024 gene open 24498-24836
150 CAJPPH010000001.1 GCA905372625_00025 gene open 24868-25200
151 CAJPPH010000001.1 GCA905372625_00026 gene open 25216-25608
152 CAJPPH010000001.1 GCA905372625_00027 gene open 25719-26432 yaaA
153 CAJPPH010000001.1 GCA905372625_00028 gene open 26610-27479
154 CAJPPH010000001.1 GCA905372625_00029 gene open 27665-28102
155 CAJPPH010000001.1 GCA905372625_00030 gene open 28068-29924
156 CAJPPH010000001.1 GCA905372625_00031 gene open 30105-30845 soxR
157 CAJPPH010000001.1 GCA905372625_00032 gene open 31251-31664 def
158 CAJPPH010000001.1 GCA905372625_00033 gene open 31677-32222 acrR
159 CAJPPH010000001.1 GCA905372625_00034 gene open 32359-33060 lolD
160 CAJPPH010000001.1 GCA905372625_00035 gene open 33075-36530 lolE
161 CAJPPH010000001.1 GCA905372625_00036 gene open 36865-38181 brnQ
162 CAJPPH010000001.1 GCA905372625_00037 gene open 38350-39288 uRH1
163 CAJPPH010000001.1 GCA905372625_00038 gene open 39523-40890 ampC
164 CAJPPH010000001.1 GCA905372625_00039 gene open 40904-41266
165 CAJPPH010000001.1 GCA905372625_00040 gene open 41287-42591 yhfT
166 CAJPPH010000001.1 GCA905372625_00041 gene open 42604-43491 php
167 CAJPPH010000001.1 GCA905372625_00042 gene open 43488-44585 metC
168 CAJPPH010000001.1 GCA905372625_00043 gene open 44600-45523 yhfZ
169 CAJPPH010000001.1 GCA905372625_00044 gene open 45537-45905
170 CAJPPH010000001.1 GCA905372625_00045 gene open 45895-47049 yhfX
171 CAJPPH010000001.1 GCA905372625_00046 gene open 47054-48268 deoB
172 CAJPPH010000001.1 GCA905372625_00047 gene open 48278-49294
173 CAJPPH010000001.1 GCA905372625_00048 gene open 49416-49877 dps
174 CAJPPH010000001.1 GCA905372625_00049 gene open 50640-51698 pfoR
175 CAJPPH010000001.1 GCA905372625_00050 gene open 51717-52643 panE
176 CAJPPH010000001.1 GCA905372625_00051 gene open 52890-53582 mtnN
177 CAJPPH010000001.1 GCA905372625_00052 gene open 53586-54464 nlpA
178 CAJPPH010000001.1 GCA905372625_00053 gene open 54516-54989 luxS
179 CAJPPH010000001.1 GCA905372625_00054 gene open 55523-56290 lolD
180 CAJPPH010000001.1 GCA905372625_00055 gene open 56283-58253
181 CAJPPH010000001.1 GCA905372625_00056 gene open 58344-59189 lolD
182 CAJPPH010000001.1 GCA905372625_00057 gene open 59182-61143
183 CAJPPH010000001.1 GCA905372625_00058 gene open 61377-62453 malK
184 CAJPPH010000001.1 GCA905372625_00059 gene open 62453-63328 ugpA
185 CAJPPH010000001.1 GCA905372625_00060 gene open 63330-64148 ugpE
186 CAJPPH010000001.1 GCA905372625_00061 gene open 64132-65424 rnjA
187 CAJPPH010000001.1 GCA905372625_00062 gene open 65452-66747 ugpB
188 CAJPPH010000001.1 GCA905372625_00063 gene open 67535-68080
189 CAJPPH010000001.1 GCA905372625_00064 gene open 68257-69813 ushA
190 CAJPPH010000001.1 GCA905372625_00065 gene open 70798-71442
191 CAJPPH010000001.1 GCA905372625_00066 gene open 71459-72709
192 CAJPPH010000001.1 GCA905372625_00067 gene open 72716-73120
193 CAJPPH010000001.1 GCA905372625_00068 gene open 73130-73450
194 CAJPPH010000001.1 GCA905372625_00069 gene open 73650-74294
195 CAJPPH010000001.1 GCA905372625_00070 gene open 74385-75092
196 CAJPPH010000001.1 GCA905372625_00071 gene open 75154-75837 ompR
197 CAJPPH010000001.1 GCA905372625_00072 gene open 75834-76832 baeS
198 CAJPPH010000001.1 GCA905372625_00073 gene open 76969-77859 rapZ
199 CAJPPH010000001.1 GCA905372625_00074 gene open 77856-78899 cofD
200 CAJPPH010000001.1 GCA905372625_00075 gene open 78968-79915 whiA
201 CAJPPH010000001.1 GCA905372625_00076 gene open 79964-80341 ssb
202 CAJPPH010000001.1 GCA905372625_00077 gene open 80395-81084 yqgA
203 CAJPPH010000001.1 GCA905372625_00078 gene open 81128-82102 mdh
204 CAJPPH010000001.1 GCA905372625_00079 gene open 82303-82863 pth
205 CAJPPH010000001.1 GCA905372625_00080 gene open 82932-86471 mfd
206 CAJPPH010000001.1 GCA905372625_00081 gene open 86455-88074 spoVB
207 CAJPPH010000001.1 GCA905372625_00082 gene open 88061-88336 hslR
208 CAJPPH010000001.1 GCA905372625_00083 gene open 88476-89183 sapB
209 CAJPPH010000001.1 GCA905372625_00084 gene open 89382-89825 ftsL
210 CAJPPH010000001.1 GCA905372625_00085 gene open 89894-90388 yabR
211 CAJPPH010000001.1 GCA905372625_00086 gene open 90452-91825 ttcA
212 CAJPPH010000001.1 GCA905372625_00087 gene open 91812-92354 hpt
213 CAJPPH010000001.1 GCA905372625_00088 gene open 92456-94561 ftsH
214 CAJPPH010000001.1 GCA905372625_00089 gene open 94625-95527 hslO
215 CAJPPH010000001.1 GCA905372625_00090 gene open 95660-96253 amaP
216 CAJPPH010000001.1 GCA905372625_00091 gene open 96262-97233
217 CAJPPH010000001.1 GCA905372625_00092 gene open 97457-98254
218 CAJPPH010000001.1 GCA905372625_00093 gene open 98282-99247
219 CAJPPH010000001.1 GCA905372625_00094 gene open 99469-100218 fabG
220 CAJPPH010000001.1 GCA905372625_00095 gene open 100265-101203
221 CAJPPH010000001.1 GCA905372625_00096 gene open 101612-102538 cysK
222 CAJPPH010000001.1 GCA905372625_00097 gene open 102811-104106 uraA
223 CAJPPH010000001.1 GCA905372625_00098 gene open 104434-105192 glpR
224 CAJPPH010000001.1 GCA905372625_00099 gene open 105208-106125 pfkB
225 CAJPPH010000001.1 GCA905372625_00100 gene open 106445-106996 thiT
226 CAJPPH010000001.1 GCA905372625_00101 gene open 107472-107912 marR
227 CAJPPH010000001.1 GCA905372625_00102 gene open 107958-108641 ompR
228 CAJPPH010000001.1 GCA905372625_00103 gene open 108681-109919 baeS
229 CAJPPH010000001.1 GCA905372625_00104 gene open 109912-110217 atl1
230 CAJPPH010000001.1 GCA905372625_00105 gene open 110470-111831
231 CAJPPH010000001.1 GCA905372625_00106 gene open 112045-112953
232 CAJPPH010000001.1 GCA905372625_00107 gene open 113196-115094 spoVK
233 CAJPPH010000001.1 GCA905372625_00108 gene open 115120-115605
234 CAJPPH010000001.1 GCA905372625_00109 gene open 115706-117259
235 CAJPPH010000001.1 GCA905372625_00110 gene open 117660-118025 soxR
236 CAJPPH010000001.1 GCA905372625_00111 gene open 118036-119367 glnA
237 CAJPPH010000001.1 GCA905372625_00112 gene open 119598-120902 fmhB
238 CAJPPH010000001.1 GCA905372625_00113 gene open 120960-121487
239 CAJPPH010000001.1 GCA905372625_00114 gene open 121582-123510 ndh
240 CAJPPH010000001.1 GCA905372625_00115 gene open 123582-124559 ispA
241 CAJPPH010000001.1 GCA905372625_00116 gene open 124729-125265 tpp15
242 CAJPPH010000001.1 GCA905372625_00117 gene open 125418-126521 apbE
243 CAJPPH010000001.1 GCA905372625_00118 gene open 126518-127468 menA
244 CAJPPH010000001.1 GCA905372625_00119 gene open 127540-127692 rpmG
245 CAJPPH010000001.1 GCA905372625_00120 gene open 127713-127883 secE
246 CAJPPH010000001.1 GCA905372625_00121 gene open 127992-128537 nusG
247 CAJPPH010000001.1 GCA905372625_00122 gene open 128524-129783 pepT
248 CAJPPH010000001.1 GCA905372625_00123 gene open 129957-130838 lCB5
249 CAJPPH010000001.1 GCA905372625_00124 gene open 130920-130992 trnT
250 CAJPPH010000001.1 GCA905372625_00124 tRNA open 130920-130992 trnT tRNA-Thr(cgt)
251 CAJPPH010000002.1 GCA905372625_00214 gene open 79779-79865 Bacteria_small_SRP
252 CAJPPH010000002.1 GCA905372625_00239 gene open 100669-100766 rli23
253 CAJPPH010000002.1 GCA905372625_00214 ncRNA open 79779-79865 Bacterial small signal recognition particle RNA
254 CAJPPH010000002.1 GCA905372625_00239 ncRNA open 100669-100766 Listeria snRNA rli23
255 CAJPPH010000002.1 regulatory_region open 29294-29338 PreQ1 (pre queuosine) riboswitch aptamer
256 CAJPPH010000002.1 regulatory_region open 48371-48583 T-box leader
257 CAJPPH010000002.1 regulatory_region open 70010-70159 glmS glucosamine-6-phosphate activated ribozyme aptamer
258 CAJPPH010000002.1 regulatory_region open 85552-85683 azaaromatic riboswitch aptamer (yjdF RNA)
259 CAJPPH010000002.1 GCA905372625_00125 CDS open 210-542 _na     110_aa Immunity protein 63 domain-containing protein
260 CAJPPH010000002.1 GCA905372625_00126 CDS open 595-933 _na     112_aa Imm59 family immunity protein
261 CAJPPH010000002.1 GCA905372625_00127 CDS open 937-1584 _na     215_aa Imm59 family immunity protein
262 CAJPPH010000002.1 GCA905372625_00128 CDS open 1608-1985 _na     125_aa Lipoprotein
263 CAJPPH010000002.1 GCA905372625_00129 CDS open 2041-2412 _na     123_aa DUF1433 domain-containing protein
264 CAJPPH010000002.1 GCA905372625_00130 CDS open 2436-2813 _na     125_aa Lipoprotein
265 CAJPPH010000002.1 GCA905372625_00131 CDS open 2900-3232 _na     110_aa hypothetical protein
266 CAJPPH010000002.1 GCA905372625_00132 CDS open 3245-3658 _na     137_aa DUF1433 domain-containing protein
267 CAJPPH010000002.1 GCA905372625_00133 CDS open 3774-4187 _na     137_aa DUF1433 domain-containing protein
268 CAJPPH010000002.1 GCA905372625_00134 CDS open 4224-4655 _na     143_aa KTSC domain-containing protein
269 CAJPPH010000002.1 GCA905372625_00135 CDS open 4854-7097 _na     747_aa zntA P-type Cu(+) transporter
270 CAJPPH010000002.1 GCA905372625_00136 CDS open 7115-7315 _na     66_aa copZ Heavy metal-associated domain protein
271 CAJPPH010000002.1 GCA905372625_00137 CDS open 7372-8205 _na     277_aa IS3 family transposase
272 CAJPPH010000002.1 GCA905372625_00138 CDS open 8205-8720 _na     171_aa Transposase
273 CAJPPH010000002.1 GCA905372625_00139 CDS open 9068-10072 _na     334_aa lacD tagatose-bisphosphate aldolase
274 CAJPPH010000002.1 GCA905372625_00140 CDS open 10135-11292 _na     385_aa nagA N-acetylglucosamine-6-phosphate deacetylase
275 CAJPPH010000002.1 GCA905372625_00141 CDS open 11320-12486 _na     388_aa agaS Sugar isomerase%2C AgaS family
276 CAJPPH010000002.1 GCA905372625_00142 CDS open 12506-13234 _na     242_aa mngR UbiC transcription regulator-associated domain protein
277 CAJPPH010000002.1 GCA905372625_00143 CDS open 13259-13423 _na     54_aa hypothetical protein
278 CAJPPH010000002.1 GCA905372625_00144 CDS open 13451-13900 _na     149_aa ptsN Phosphoenolpyruvate-dependent sugar phosphotransferase system%2C EIIA 2
279 CAJPPH010000002.1 GCA905372625_00145 CDS open 13936-15339 _na     467_aa frwB Phosphotransferase system%2C EIIC
280 CAJPPH010000002.1 GCA905372625_00146 CDS open 15360-16277 _na     305_aa pfkB 1-phosphofructokinase
281 CAJPPH010000002.1 GCA905372625_00147 CDS open 16393-17163 _na     256_aa rpiR SIS domain protein
282 CAJPPH010000002.1 GCA905372625_00148 CDS open 17219-17896 _na     225_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
283 CAJPPH010000002.1 GCA905372625_00149 CDS open 17923-18825 _na     300_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
284 CAJPPH010000002.1 GCA905372625_00150 CDS open 18837-19358 _na     173_aa msrA Peptide methionine sulfoxide reductase MsrA
285 CAJPPH010000002.1 GCA905372625_00151 CDS open 19614-20780 _na     388_aa aspB Aminotransferase
286 CAJPPH010000002.1 GCA905372625_00152 CDS open 21039-22427 _na     462_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
287 CAJPPH010000002.1 GCA905372625_00153 CDS open 22732-23208 _na     158_aa yjhB Mutator MutT protein
288 CAJPPH010000002.1 GCA905372625_00154 CDS open 23219-25117 _na     632_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
289 CAJPPH010000002.1 GCA905372625_00155 CDS open 25128-25841 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
290 CAJPPH010000002.1 GCA905372625_00156 CDS open 25902-26903 _na     333_aa Nucleoid-associated protein
291 CAJPPH010000002.1 GCA905372625_00157 CDS open 26990-27520 _na     176_aa adaB 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein
292 CAJPPH010000002.1 GCA905372625_00158 CDS open 27510-28505 _na     331_aa ygaE Putative aromatic acid exporter C-terminal domain-containing protein
293 CAJPPH010000002.1 GCA905372625_00159 CDS open 28669-29229 _na     186_aa rpoE RNA polymerase sigma factor SigS
294 CAJPPH010000002.1 GCA905372625_00160 CDS open 29344-29853 _na     169_aa queT QueT transporter
295 CAJPPH010000002.1 GCA905372625_00161 CDS open 29950-30588 _na     212_aa gloB Metallo-beta-lactamase domain protein
296 CAJPPH010000002.1 GCA905372625_00162 CDS open 30600-31382 _na     260_aa tatD Hydrolase%2C TatD family
297 CAJPPH010000002.1 GCA905372625_00163 CDS open 31379-31945 _na     188_aa rnmV ribonuclease M5
298 CAJPPH010000002.1 GCA905372625_00164 CDS open 31938-32807 _na     289_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
299 CAJPPH010000002.1 GCA905372625_00165 CDS open 33035-33301 _na     88_aa arsR Transcriptional regulator%2C ArsR family
300 CAJPPH010000002.1 GCA905372625_00166 CDS open 33303-33962 _na     219_aa DUF1648 domain-containing protein
301 CAJPPH010000002.1 GCA905372625_00167 CDS open 34135-34980 _na     281_aa cdaA diadenylate cyclase CdaA
302 CAJPPH010000002.1 GCA905372625_00168 CDS open 34973-36004 _na     343_aa ybbR YbbR-like protein
303 CAJPPH010000002.1 GCA905372625_00169 CDS open 36022-37374 _na     450_aa glmM phosphoglucosamine mutase
304 CAJPPH010000002.1 GCA905372625_00170 CDS open 37512-37781 _na     89_aa rpsN 30S ribosomal protein S14
305 CAJPPH010000002.1 GCA905372625_00171 CDS open 37799-37909 _na     36_aa Metal homeostasis protein
306 CAJPPH010000002.1 GCA905372625_00172 CDS open 38088-38621 _na     177_aa yciA Thioesterase family protein
307 CAJPPH010000002.1 GCA905372625_00173 CDS open 38701-39309 _na     202_aa tVP38 TVP38/TMEM64 family membrane protein
308 CAJPPH010000002.1 GCA905372625_00174 CDS open 39325-39609 _na     94_aa yidD membrane protein insertion efficiency factor YidD
309 CAJPPH010000002.1 GCA905372625_00175 CDS open 39723-40247 _na     174_aa Lipoprotein
310 CAJPPH010000002.1 GCA905372625_00176 CDS open 40323-41051 _na     242_aa larD D/L-lactic acid transporter LarD
311 CAJPPH010000002.1 GCA905372625_00177 CDS open 41065-42456 _na     463_aa larC nickel pincer cofactor biosynthesis protein LarC
312 CAJPPH010000002.1 GCA905372625_00178 CDS open 42453-43196 _na     247_aa larB nickel pincer cofactor biosynthesis protein LarB
313 CAJPPH010000002.1 GCA905372625_00179 CDS open 43198-44559 _na     453_aa larA nickel-dependent lactate racemase
314 CAJPPH010000002.1 GCA905372625_00180 CDS open 44586-45299 _na     237_aa crp Transcriptional regulator%2C Crp/Fnr family
315 CAJPPH010000002.1 GCA905372625_00181 CDS open 45321-46145 _na     274_aa larE ATP-dependent sacrificial sulfur transferase LarE
316 CAJPPH010000002.1 GCA905372625_00182 CDS open 46145-46681 _na     178_aa DUF924 domain-containing protein
317 CAJPPH010000002.1 GCA905372625_00183 CDS open 46920-48317 _na     465_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
318 CAJPPH010000002.1 GCA905372625_00184 CDS open 48640-49917 _na     425_aa serS serine--tRNA ligase
319 CAJPPH010000002.1 GCA905372625_00185 CDS open 49983-51773 _na     596_aa ugpQ1 Glycerophosphodiester phosphodiesterase family protein
320 CAJPPH010000002.1 GCA905372625_00186 CDS open 51926-52933 _na     335_aa DUF1307 domain-containing protein
321 CAJPPH010000002.1 GCA905372625_00187 CDS open 53110-54267 _na     385_aa livK Receptor family ligand-binding protein
322 CAJPPH010000002.1 GCA905372625_00188 CDS open 54362-55243 _na     293_aa livH Branched-chain amino acid ABC transporter%2C permease protein
323 CAJPPH010000002.1 GCA905372625_00189 CDS open 55253-56215 _na     320_aa livM Branched-chain amino acid ABC transporter%2C permease protein
324 CAJPPH010000002.1 GCA905372625_00190 CDS open 56215-56985 _na     256_aa livG ABC transporter%2C ATP-binding protein
325 CAJPPH010000002.1 GCA905372625_00191 CDS open 56986-57690 _na     234_aa livF ABC transporter%2C ATP-binding protein
326 CAJPPH010000002.1 GCA905372625_00192 CDS open 57693-58334 _na     213_aa CBS domain protein
327 CAJPPH010000002.1 GCA905372625_00193 CDS open 58668-59897 _na     409_aa malY cysteine-S-conjugate beta-lyase
328 CAJPPH010000002.1 GCA905372625_00194 CDS open 59908-60294 _na     128_aa ridA Putative endoribonuclease L-PSP
329 CAJPPH010000002.1 GCA905372625_00195 CDS open 60327-60761 _na     144_aa eamA EamA domain-containing protein
330 CAJPPH010000002.1 GCA905372625_00196 CDS open 60846-62099 _na     417_aa yhiN BaiN-like insert domain-containing protein
331 CAJPPH010000002.1 GCA905372625_00197 CDS open 62355-63065 _na     236_aa hypothetical protein
332 CAJPPH010000002.1 GCA905372625_00198 CDS open 63086-63835 _na     249_aa DUF4336 domain-containing protein
333 CAJPPH010000002.1 GCA905372625_00199 CDS open 63988-64266 _na     92_aa DUF1490 domain-containing protein
334 CAJPPH010000002.1 GCA905372625_00200 CDS open 64266-66320 _na     684_aa zntA Cd(2+)-exporting ATPase
335 CAJPPH010000002.1 GCA905372625_00201 CDS open 66662-67441 _na     259_aa ldcB Peptidase M15B domain-containing protein
336 CAJPPH010000002.1 GCA905372625_00202 CDS open 67640-69118 _na     492_aa guaB IMP dehydrogenase
337 CAJPPH010000002.1 GCA905372625_00203 CDS open 70223-72031 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
338 CAJPPH010000002.1 GCA905372625_00204 CDS open 72490-73002 _na     170_aa Thiol-disulfide isomerase
339 CAJPPH010000002.1 GCA905372625_00205 CDS open 73527-73979 _na     150_aa wzb protein-tyrosine-phosphatase
340 CAJPPH010000002.1 GCA905372625_00206 CDS open 73981-75102 _na     373_aa Putative membrane protein
341 CAJPPH010000002.1 GCA905372625_00207 CDS open 75089-76384 _na     431_aa DUF308 domain-containing protein
342 CAJPPH010000002.1 GCA905372625_00208 CDS open 76389-76895 _na     168_aa tadA tRNA adenosine(34) deaminase TadA
343 CAJPPH010000002.1 GCA905372625_00209 CDS open 77011-77277 _na     88_aa MtN3/saliva family protein
344 CAJPPH010000002.1 GCA905372625_00210 CDS open 77329-78024 _na     231_aa Phosphomethylpyrimidine kinase
345 CAJPPH010000002.1 GCA905372625_00211 CDS open 78120-78665 _na     181_aa DUF6609 domain-containing protein
346 CAJPPH010000002.1 GCA905372625_00212 CDS open 78847-79068 _na     73_aa hypothetical protein
347 CAJPPH010000002.1 GCA905372625_00213 CDS open 79333-79836 _na     167_aa hypothetical protein
348 CAJPPH010000002.1 GCA905372625_00215 CDS open 79944-82088 _na     714_aa helD UvrD-like helicase ATP-binding domain-containing protein
349 CAJPPH010000002.1 GCA905372625_00216 CDS open 82150-83868 _na     572_aa dnaX DNA polymerase III subunit gamma/tau
350 CAJPPH010000002.1 GCA905372625_00217 CDS open 83898-84215 _na     105_aa ybaB YbaB/EbfC family nucleoid-associated protein
351 CAJPPH010000002.1 GCA905372625_00218 CDS open 84233-84829 _na     198_aa recR recombination mediator RecR
352 CAJPPH010000002.1 GCA905372625_00219 CDS open 85698-86114 _na     138_aa yjdF YjdF family protein
353 CAJPPH010000002.1 GCA905372625_00220 CDS open 86308-86760 _na     150_aa hypothetical protein
354 CAJPPH010000002.1 GCA905372625_00221 CDS open 86772-87143 _na     123_aa Pyrimidine dimer DNA glycosylase
355 CAJPPH010000002.1 GCA905372625_00222 CDS open 87145-87612 _na     155_aa hypothetical protein
356 CAJPPH010000002.1 GCA905372625_00223 CDS open 87625-88086 _na     153_aa hypothetical protein
357 CAJPPH010000002.1 GCA905372625_00224 CDS open 88512-89720 _na     402_aa dAP2 Xaa-Pro dipeptidyl-peptidase-like domain-containing protein
358 CAJPPH010000002.1 GCA905372625_00225 CDS open 90134-91075 _na     313_aa hypothetical protein
359 CAJPPH010000002.1 GCA905372625_00226 CDS open 91088-91579 _na     163_aa hypothetical protein
360 CAJPPH010000002.1 GCA905372625_00227 CDS open 91576-92607 _na     343_aa DUF4231 domain-containing protein
361 CAJPPH010000002.1 GCA905372625_00228 CDS open 92604-93089 _na     161_aa hypothetical protein
362 CAJPPH010000002.1 GCA905372625_00229 CDS open 93109-93588 _na     159_aa hypothetical protein
363 CAJPPH010000002.1 GCA905372625_00230 CDS open 93648-94571 _na     307_aa DUF4231 domain-containing protein
364 CAJPPH010000002.1 GCA905372625_00231 CDS open 94652-95683 _na     343_aa DUF4231 domain-containing protein
365 CAJPPH010000002.1 GCA905372625_00232 CDS open 95662-96600 _na     312_aa DUF2207 domain-containing protein
366 CAJPPH010000002.1 GCA905372625_00233 CDS open 96839-97324 _na     161_aa hypothetical protein
367 CAJPPH010000002.1 GCA905372625_00234 CDS open 97346-98032 _na     228_aa yigB YjjG family noncanonical pyrimidine nucleotidase
368 CAJPPH010000002.1 GCA905372625_00235 CDS open 98160-99065 _na     301_aa dAP2 AB hydrolase-1 domain-containing protein
369 CAJPPH010000002.1 GCA905372625_00236 CDS open 99176-99784 _na     202_aa ORFB%2C transposon ISSsa2
370 CAJPPH010000002.1 GCA905372625_00237 CDS open 100009-100524 _na     171_aa Transposase
371 CAJPPH010000002.1 GCA905372625_00238 CDS open 100576-101412 _na     278_aa IS3 family transposase
372 CAJPPH010000002.1 GCA905372625_00240 CDS open 102277-102645 _na     122_aa arsR Cadmium efflux system accessory protein
373 CAJPPH010000002.1 GCA905372625_00241 CDS open 102638-104767 _na     709_aa zntA Cd(2+)-exporting ATPase
374 CAJPPH010000002.1 GCA905372625_00242 CDS open 105042-105875 _na     277_aa Integrase catalytic domain-containing protein
375 CAJPPH010000002.1 GCA905372625_00243 CDS open 105875-106387 _na     170_aa Transposase
376 CAJPPH010000002.1 GCA905372625_00244 CDS open 106684-106875 _na     63_aa toxin-antitoxin system protein
377 CAJPPH010000002.1 GCA905372625_00245 CDS open 106872-107150 _na     92_aa yafQ type II toxin-antitoxin system YafQ family toxin
378 CAJPPH010000002.1 GCA905372625_00125 gene open 210-542
379 CAJPPH010000002.1 GCA905372625_00126 gene open 595-933
380 CAJPPH010000002.1 GCA905372625_00127 gene open 937-1584
381 CAJPPH010000002.1 GCA905372625_00128 gene open 1608-1985
382 CAJPPH010000002.1 GCA905372625_00129 gene open 2041-2412
383 CAJPPH010000002.1 GCA905372625_00130 gene open 2436-2813
384 CAJPPH010000002.1 GCA905372625_00131 gene open 2900-3232
385 CAJPPH010000002.1 GCA905372625_00132 gene open 3245-3658
386 CAJPPH010000002.1 GCA905372625_00133 gene open 3774-4187
387 CAJPPH010000002.1 GCA905372625_00134 gene open 4224-4655
388 CAJPPH010000002.1 GCA905372625_00135 gene open 4854-7097 zntA
389 CAJPPH010000002.1 GCA905372625_00136 gene open 7115-7315 copZ
390 CAJPPH010000002.1 GCA905372625_00137 gene open 7372-8205
391 CAJPPH010000002.1 GCA905372625_00138 gene open 8205-8720
392 CAJPPH010000002.1 GCA905372625_00139 gene open 9068-10072 lacD
393 CAJPPH010000002.1 GCA905372625_00140 gene open 10135-11292 nagA
394 CAJPPH010000002.1 GCA905372625_00141 gene open 11320-12486 agaS
395 CAJPPH010000002.1 GCA905372625_00142 gene open 12506-13234 mngR
396 CAJPPH010000002.1 GCA905372625_00143 gene open 13259-13423
397 CAJPPH010000002.1 GCA905372625_00144 gene open 13451-13900 ptsN
398 CAJPPH010000002.1 GCA905372625_00145 gene open 13936-15339 frwB
399 CAJPPH010000002.1 GCA905372625_00146 gene open 15360-16277 pfkB
400 CAJPPH010000002.1 GCA905372625_00147 gene open 16393-17163 rpiR
401 CAJPPH010000002.1 GCA905372625_00148 gene open 17219-17896 sdaAB
402 CAJPPH010000002.1 GCA905372625_00149 gene open 17923-18825 sdaAA
403 CAJPPH010000002.1 GCA905372625_00150 gene open 18837-19358 msrA
404 CAJPPH010000002.1 GCA905372625_00151 gene open 19614-20780 aspB
405 CAJPPH010000002.1 GCA905372625_00152 gene open 21039-22427 mnmE
406 CAJPPH010000002.1 GCA905372625_00153 gene open 22732-23208 yjhB
407 CAJPPH010000002.1 GCA905372625_00154 gene open 23219-25117 mnmG
408 CAJPPH010000002.1 GCA905372625_00155 gene open 25128-25841 rsmG
409 CAJPPH010000002.1 GCA905372625_00156 gene open 25902-26903
410 CAJPPH010000002.1 GCA905372625_00157 gene open 26990-27520 adaB
411 CAJPPH010000002.1 GCA905372625_00158 gene open 27510-28505 ygaE
412 CAJPPH010000002.1 GCA905372625_00159 gene open 28669-29229 rpoE
413 CAJPPH010000002.1 GCA905372625_00160 gene open 29344-29853 queT
414 CAJPPH010000002.1 GCA905372625_00161 gene open 29950-30588 gloB
415 CAJPPH010000002.1 GCA905372625_00162 gene open 30600-31382 tatD
416 CAJPPH010000002.1 GCA905372625_00163 gene open 31379-31945 rnmV
417 CAJPPH010000002.1 GCA905372625_00164 gene open 31938-32807 rsmA
418 CAJPPH010000002.1 GCA905372625_00165 gene open 33035-33301 arsR
419 CAJPPH010000002.1 GCA905372625_00166 gene open 33303-33962
420 CAJPPH010000002.1 GCA905372625_00167 gene open 34135-34980 cdaA
421 CAJPPH010000002.1 GCA905372625_00168 gene open 34973-36004 ybbR
422 CAJPPH010000002.1 GCA905372625_00169 gene open 36022-37374 glmM
423 CAJPPH010000002.1 GCA905372625_00170 gene open 37512-37781 rpsN
424 CAJPPH010000002.1 GCA905372625_00171 gene open 37799-37909
425 CAJPPH010000002.1 GCA905372625_00172 gene open 38088-38621 yciA
426 CAJPPH010000002.1 GCA905372625_00173 gene open 38701-39309 tVP38
427 CAJPPH010000002.1 GCA905372625_00174 gene open 39325-39609 yidD
428 CAJPPH010000002.1 GCA905372625_00175 gene open 39723-40247
429 CAJPPH010000002.1 GCA905372625_00176 gene open 40323-41051 larD
430 CAJPPH010000002.1 GCA905372625_00177 gene open 41065-42456 larC
431 CAJPPH010000002.1 GCA905372625_00178 gene open 42453-43196 larB
432 CAJPPH010000002.1 GCA905372625_00179 gene open 43198-44559 larA
433 CAJPPH010000002.1 GCA905372625_00180 gene open 44586-45299 crp
434 CAJPPH010000002.1 GCA905372625_00181 gene open 45321-46145 larE
435 CAJPPH010000002.1 GCA905372625_00182 gene open 46145-46681
436 CAJPPH010000002.1 GCA905372625_00183 gene open 46920-48317 dacC
437 CAJPPH010000002.1 GCA905372625_00184 gene open 48640-49917 serS
438 CAJPPH010000002.1 GCA905372625_00185 gene open 49983-51773 ugpQ1
439 CAJPPH010000002.1 GCA905372625_00186 gene open 51926-52933
440 CAJPPH010000002.1 GCA905372625_00187 gene open 53110-54267 livK
441 CAJPPH010000002.1 GCA905372625_00188 gene open 54362-55243 livH
442 CAJPPH010000002.1 GCA905372625_00189 gene open 55253-56215 livM
443 CAJPPH010000002.1 GCA905372625_00190 gene open 56215-56985 livG
444 CAJPPH010000002.1 GCA905372625_00191 gene open 56986-57690 livF
445 CAJPPH010000002.1 GCA905372625_00192 gene open 57693-58334
446 CAJPPH010000002.1 GCA905372625_00193 gene open 58668-59897 malY
447 CAJPPH010000002.1 GCA905372625_00194 gene open 59908-60294 ridA
448 CAJPPH010000002.1 GCA905372625_00195 gene open 60327-60761 eamA
449 CAJPPH010000002.1 GCA905372625_00196 gene open 60846-62099 yhiN
450 CAJPPH010000002.1 GCA905372625_00197 gene open 62355-63065
451 CAJPPH010000002.1 GCA905372625_00198 gene open 63086-63835
452 CAJPPH010000002.1 GCA905372625_00199 gene open 63988-64266
453 CAJPPH010000002.1 GCA905372625_00200 gene open 64266-66320 zntA
454 CAJPPH010000002.1 GCA905372625_00201 gene open 66662-67441 ldcB
455 CAJPPH010000002.1 GCA905372625_00202 gene open 67640-69118 guaB
456 CAJPPH010000002.1 GCA905372625_00203 gene open 70223-72031 glmS
457 CAJPPH010000002.1 GCA905372625_00204 gene open 72490-73002
458 CAJPPH010000002.1 GCA905372625_00205 gene open 73527-73979 wzb
459 CAJPPH010000002.1 GCA905372625_00206 gene open 73981-75102
460 CAJPPH010000002.1 GCA905372625_00207 gene open 75089-76384
461 CAJPPH010000002.1 GCA905372625_00208 gene open 76389-76895 tadA
462 CAJPPH010000002.1 GCA905372625_00209 gene open 77011-77277
463 CAJPPH010000002.1 GCA905372625_00210 gene open 77329-78024
464 CAJPPH010000002.1 GCA905372625_00211 gene open 78120-78665
465 CAJPPH010000002.1 GCA905372625_00212 gene open 78847-79068
466 CAJPPH010000002.1 GCA905372625_00213 gene open 79333-79836
467 CAJPPH010000002.1 GCA905372625_00215 gene open 79944-82088 helD
468 CAJPPH010000002.1 GCA905372625_00216 gene open 82150-83868 dnaX
469 CAJPPH010000002.1 GCA905372625_00217 gene open 83898-84215 ybaB
470 CAJPPH010000002.1 GCA905372625_00218 gene open 84233-84829 recR
471 CAJPPH010000002.1 GCA905372625_00219 gene open 85698-86114 yjdF
472 CAJPPH010000002.1 GCA905372625_00220 gene open 86308-86760
473 CAJPPH010000002.1 GCA905372625_00221 gene open 86772-87143
474 CAJPPH010000002.1 GCA905372625_00222 gene open 87145-87612
475 CAJPPH010000002.1 GCA905372625_00223 gene open 87625-88086
476 CAJPPH010000002.1 GCA905372625_00224 gene open 88512-89720 dAP2
477 CAJPPH010000002.1 GCA905372625_00225 gene open 90134-91075
478 CAJPPH010000002.1 GCA905372625_00226 gene open 91088-91579
479 CAJPPH010000002.1 GCA905372625_00227 gene open 91576-92607
480 CAJPPH010000002.1 GCA905372625_00228 gene open 92604-93089
481 CAJPPH010000002.1 GCA905372625_00229 gene open 93109-93588
482 CAJPPH010000002.1 GCA905372625_00230 gene open 93648-94571
483 CAJPPH010000002.1 GCA905372625_00231 gene open 94652-95683
484 CAJPPH010000002.1 GCA905372625_00232 gene open 95662-96600
485 CAJPPH010000002.1 GCA905372625_00233 gene open 96839-97324
486 CAJPPH010000002.1 GCA905372625_00234 gene open 97346-98032 yigB
487 CAJPPH010000002.1 GCA905372625_00235 gene open 98160-99065 dAP2
488 CAJPPH010000002.1 GCA905372625_00236 gene open 99176-99784
489 CAJPPH010000002.1 GCA905372625_00237 gene open 100009-100524
490 CAJPPH010000002.1 GCA905372625_00238 gene open 100576-101412
491 CAJPPH010000002.1 GCA905372625_00240 gene open 102277-102645 arsR
492 CAJPPH010000002.1 GCA905372625_00241 gene open 102638-104767 zntA
493 CAJPPH010000002.1 GCA905372625_00242 gene open 105042-105875
494 CAJPPH010000002.1 GCA905372625_00243 gene open 105875-106387
495 CAJPPH010000002.1 GCA905372625_00244 gene open 106684-106875
496 CAJPPH010000002.1 GCA905372625_00245 gene open 106872-107150 yafQ
497 CAJPPH010000003.1 regulatory_region open 16497-16712 T-box leader
498 CAJPPH010000003.1 regulatory_region open 69101-69344 T-box leader
499 CAJPPH010000003.1 GCA905372625_00246 CDS open 122-1282 _na     386_aa pksG hydroxymethylglutaryl-CoA synthase
500 CAJPPH010000003.1 GCA905372625_00247 CDS open 1512-2702 _na     396_aa paaJ acetyl-CoA C-acetyltransferase