BAKTAGenome Explorer: Prevotella denticola (GCA_905373395.1)
Select a Genome:
|
BAKTA Annotations for GCA_905373395.1
|
Search & Sort all 4554 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | CAJPSO010000002.1 | GCA905373395_00273 | CDS | open | 55478-57466 | _na 662_aa | lmbE | Glucosamine-6-phosphate deaminase 1 |
| 502 | CAJPSO010000002.1 | GCA905373395_00274 | CDS | open | 57490-58836 | _na 448_aa | exo-alpha-sialidase | |
| 503 | CAJPSO010000002.1 | GCA905373395_00275 | CDS | open | 59332-60912 | _na 526_aa | Lysosomal dipeptide transporter MFSD1 | |
| 504 | CAJPSO010000002.1 | GCA905373395_00276 | CDS | open | 61114-63270 | _na 718_aa | Prolyl tripeptidyl peptidase | |
| 505 | CAJPSO010000002.1 | GCA905373395_00277 | CDS | open | 63273-65201 | _na 642_aa | yidC | membrane protein insertase YidC |
| 506 | CAJPSO010000002.1 | GCA905373395_00278 | CDS | open | 65202-66812 | _na 536_aa | pyrG | CTP synthase |
| 507 | CAJPSO010000002.1 | GCA905373395_00279 | CDS | open | 67260-68798 | _na 512_aa | AAA-ATPase-like domain-containing protein | |
| 508 | CAJPSO010000002.1 | GCA905373395_00280 | CDS | open | 69118-70653 | _na 511_aa | Alpha-L-fucosidase 1 family protein | |
| 509 | CAJPSO010000002.1 | GCA905373395_00281 | CDS | open | 71055-73220 | _na 721_aa | Neopullulanase | |
| 510 | CAJPSO010000002.1 | GCA905373395_00282 | CDS | open | 73380-74267 | _na 295_aa | fabD | ACP S-malonyltransferase |
| 511 | CAJPSO010000002.1 | GCA905373395_00283 | CDS | open | 74379-76103 | _na 574_aa | DUF4153 domain-containing protein | |
| 512 | CAJPSO010000002.1 | GCA905373395_00284 | CDS | open | 76750-78297 | _na 515_aa | Glycosyl hydrolase family 109 protein 1 | |
| 513 | CAJPSO010000002.1 | GCA905373395_00285 | CDS | open | 78414-79541 | _na 375_aa | NadR/Ttd14 AAA domain-containing protein | |
| 514 | CAJPSO010000002.1 | GCA905373395_00286 | CDS | open | 79576-80124 | _na 182_aa | rplI | 50S ribosomal protein L9 |
| 515 | CAJPSO010000002.1 | GCA905373395_00287 | CDS | open | 80140-80409 | _na 89_aa | rpsR | 30S ribosomal protein S18 |
| 516 | CAJPSO010000002.1 | GCA905373395_00288 | CDS | open | 80413-80757 | _na 114_aa | rpsF | 30S ribosomal protein S6 |
| 517 | CAJPSO010000002.1 | GCA905373395_00289 | CDS | open | 80808-81065 | _na 85_aa | hypothetical protein | |
| 518 | CAJPSO010000002.1 | GCA905373395_00290 | CDS | open | 82079-83434 | _na 451_aa | Bacteroidetes-Associated Carbohydrate-binding Often N-terminal | |
| 519 | CAJPSO010000002.1 | GCA905373395_00291 | CDS | open | 83442-85187 | _na 581_aa | DUF4302 domain-containing protein | |
| 520 | CAJPSO010000002.1 | GCA905373395_00292 | CDS | open | 85205-86128 | _na 307_aa | Lipoprotein | |
| 521 | CAJPSO010000002.1 | GCA905373395_00293 | CDS | open | 86327-88012 | _na 561_aa | SusD-like N-terminal domain-containing protein | |
| 522 | CAJPSO010000002.1 | GCA905373395_00294 | CDS | open | 88034-91342 | _na 1102_aa | btuB | TonB-dependent receptor plug domain-containing protein |
| 523 | CAJPSO010000002.1 | GCA905373395_00295 | CDS | open | 91859-95569 | _na 1236_aa | Internalin-J | |
| 524 | CAJPSO010000002.1 | GCA905373395_00296 | CDS | open | 95881-98256 | _na 791_aa | aprX | Serine protease AprX |
| 525 | CAJPSO010000002.1 | GCA905373395_00297 | CDS | open | 98253-99851 | _na 532_aa | Bacterial repeat domain-containing protein | |
| 526 | CAJPSO010000002.1 | GCA905373395_00298 | CDS | open | 100815-101261 | _na 148_aa | rpiB | ribose 5-phosphate isomerase B |
| 527 | CAJPSO010000002.1 | GCA905373395_00299 | CDS | open | 101326-103341 | _na 671_aa | Transketolase-like pyrimidine-binding domain-containing protein | |
| 528 | CAJPSO010000002.1 | GCA905373395_00300 | CDS | open | 103890-104567 | _na 225_aa | Hydrolase%2C NUDIX family | |
| 529 | CAJPSO010000002.1 | GCA905373395_00301 | CDS | open | 104747-105907 | _na 386_aa | galK | galactokinase |
| 530 | CAJPSO010000002.1 | GCA905373395_00302 | CDS | open | 105955-107205 | _na 416_aa | fucP | Transporter%2C major facilitator family protein |
| 531 | CAJPSO010000002.1 | GCA905373395_00303 | CDS | open | 107247-108365 | _na 372_aa | Aldose 1-epimerase | |
| 532 | CAJPSO010000002.1 | GCA905373395_00304 | CDS | open | 109744-110949 | _na 401_aa | ribA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 533 | CAJPSO010000002.1 | GCA905373395_00305 | CDS | open | 110964-112850 | _na 628_aa | Permease%2C YjgP/YjgQ family | |
| 534 | CAJPSO010000002.1 | GCA905373395_00306 | CDS | open | 113358-113750 | _na 130_aa | START-like domain-containing protein | |
| 535 | CAJPSO010000002.1 | GCA905373395_00308 | CDS | open | 115234-116148 | _na 304_aa | DUF2971 domain-containing protein | |
| 536 | CAJPSO010000002.1 | GCA905373395_00309 | CDS | open | 116436-116888 | _na 150_aa | ADP-ribosylglycohydrolase family protein | |
| 537 | CAJPSO010000002.1 | GCA905373395_00310 | CDS | open | 116932-117630 | _na 232_aa | hypothetical protein | |
| 538 | CAJPSO010000002.1 | GCA905373395_00311 | CDS | open | 117677-118171 | _na 164_aa | hypothetical protein | |
| 539 | CAJPSO010000002.1 | GCA905373395_00312 | CDS | open | 118220-118768 | _na 182_aa | ADP-ribosylglycohydrolase family protein | |
| 540 | CAJPSO010000002.1 | GCA905373395_00313 | CDS | open | 118936-119175 | _na 79_aa | hypothetical protein | |
| 541 | CAJPSO010000002.1 | GCA905373395_00314 | CDS | open | 119811-122780 | _na 989_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 542 | CAJPSO010000002.1 | GCA905373395_00315 | CDS | open | 122794-124368 | _na 524_aa | susD | SusD family protein |
| 543 | CAJPSO010000002.1 | GCA905373395_00316 | CDS | open | 124382-126070 | _na 562_aa | DUF5114 domain-containing protein | |
| 544 | CAJPSO010000002.1 | GCA905373395_00317 | CDS | open | 126095-127144 | _na 349_aa | Arabinogalactan endo-beta-1%2C4-galactanase | |
| 545 | CAJPSO010000002.1 | GCA905373395_00318 | CDS | open | 127442-131284 | _na 1280_aa | histidine kinase | |
| 546 | CAJPSO010000002.1 | GCA905373395_00319 | CDS | open | 131515-132801 | _na 428_aa | tetrahydrofolate synthase | |
| 547 | CAJPSO010000002.1 | GCA905373395_00320 | CDS | open | 132892-134034 | _na 380_aa | dnaJ | molecular chaperone DnaJ |
| 548 | CAJPSO010000002.1 | GCA905373395_00321 | CDS | open | 134183-134773 | _na 196_aa | grpE | Protein GrpE |
| 549 | CAJPSO010000002.1 | GCA905373395_00322 | CDS | open | 134825-136447 | _na 540_aa | uup | ABC transporter domain-containing protein |
| 550 | CAJPSO010000002.1 | GCA905373395_00323 | CDS | open | 136649-137371 | _na 240_aa | pflA | pyruvate formate-lyase-activating protein |
| 551 | CAJPSO010000002.1 | GCA905373395_00324 | CDS | open | 137421-139667 | _na 748_aa | pflB | formate C-acetyltransferase |
| 552 | CAJPSO010000002.1 | GCA905373395_00325 | CDS | open | 140078-140803 | _na 241_aa | RDD family | |
| 553 | CAJPSO010000002.1 | GCA905373395_00326 | CDS | open | 140905-141885 | _na 326_aa | Integral membrane protein DUF95 | |
| 554 | CAJPSO010000002.1 | GCA905373395_00327 | CDS | open | 141860-142852 | _na 330_aa | Transmembrane protein | |
| 555 | CAJPSO010000002.1 | GCA905373395_00328 | CDS | open | 142865-143476 | _na 203_aa | Protein-glutamine gamma-glutamyltransferase-like C-terminal domain-containing protein | |
| 556 | CAJPSO010000002.1 | GCA905373395_00329 | CDS | open | 143473-144726 | _na 417_aa | DUF4350 domain-containing protein | |
| 557 | CAJPSO010000002.1 | GCA905373395_00330 | CDS | open | 144780-145754 | _na 324_aa | ATPase%2C AAA family | |
| 558 | CAJPSO010000002.1 | GCA905373395_00331 | CDS | open | 145894-147207 | _na 437_aa | DUF58 domain-containing protein | |
| 559 | CAJPSO010000002.1 | GCA905373395_00332 | CDS | open | 147688-149493 | _na 601_aa | mutS | DNA mismatch repair protein mutS |
| 560 | CAJPSO010000002.1 | GCA905373395_00333 | CDS | open | 149524-150846 | _na 440_aa | Thioredoxin domain-containing protein | |
| 561 | CAJPSO010000002.1 | GCA905373395_00334 | CDS | open | 150877-151551 | _na 224_aa | T9SS C-terminal target domain-containing protein | |
| 562 | CAJPSO010000002.1 | GCA905373395_00335 | CDS | open | 151596-152384 | _na 262_aa | Outer membrane lipoprotein Omp28 family protein | |
| 563 | CAJPSO010000002.1 | GCA905373395_00336 | CDS | open | 152390-154021 | _na 543_aa | Outer membrane insertion signal domain protein | |
| 564 | CAJPSO010000002.1 | GCA905373395_00337 | CDS | open | 154026-154484 | _na 152_aa | Stage IV sporulation protein H | |
| 565 | CAJPSO010000002.1 | GCA905373395_00338 | CDS | open | 155404-156276 | _na 290_aa | Transporter | |
| 566 | CAJPSO010000002.1 | GCA905373395_00339 | CDS | open | 156294-158273 | _na 659_aa | TonB-dependent receptor | |
| 567 | CAJPSO010000002.1 | GCA905373395_00340 | CDS | open | 158347-159138 | _na 263_aa | hmuY | HmuY family protein |
| 568 | CAJPSO010000002.1 | GCA905373395_00341 | CDS | open | 159157-159750 | _na 197_aa | Lipocalin-like domain-containing protein | |
| 569 | CAJPSO010000002.1 | GCA905373395_00342 | CDS | open | 159747-160229 | _na 160_aa | Secretion system C-terminal sorting domain-containing protein | |
| 570 | CAJPSO010000002.1 | GCA905373395_00343 | CDS | open | 161204-162556 | _na 450_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 571 | CAJPSO010000002.1 | GCA905373395_00344 | CDS | open | 162553-163593 | _na 346_aa | dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase | |
| 572 | CAJPSO010000002.1 | GCA905373395_00345 | CDS | open | 163702-164514 | _na 270_aa | gldB | Gliding motility-associated lipoprotein GldB |
| 573 | CAJPSO010000002.1 | GCA905373395_00346 | CDS | open | 164602-165525 | _na 307_aa | Nuclease | |
| 574 | CAJPSO010000002.1 | GCA905373395_00347 | CDS | open | 165649-165900 | _na 83_aa | type B 50S ribosomal protein L31 | |
| 575 | CAJPSO010000002.1 | GCA905373395_00348 | CDS | open | 166034-167377 | _na 447_aa | Nucleic acid-binding domain protein | |
| 576 | CAJPSO010000002.1 | GCA905373395_00349 | CDS | open | 167402-168637 | _na 411_aa | DUF5689 domain-containing protein | |
| 577 | CAJPSO010000002.1 | GCA905373395_00350 | CDS | open | 168659-171232 | _na 857_aa | TonB-dependent receptor | |
| 578 | CAJPSO010000002.1 | GCA905373395_00351 | CDS | open | 171521-172564 | _na 347_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 579 | CAJPSO010000002.1 | GCA905373395_00352 | CDS | open | 172741-173325 | _na 194_aa | Uracil-DNA glycosylase family protein | |
| 580 | CAJPSO010000002.1 | GCA905373395_00353 | CDS | open | 173364-173993 | _na 209_aa | udk | uridine kinase |
| 581 | CAJPSO010000002.1 | GCA905373395_00354 | CDS | open | 174757-176856 | _na 699_aa | dsbD | Thiol:disulfide interchange protein DsbD |
| 582 | CAJPSO010000002.1 | GCA905373395_00355 | CDS | open | 177113-177823 | _na 236_aa | pyrH | UMP kinase |
| 583 | CAJPSO010000002.1 | GCA905373395_00356 | CDS | open | 177922-178713 | _na 263_aa | Biotin--[acetyl-CoA-carboxylase] ligase | |
| 584 | CAJPSO010000002.1 | GCA905373395_00357 | CDS | open | 178729-179094 | _na 121_aa | UPF0102 protein HMPREF9303_1851 | |
| 585 | CAJPSO010000002.1 | GCA905373395_00358 | CDS | open | 179294-179746 | _na 150_aa | tRNA-specific adenosine deaminase | |
| 586 | CAJPSO010000002.1 | GCA905373395_00359 | CDS | open | 179893-180360 | _na 155_aa | tadA | Guanine deaminase |
| 587 | CAJPSO010000002.1 | GCA905373395_00360 | CDS | open | 180381-181019 | _na 212_aa | putative HD superfamily hydrolase | |
| 588 | CAJPSO010000002.1 | GCA905373395_00361 | CDS | open | 181079-182020 | _na 313_aa | menA | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase |
| 589 | CAJPSO010000002.1 | GCA905373395_00362 | CDS | open | 182081-184474 | _na 797_aa | Porin | |
| 590 | CAJPSO010000002.1 | GCA905373395_00363 | CDS | open | 184475-184705 | _na 76_aa | Lipoprotein | |
| 591 | CAJPSO010000002.1 | GCA905373395_00364 | CDS | open | 184916-185854 | _na 312_aa | DUF4468 domain-containing protein | |
| 592 | CAJPSO010000002.1 | GCA905373395_00365 | CDS | open | 186190-186849 | _na 219_aa | Conserved domain protein | |
| 593 | CAJPSO010000002.1 | GCA905373395_00366 | CDS | open | 187185-188036 | _na 283_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 594 | CAJPSO010000002.1 | GCA905373395_00367 | CDS | open | 188435-190051 | _na 538_aa | beta-N-acetylhexosaminidase | |
| 595 | CAJPSO010000002.1 | GCA905373395_00368 | CDS | open | 190058-190177 | _na 39_aa | hypothetical protein | |
| 596 | CAJPSO010000002.1 | GCA905373395_00369 | CDS | open | 190207-191073 | _na 288_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 597 | CAJPSO010000002.1 | GCA905373395_00370 | CDS | open | 191093-192085 | _na 330_aa | nadA | quinolinate synthase NadA |
| 598 | CAJPSO010000002.1 | GCA905373395_00371 | CDS | open | 192222-193814 | _na 530_aa | nadB | L-aspartate oxidase |
| 599 | CAJPSO010000002.1 | GCA905373395_00372 | CDS | open | 194007-194714 | _na 235_aa | ompR | Transcriptional regulatory protein RprY |
| 600 | CAJPSO010000002.1 | GCA905373395_00373 | CDS | open | 194748-196304 | _na 518_aa | kdpD | histidine kinase |
| 601 | CAJPSO010000002.1 | GCA905373395_00374 | CDS | open | 196589-197167 | _na 192_aa | hypothetical protein | |
| 602 | CAJPSO010000002.1 | GCA905373395_00375 | CDS | open | 197262-198833 | _na 523_aa | cafA | S1 RNA binding domain protein |
| 603 | CAJPSO010000002.1 | GCA905373395_00376 | CDS | open | 199020-199109 | _na 29_aa | Mitochondrial mRNA-processing protein COX24 C-terminal domain-containing protein | |
| 604 | CAJPSO010000002.1 | GCA905373395_00377 | CDS | open | 199152-199430 | _na 92_aa | DNA-binding protein HU | |
| 605 | CAJPSO010000002.1 | GCA905373395_00378 | CDS | open | 199633-200463 | _na 276_aa | coaW | type II pantothenate kinase |
| 606 | CAJPSO010000002.1 | GCA905373395_00379 | CDS | open | 200500-201927 | _na 475_aa | Na(+)/glucose symporter | |
| 607 | CAJPSO010000002.1 | GCA905373395_00380 | CDS | open | 202091-203452 | _na 453_aa | TrpB-like pyridoxal phosphate-dependent enzyme | |
| 608 | CAJPSO010000002.1 | GCA905373395_00381 | CDS | open | 203560-205548 | _na 662_aa | oPT | OPT family oligopeptide transporter |
| 609 | CAJPSO010000002.1 | GCA905373395_00382 | CDS | open | 205635-206297 | _na 220_aa | tsaA | tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO |
| 610 | CAJPSO010000002.1 | GCA905373395_00383 | CDS | open | 206872-207909 | _na 345_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 611 | CAJPSO010000002.1 | GCA905373395_00384 | CDS | open | 208093-208908 | _na 271_aa | DUF4348 domain-containing protein | |
| 612 | CAJPSO010000002.1 | GCA905373395_00385 | CDS | open | 208985-209557 | _na 190_aa | Bacterial transferase hexapeptide repeat protein | |
| 613 | CAJPSO010000002.1 | GCA905373395_00386 | CDS | open | 209616-210620 | _na 334_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 614 | CAJPSO010000002.1 | GCA905373395_00387 | CDS | open | 211014-211769 | _na 251_aa | Putative hydrolase | |
| 615 | CAJPSO010000002.1 | GCA905373395_00388 | CDS | open | 211965-213140 | _na 391_aa | DUF4105 domain-containing protein | |
| 616 | CAJPSO010000002.1 | GCA905373395_00389 | CDS | open | 213137-213499 | _na 120_aa | Secreted protein | |
| 617 | CAJPSO010000002.1 | GCA905373395_00390 | CDS | open | 213849-217208 | _na 1119_aa | secA | preprotein translocase subunit SecA |
| 618 | CAJPSO010000002.1 | GCA905373395_00391 | CDS | open | 217189-217941 | _na 250_aa | lptB | Lipopolysaccharide export system ATP-binding protein LptB |
| 619 | CAJPSO010000002.1 | GCA905373395_00392 | CDS | open | 218074-219861 | _na 595_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 620 | CAJPSO010000002.1 | GCA905373395_00393 | CDS | open | 219866-220465 | _na 199_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 621 | CAJPSO010000002.1 | GCA905373395_00394 | CDS | open | 220640-221623 | _na 327_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 622 | CAJPSO010000002.1 | GCA905373395_00395 | CDS | open | 221667-222866 | _na 399_aa | DUF4421 domain-containing protein | |
| 623 | CAJPSO010000002.1 | GCA905373395_00396 | CDS | open | 222957-223931 | _na 324_aa | Putative lipoprotein | |
| 624 | CAJPSO010000002.1 | GCA905373395_00397 | CDS | open | 224179-224772 | _na 197_aa | HTH tetR-type domain-containing protein | |
| 625 | CAJPSO010000002.1 | GCA905373395_00398 | CDS | open | 224898-225644 | _na 248_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 626 | CAJPSO010000002.1 | GCA905373395_00399 | CDS | open | 225806-226483 | _na 225_aa | Pseudouridine synthase RsuA/RluA-like domain-containing protein | |
| 627 | CAJPSO010000002.1 | GCA905373395_00400 | CDS | open | 227313-228431 | _na 372_aa | Glycoside hydrolase | |
| 628 | CAJPSO010000002.1 | GCA905373395_00401 | CDS | open | 228502-229254 | _na 250_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 629 | CAJPSO010000002.1 | GCA905373395_00402 | CDS | open | 229478-231772 | _na 764_aa | sfcA | Phosphate acetyl/butyryl transferase |
| 630 | CAJPSO010000002.1 | GCA905373395_00403 | CDS | open | 231896-232543 | _na 215_aa | tetR | Transcriptional regulator%2C TetR family |
| 631 | CAJPSO010000002.1 | GCA905373395_00404 | CDS | open | 232616-234019 | _na 467_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 632 | CAJPSO010000002.1 | GCA905373395_00405 | CDS | open | 234095-235612 | _na 505_aa | dltB | D-alanyl-lipoteichoic acid biosynthesis protein DltB |
| 633 | CAJPSO010000002.1 | GCA905373395_00406 | CDS | open | 236341-236817 | _na 158_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 634 | CAJPSO010000002.1 | GCA905373395_00407 | CDS | open | 236824-237498 | _na 224_aa | cpoB | Ancillary SecYEG translocon subunit/Cell division coordinator CpoB TPR domain-containing protein |
| 635 | CAJPSO010000002.1 | GCA905373395_00408 | CDS | open | 237623-238897 | _na 424_aa | recF | DNA replication/repair protein RecF |
| 636 | CAJPSO010000002.1 | GCA905373395_00409 | CDS | open | 238903-239193 | _na 96_aa | DUF721 domain-containing protein | |
| 637 | CAJPSO010000002.1 | GCA905373395_00410 | CDS | open | 240044-240658 | _na 204_aa | DNA alkylation repair enzyme | |
| 638 | CAJPSO010000002.1 | GCA905373395_00229 | gene | open | 2939-3130 | |||
| 639 | CAJPSO010000002.1 | GCA905373395_00230 | gene | open | 4407-5096 | |||
| 640 | CAJPSO010000002.1 | GCA905373395_00231 | gene | open | 5059-5877 | |||
| 641 | CAJPSO010000002.1 | GCA905373395_00232 | gene | open | 6083-6745 | parA | ||
| 642 | CAJPSO010000002.1 | GCA905373395_00233 | gene | open | 7296-7940 | |||
| 643 | CAJPSO010000002.1 | GCA905373395_00234 | gene | open | 8111-8593 | |||
| 644 | CAJPSO010000002.1 | GCA905373395_00235 | gene | open | 9507-10217 | |||
| 645 | CAJPSO010000002.1 | GCA905373395_00236 | gene | open | 11505-12725 | |||
| 646 | CAJPSO010000002.1 | GCA905373395_00237 | gene | open | 12870-13820 | |||
| 647 | CAJPSO010000002.1 | GCA905373395_00238 | gene | open | 13899-14558 | |||
| 648 | CAJPSO010000002.1 | GCA905373395_00240 | gene | open | 14835-15302 | nrdG | ||
| 649 | CAJPSO010000002.1 | GCA905373395_00241 | gene | open | 15449-15949 | |||
| 650 | CAJPSO010000002.1 | GCA905373395_00242 | gene | open | 15892-16101 | |||
| 651 | CAJPSO010000002.1 | GCA905373395_00243 | gene | open | 16436-16987 | |||
| 652 | CAJPSO010000002.1 | GCA905373395_00244 | gene | open | 17176-17268 | |||
| 653 | CAJPSO010000002.1 | GCA905373395_00245 | gene | open | 18056-18946 | araC | ||
| 654 | CAJPSO010000002.1 | GCA905373395_00246 | gene | open | 18982-20199 | |||
| 655 | CAJPSO010000002.1 | GCA905373395_00247 | gene | open | 20228-21646 | yicJ | ||
| 656 | CAJPSO010000002.1 | GCA905373395_00248 | gene | open | 21643-22806 | |||
| 657 | CAJPSO010000002.1 | GCA905373395_00249 | gene | open | 22817-23911 | |||
| 658 | CAJPSO010000002.1 | GCA905373395_00250 | gene | open | 25342-26901 | |||
| 659 | CAJPSO010000002.1 | GCA905373395_00251 | gene | open | 27154-27309 | |||
| 660 | CAJPSO010000002.1 | GCA905373395_00252 | gene | open | 27589-27726 | |||
| 661 | CAJPSO010000002.1 | GCA905373395_00253 | gene | open | 28204-30000 | |||
| 662 | CAJPSO010000002.1 | GCA905373395_00254 | gene | open | 31386-33008 | |||
| 663 | CAJPSO010000002.1 | GCA905373395_00255 | gene | open | 33051-33299 | |||
| 664 | CAJPSO010000002.1 | GCA905373395_00256 | gene | open | 33717-33887 | |||
| 665 | CAJPSO010000002.1 | GCA905373395_00257 | gene | open | 34273-35568 | |||
| 666 | CAJPSO010000002.1 | GCA905373395_00258 | gene | open | 35712-37760 | |||
| 667 | CAJPSO010000002.1 | GCA905373395_00259 | gene | open | 37763-38599 | |||
| 668 | CAJPSO010000002.1 | GCA905373395_00260 | gene | open | 39229-39882 | rbr | ||
| 669 | CAJPSO010000002.1 | GCA905373395_00261 | gene | open | 40287-41390 | mrp | ||
| 670 | CAJPSO010000002.1 | GCA905373395_00262 | gene | open | 41511-42431 | |||
| 671 | CAJPSO010000002.1 | GCA905373395_00263 | gene | open | 42546-42923 | |||
| 672 | CAJPSO010000002.1 | GCA905373395_00264 | gene | open | 43298-44242 | ppaX | ||
| 673 | CAJPSO010000002.1 | GCA905373395_00266 | gene | open | 45353-46432 | |||
| 674 | CAJPSO010000002.1 | GCA905373395_00267 | gene | open | 46433-49627 | |||
| 675 | CAJPSO010000002.1 | GCA905373395_00268 | gene | open | 49608-51035 | |||
| 676 | CAJPSO010000002.1 | GCA905373395_00269 | gene | open | 51587-51976 | tonB | ||
| 677 | CAJPSO010000002.1 | GCA905373395_00270 | gene | open | 52173-52655 | |||
| 678 | CAJPSO010000002.1 | GCA905373395_00271 | gene | open | 53305-54630 | |||
| 679 | CAJPSO010000002.1 | GCA905373395_00272 | gene | open | 54690-55478 | nagB | ||
| 680 | CAJPSO010000002.1 | GCA905373395_00273 | gene | open | 55478-57466 | lmbE | ||
| 681 | CAJPSO010000002.1 | GCA905373395_00274 | gene | open | 57490-58836 | |||
| 682 | CAJPSO010000002.1 | GCA905373395_00275 | gene | open | 59332-60912 | |||
| 683 | CAJPSO010000002.1 | GCA905373395_00276 | gene | open | 61114-63270 | |||
| 684 | CAJPSO010000002.1 | GCA905373395_00277 | gene | open | 63273-65201 | yidC | ||
| 685 | CAJPSO010000002.1 | GCA905373395_00278 | gene | open | 65202-66812 | pyrG | ||
| 686 | CAJPSO010000002.1 | GCA905373395_00279 | gene | open | 67260-68798 | |||
| 687 | CAJPSO010000002.1 | GCA905373395_00280 | gene | open | 69118-70653 | |||
| 688 | CAJPSO010000002.1 | GCA905373395_00281 | gene | open | 71055-73220 | |||
| 689 | CAJPSO010000002.1 | GCA905373395_00282 | gene | open | 73380-74267 | fabD | ||
| 690 | CAJPSO010000002.1 | GCA905373395_00283 | gene | open | 74379-76103 | |||
| 691 | CAJPSO010000002.1 | GCA905373395_00284 | gene | open | 76750-78297 | |||
| 692 | CAJPSO010000002.1 | GCA905373395_00285 | gene | open | 78414-79541 | |||
| 693 | CAJPSO010000002.1 | GCA905373395_00286 | gene | open | 79576-80124 | rplI | ||
| 694 | CAJPSO010000002.1 | GCA905373395_00287 | gene | open | 80140-80409 | rpsR | ||
| 695 | CAJPSO010000002.1 | GCA905373395_00288 | gene | open | 80413-80757 | rpsF | ||
| 696 | CAJPSO010000002.1 | GCA905373395_00289 | gene | open | 80808-81065 | |||
| 697 | CAJPSO010000002.1 | GCA905373395_00290 | gene | open | 82079-83434 | |||
| 698 | CAJPSO010000002.1 | GCA905373395_00291 | gene | open | 83442-85187 | |||
| 699 | CAJPSO010000002.1 | GCA905373395_00292 | gene | open | 85205-86128 | |||
| 700 | CAJPSO010000002.1 | GCA905373395_00293 | gene | open | 86327-88012 | |||
| 701 | CAJPSO010000002.1 | GCA905373395_00294 | gene | open | 88034-91342 | btuB | ||
| 702 | CAJPSO010000002.1 | GCA905373395_00295 | gene | open | 91859-95569 | |||
| 703 | CAJPSO010000002.1 | GCA905373395_00296 | gene | open | 95881-98256 | aprX | ||
| 704 | CAJPSO010000002.1 | GCA905373395_00297 | gene | open | 98253-99851 | |||
| 705 | CAJPSO010000002.1 | GCA905373395_00298 | gene | open | 100815-101261 | rpiB | ||
| 706 | CAJPSO010000002.1 | GCA905373395_00299 | gene | open | 101326-103341 | |||
| 707 | CAJPSO010000002.1 | GCA905373395_00300 | gene | open | 103890-104567 | |||
| 708 | CAJPSO010000002.1 | GCA905373395_00301 | gene | open | 104747-105907 | galK | ||
| 709 | CAJPSO010000002.1 | GCA905373395_00302 | gene | open | 105955-107205 | fucP | ||
| 710 | CAJPSO010000002.1 | GCA905373395_00303 | gene | open | 107247-108365 | |||
| 711 | CAJPSO010000002.1 | GCA905373395_00304 | gene | open | 109744-110949 | ribA | ||
| 712 | CAJPSO010000002.1 | GCA905373395_00305 | gene | open | 110964-112850 | |||
| 713 | CAJPSO010000002.1 | GCA905373395_00306 | gene | open | 113358-113750 | |||
| 714 | CAJPSO010000002.1 | GCA905373395_00308 | gene | open | 115234-116148 | |||
| 715 | CAJPSO010000002.1 | GCA905373395_00309 | gene | open | 116436-116888 | |||
| 716 | CAJPSO010000002.1 | GCA905373395_00310 | gene | open | 116932-117630 | |||
| 717 | CAJPSO010000002.1 | GCA905373395_00311 | gene | open | 117677-118171 | |||
| 718 | CAJPSO010000002.1 | GCA905373395_00312 | gene | open | 118220-118768 | |||
| 719 | CAJPSO010000002.1 | GCA905373395_00313 | gene | open | 118936-119175 | |||
| 720 | CAJPSO010000002.1 | GCA905373395_00314 | gene | open | 119811-122780 | |||
| 721 | CAJPSO010000002.1 | GCA905373395_00315 | gene | open | 122794-124368 | susD | ||
| 722 | CAJPSO010000002.1 | GCA905373395_00316 | gene | open | 124382-126070 | |||
| 723 | CAJPSO010000002.1 | GCA905373395_00317 | gene | open | 126095-127144 | |||
| 724 | CAJPSO010000002.1 | GCA905373395_00318 | gene | open | 127442-131284 | |||
| 725 | CAJPSO010000002.1 | GCA905373395_00319 | gene | open | 131515-132801 | |||
| 726 | CAJPSO010000002.1 | GCA905373395_00320 | gene | open | 132892-134034 | dnaJ | ||
| 727 | CAJPSO010000002.1 | GCA905373395_00321 | gene | open | 134183-134773 | grpE | ||
| 728 | CAJPSO010000002.1 | GCA905373395_00322 | gene | open | 134825-136447 | uup | ||
| 729 | CAJPSO010000002.1 | GCA905373395_00323 | gene | open | 136649-137371 | pflA | ||
| 730 | CAJPSO010000002.1 | GCA905373395_00324 | gene | open | 137421-139667 | pflB | ||
| 731 | CAJPSO010000002.1 | GCA905373395_00325 | gene | open | 140078-140803 | |||
| 732 | CAJPSO010000002.1 | GCA905373395_00326 | gene | open | 140905-141885 | |||
| 733 | CAJPSO010000002.1 | GCA905373395_00327 | gene | open | 141860-142852 | |||
| 734 | CAJPSO010000002.1 | GCA905373395_00328 | gene | open | 142865-143476 | |||
| 735 | CAJPSO010000002.1 | GCA905373395_00329 | gene | open | 143473-144726 | |||
| 736 | CAJPSO010000002.1 | GCA905373395_00330 | gene | open | 144780-145754 | |||
| 737 | CAJPSO010000002.1 | GCA905373395_00331 | gene | open | 145894-147207 | |||
| 738 | CAJPSO010000002.1 | GCA905373395_00332 | gene | open | 147688-149493 | mutS | ||
| 739 | CAJPSO010000002.1 | GCA905373395_00333 | gene | open | 149524-150846 | |||
| 740 | CAJPSO010000002.1 | GCA905373395_00334 | gene | open | 150877-151551 | |||
| 741 | CAJPSO010000002.1 | GCA905373395_00335 | gene | open | 151596-152384 | |||
| 742 | CAJPSO010000002.1 | GCA905373395_00336 | gene | open | 152390-154021 | |||
| 743 | CAJPSO010000002.1 | GCA905373395_00337 | gene | open | 154026-154484 | |||
| 744 | CAJPSO010000002.1 | GCA905373395_00338 | gene | open | 155404-156276 | |||
| 745 | CAJPSO010000002.1 | GCA905373395_00339 | gene | open | 156294-158273 | |||
| 746 | CAJPSO010000002.1 | GCA905373395_00340 | gene | open | 158347-159138 | hmuY | ||
| 747 | CAJPSO010000002.1 | GCA905373395_00341 | gene | open | 159157-159750 | |||
| 748 | CAJPSO010000002.1 | GCA905373395_00342 | gene | open | 159747-160229 | |||
| 749 | CAJPSO010000002.1 | GCA905373395_00343 | gene | open | 161204-162556 | mtaB | ||
| 750 | CAJPSO010000002.1 | GCA905373395_00344 | gene | open | 162553-163593 | |||
| 751 | CAJPSO010000002.1 | GCA905373395_00345 | gene | open | 163702-164514 | gldB | ||
| 752 | CAJPSO010000002.1 | GCA905373395_00346 | gene | open | 164602-165525 | |||
| 753 | CAJPSO010000002.1 | GCA905373395_00347 | gene | open | 165649-165900 | |||
| 754 | CAJPSO010000002.1 | GCA905373395_00348 | gene | open | 166034-167377 | |||
| 755 | CAJPSO010000002.1 | GCA905373395_00349 | gene | open | 167402-168637 | |||
| 756 | CAJPSO010000002.1 | GCA905373395_00350 | gene | open | 168659-171232 | |||
| 757 | CAJPSO010000002.1 | GCA905373395_00351 | gene | open | 171521-172564 | |||
| 758 | CAJPSO010000002.1 | GCA905373395_00352 | gene | open | 172741-173325 | |||
| 759 | CAJPSO010000002.1 | GCA905373395_00353 | gene | open | 173364-173993 | udk | ||
| 760 | CAJPSO010000002.1 | GCA905373395_00354 | gene | open | 174757-176856 | dsbD | ||
| 761 | CAJPSO010000002.1 | GCA905373395_00355 | gene | open | 177113-177823 | pyrH | ||
| 762 | CAJPSO010000002.1 | GCA905373395_00356 | gene | open | 177922-178713 | |||
| 763 | CAJPSO010000002.1 | GCA905373395_00357 | gene | open | 178729-179094 | |||
| 764 | CAJPSO010000002.1 | GCA905373395_00358 | gene | open | 179294-179746 | |||
| 765 | CAJPSO010000002.1 | GCA905373395_00359 | gene | open | 179893-180360 | tadA | ||
| 766 | CAJPSO010000002.1 | GCA905373395_00360 | gene | open | 180381-181019 | |||
| 767 | CAJPSO010000002.1 | GCA905373395_00361 | gene | open | 181079-182020 | menA | ||
| 768 | CAJPSO010000002.1 | GCA905373395_00362 | gene | open | 182081-184474 | |||
| 769 | CAJPSO010000002.1 | GCA905373395_00363 | gene | open | 184475-184705 | |||
| 770 | CAJPSO010000002.1 | GCA905373395_00364 | gene | open | 184916-185854 | |||
| 771 | CAJPSO010000002.1 | GCA905373395_00365 | gene | open | 186190-186849 | |||
| 772 | CAJPSO010000002.1 | GCA905373395_00366 | gene | open | 187185-188036 | |||
| 773 | CAJPSO010000002.1 | GCA905373395_00367 | gene | open | 188435-190051 | |||
| 774 | CAJPSO010000002.1 | GCA905373395_00368 | gene | open | 190058-190177 | |||
| 775 | CAJPSO010000002.1 | GCA905373395_00369 | gene | open | 190207-191073 | nadC | ||
| 776 | CAJPSO010000002.1 | GCA905373395_00370 | gene | open | 191093-192085 | nadA | ||
| 777 | CAJPSO010000002.1 | GCA905373395_00371 | gene | open | 192222-193814 | nadB | ||
| 778 | CAJPSO010000002.1 | GCA905373395_00372 | gene | open | 194007-194714 | ompR | ||
| 779 | CAJPSO010000002.1 | GCA905373395_00373 | gene | open | 194748-196304 | kdpD | ||
| 780 | CAJPSO010000002.1 | GCA905373395_00374 | gene | open | 196589-197167 | |||
| 781 | CAJPSO010000002.1 | GCA905373395_00375 | gene | open | 197262-198833 | cafA | ||
| 782 | CAJPSO010000002.1 | GCA905373395_00376 | gene | open | 199020-199109 | |||
| 783 | CAJPSO010000002.1 | GCA905373395_00377 | gene | open | 199152-199430 | |||
| 784 | CAJPSO010000002.1 | GCA905373395_00378 | gene | open | 199633-200463 | coaW | ||
| 785 | CAJPSO010000002.1 | GCA905373395_00379 | gene | open | 200500-201927 | |||
| 786 | CAJPSO010000002.1 | GCA905373395_00380 | gene | open | 202091-203452 | |||
| 787 | CAJPSO010000002.1 | GCA905373395_00381 | gene | open | 203560-205548 | oPT | ||
| 788 | CAJPSO010000002.1 | GCA905373395_00382 | gene | open | 205635-206297 | tsaA | ||
| 789 | CAJPSO010000002.1 | GCA905373395_00383 | gene | open | 206872-207909 | pheS | ||
| 790 | CAJPSO010000002.1 | GCA905373395_00384 | gene | open | 208093-208908 | |||
| 791 | CAJPSO010000002.1 | GCA905373395_00385 | gene | open | 208985-209557 | |||
| 792 | CAJPSO010000002.1 | GCA905373395_00386 | gene | open | 209616-210620 | murB | ||
| 793 | CAJPSO010000002.1 | GCA905373395_00387 | gene | open | 211014-211769 | |||
| 794 | CAJPSO010000002.1 | GCA905373395_00388 | gene | open | 211965-213140 | |||
| 795 | CAJPSO010000002.1 | GCA905373395_00389 | gene | open | 213137-213499 | |||
| 796 | CAJPSO010000002.1 | GCA905373395_00390 | gene | open | 213849-217208 | secA | ||
| 797 | CAJPSO010000002.1 | GCA905373395_00391 | gene | open | 217189-217941 | lptB | ||
| 798 | CAJPSO010000002.1 | GCA905373395_00392 | gene | open | 218074-219861 | abc-f | ||
| 799 | CAJPSO010000002.1 | GCA905373395_00393 | gene | open | 219866-220465 | yihA | ||
| 800 | CAJPSO010000002.1 | GCA905373395_00394 | gene | open | 220640-221623 | mviM | ||
| 801 | CAJPSO010000002.1 | GCA905373395_00395 | gene | open | 221667-222866 | |||
| 802 | CAJPSO010000002.1 | GCA905373395_00396 | gene | open | 222957-223931 | |||
| 803 | CAJPSO010000002.1 | GCA905373395_00397 | gene | open | 224179-224772 | |||
| 804 | CAJPSO010000002.1 | GCA905373395_00398 | gene | open | 224898-225644 | fabG | ||
| 805 | CAJPSO010000002.1 | GCA905373395_00399 | gene | open | 225806-226483 | |||
| 806 | CAJPSO010000002.1 | GCA905373395_00400 | gene | open | 227313-228431 | |||
| 807 | CAJPSO010000002.1 | GCA905373395_00401 | gene | open | 228502-229254 | |||
| 808 | CAJPSO010000002.1 | GCA905373395_00402 | gene | open | 229478-231772 | sfcA | ||
| 809 | CAJPSO010000002.1 | GCA905373395_00403 | gene | open | 231896-232543 | tetR | ||
| 810 | CAJPSO010000002.1 | GCA905373395_00404 | gene | open | 232616-234019 | |||
| 811 | CAJPSO010000002.1 | GCA905373395_00405 | gene | open | 234095-235612 | dltB | ||
| 812 | CAJPSO010000002.1 | GCA905373395_00406 | gene | open | 236341-236817 | ribH | ||
| 813 | CAJPSO010000002.1 | GCA905373395_00407 | gene | open | 236824-237498 | cpoB | ||
| 814 | CAJPSO010000002.1 | GCA905373395_00408 | gene | open | 237623-238897 | recF | ||
| 815 | CAJPSO010000002.1 | GCA905373395_00409 | gene | open | 238903-239193 | |||
| 816 | CAJPSO010000002.1 | GCA905373395_00410 | gene | open | 240044-240658 | |||
| 817 | CAJPSO010000002.1 | GCA905373395_00239 | gene | open | 14653-14726 | trnR | ||
| 818 | CAJPSO010000002.1 | GCA905373395_00265 | gene | open | 44369-44441 | trnfM | ||
| 819 | CAJPSO010000002.1 | GCA905373395_00307 | gene | open | 114082-114155 | trnM | ||
| 820 | CAJPSO010000002.1 | GCA905373395_00239 | tRNA | open | 14653-14726 | trnR | tRNA-Arg(acg) | |
| 821 | CAJPSO010000002.1 | GCA905373395_00265 | tRNA | open | 44369-44441 | trnfM | tRNA-fMet(cat) | |
| 822 | CAJPSO010000002.1 | GCA905373395_00307 | tRNA | open | 114082-114155 | trnM | tRNA-Met(cat) | |
| 823 | CAJPSO010000003.1 | GCA905373395_00545 | gene | open | 139287-139685 | ssrA | ||
| 824 | CAJPSO010000003.1 | GCA905373395_00545 | tmRNA | open | 139287-139685 | ssrA | transfer-messenger RNA%2C SsrA | |
| 825 | CAJPSO010000003.1 | GCA905373395_00453 | gene | open | 41677-41783 | Bacteroidales_small_SRP | ||
| 826 | CAJPSO010000003.1 | GCA905373395_00454 | gene | open | 41684-41773 | Bacteria_small_SRP | ||
| 827 | CAJPSO010000003.1 | GCA905373395_00453 | ncRNA | open | 41677-41783 | Bacteroidales small SRP | ||
| 828 | CAJPSO010000003.1 | GCA905373395_00454 | ncRNA | open | 41684-41773 | Bacterial small signal recognition particle RNA | ||
| 829 | CAJPSO010000003.1 | regulatory_region | open | 92144-92333 | Cobalamin riboswitch aptamer | |||
| 830 | CAJPSO010000003.1 | repeat_region | open | 1-1672 | CRISPR array with 22 repeats of length 47%2C consensus sequence ATTGTGCTTGCTACTGCAAAGATACACATTTTGAAGCAATTCACAAC and spacer length 29 | |||
| 831 | CAJPSO010000003.1 | GCA905373395_00411 | CDS | open | 1899-4367 | _na 822_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 832 | CAJPSO010000003.1 | GCA905373395_00412 | CDS | open | 4380-5120 | _na 246_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 833 | CAJPSO010000003.1 | GCA905373395_00413 | CDS | open | 5323-5778 | _na 151_aa | pyrI | aspartate carbamoyltransferase regulatory subunit |
| 834 | CAJPSO010000003.1 | GCA905373395_00414 | CDS | open | 5881-6300 | _na 139_aa | BACON domain-containing protein | |
| 835 | CAJPSO010000003.1 | GCA905373395_00415 | CDS | open | 6326-7273 | _na 315_aa | pyrB | aspartate carbamoyltransferase |
| 836 | CAJPSO010000003.1 | GCA905373395_00416 | CDS | open | 7437-9740 | _na 767_aa | mrcA | peptidoglycan glycosyltransferase |
| 837 | CAJPSO010000003.1 | GCA905373395_00417 | CDS | open | 10508-11755 | _na 415_aa | lolE | Lipoprotein-releasing system transmembrane protein lolE |
| 838 | CAJPSO010000003.1 | GCA905373395_00418 | CDS | open | 11859-13064 | _na 401_aa | aspB | Aminotransferase%2C class I/II |
| 839 | CAJPSO010000003.1 | GCA905373395_00419 | CDS | open | 13177-13293 | _na 38_aa | hypothetical protein | |
| 840 | CAJPSO010000003.1 | GCA905373395_00420 | CDS | open | 13290-13778 | _na 162_aa | Phage tail component domain protein | |
| 841 | CAJPSO010000003.1 | GCA905373395_00421 | CDS | open | 13814-14485 | _na 223_aa | Pyridoxal phosphate homeostasis protein | |
| 842 | CAJPSO010000003.1 | GCA905373395_00422 | CDS | open | 14590-15636 | _na 348_aa | hisC | histidinol-phosphate transaminase |
| 843 | CAJPSO010000003.1 | GCA905373395_00423 | CDS | open | 15686-16414 | _na 242_aa | trmH | RNA methyltransferase%2C TrmH family |
| 844 | CAJPSO010000003.1 | GCA905373395_00424 | CDS | open | 16567-18831 | _na 754_aa | Outer membrane protein%2C OMP85 family | |
| 845 | CAJPSO010000003.1 | GCA905373395_00425 | CDS | open | 18951-19751 | _na 266_aa | Metallo-beta-lactamase | |
| 846 | CAJPSO010000003.1 | GCA905373395_00426 | CDS | open | 19970-20134 | _na 54_aa | rubredoxin | |
| 847 | CAJPSO010000003.1 | GCA905373395_00427 | CDS | open | 20287-20793 | _na 168_aa | DUF4375 domain-containing protein | |
| 848 | CAJPSO010000003.1 | GCA905373395_00428 | CDS | open | 20790-21269 | _na 159_aa | smpB | SsrA-binding protein SmpB |
| 849 | CAJPSO010000003.1 | GCA905373395_00429 | CDS | open | 21655-22542 | _na 295_aa | map | type I methionyl aminopeptidase |
| 850 | CAJPSO010000003.1 | GCA905373395_00430 | CDS | open | 22608-23639 | _na 343_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 851 | CAJPSO010000003.1 | GCA905373395_00431 | CDS | open | 23674-24177 | _na 167_aa | Competence protein | |
| 852 | CAJPSO010000003.1 | GCA905373395_00432 | CDS | open | 24303-24566 | _na 87_aa | rpmB | 50S ribosomal protein L28 |
| 853 | CAJPSO010000003.1 | GCA905373395_00433 | CDS | open | 24572-24760 | _na 62_aa | rpmG | 50S ribosomal protein L33 |
| 854 | CAJPSO010000003.1 | GCA905373395_00434 | CDS | open | 24806-24964 | _na 52_aa | DUF4295 domain-containing protein | |
| 855 | CAJPSO010000003.1 | GCA905373395_00435 | CDS | open | 25057-25896 | _na 279_aa | 4Fe-4S binding domain protein | |
| 856 | CAJPSO010000003.1 | GCA905373395_00436 | CDS | open | 26005-27549 | _na 514_aa | ComEC/Rec2-like protein | |
| 857 | CAJPSO010000003.1 | GCA905373395_00437 | CDS | open | 27574-28335 | _na 253_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 858 | CAJPSO010000003.1 | GCA905373395_00438 | CDS | open | 28348-29274 | _na 308_aa | Putative membrane protein | |
| 859 | CAJPSO010000003.1 | GCA905373395_00439 | CDS | open | 29477-30361 | _na 294_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 860 | CAJPSO010000003.1 | GCA905373395_00440 | CDS | open | 30865-31692 | _na 275_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 861 | CAJPSO010000003.1 | GCA905373395_00441 | CDS | open | 31877-32989 | _na 370_aa | prfA | peptide chain release factor 1 |
| 862 | CAJPSO010000003.1 | GCA905373395_00442 | CDS | open | 33009-33965 | _na 318_aa | hrgA | HrgA protein |
| 863 | CAJPSO010000003.1 | GCA905373395_00443 | CDS | open | 33970-35118 | _na 382_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 864 | CAJPSO010000003.1 | GCA905373395_00444 | CDS | open | 35265-35741 | _na 158_aa | TonB-dependent receptor | |
| 865 | CAJPSO010000003.1 | GCA905373395_00445 | CDS | open | 35853-36593 | _na 246_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 866 | CAJPSO010000003.1 | GCA905373395_00446 | CDS | open | 36729-37526 | _na 265_aa | NADP oxidoreductase coenzyme F420-dependent | |
| 867 | CAJPSO010000003.1 | GCA905373395_00447 | CDS | open | 37604-38122 | _na 172_aa | yrbI | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family |
| 868 | CAJPSO010000003.1 | GCA905373395_00448 | CDS | open | 38137-38700 | _na 187_aa | dTTP/UTP pyrophosphatase | |
| 869 | CAJPSO010000003.1 | GCA905373395_00449 | CDS | open | 38702-39172 | _na 156_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 870 | CAJPSO010000003.1 | GCA905373395_00450 | CDS | open | 39743-40993 | _na 416_aa | pgk | Phosphoglycerate kinase |
| 871 | CAJPSO010000003.1 | GCA905373395_00455 | CDS | open | 41930-42469 | _na 179_aa | DUF4199 domain-containing protein | |
| 872 | CAJPSO010000003.1 | GCA905373395_00456 | CDS | open | 42604-43557 | _na 317_aa | wcaA | Glycosyltransferase 2-like domain-containing protein |
| 873 | CAJPSO010000003.1 | GCA905373395_00457 | CDS | open | 43670-44149 | _na 159_aa | Conserved domain protein | |
| 874 | CAJPSO010000003.1 | GCA905373395_00458 | CDS | open | 44103-44795 | _na 230_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 875 | CAJPSO010000003.1 | GCA905373395_00459 | CDS | open | 44927-45943 | _na 338_aa | FAD:protein FMN transferase | |
| 876 | CAJPSO010000003.1 | GCA905373395_00460 | CDS | open | 46057-46722 | _na 221_aa | Cyclic nucleotide-binding domain protein | |
| 877 | CAJPSO010000003.1 | GCA905373395_00461 | CDS | open | 47259-47399 | _na 46_aa | hypothetical protein | |
| 878 | CAJPSO010000003.1 | GCA905373395_00462 | CDS | open | 47491-48504 | _na 337_aa | fmt | methionyl-tRNA formyltransferase |
| 879 | CAJPSO010000003.1 | GCA905373395_00463 | CDS | open | 48606-50402 | _na 598_aa | CBS domain-containing protein | |
| 880 | CAJPSO010000003.1 | GCA905373395_00464 | CDS | open | 50415-50984 | _na 189_aa | L-threonylcarbamoyladenylate synthase | |
| 881 | CAJPSO010000003.1 | GCA905373395_00465 | CDS | open | 51322-51990 | _na 222_aa | DUF4230 domain-containing protein | |
| 882 | CAJPSO010000003.1 | GCA905373395_00466 | CDS | open | 51993-52673 | _na 226_aa | DUF4230 domain-containing protein | |
| 883 | CAJPSO010000003.1 | GCA905373395_00467 | CDS | open | 52651-52893 | _na 80_aa | HEPN domain-containing protein | |
| 884 | CAJPSO010000003.1 | GCA905373395_00468 | CDS | open | 52897-53496 | _na 199_aa | ADP-ribose pyrophosphatase | |
| 885 | CAJPSO010000003.1 | GCA905373395_00469 | CDS | open | 53838-54089 | _na 83_aa | hypothetical protein | |
| 886 | CAJPSO010000003.1 | GCA905373395_00470 | CDS | open | 54313-54630 | _na 105_aa | rplU | 50S ribosomal protein L21 |
| 887 | CAJPSO010000003.1 | GCA905373395_00471 | CDS | open | 54647-54937 | _na 96_aa | rpmA | 50S ribosomal protein L27 |
| 888 | CAJPSO010000003.1 | GCA905373395_00472 | CDS | open | 55544-56578 | _na 344_aa | Zinc ribbon domain-containing protein | |
| 889 | CAJPSO010000003.1 | GCA905373395_00473 | CDS | open | 56750-58801 | _na 683_aa | yhbU | putative protease yhbU |
| 890 | CAJPSO010000003.1 | GCA905373395_00474 | CDS | open | 58917-59807 | _na 296_aa | metA | homoserine O-succinyltransferase |
| 891 | CAJPSO010000003.1 | GCA905373395_00475 | CDS | open | 60161-60748 | _na 195_aa | Cysteine/O-acetylserine efflux protein | |
| 892 | CAJPSO010000003.1 | GCA905373395_00477 | CDS | open | 61199-61465 | _na 88_aa | hypothetical protein | |
| 893 | CAJPSO010000003.1 | GCA905373395_00478 | CDS | open | 61473-62354 | _na 293_aa | Tetratricopeptide repeat protein | |
| 894 | CAJPSO010000003.1 | GCA905373395_00479 | CDS | open | 62466-63032 | _na 188_aa | Lipoprotein | |
| 895 | CAJPSO010000003.1 | GCA905373395_00480 | CDS | open | 63043-64284 | _na 413_aa | sigma-54-dependent Fis family transcriptional regulator | |
| 896 | CAJPSO010000003.1 | GCA905373395_00481 | CDS | open | 64592-64825 | _na 77_aa | hypothetical protein | |
| 897 | CAJPSO010000003.1 | GCA905373395_00482 | CDS | open | 64831-65832 | _na 333_aa | Putative membrane protein | |
| 898 | CAJPSO010000003.1 | GCA905373395_00483 | CDS | open | 65943-67079 | _na 378_aa | pdxA | Pyridoxal phosphate biosynthetic protein PdxA |
| 899 | CAJPSO010000003.1 | GCA905373395_00484 | CDS | open | 67164-68225 | _na 353_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 900 | CAJPSO010000003.1 | GCA905373395_00485 | CDS | open | 68936-70327 | _na 463_aa | glmM | phosphoglucosamine mutase |
| 901 | CAJPSO010000003.1 | GCA905373395_00486 | CDS | open | 70388-71026 | _na 212_aa | DUF4827 domain-containing protein | |
| 902 | CAJPSO010000003.1 | GCA905373395_00487 | CDS | open | 71039-71326 | _na 95_aa | hypothetical protein | |
| 903 | CAJPSO010000003.1 | GCA905373395_00488 | CDS | open | 71432-71926 | _na 164_aa | RNA polymerase sigma factor%2C sigma-70 family | |
| 904 | CAJPSO010000003.1 | GCA905373395_00489 | CDS | open | 71923-72615 | _na 230_aa | fecR | Protein FecR C-terminal domain-containing protein |
| 905 | CAJPSO010000003.1 | GCA905373395_00490 | CDS | open | 72620-75166 | _na 848_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 906 | CAJPSO010000003.1 | GCA905373395_00491 | CDS | open | 75243-75560 | _na 105_aa | Lipoprotein | |
| 907 | CAJPSO010000003.1 | GCA905373395_00492 | CDS | open | 76123-77205 | _na 360_aa | ATP-grasp domain-containing protein | |
| 908 | CAJPSO010000003.1 | GCA905373395_00493 | CDS | open | 77361-78545 | _na 394_aa | AAA domain-containing protein | |
| 909 | CAJPSO010000003.1 | GCA905373395_00494 | CDS | open | 78592-82167 | _na 1191_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 910 | CAJPSO010000003.1 | GCA905373395_00495 | CDS | open | 82623-83495 | _na 290_aa | Methylphosphotriester-DNA--protein-cysteine S-methyltransferase | |
| 911 | CAJPSO010000003.1 | GCA905373395_00496 | CDS | open | 83679-84950 | _na 423_aa | Outer membrane efflux protein | |
| 912 | CAJPSO010000003.1 | GCA905373395_00497 | CDS | open | 84947-85981 | _na 344_aa | Putative efflux pump membrane fusion protein | |
| 913 | CAJPSO010000003.1 | GCA905373395_00498 | CDS | open | 85985-87451 | _na 488_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 914 | CAJPSO010000003.1 | GCA905373395_00499 | CDS | open | 87474-88532 | _na 352_aa | Transport permease protein | |
| 915 | CAJPSO010000003.1 | GCA905373395_00500 | CDS | open | 88540-89625 | _na 361_aa | ABC-2 type transporter | |
| 916 | CAJPSO010000003.1 | GCA905373395_00501 | CDS | open | 90051-90434 | _na 127_aa | yjbR | YjbR protein |
| 917 | CAJPSO010000003.1 | GCA905373395_00502 | CDS | open | 90662-91942 | _na 426_aa | glyA | Serine hydroxymethyltransferase |
| 918 | CAJPSO010000003.1 | GCA905373395_00503 | CDS | open | 92383-94362 | _na 659_aa | TonB-dependent receptor | |
| 919 | CAJPSO010000003.1 | GCA905373395_00504 | CDS | open | 94471-95535 | _na 354_aa | PQQ enzyme repeat protein | |
| 920 | CAJPSO010000003.1 | GCA905373395_00505 | CDS | open | 95532-95732 | _na 66_aa | hypothetical protein | |
| 921 | CAJPSO010000003.1 | GCA905373395_00506 | CDS | open | 95804-97009 | _na 401_aa | pncB | nicotinate phosphoribosyltransferase |
| 922 | CAJPSO010000003.1 | GCA905373395_00507 | CDS | open | 97130-98491 | _na 453_aa | Multidrug-efflux transporter | |
| 923 | CAJPSO010000003.1 | GCA905373395_00508 | CDS | open | 99312-99896 | _na 194_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 924 | CAJPSO010000003.1 | GCA905373395_00509 | CDS | open | 100157-101152 | _na 331_aa | ldhA | 4-phosphoerythronate dehydrogenase |
| 925 | CAJPSO010000003.1 | GCA905373395_00510 | CDS | open | 101177-101356 | _na 59_aa | hypothetical protein | |
| 926 | CAJPSO010000003.1 | GCA905373395_00511 | CDS | open | 101796-102266 | _na 156_aa | Helix-turn-helix | |
| 927 | CAJPSO010000003.1 | GCA905373395_00512 | CDS | open | 102684-102791 | _na 35_aa | hypothetical protein | |
| 928 | CAJPSO010000003.1 | GCA905373395_00513 | CDS | open | 103104-104129 | _na 341_aa | holA | DNA polymerase III subunit delta |
| 929 | CAJPSO010000003.1 | GCA905373395_00514 | CDS | open | 104350-104796 | _na 148_aa | hsdR | Type I restriction enzyme HsdR protein N-terminal domain protein |
| 930 | CAJPSO010000003.1 | GCA905373395_00515 | CDS | open | 105122-105952 | _na 276_aa | djlA | DnaJ-like protein DjlA |
| 931 | CAJPSO010000003.1 | GCA905373395_00516 | CDS | open | 105912-106070 | _na 52_aa | hypothetical protein | |
| 932 | CAJPSO010000003.1 | GCA905373395_00517 | CDS | open | 106142-106888 | _na 248_aa | Peptidyl-prolyl cis-trans isomerase | |
| 933 | CAJPSO010000003.1 | GCA905373395_00518 | CDS | open | 107601-108428 | _na 275_aa | dR0291 | C4-type zinc ribbon domain-containing protein |
| 934 | CAJPSO010000003.1 | GCA905373395_00519 | CDS | open | 108516-109331 | _na 271_aa | Nif3-like dinuclear metal center hexameric protein | |
| 935 | CAJPSO010000003.1 | GCA905373395_00520 | CDS | open | 109415-110347 | _na 310_aa | Lipoprotein | |
| 936 | CAJPSO010000003.1 | GCA905373395_00521 | CDS | open | 110307-110450 | _na 47_aa | hypothetical protein | |
| 937 | CAJPSO010000003.1 | GCA905373395_00522 | CDS | open | 110631-111377 | _na 248_aa | wcaA | Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase |
| 938 | CAJPSO010000003.1 | GCA905373395_00523 | CDS | open | 111445-112272 | _na 275_aa | Acyltransferase | |
| 939 | CAJPSO010000003.1 | GCA905373395_00524 | CDS | open | 112292-113464 | _na 390_aa | putative metallophosphoesterase Cj0846 | |
| 940 | CAJPSO010000003.1 | GCA905373395_00525 | CDS | open | 113461-113727 | _na 88_aa | vitamin B12 dependent-methionine synthase activation domain-containing protein | |
| 941 | CAJPSO010000003.1 | GCA905373395_00526 | CDS | open | 113717-115066 | _na 449_aa | dihydroorotase | |
| 942 | CAJPSO010000003.1 | GCA905373395_00527 | CDS | open | 115157-116008 | _na 283_aa | DUF4369 domain-containing protein | |
| 943 | CAJPSO010000003.1 | GCA905373395_00528 | CDS | open | 116119-116553 | _na 144_aa | Lipoprotein | |
| 944 | CAJPSO010000003.1 | GCA905373395_00529 | CDS | open | 116537-116881 | _na 114_aa | Septum formation initiator | |
| 945 | CAJPSO010000003.1 | GCA905373395_00530 | CDS | open | 116878-117003 | _na 41_aa | hypothetical protein | |
| 946 | CAJPSO010000003.1 | GCA905373395_00531 | CDS | open | 117100-118902 | _na 600_aa | DNA polymerase III subunit gamma/tau | |
| 947 | CAJPSO010000003.1 | GCA905373395_00532 | CDS | open | 119517-121787 | _na 756_aa | yhaU | K(+)/H(+) antiporter yhaU |
| 948 | CAJPSO010000003.1 | GCA905373395_00533 | CDS | open | 122007-123230 | _na 407_aa | pepT | peptidase T |
| 949 | CAJPSO010000003.1 | GCA905373395_00534 | CDS | open | 123327-124589 | _na 420_aa | Na(+)/serine-threonine symporter | |
| 950 | CAJPSO010000003.1 | GCA905373395_00536 | CDS | open | 125298-126335 | _na 345_aa | asnA | aspartate--ammonia ligase |
| 951 | CAJPSO010000003.1 | GCA905373395_00537 | CDS | open | 126707-127660 | _na 317_aa | N-carbamoyl-D-amino acid hydrolase | |
| 952 | CAJPSO010000003.1 | GCA905373395_00538 | CDS | open | 127729-128244 | _na 171_aa | FMN reductase [NAD(P)H] | |
| 953 | CAJPSO010000003.1 | GCA905373395_00539 | CDS | open | 128423-131269 | _na 948_aa | lptD | LPS-assembly protein LptD central domain-containing protein |
| 954 | CAJPSO010000003.1 | GCA905373395_00540 | CDS | open | 131732-134146 | _na 804_aa | Outer membrane cobalamin receptor protein | |
| 955 | CAJPSO010000003.1 | GCA905373395_00541 | CDS | open | 134257-135747 | _na 496_aa | hypothetical protein | |
| 956 | CAJPSO010000003.1 | GCA905373395_00542 | CDS | open | 135870-135974 | _na 34_aa | IS982 family transposase | |
| 957 | CAJPSO010000003.1 | GCA905373395_00543 | CDS | open | 136370-137428 | _na 352_aa | Agmatine deiminase | |
| 958 | CAJPSO010000003.1 | GCA905373395_00544 | CDS | open | 137671-139032 | _na 453_aa | argE | dipeptidase |
| 959 | CAJPSO010000003.1 | GCA905373395_00546 | CDS | open | 139820-140656 | _na 278_aa | Antioxidant%2C AhpC/TSA family | |
| 960 | CAJPSO010000003.1 | GCA905373395_00547 | CDS | open | 140842-141534 | _na 230_aa | queuosine precursor transporter | |
| 961 | CAJPSO010000003.1 | GCA905373395_00548 | CDS | open | 141655-142110 | _na 151_aa | queF | preQ(1) synthase |
| 962 | CAJPSO010000003.1 | GCA905373395_00549 | CDS | open | 142432-143376 | _na 314_aa | Aldose 1-epimerase | |
| 963 | CAJPSO010000003.1 | GCA905373395_00550 | CDS | open | 143531-144433 | _na 300_aa | Lipoprotein | |
| 964 | CAJPSO010000003.1 | GCA905373395_00551 | CDS | open | 144612-146531 | _na 639_aa | Copper-exporting P-type ATPase A | |
| 965 | CAJPSO010000003.1 | GCA905373395_00552 | CDS | open | 146765-146977 | _na 70_aa | copZ | Copper chaperone CopZ |
| 966 | CAJPSO010000003.1 | GCA905373395_00553 | CDS | open | 147344-148810 | _na 488_aa | Divergent AAA domain protein | |
| 967 | CAJPSO010000003.1 | GCA905373395_00554 | CDS | open | 148905-149411 | _na 168_aa | putative HD superfamily hydrolase | |
| 968 | CAJPSO010000003.1 | GCA905373395_00555 | CDS | open | 150134-152167 | _na 677_aa | Peptidase family M13 | |
| 969 | CAJPSO010000003.1 | GCA905373395_00556 | CDS | open | 152250-154250 | _na 666_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 970 | CAJPSO010000003.1 | GCA905373395_00557 | CDS | open | 154415-155071 | _na 218_aa | DUF1266 domain-containing protein | |
| 971 | CAJPSO010000003.1 | GCA905373395_00558 | CDS | open | 155797-156282 | _na 161_aa | Ferritin | |
| 972 | CAJPSO010000003.1 | GCA905373395_00559 | CDS | open | 156431-157447 | _na 338_aa | ilvE | branched-chain amino acid aminotransferase |
| 973 | CAJPSO010000003.1 | GCA905373395_00560 | CDS | open | 157579-157767 | _na 62_aa | xseB | exodeoxyribonuclease VII small subunit |
| 974 | CAJPSO010000003.1 | GCA905373395_00561 | CDS | open | 157950-159254 | _na 434_aa | xseA | exodeoxyribonuclease VII large subunit |
| 975 | CAJPSO010000003.1 | GCA905373395_00562 | CDS | open | 159337-160761 | _na 474_aa | Subtilisin NAT | |
| 976 | CAJPSO010000003.1 | GCA905373395_00565 | CDS | open | 161493-161633 | _na 46_aa | hypothetical protein | |
| 977 | CAJPSO010000003.1 | GCA905373395_00566 | CDS | open | 161655-162668 | _na 337_aa | Acyltransferase family | |
| 978 | CAJPSO010000003.1 | GCA905373395_00567 | CDS | open | 162668-162811 | _na 47_aa | hypothetical protein | |
| 979 | CAJPSO010000003.1 | GCA905373395_00568 | CDS | open | 162789-163280 | _na 163_aa | DNA polymerase III polC-type | |
| 980 | CAJPSO010000003.1 | GCA905373395_00569 | CDS | open | 163458-164381 | _na 307_aa | K+-dependent Na+/Ca+ exchanger family protein | |
| 981 | CAJPSO010000003.1 | GCA905373395_00570 | CDS | open | 164378-164527 | _na 49_aa | Conserved domain protein | |
| 982 | CAJPSO010000003.1 | GCA905373395_00571 | CDS | open | 164528-165199 | _na 223_aa | ftrB | Transcriptional activator FtrB |
| 983 | CAJPSO010000003.1 | GCA905373395_00572 | CDS | open | 165324-165848 | _na 174_aa | Regulator of cell morphogenesis and NO signaling | |
| 984 | CAJPSO010000003.1 | GCA905373395_00573 | CDS | open | 165853-166191 | _na 112_aa | DUF488 domain-containing protein | |
| 985 | CAJPSO010000003.1 | GCA905373395_00574 | CDS | open | 166326-166733 | _na 135_aa | Hsp20/alpha crystallin family protein | |
| 986 | CAJPSO010000003.1 | GCA905373395_00575 | CDS | open | 167059-167889 | _na 276_aa | DUF4846 domain-containing protein | |
| 987 | CAJPSO010000003.1 | GCA905373395_00576 | CDS | open | 168204-168710 | _na 168_aa | DUF6852 domain-containing protein | |
| 988 | CAJPSO010000003.1 | GCA905373395_00577 | CDS | open | 168738-169301 | _na 187_aa | coaE | dephospho-CoA kinase |
| 989 | CAJPSO010000003.1 | GCA905373395_00578 | CDS | open | 169298-170308 | _na 336_aa | YbbR-like protein | |
| 990 | CAJPSO010000003.1 | GCA905373395_00579 | CDS | open | 170342-170671 | _na 109_aa | yajC | preprotein translocase subunit YajC |
| 991 | CAJPSO010000003.1 | GCA905373395_00580 | CDS | open | 170787-171866 | _na 359_aa | nusB | transcription antitermination factor NusB |
| 992 | CAJPSO010000003.1 | GCA905373395_00581 | CDS | open | 172131-172745 | _na 204_aa | 50S ribosomal protein L25/general stress protein Ctc | |
| 993 | CAJPSO010000003.1 | GCA905373395_00582 | CDS | open | 172776-173348 | _na 190_aa | pth | aminoacyl-tRNA hydrolase |
| 994 | CAJPSO010000003.1 | GCA905373395_00583 | CDS | open | 173382-173804 | _na 140_aa | hslR | RNA-binding S4 domain-containing protein |
| 995 | CAJPSO010000003.1 | GCA905373395_00584 | CDS | open | 174230-175684 | _na 484_aa | pepD2 | Peptidase M20 dimerisation domain-containing protein |
| 996 | CAJPSO010000003.1 | GCA905373395_00585 | CDS | open | 175755-176786 | _na 343_aa | Dolichol-P-glucose synthetase | |
| 997 | CAJPSO010000003.1 | GCA905373395_00586 | CDS | open | 176865-177689 | _na 274_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 998 | CAJPSO010000003.1 | GCA905373395_00587 | CDS | open | 177859-178344 | _na 161_aa | Free methionine-R-sulfoxide reductase | |
| 999 | CAJPSO010000003.1 | GCA905373395_00588 | CDS | open | 178413-178973 | _na 186_aa | frr | ribosome recycling factor |
| 1000 | CAJPSO010000003.1 | GCA905373395_00589 | CDS | open | 179055-180143 | _na 362_aa | rsgA | ribosome small subunit-dependent GTPase A |

