BAKTAGenome Explorer: Solobacterium moorei (GCA_905373405.1)
Select a Genome:
|
BAKTA Annotations for GCA_905373405.1
|
Search & Sort all 3887 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAJPSQ010000001.1 | regulatory_region | open | 121479-121677 | T-box leader | |||
| 2 | CAJPSQ010000001.1 | regulatory_region | open | 139678-139791 | FMN riboswitch aptamer (RFN element) | |||
| 3 | CAJPSQ010000001.1 | regulatory_region | open | 156564-156755 | T-box leader | |||
| 4 | CAJPSQ010000001.1 | repeat_region | open | 42314-46121 | CRISPR array with 58 repeats of length 36%2C consensus sequence GTTCTGCTACCATCGAAATTTTTGCTAGACTACAAC and spacer length 30 | |||
| 5 | CAJPSQ010000001.1 | GCA905373405_00001 | CDS | open | 32-127 | _na 31_aa | hypothetical protein | |
| 6 | CAJPSQ010000001.1 | GCA905373405_00002 | CDS | open | 312-1361 | _na 349_aa | Lipoprotein | |
| 7 | CAJPSQ010000001.1 | GCA905373405_00003 | CDS | open | 1557-3500 | _na 647_aa | HTH domain protein | |
| 8 | CAJPSQ010000001.1 | GCA905373405_00004 | CDS | open | 3511-3948 | _na 145_aa | Ascorbate-specific PTS system EIIA component | |
| 9 | CAJPSQ010000001.1 | GCA905373405_00005 | CDS | open | 3967-4254 | _na 95_aa | Phosphotransferase system EIIB component type 2/3 domain-containing protein | |
| 10 | CAJPSQ010000001.1 | GCA905373405_00006 | CDS | open | 4281-5549 | _na 422_aa | Ascorbate-specific PTS system EIIC component | |
| 11 | CAJPSQ010000001.1 | GCA905373405_00007 | CDS | open | 5567-6307 | _na 246_aa | SIS domain-containing protein | |
| 12 | CAJPSQ010000001.1 | GCA905373405_00008 | CDS | open | 6514-6876 | _na 120_aa | hicB | toxin-antitoxin system HicB family antitoxin |
| 13 | CAJPSQ010000001.1 | GCA905373405_00009 | CDS | open | 6914-8548 | _na 544_aa | lysS | lysine--tRNA ligase |
| 14 | CAJPSQ010000001.1 | GCA905373405_00010 | CDS | open | 8817-10175 | _na 452_aa | Putative permease | |
| 15 | CAJPSQ010000001.1 | GCA905373405_00011 | CDS | open | 10310-11038 | _na 242_aa | phosphoserine phosphatase | |
| 16 | CAJPSQ010000001.1 | GCA905373405_00012 | CDS | open | 11051-11632 | _na 193_aa | Hydrolase%2C NUDIX family | |
| 17 | CAJPSQ010000001.1 | GCA905373405_00013 | CDS | open | 11622-12497 | _na 291_aa | Acetyltransferase%2C GNAT family | |
| 18 | CAJPSQ010000001.1 | GCA905373405_00014 | CDS | open | 12519-13925 | _na 468_aa | Penicillin-binding protein transpeptidase domain-containing protein | |
| 19 | CAJPSQ010000001.1 | GCA905373405_00015 | CDS | open | 13876-15306 | _na 476_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 20 | CAJPSQ010000001.1 | GCA905373405_00016 | CDS | open | 15383-15487 | _na 34_aa | hypothetical protein | |
| 21 | CAJPSQ010000001.1 | GCA905373405_00017 | CDS | open | 15465-16475 | _na 336_aa | Aldose 1-epimerase | |
| 22 | CAJPSQ010000001.1 | GCA905373405_00018 | CDS | open | 16521-18044 | _na 507_aa | Sucrose-6-phosphate hydrolase | |
| 23 | CAJPSQ010000001.1 | GCA905373405_00019 | CDS | open | 18149-19162 | _na 337_aa | hypothetical protein | |
| 24 | CAJPSQ010000001.1 | GCA905373405_00020 | CDS | open | 19205-20473 | _na 422_aa | 2-hydroxyglutaryl-CoA dehydratase | |
| 25 | CAJPSQ010000001.1 | GCA905373405_00021 | CDS | open | 20473-23394 | _na 973_aa | 2-hydroxyacyl-CoA dehydratase | |
| 26 | CAJPSQ010000001.1 | GCA905373405_00022 | CDS | open | 23586-25019 | _na 477_aa | TldD/PmbA family protein | |
| 27 | CAJPSQ010000001.1 | GCA905373405_00023 | CDS | open | 25019-26299 | _na 426_aa | TldD/PmbA family protein | |
| 28 | CAJPSQ010000001.1 | GCA905373405_00024 | CDS | open | 26436-27962 | _na 508_aa | PAS domain-containing protein | |
| 29 | CAJPSQ010000001.1 | GCA905373405_00025 | CDS | open | 28129-29625 | _na 498_aa | Metal-dependent carboxypeptidase | |
| 30 | CAJPSQ010000001.1 | GCA905373405_00026 | CDS | open | 29622-30191 | _na 189_aa | xanthine phosphoribosyltransferase | |
| 31 | CAJPSQ010000001.1 | GCA905373405_00027 | CDS | open | 30227-31396 | _na 389_aa | Alcohol dehydrogenase%2C iron-dependent | |
| 32 | CAJPSQ010000001.1 | GCA905373405_00028 | CDS | open | 31678-31890 | _na 70_aa | hypothetical protein | |
| 33 | CAJPSQ010000001.1 | GCA905373405_00029 | CDS | open | 31988-32701 | _na 237_aa | Response regulator receiver domain protein | |
| 34 | CAJPSQ010000001.1 | GCA905373405_00030 | CDS | open | 32706-33617 | _na 303_aa | histidine kinase | |
| 35 | CAJPSQ010000001.1 | GCA905373405_00031 | CDS | open | 33705-34466 | _na 253_aa | Putative bacteriocin export ABC transporter%2C lactococcin 972 group | |
| 36 | CAJPSQ010000001.1 | GCA905373405_00032 | CDS | open | 34466-36445 | _na 659_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 37 | CAJPSQ010000001.1 | GCA905373405_00033 | CDS | open | 36892-38673 | _na 593_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 38 | CAJPSQ010000001.1 | GCA905373405_00034 | CDS | open | 38760-40109 | _na 449_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 39 | CAJPSQ010000001.1 | GCA905373405_00035 | CDS | open | 40216-41115 | _na 299_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 40 | CAJPSQ010000001.1 | GCA905373405_00036 | CDS | open | 41066-41428 | _na 120_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 41 | CAJPSQ010000001.1 | GCA905373405_00037 | CDS | open | 41425-42276 | _na 283_aa | hypothetical protein | |
| 42 | CAJPSQ010000001.1 | GCA905373405_00038 | CDS | open | 46335-47246 | _na 303_aa | degV | EDD domain protein%2C DegV family |
| 43 | CAJPSQ010000001.1 | GCA905373405_00039 | CDS | open | 47447-47659 | _na 70_aa | feoA | FeoA domain protein |
| 44 | CAJPSQ010000001.1 | GCA905373405_00040 | CDS | open | 47670-47891 | _na 73_aa | feoA | FeoA domain protein |
| 45 | CAJPSQ010000001.1 | GCA905373405_00041 | CDS | open | 47919-50363 | _na 814_aa | feoB | ferrous iron transport protein B |
| 46 | CAJPSQ010000001.1 | GCA905373405_00042 | CDS | open | 50420-50662 | _na 80_aa | HTH dtxR-type domain-containing protein | |
| 47 | CAJPSQ010000001.1 | GCA905373405_00043 | CDS | open | 50685-51065 | _na 126_aa | Heavy metal-associated domain protein | |
| 48 | CAJPSQ010000001.1 | GCA905373405_00044 | CDS | open | 51110-52342 | _na 410_aa | hypothetical protein | |
| 49 | CAJPSQ010000001.1 | GCA905373405_00045 | CDS | open | 52329-52535 | _na 68_aa | HTH cro/C1-type domain-containing protein | |
| 50 | CAJPSQ010000001.1 | GCA905373405_00046 | CDS | open | 52544-53017 | _na 157_aa | DUF2975 domain-containing protein | |
| 51 | CAJPSQ010000001.1 | GCA905373405_00047 | CDS | open | 53170-53532 | _na 120_aa | gntR | Transcriptional regulator%2C GntR family |
| 52 | CAJPSQ010000001.1 | GCA905373405_00048 | CDS | open | 53532-54230 | _na 232_aa | ABC transporter%2C ATP-binding protein | |
| 53 | CAJPSQ010000001.1 | GCA905373405_00049 | CDS | open | 54224-55036 | _na 270_aa | ABC transporter permease | |
| 54 | CAJPSQ010000001.1 | GCA905373405_00050 | CDS | open | 55043-55333 | _na 96_aa | Stress responsive A/B barrel domain protein | |
| 55 | CAJPSQ010000001.1 | GCA905373405_00051 | CDS | open | 55431-55934 | _na 167_aa | Ferritin | |
| 56 | CAJPSQ010000001.1 | GCA905373405_00052 | CDS | open | 55957-56331 | _na 124_aa | Desulfoferrodoxin | |
| 57 | CAJPSQ010000001.1 | GCA905373405_00053 | CDS | open | 56423-57313 | _na 296_aa | Lipid kinase%2C YegS/Rv2252/BmrU family | |
| 58 | CAJPSQ010000001.1 | GCA905373405_00054 | CDS | open | 57310-57738 | _na 142_aa | TM2 domain protein | |
| 59 | CAJPSQ010000001.1 | GCA905373405_00055 | CDS | open | 57812-58687 | _na 291_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 60 | CAJPSQ010000001.1 | GCA905373405_00056 | CDS | open | 58756-59109 | _na 117_aa | rinA | Phage transcriptional regulator%2C RinA family |
| 61 | CAJPSQ010000001.1 | GCA905373405_00057 | CDS | open | 59148-59558 | _na 136_aa | Zn-finger containing protein | |
| 62 | CAJPSQ010000001.1 | GCA905373405_00058 | CDS | open | 59634-60968 | _na 444_aa | Aminopeptidase | |
| 63 | CAJPSQ010000001.1 | GCA905373405_00059 | CDS | open | 61087-61989 | _na 300_aa | ROK family protein | |
| 64 | CAJPSQ010000001.1 | GCA905373405_00060 | CDS | open | 62002-63480 | _na 492_aa | DUF2779 domain-containing protein | |
| 65 | CAJPSQ010000001.1 | GCA905373405_00061 | CDS | open | 63638-64165 | _na 175_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 66 | CAJPSQ010000001.1 | GCA905373405_00062 | CDS | open | 64325-64648 | _na 107_aa | hypothetical protein | |
| 67 | CAJPSQ010000001.1 | GCA905373405_00063 | CDS | open | 64791-66497 | _na 568_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 68 | CAJPSQ010000001.1 | GCA905373405_00064 | CDS | open | 66567-67292 | _na 241_aa | Putative diadenosine tetraphosphatase | |
| 69 | CAJPSQ010000001.1 | GCA905373405_00065 | CDS | open | 67439-68167 | _na 242_aa | putative transcriptional regulatory protein HMPREF9430_00563 | |
| 70 | CAJPSQ010000001.1 | GCA905373405_00066 | CDS | open | 68246-68911 | _na 221_aa | Response regulator receiver domain protein | |
| 71 | CAJPSQ010000001.1 | GCA905373405_00067 | CDS | open | 68913-69914 | _na 333_aa | histidine kinase | |
| 72 | CAJPSQ010000001.1 | GCA905373405_00068 | CDS | open | 70005-70691 | _na 228_aa | ABC transporter%2C ATP-binding protein | |
| 73 | CAJPSQ010000001.1 | GCA905373405_00069 | CDS | open | 70694-73408 | _na 904_aa | Efflux ABC transporter%2C permease protein | |
| 74 | CAJPSQ010000001.1 | GCA905373405_00070 | CDS | open | 73467-74588 | _na 373_aa | tRNA(Met) cytidine acetate ligase | |
| 75 | CAJPSQ010000001.1 | GCA905373405_00071 | CDS | open | 74656-75525 | _na 289_aa | Serine aminopeptidase S33 domain-containing protein | |
| 76 | CAJPSQ010000001.1 | GCA905373405_00072 | CDS | open | 75678-76181 | _na 167_aa | DUF177 domain-containing protein | |
| 77 | CAJPSQ010000001.1 | GCA905373405_00073 | CDS | open | 76198-76356 | _na 52_aa | rpmF | 50S ribosomal protein L32 |
| 78 | CAJPSQ010000001.1 | GCA905373405_00074 | CDS | open | 76447-77664 | _na 405_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 79 | CAJPSQ010000001.1 | GCA905373405_00075 | CDS | open | 77733-78773 | _na 346_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 80 | CAJPSQ010000001.1 | GCA905373405_00076 | CDS | open | 78776-79525 | _na 249_aa | Stp1/IreP family PP2C-type Ser/Thr phosphatase | |
| 81 | CAJPSQ010000001.1 | GCA905373405_00077 | CDS | open | 79522-81198 | _na 558_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 82 | CAJPSQ010000001.1 | GCA905373405_00078 | CDS | open | 81208-82071 | _na 287_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 83 | CAJPSQ010000001.1 | GCA905373405_00079 | CDS | open | 82068-82721 | _na 217_aa | rpe | ribulose-phosphate 3-epimerase |
| 84 | CAJPSQ010000001.1 | GCA905373405_00080 | CDS | open | 82706-83314 | _na 202_aa | thiamine diphosphokinase | |
| 85 | CAJPSQ010000001.1 | GCA905373405_00081 | CDS | open | 83356-83559 | _na 67_aa | rpmB | 50S ribosomal protein L28 |
| 86 | CAJPSQ010000001.1 | GCA905373405_00082 | CDS | open | 83786-85048 | _na 420_aa | ftsA | Cell division protein FtsA |
| 87 | CAJPSQ010000001.1 | GCA905373405_00083 | CDS | open | 85067-86149 | _na 360_aa | ftsZ | cell division protein FtsZ |
| 88 | CAJPSQ010000001.1 | GCA905373405_00084 | CDS | open | 86206-86658 | _na 150_aa | Hydrolase%2C NUDIX family | |
| 89 | CAJPSQ010000001.1 | GCA905373405_00085 | CDS | open | 86775-86996 | _na 73_aa | hypA | Hydrogenase maturation nickel metallochaperone HypA |
| 90 | CAJPSQ010000001.1 | GCA905373405_00086 | CDS | open | 87154-88419 | _na 421_aa | CBS domain protein | |
| 91 | CAJPSQ010000001.1 | GCA905373405_00087 | CDS | open | 88450-89181 | _na 243_aa | Ribosomal RNA small subunit methyltransferase E | |
| 92 | CAJPSQ010000001.1 | GCA905373405_00088 | CDS | open | 89197-90666 | _na 489_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 93 | CAJPSQ010000001.1 | GCA905373405_00089 | CDS | open | 90653-91294 | _na 213_aa | deoC | deoxyribose-phosphate aldolase |
| 94 | CAJPSQ010000001.1 | GCA905373405_00090 | CDS | open | 91484-91666 | _na 60_aa | rpsU | 30S ribosomal protein S21 |
| 95 | CAJPSQ010000001.1 | GCA905373405_00091 | CDS | open | 91793-92668 | _na 291_aa | MBL fold metallo-hydrolase | |
| 96 | CAJPSQ010000001.1 | GCA905373405_00092 | CDS | open | 92690-93307 | _na 205_aa | Bacteriocin transport accessory protein | |
| 97 | CAJPSQ010000001.1 | GCA905373405_00093 | CDS | open | 93418-94413 | _na 331_aa | PhoH-like protein | |
| 98 | CAJPSQ010000001.1 | GCA905373405_00094 | CDS | open | 94415-94873 | _na 152_aa | ybeY | rRNA maturation RNase YbeY |
| 99 | CAJPSQ010000001.1 | GCA905373405_00095 | CDS | open | 94863-95198 | _na 111_aa | Prokaryotic diacylglycerol kinase | |
| 100 | CAJPSQ010000001.1 | GCA905373405_00096 | CDS | open | 95210-95611 | _na 133_aa | cdd | cytidine deaminase |
| 101 | CAJPSQ010000001.1 | GCA905373405_00097 | CDS | open | 95608-96501 | _na 297_aa | era | GTPase Era |
| 102 | CAJPSQ010000001.1 | GCA905373405_00098 | CDS | open | 96470-97246 | _na 258_aa | recO | DNA repair protein RecO |
| 103 | CAJPSQ010000001.1 | GCA905373405_00099 | CDS | open | 98008-99387 | _na 459_aa | glycine--tRNA ligase | |
| 104 | CAJPSQ010000001.1 | GCA905373405_00100 | CDS | open | 99400-101163 | _na 587_aa | DNA primase | |
| 105 | CAJPSQ010000001.1 | GCA905373405_00101 | CDS | open | 101141-102547 | _na 468_aa | sigA | RNA polymerase sigma factor SigA |
| 106 | CAJPSQ010000001.1 | GCA905373405_00102 | CDS | open | 102549-103208 | _na 219_aa | SAM-dependent methyltransferase | |
| 107 | CAJPSQ010000001.1 | GCA905373405_00103 | CDS | open | 103236-103502 | _na 88_aa | rpsT | 30S ribosomal protein S20 |
| 108 | CAJPSQ010000001.1 | GCA905373405_00104 | CDS | open | 103614-104552 | _na 312_aa | fmt | methionyl-tRNA formyltransferase |
| 109 | CAJPSQ010000001.1 | GCA905373405_00105 | CDS | open | 104553-106358 | _na 601_aa | lepA | translation elongation factor 4 |
| 110 | CAJPSQ010000001.1 | GCA905373405_00106 | CDS | open | 106348-107445 | _na 365_aa | hemW | radical SAM family heme chaperone HemW |
| 111 | CAJPSQ010000001.1 | GCA905373405_00107 | CDS | open | 107578-107844 | _na 88_aa | rpsO | 30S ribosomal protein S15 |
| 112 | CAJPSQ010000001.1 | GCA905373405_00108 | CDS | open | 107918-108619 | _na 233_aa | ABC transporter%2C ATP-binding protein | |
| 113 | CAJPSQ010000001.1 | GCA905373405_00109 | CDS | open | 108619-112062 | _na 1147_aa | ABC transporter permease | |
| 114 | CAJPSQ010000001.1 | GCA905373405_00110 | CDS | open | 112062-112727 | _na 221_aa | GIY-YIG domain-containing protein | |
| 115 | CAJPSQ010000001.1 | GCA905373405_00111 | CDS | open | 112818-115040 | _na 740_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 116 | CAJPSQ010000001.1 | GCA905373405_00112 | CDS | open | 115088-115741 | _na 217_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 117 | CAJPSQ010000001.1 | GCA905373405_00113 | CDS | open | 115773-116447 | _na 224_aa | GerMN domain-containing protein | |
| 118 | CAJPSQ010000001.1 | GCA905373405_00114 | CDS | open | 116549-117391 | _na 280_aa | Internalin | |
| 119 | CAJPSQ010000001.1 | GCA905373405_00115 | CDS | open | 117464-118843 | _na 459_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 120 | CAJPSQ010000001.1 | GCA905373405_00116 | CDS | open | 118887-119246 | _na 119_aa | hypothetical protein | |
| 121 | CAJPSQ010000001.1 | GCA905373405_00117 | CDS | open | 119399-119788 | _na 129_aa | DUF948 domain-containing protein | |
| 122 | CAJPSQ010000001.1 | GCA905373405_00118 | CDS | open | 119781-120467 | _na 228_aa | ytxH | YtxH domain-containing protein |
| 123 | CAJPSQ010000001.1 | GCA905373405_00119 | CDS | open | 120478-121482 | _na 334_aa | lacI | Transcriptional regulator%2C LacI family |
| 124 | CAJPSQ010000001.1 | GCA905373405_00120 | CDS | open | 121721-122968 | _na 415_aa | tyrS | tyrosine--tRNA ligase |
| 125 | CAJPSQ010000001.1 | GCA905373405_00121 | CDS | open | 123041-123544 | _na 167_aa | Lipoprotein | |
| 126 | CAJPSQ010000001.1 | GCA905373405_00122 | CDS | open | 123559-125202 | _na 547_aa | Polysaccharide biosynthesis protein | |
| 127 | CAJPSQ010000001.1 | GCA905373405_00123 | CDS | open | 125203-125904 | _na 233_aa | Pseudouridine synthase | |
| 128 | CAJPSQ010000001.1 | GCA905373405_00124 | CDS | open | 125885-126796 | _na 303_aa | ispH | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase |
| 129 | CAJPSQ010000001.1 | GCA905373405_00125 | CDS | open | 126853-128220 | _na 455_aa | ATP-dependent helicase | |
| 130 | CAJPSQ010000001.1 | GCA905373405_00126 | CDS | open | 128345-128620 | _na 91_aa | HTH arsR-type domain-containing protein | |
| 131 | CAJPSQ010000001.1 | GCA905373405_00127 | CDS | open | 128610-129257 | _na 215_aa | DUF1648 domain-containing protein | |
| 132 | CAJPSQ010000001.1 | GCA905373405_00129 | CDS | open | 129557-131428 | _na 623_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 133 | CAJPSQ010000001.1 | GCA905373405_00130 | CDS | open | 131466-132095 | _na 209_aa | PAP2 family protein | |
| 134 | CAJPSQ010000001.1 | GCA905373405_00131 | CDS | open | 132111-133184 | _na 357_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 135 | CAJPSQ010000001.1 | GCA905373405_00132 | CDS | open | 133280-133480 | _na 66_aa | Large ribosomal subunit protein bL33B | |
| 136 | CAJPSQ010000001.1 | GCA905373405_00133 | CDS | open | 133510-134115 | _na 201_aa | Metallo-beta-lactamase domain protein | |
| 137 | CAJPSQ010000001.1 | GCA905373405_00134 | CDS | open | 134173-134916 | _na 247_aa | Lipoprotein | |
| 138 | CAJPSQ010000001.1 | GCA905373405_00135 | CDS | open | 134988-135971 | _na 327_aa | tadA | Flp pilus assembly complex ATPase component TadA |
| 139 | CAJPSQ010000001.1 | GCA905373405_00136 | CDS | open | 136003-136938 | _na 311_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 140 | CAJPSQ010000001.1 | GCA905373405_00137 | CDS | open | 136954-137250 | _na 98_aa | comGC | competence type IV pilus major pilin ComGC |
| 141 | CAJPSQ010000001.1 | GCA905373405_00138 | CDS | open | 137228-137536 | _na 102_aa | Prepilin-type cleavage/methylation N-terminal domain protein | |
| 142 | CAJPSQ010000001.1 | GCA905373405_00139 | CDS | open | 137511-137756 | _na 81_aa | Type II secretion system protein | |
| 143 | CAJPSQ010000001.1 | GCA905373405_00140 | CDS | open | 137717-138109 | _na 130_aa | Type II secretion system protein | |
| 144 | CAJPSQ010000001.1 | GCA905373405_00141 | CDS | open | 138078-138413 | _na 111_aa | Septum formation initiator | |
| 145 | CAJPSQ010000001.1 | GCA905373405_00142 | CDS | open | 138500-139615 | _na 371_aa | Yip1 domain-containing protein | |
| 146 | CAJPSQ010000001.1 | GCA905373405_00143 | CDS | open | 139866-140468 | _na 200_aa | Riboflavin transporter | |
| 147 | CAJPSQ010000001.1 | GCA905373405_00144 | CDS | open | 140597-141760 | _na 387_aa | hypothetical protein | |
| 148 | CAJPSQ010000001.1 | GCA905373405_00145 | CDS | open | 141762-142436 | _na 224_aa | cmk | (d)CMP kinase |
| 149 | CAJPSQ010000001.1 | GCA905373405_00146 | CDS | open | 142436-143749 | _na 437_aa | der | ribosome biogenesis GTPase Der |
| 150 | CAJPSQ010000001.1 | GCA905373405_00147 | CDS | open | 143746-144735 | _na 329_aa | Glycerol-3-phosphate dehydrogenase [NAD(P)+] | |
| 151 | CAJPSQ010000001.1 | GCA905373405_00148 | CDS | open | 144809-147403 | _na 864_aa | peptidoglycan glycosyltransferase | |
| 152 | CAJPSQ010000001.1 | GCA905373405_00149 | CDS | open | 147418-148266 | _na 282_aa | degV | EDD domain protein%2C DegV family |
| 153 | CAJPSQ010000001.1 | GCA905373405_00150 | CDS | open | 148290-151469 | _na 1059_aa | DNA-directed DNA polymerase | |
| 154 | CAJPSQ010000001.1 | GCA905373405_00151 | CDS | open | 151471-152139 | _na 222_aa | Response regulator receiver domain protein | |
| 155 | CAJPSQ010000001.1 | GCA905373405_00152 | CDS | open | 152090-153571 | _na 493_aa | histidine kinase | |
| 156 | CAJPSQ010000001.1 | GCA905373405_00153 | CDS | open | 153561-154235 | _na 224_aa | Methyltransferase domain protein | |
| 157 | CAJPSQ010000001.1 | GCA905373405_00154 | CDS | open | 154283-155326 | _na 347_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 158 | CAJPSQ010000001.1 | GCA905373405_00155 | CDS | open | 155392-156159 | _na 255_aa | HAD family hydrolase | |
| 159 | CAJPSQ010000001.1 | GCA905373405_00156 | CDS | open | 156181-156528 | _na 115_aa | Dinitrogenase iron-molybdenum cofactor | |
| 160 | CAJPSQ010000001.1 | GCA905373405_00157 | CDS | open | 156791-159190 | _na 799_aa | leuS | leucine--tRNA ligase |
| 161 | CAJPSQ010000001.1 | GCA905373405_00158 | CDS | open | 159272-160033 | _na 253_aa | Segregation and condensation protein A | |
| 162 | CAJPSQ010000001.1 | GCA905373405_00159 | CDS | open | 160026-160679 | _na 217_aa | scpB | SMC-Scp complex subunit ScpB |
| 163 | CAJPSQ010000001.1 | GCA905373405_00160 | CDS | open | 160700-161185 | _na 161_aa | DUF4358 domain-containing protein | |
| 164 | CAJPSQ010000001.1 | GCA905373405_00161 | CDS | open | 161223-162518 | _na 431_aa | purB | adenylosuccinate lyase |
| 165 | CAJPSQ010000001.1 | GCA905373405_00001 | gene | open | 32-127 | |||
| 166 | CAJPSQ010000001.1 | GCA905373405_00002 | gene | open | 312-1361 | |||
| 167 | CAJPSQ010000001.1 | GCA905373405_00003 | gene | open | 1557-3500 | |||
| 168 | CAJPSQ010000001.1 | GCA905373405_00004 | gene | open | 3511-3948 | |||
| 169 | CAJPSQ010000001.1 | GCA905373405_00005 | gene | open | 3967-4254 | |||
| 170 | CAJPSQ010000001.1 | GCA905373405_00006 | gene | open | 4281-5549 | |||
| 171 | CAJPSQ010000001.1 | GCA905373405_00007 | gene | open | 5567-6307 | |||
| 172 | CAJPSQ010000001.1 | GCA905373405_00008 | gene | open | 6514-6876 | hicB | ||
| 173 | CAJPSQ010000001.1 | GCA905373405_00009 | gene | open | 6914-8548 | lysS | ||
| 174 | CAJPSQ010000001.1 | GCA905373405_00010 | gene | open | 8817-10175 | |||
| 175 | CAJPSQ010000001.1 | GCA905373405_00011 | gene | open | 10310-11038 | |||
| 176 | CAJPSQ010000001.1 | GCA905373405_00012 | gene | open | 11051-11632 | |||
| 177 | CAJPSQ010000001.1 | GCA905373405_00013 | gene | open | 11622-12497 | |||
| 178 | CAJPSQ010000001.1 | GCA905373405_00014 | gene | open | 12519-13925 | |||
| 179 | CAJPSQ010000001.1 | GCA905373405_00015 | gene | open | 13876-15306 | ftsW | ||
| 180 | CAJPSQ010000001.1 | GCA905373405_00016 | gene | open | 15383-15487 | |||
| 181 | CAJPSQ010000001.1 | GCA905373405_00017 | gene | open | 15465-16475 | |||
| 182 | CAJPSQ010000001.1 | GCA905373405_00018 | gene | open | 16521-18044 | |||
| 183 | CAJPSQ010000001.1 | GCA905373405_00019 | gene | open | 18149-19162 | |||
| 184 | CAJPSQ010000001.1 | GCA905373405_00020 | gene | open | 19205-20473 | |||
| 185 | CAJPSQ010000001.1 | GCA905373405_00021 | gene | open | 20473-23394 | |||
| 186 | CAJPSQ010000001.1 | GCA905373405_00022 | gene | open | 23586-25019 | |||
| 187 | CAJPSQ010000001.1 | GCA905373405_00023 | gene | open | 25019-26299 | |||
| 188 | CAJPSQ010000001.1 | GCA905373405_00024 | gene | open | 26436-27962 | |||
| 189 | CAJPSQ010000001.1 | GCA905373405_00025 | gene | open | 28129-29625 | |||
| 190 | CAJPSQ010000001.1 | GCA905373405_00026 | gene | open | 29622-30191 | |||
| 191 | CAJPSQ010000001.1 | GCA905373405_00027 | gene | open | 30227-31396 | |||
| 192 | CAJPSQ010000001.1 | GCA905373405_00028 | gene | open | 31678-31890 | |||
| 193 | CAJPSQ010000001.1 | GCA905373405_00029 | gene | open | 31988-32701 | |||
| 194 | CAJPSQ010000001.1 | GCA905373405_00030 | gene | open | 32706-33617 | |||
| 195 | CAJPSQ010000001.1 | GCA905373405_00031 | gene | open | 33705-34466 | |||
| 196 | CAJPSQ010000001.1 | GCA905373405_00032 | gene | open | 34466-36445 | |||
| 197 | CAJPSQ010000001.1 | GCA905373405_00033 | gene | open | 36892-38673 | cas9 | ||
| 198 | CAJPSQ010000001.1 | GCA905373405_00034 | gene | open | 38760-40109 | cas9 | ||
| 199 | CAJPSQ010000001.1 | GCA905373405_00035 | gene | open | 40216-41115 | cas1 | ||
| 200 | CAJPSQ010000001.1 | GCA905373405_00036 | gene | open | 41066-41428 | cas2 | ||
| 201 | CAJPSQ010000001.1 | GCA905373405_00037 | gene | open | 41425-42276 | |||
| 202 | CAJPSQ010000001.1 | GCA905373405_00038 | gene | open | 46335-47246 | degV | ||
| 203 | CAJPSQ010000001.1 | GCA905373405_00039 | gene | open | 47447-47659 | feoA | ||
| 204 | CAJPSQ010000001.1 | GCA905373405_00040 | gene | open | 47670-47891 | feoA | ||
| 205 | CAJPSQ010000001.1 | GCA905373405_00041 | gene | open | 47919-50363 | feoB | ||
| 206 | CAJPSQ010000001.1 | GCA905373405_00042 | gene | open | 50420-50662 | |||
| 207 | CAJPSQ010000001.1 | GCA905373405_00043 | gene | open | 50685-51065 | |||
| 208 | CAJPSQ010000001.1 | GCA905373405_00044 | gene | open | 51110-52342 | |||
| 209 | CAJPSQ010000001.1 | GCA905373405_00045 | gene | open | 52329-52535 | |||
| 210 | CAJPSQ010000001.1 | GCA905373405_00046 | gene | open | 52544-53017 | |||
| 211 | CAJPSQ010000001.1 | GCA905373405_00047 | gene | open | 53170-53532 | gntR | ||
| 212 | CAJPSQ010000001.1 | GCA905373405_00048 | gene | open | 53532-54230 | |||
| 213 | CAJPSQ010000001.1 | GCA905373405_00049 | gene | open | 54224-55036 | |||
| 214 | CAJPSQ010000001.1 | GCA905373405_00050 | gene | open | 55043-55333 | |||
| 215 | CAJPSQ010000001.1 | GCA905373405_00051 | gene | open | 55431-55934 | |||
| 216 | CAJPSQ010000001.1 | GCA905373405_00052 | gene | open | 55957-56331 | |||
| 217 | CAJPSQ010000001.1 | GCA905373405_00053 | gene | open | 56423-57313 | |||
| 218 | CAJPSQ010000001.1 | GCA905373405_00054 | gene | open | 57310-57738 | |||
| 219 | CAJPSQ010000001.1 | GCA905373405_00055 | gene | open | 57812-58687 | |||
| 220 | CAJPSQ010000001.1 | GCA905373405_00056 | gene | open | 58756-59109 | rinA | ||
| 221 | CAJPSQ010000001.1 | GCA905373405_00057 | gene | open | 59148-59558 | |||
| 222 | CAJPSQ010000001.1 | GCA905373405_00058 | gene | open | 59634-60968 | |||
| 223 | CAJPSQ010000001.1 | GCA905373405_00059 | gene | open | 61087-61989 | |||
| 224 | CAJPSQ010000001.1 | GCA905373405_00060 | gene | open | 62002-63480 | |||
| 225 | CAJPSQ010000001.1 | GCA905373405_00061 | gene | open | 63638-64165 | hpf | ||
| 226 | CAJPSQ010000001.1 | GCA905373405_00062 | gene | open | 64325-64648 | |||
| 227 | CAJPSQ010000001.1 | GCA905373405_00063 | gene | open | 64791-66497 | |||
| 228 | CAJPSQ010000001.1 | GCA905373405_00064 | gene | open | 66567-67292 | |||
| 229 | CAJPSQ010000001.1 | GCA905373405_00065 | gene | open | 67439-68167 | |||
| 230 | CAJPSQ010000001.1 | GCA905373405_00066 | gene | open | 68246-68911 | |||
| 231 | CAJPSQ010000001.1 | GCA905373405_00067 | gene | open | 68913-69914 | |||
| 232 | CAJPSQ010000001.1 | GCA905373405_00068 | gene | open | 70005-70691 | |||
| 233 | CAJPSQ010000001.1 | GCA905373405_00069 | gene | open | 70694-73408 | |||
| 234 | CAJPSQ010000001.1 | GCA905373405_00070 | gene | open | 73467-74588 | |||
| 235 | CAJPSQ010000001.1 | GCA905373405_00071 | gene | open | 74656-75525 | |||
| 236 | CAJPSQ010000001.1 | GCA905373405_00072 | gene | open | 75678-76181 | |||
| 237 | CAJPSQ010000001.1 | GCA905373405_00073 | gene | open | 76198-76356 | rpmF | ||
| 238 | CAJPSQ010000001.1 | GCA905373405_00074 | gene | open | 76447-77664 | rsmB | ||
| 239 | CAJPSQ010000001.1 | GCA905373405_00075 | gene | open | 77733-78773 | rlmN | ||
| 240 | CAJPSQ010000001.1 | GCA905373405_00076 | gene | open | 78776-79525 | |||
| 241 | CAJPSQ010000001.1 | GCA905373405_00077 | gene | open | 79522-81198 | pknB | ||
| 242 | CAJPSQ010000001.1 | GCA905373405_00078 | gene | open | 81208-82071 | rsgA | ||
| 243 | CAJPSQ010000001.1 | GCA905373405_00079 | gene | open | 82068-82721 | rpe | ||
| 244 | CAJPSQ010000001.1 | GCA905373405_00080 | gene | open | 82706-83314 | |||
| 245 | CAJPSQ010000001.1 | GCA905373405_00081 | gene | open | 83356-83559 | rpmB | ||
| 246 | CAJPSQ010000001.1 | GCA905373405_00082 | gene | open | 83786-85048 | ftsA | ||
| 247 | CAJPSQ010000001.1 | GCA905373405_00083 | gene | open | 85067-86149 | ftsZ | ||
| 248 | CAJPSQ010000001.1 | GCA905373405_00084 | gene | open | 86206-86658 | |||
| 249 | CAJPSQ010000001.1 | GCA905373405_00085 | gene | open | 86775-86996 | hypA | ||
| 250 | CAJPSQ010000001.1 | GCA905373405_00086 | gene | open | 87154-88419 | |||
| 251 | CAJPSQ010000001.1 | GCA905373405_00087 | gene | open | 88450-89181 | |||
| 252 | CAJPSQ010000001.1 | GCA905373405_00088 | gene | open | 89197-90666 | |||
| 253 | CAJPSQ010000001.1 | GCA905373405_00089 | gene | open | 90653-91294 | deoC | ||
| 254 | CAJPSQ010000001.1 | GCA905373405_00090 | gene | open | 91484-91666 | rpsU | ||
| 255 | CAJPSQ010000001.1 | GCA905373405_00091 | gene | open | 91793-92668 | |||
| 256 | CAJPSQ010000001.1 | GCA905373405_00092 | gene | open | 92690-93307 | |||
| 257 | CAJPSQ010000001.1 | GCA905373405_00093 | gene | open | 93418-94413 | |||
| 258 | CAJPSQ010000001.1 | GCA905373405_00094 | gene | open | 94415-94873 | ybeY | ||
| 259 | CAJPSQ010000001.1 | GCA905373405_00095 | gene | open | 94863-95198 | |||
| 260 | CAJPSQ010000001.1 | GCA905373405_00096 | gene | open | 95210-95611 | cdd | ||
| 261 | CAJPSQ010000001.1 | GCA905373405_00097 | gene | open | 95608-96501 | era | ||
| 262 | CAJPSQ010000001.1 | GCA905373405_00098 | gene | open | 96470-97246 | recO | ||
| 263 | CAJPSQ010000001.1 | GCA905373405_00099 | gene | open | 98008-99387 | |||
| 264 | CAJPSQ010000001.1 | GCA905373405_00100 | gene | open | 99400-101163 | |||
| 265 | CAJPSQ010000001.1 | GCA905373405_00101 | gene | open | 101141-102547 | sigA | ||
| 266 | CAJPSQ010000001.1 | GCA905373405_00102 | gene | open | 102549-103208 | |||
| 267 | CAJPSQ010000001.1 | GCA905373405_00103 | gene | open | 103236-103502 | rpsT | ||
| 268 | CAJPSQ010000001.1 | GCA905373405_00104 | gene | open | 103614-104552 | fmt | ||
| 269 | CAJPSQ010000001.1 | GCA905373405_00105 | gene | open | 104553-106358 | lepA | ||
| 270 | CAJPSQ010000001.1 | GCA905373405_00106 | gene | open | 106348-107445 | hemW | ||
| 271 | CAJPSQ010000001.1 | GCA905373405_00107 | gene | open | 107578-107844 | rpsO | ||
| 272 | CAJPSQ010000001.1 | GCA905373405_00108 | gene | open | 107918-108619 | |||
| 273 | CAJPSQ010000001.1 | GCA905373405_00109 | gene | open | 108619-112062 | |||
| 274 | CAJPSQ010000001.1 | GCA905373405_00110 | gene | open | 112062-112727 | |||
| 275 | CAJPSQ010000001.1 | GCA905373405_00111 | gene | open | 112818-115040 | pnp | ||
| 276 | CAJPSQ010000001.1 | GCA905373405_00112 | gene | open | 115088-115741 | trmB | ||
| 277 | CAJPSQ010000001.1 | GCA905373405_00113 | gene | open | 115773-116447 | |||
| 278 | CAJPSQ010000001.1 | GCA905373405_00114 | gene | open | 116549-117391 | |||
| 279 | CAJPSQ010000001.1 | GCA905373405_00115 | gene | open | 117464-118843 | murC | ||
| 280 | CAJPSQ010000001.1 | GCA905373405_00116 | gene | open | 118887-119246 | |||
| 281 | CAJPSQ010000001.1 | GCA905373405_00117 | gene | open | 119399-119788 | |||
| 282 | CAJPSQ010000001.1 | GCA905373405_00118 | gene | open | 119781-120467 | ytxH | ||
| 283 | CAJPSQ010000001.1 | GCA905373405_00119 | gene | open | 120478-121482 | lacI | ||
| 284 | CAJPSQ010000001.1 | GCA905373405_00120 | gene | open | 121721-122968 | tyrS | ||
| 285 | CAJPSQ010000001.1 | GCA905373405_00121 | gene | open | 123041-123544 | |||
| 286 | CAJPSQ010000001.1 | GCA905373405_00122 | gene | open | 123559-125202 | |||
| 287 | CAJPSQ010000001.1 | GCA905373405_00123 | gene | open | 125203-125904 | |||
| 288 | CAJPSQ010000001.1 | GCA905373405_00124 | gene | open | 125885-126796 | ispH | ||
| 289 | CAJPSQ010000001.1 | GCA905373405_00125 | gene | open | 126853-128220 | |||
| 290 | CAJPSQ010000001.1 | GCA905373405_00126 | gene | open | 128345-128620 | |||
| 291 | CAJPSQ010000001.1 | GCA905373405_00127 | gene | open | 128610-129257 | |||
| 292 | CAJPSQ010000001.1 | GCA905373405_00129 | gene | open | 129557-131428 | asnB | ||
| 293 | CAJPSQ010000001.1 | GCA905373405_00130 | gene | open | 131466-132095 | |||
| 294 | CAJPSQ010000001.1 | GCA905373405_00131 | gene | open | 132111-133184 | ispG | ||
| 295 | CAJPSQ010000001.1 | GCA905373405_00132 | gene | open | 133280-133480 | |||
| 296 | CAJPSQ010000001.1 | GCA905373405_00133 | gene | open | 133510-134115 | |||
| 297 | CAJPSQ010000001.1 | GCA905373405_00134 | gene | open | 134173-134916 | |||
| 298 | CAJPSQ010000001.1 | GCA905373405_00135 | gene | open | 134988-135971 | tadA | ||
| 299 | CAJPSQ010000001.1 | GCA905373405_00136 | gene | open | 136003-136938 | gspF | ||
| 300 | CAJPSQ010000001.1 | GCA905373405_00137 | gene | open | 136954-137250 | comGC | ||
| 301 | CAJPSQ010000001.1 | GCA905373405_00138 | gene | open | 137228-137536 | |||
| 302 | CAJPSQ010000001.1 | GCA905373405_00139 | gene | open | 137511-137756 | |||
| 303 | CAJPSQ010000001.1 | GCA905373405_00140 | gene | open | 137717-138109 | |||
| 304 | CAJPSQ010000001.1 | GCA905373405_00141 | gene | open | 138078-138413 | |||
| 305 | CAJPSQ010000001.1 | GCA905373405_00142 | gene | open | 138500-139615 | |||
| 306 | CAJPSQ010000001.1 | GCA905373405_00143 | gene | open | 139866-140468 | |||
| 307 | CAJPSQ010000001.1 | GCA905373405_00144 | gene | open | 140597-141760 | |||
| 308 | CAJPSQ010000001.1 | GCA905373405_00145 | gene | open | 141762-142436 | cmk | ||
| 309 | CAJPSQ010000001.1 | GCA905373405_00146 | gene | open | 142436-143749 | der | ||
| 310 | CAJPSQ010000001.1 | GCA905373405_00147 | gene | open | 143746-144735 | |||
| 311 | CAJPSQ010000001.1 | GCA905373405_00148 | gene | open | 144809-147403 | |||
| 312 | CAJPSQ010000001.1 | GCA905373405_00149 | gene | open | 147418-148266 | degV | ||
| 313 | CAJPSQ010000001.1 | GCA905373405_00150 | gene | open | 148290-151469 | |||
| 314 | CAJPSQ010000001.1 | GCA905373405_00151 | gene | open | 151471-152139 | |||
| 315 | CAJPSQ010000001.1 | GCA905373405_00152 | gene | open | 152090-153571 | |||
| 316 | CAJPSQ010000001.1 | GCA905373405_00153 | gene | open | 153561-154235 | |||
| 317 | CAJPSQ010000001.1 | GCA905373405_00154 | gene | open | 154283-155326 | |||
| 318 | CAJPSQ010000001.1 | GCA905373405_00155 | gene | open | 155392-156159 | |||
| 319 | CAJPSQ010000001.1 | GCA905373405_00156 | gene | open | 156181-156528 | |||
| 320 | CAJPSQ010000001.1 | GCA905373405_00157 | gene | open | 156791-159190 | leuS | ||
| 321 | CAJPSQ010000001.1 | GCA905373405_00158 | gene | open | 159272-160033 | |||
| 322 | CAJPSQ010000001.1 | GCA905373405_00159 | gene | open | 160026-160679 | scpB | ||
| 323 | CAJPSQ010000001.1 | GCA905373405_00160 | gene | open | 160700-161185 | |||
| 324 | CAJPSQ010000001.1 | GCA905373405_00161 | gene | open | 161223-162518 | purB | ||
| 325 | CAJPSQ010000001.1 | GCA905373405_00128 | gene | open | 129333-129406 | trnE | ||
| 326 | CAJPSQ010000001.1 | GCA905373405_00128 | tRNA | open | 129333-129406 | trnE | tRNA-Glu(ctc) | |
| 327 | CAJPSQ010000002.1 | regulatory_region | open | 129729-129927 | T-box leader | |||
| 328 | CAJPSQ010000002.1 | GCA905373405_00162 | CDS | open | 158-658 | _na 166_aa | DUF1836 domain-containing protein | |
| 329 | CAJPSQ010000002.1 | GCA905373405_00163 | CDS | open | 795-1493 | _na 232_aa | Channel protein%2C hemolysin III family | |
| 330 | CAJPSQ010000002.1 | GCA905373405_00164 | CDS | open | 1558-1869 | _na 103_aa | hypothetical protein | |
| 331 | CAJPSQ010000002.1 | GCA905373405_00165 | CDS | open | 1899-2168 | _na 89_aa | Acetyltransferase%2C GNAT family | |
| 332 | CAJPSQ010000002.1 | GCA905373405_00166 | CDS | open | 2193-2660 | _na 155_aa | hypothetical protein | |
| 333 | CAJPSQ010000002.1 | GCA905373405_00167 | CDS | open | 2746-3438 | _na 230_aa | putative 2-phosphosulfolactate phosphatase | |
| 334 | CAJPSQ010000002.1 | GCA905373405_00168 | CDS | open | 3431-4225 | _na 264_aa | Cof-like hydrolase | |
| 335 | CAJPSQ010000002.1 | GCA905373405_00169 | CDS | open | 4222-5025 | _na 267_aa | yhfC | YhfC family intramembrane metalloprotease |
| 336 | CAJPSQ010000002.1 | GCA905373405_00170 | CDS | open | 5144-5497 | _na 117_aa | rplS | 50S ribosomal protein L19 |
| 337 | CAJPSQ010000002.1 | GCA905373405_00171 | CDS | open | 5562-6230 | _na 222_aa | lepB | signal peptidase I |
| 338 | CAJPSQ010000002.1 | GCA905373405_00172 | CDS | open | 6224-7093 | _na 289_aa | ylqF | ribosome biogenesis GTPase YlqF |
| 339 | CAJPSQ010000002.1 | GCA905373405_00173 | CDS | open | 7065-7691 | _na 208_aa | ribonuclease HII | |
| 340 | CAJPSQ010000002.1 | GCA905373405_00174 | CDS | open | 7738-8493 | _na 251_aa | dprA | Putative DNA protecting protein DprA |
| 341 | CAJPSQ010000002.1 | GCA905373405_00175 | CDS | open | 8551-10683 | _na 710_aa | topA | type I DNA topoisomerase |
| 342 | CAJPSQ010000002.1 | GCA905373405_00176 | CDS | open | 10687-11982 | _na 431_aa | trmFO | methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO |
| 343 | CAJPSQ010000002.1 | GCA905373405_00177 | CDS | open | 11972-12895 | _na 307_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 344 | CAJPSQ010000002.1 | GCA905373405_00178 | CDS | open | 12909-13670 | _na 253_aa | Uridine phosphorylase | |
| 345 | CAJPSQ010000002.1 | GCA905373405_00179 | CDS | open | 13946-15538 | _na 530_aa | ABC transporter ATP-binding protein | |
| 346 | CAJPSQ010000002.1 | GCA905373405_00180 | CDS | open | 15778-16728 | _na 316_aa | rpsB | 30S ribosomal protein S2 |
| 347 | CAJPSQ010000002.1 | GCA905373405_00181 | CDS | open | 16731-17618 | _na 295_aa | tsf | translation elongation factor Ts |
| 348 | CAJPSQ010000002.1 | GCA905373405_00182 | CDS | open | 18075-18956 | _na 293_aa | Ppx/GppA phosphatase N-terminal domain-containing protein | |
| 349 | CAJPSQ010000002.1 | GCA905373405_00183 | CDS | open | 19059-19772 | _na 237_aa | pyrH | UMP kinase |
| 350 | CAJPSQ010000002.1 | GCA905373405_00184 | CDS | open | 19775-20323 | _na 182_aa | frr | ribosome recycling factor |
| 351 | CAJPSQ010000002.1 | GCA905373405_00185 | CDS | open | 20412-21116 | _na 234_aa | isoprenyl transferase | |
| 352 | CAJPSQ010000002.1 | GCA905373405_00186 | CDS | open | 21067-21897 | _na 276_aa | Phosphatidate cytidylyltransferase | |
| 353 | CAJPSQ010000002.1 | GCA905373405_00187 | CDS | open | 21899-23056 | _na 385_aa | 1-deoxy-D-xylulose-5-phosphate reductoisomerase | |
| 354 | CAJPSQ010000002.1 | GCA905373405_00188 | CDS | open | 23053-24114 | _na 353_aa | rseP | RIP metalloprotease RseP |
| 355 | CAJPSQ010000002.1 | GCA905373405_00189 | CDS | open | 24130-25143 | _na 337_aa | galE | UDP-glucose 4-epimerase GalE |
| 356 | CAJPSQ010000002.1 | GCA905373405_00190 | CDS | open | 25130-25573 | _na 147_aa | PTS EIIA type-4 domain-containing protein | |
| 357 | CAJPSQ010000002.1 | GCA905373405_00191 | CDS | open | 25885-27459 | _na 524_aa | SH3 domain protein | |
| 358 | CAJPSQ010000002.1 | GCA905373405_00192 | CDS | open | 27603-28754 | _na 383_aa | C40 family peptidase | |
| 359 | CAJPSQ010000002.1 | GCA905373405_00193 | CDS | open | 28821-30026 | _na 401_aa | PUA domain-containing protein | |
| 360 | CAJPSQ010000002.1 | GCA905373405_00194 | CDS | open | 30130-30849 | _na 239_aa | radC | DNA repair protein RadC |
| 361 | CAJPSQ010000002.1 | GCA905373405_00195 | CDS | open | 31001-33616 | _na 871_aa | polA | DNA polymerase I |
| 362 | CAJPSQ010000002.1 | GCA905373405_00196 | CDS | open | 33618-34424 | _na 268_aa | mutM | bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase |
| 363 | CAJPSQ010000002.1 | GCA905373405_00197 | CDS | open | 34432-35043 | _na 203_aa | coaE | dephospho-CoA kinase |
| 364 | CAJPSQ010000002.1 | GCA905373405_00198 | CDS | open | 35024-36217 | _na 397_aa | dnaD | DnaD domain-containing protein |
| 365 | CAJPSQ010000002.1 | GCA905373405_00199 | CDS | open | 36221-37132 | _na 303_aa | IstB-like ATP-binding domain-containing protein | |
| 366 | CAJPSQ010000002.1 | GCA905373405_00200 | CDS | open | 37191-38153 | _na 320_aa | pfkA | 6-phosphofructokinase |
| 367 | CAJPSQ010000002.1 | GCA905373405_00201 | CDS | open | 38161-39603 | _na 480_aa | pyk | pyruvate kinase |
| 368 | CAJPSQ010000002.1 | GCA905373405_00202 | CDS | open | 39669-41504 | _na 611_aa | rnjA | ribonuclease J1 |
| 369 | CAJPSQ010000002.1 | GCA905373405_00203 | CDS | open | 41601-42167 | _na 188_aa | def | peptide deformylase |
| 370 | CAJPSQ010000002.1 | GCA905373405_00204 | CDS | open | 42322-43575 | _na 417_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 371 | CAJPSQ010000002.1 | GCA905373405_00205 | CDS | open | 43572-44132 | _na 186_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 372 | CAJPSQ010000002.1 | GCA905373405_00206 | CDS | open | 44129-44650 | _na 173_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 373 | CAJPSQ010000002.1 | GCA905373405_00207 | CDS | open | 44647-45615 | _na 322_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 374 | CAJPSQ010000002.1 | GCA905373405_00208 | CDS | open | 45980-46552 | _na 190_aa | grpB | GrpB family protein |
| 375 | CAJPSQ010000002.1 | GCA905373405_00209 | CDS | open | 46844-47878 | _na 344_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 376 | CAJPSQ010000002.1 | GCA905373405_00210 | CDS | open | 47871-48410 | _na 179_aa | grpE | nucleotide exchange factor GrpE |
| 377 | CAJPSQ010000002.1 | GCA905373405_00211 | CDS | open | 48428-50248 | _na 606_aa | dnaK | molecular chaperone DnaK |
| 378 | CAJPSQ010000002.1 | GCA905373405_00212 | CDS | open | 50311-51459 | _na 382_aa | dnaJ | molecular chaperone DnaJ |
| 379 | CAJPSQ010000002.1 | GCA905373405_00213 | CDS | open | 51494-54046 | _na 850_aa | clpB | Putative ATP-dependent chaperone protein ClpB |
| 380 | CAJPSQ010000002.1 | GCA905373405_00214 | CDS | open | 54365-54841 | _na 158_aa | DUF4829 domain-containing protein | |
| 381 | CAJPSQ010000002.1 | GCA905373405_00215 | CDS | open | 55016-55432 | _na 138_aa | hypothetical protein | |
| 382 | CAJPSQ010000002.1 | GCA905373405_00216 | CDS | open | 55474-56304 | _na 276_aa | Cof-like hydrolase | |
| 383 | CAJPSQ010000002.1 | GCA905373405_00217 | CDS | open | 56443-56934 | _na 163_aa | DUF5673 domain-containing protein | |
| 384 | CAJPSQ010000002.1 | GCA905373405_00218 | CDS | open | 57019-57882 | _na 287_aa | Hydrolase%2C NUDIX family | |
| 385 | CAJPSQ010000002.1 | GCA905373405_00219 | CDS | open | 57882-58400 | _na 172_aa | nicotinamidase | |
| 386 | CAJPSQ010000002.1 | GCA905373405_00220 | CDS | open | 58410-59927 | _na 505_aa | nicotinate phosphoribosyltransferase | |
| 387 | CAJPSQ010000002.1 | GCA905373405_00221 | CDS | open | 59924-60556 | _na 210_aa | nadD | nicotinate (nicotinamide) nucleotide adenylyltransferase |
| 388 | CAJPSQ010000002.1 | GCA905373405_00222 | CDS | open | 60546-62507 | _na 653_aa | NAD(+) synthase | |
| 389 | CAJPSQ010000002.1 | GCA905373405_00223 | CDS | open | 62684-64621 | _na 645_aa | Dipeptidase | |
| 390 | CAJPSQ010000002.1 | GCA905373405_00224 | CDS | open | 64676-65356 | _na 226_aa | Cyclic nucleotide-binding domain-containing protein | |
| 391 | CAJPSQ010000002.1 | GCA905373405_00225 | CDS | open | 65459-66385 | _na 308_aa | Phosphate/phosphite/phosphonate ABC transporter%2C periplasmic binding protein | |
| 392 | CAJPSQ010000002.1 | GCA905373405_00226 | CDS | open | 66389-67159 | _na 256_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 393 | CAJPSQ010000002.1 | GCA905373405_00227 | CDS | open | 67149-67928 | _na 259_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 394 | CAJPSQ010000002.1 | GCA905373405_00228 | CDS | open | 67925-68707 | _na 260_aa | phnE | phosphonate ABC transporter%2C permease protein PhnE |
| 395 | CAJPSQ010000002.1 | GCA905373405_00229 | CDS | open | 68707-69519 | _na 270_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 396 | CAJPSQ010000002.1 | GCA905373405_00230 | CDS | open | 69579-70211 | _na 210_aa | Haloacid dehalogenase-like hydrolase | |
| 397 | CAJPSQ010000002.1 | GCA905373405_00231 | CDS | open | 70208-71350 | _na 380_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 398 | CAJPSQ010000002.1 | GCA905373405_00232 | CDS | open | 71673-73286 | _na 537_aa | Restriction endonuclease subunit S | |
| 399 | CAJPSQ010000002.1 | GCA905373405_00233 | CDS | open | 73299-75719 | _na 806_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 400 | CAJPSQ010000002.1 | GCA905373405_00234 | CDS | open | 75709-77199 | _na 496_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 401 | CAJPSQ010000002.1 | GCA905373405_00235 | CDS | open | 77186-78232 | _na 348_aa | restriction endonuclease subunit S | |
| 402 | CAJPSQ010000002.1 | GCA905373405_00236 | CDS | open | 78186-78869 | _na 227_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 403 | CAJPSQ010000002.1 | GCA905373405_00237 | CDS | open | 78873-81788 | _na 971_aa | Type I restriction enzyme endonuclease subunit | |
| 404 | CAJPSQ010000002.1 | GCA905373405_00238 | CDS | open | 81844-82812 | _na 322_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 405 | CAJPSQ010000002.1 | GCA905373405_00239 | CDS | open | 82833-83390 | _na 185_aa | restriction endonuclease subunit S | |
| 406 | CAJPSQ010000002.1 | GCA905373405_00240 | CDS | open | 83406-84380 | _na 324_aa | ImmA/IrrE family metallo-endopeptidase | |
| 407 | CAJPSQ010000002.1 | GCA905373405_00241 | CDS | open | 84467-84721 | _na 84_aa | XRE family transcriptional regulator | |
| 408 | CAJPSQ010000002.1 | GCA905373405_00242 | CDS | open | 84838-88044 | _na 1068_aa | hypothetical protein | |
| 409 | CAJPSQ010000002.1 | GCA905373405_00243 | CDS | open | 88041-92726 | _na 1561_aa | yprA | DEAD/DEAH box helicase |
| 410 | CAJPSQ010000002.1 | GCA905373405_00244 | CDS | open | 93084-93551 | _na 155_aa | GNAT family N-acetyltransferase | |
| 411 | CAJPSQ010000002.1 | GCA905373405_00245 | CDS | open | 93704-94477 | _na 257_aa | Methyltransferase domain protein | |
| 412 | CAJPSQ010000002.1 | GCA905373405_00246 | CDS | open | 94493-95065 | _na 190_aa | DUF3990 domain-containing protein | |
| 413 | CAJPSQ010000002.1 | GCA905373405_00247 | CDS | open | 95210-95866 | _na 218_aa | AB hydrolase-1 domain-containing protein | |
| 414 | CAJPSQ010000002.1 | GCA905373405_00248 | CDS | open | 95996-97360 | _na 454_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 415 | CAJPSQ010000002.1 | GCA905373405_00249 | CDS | open | 97608-97799 | _na 63_aa | hypothetical protein | |
| 416 | CAJPSQ010000002.1 | GCA905373405_00250 | CDS | open | 97765-97893 | _na 42_aa | hypothetical protein | |
| 417 | CAJPSQ010000002.1 | GCA905373405_00251 | CDS | open | 98177-99757 | _na 526_aa | potassium/proton antiporter | |
| 418 | CAJPSQ010000002.1 | GCA905373405_00252 | CDS | open | 99991-100401 | _na 136_aa | Acetyltransferase%2C GNAT family | |
| 419 | CAJPSQ010000002.1 | GCA905373405_00253 | CDS | open | 100959-101402 | _na 147_aa | CpXC domain-containing protein | |
| 420 | CAJPSQ010000002.1 | GCA905373405_00254 | CDS | open | 101445-101915 | _na 156_aa | Acetyltransferase%2C GNAT family | |
| 421 | CAJPSQ010000002.1 | GCA905373405_00255 | CDS | open | 102100-102684 | _na 194_aa | tetR | Transcriptional regulator%2C TetR family |
| 422 | CAJPSQ010000002.1 | GCA905373405_00256 | CDS | open | 102671-103762 | _na 363_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 423 | CAJPSQ010000002.1 | GCA905373405_00257 | CDS | open | 104042-104380 | _na 112_aa | DUF5658 domain-containing protein | |
| 424 | CAJPSQ010000002.1 | GCA905373405_00258 | CDS | open | 104419-104937 | _na 172_aa | Nitroreductase family protein | |
| 425 | CAJPSQ010000002.1 | GCA905373405_00259 | CDS | open | 104947-107643 | _na 898_aa | ppc | phosphoenolpyruvate carboxylase |
| 426 | CAJPSQ010000002.1 | GCA905373405_00260 | CDS | open | 107864-108805 | _na 313_aa | ABC transporter%2C permease protein | |
| 427 | CAJPSQ010000002.1 | GCA905373405_00261 | CDS | open | 108795-109610 | _na 271_aa | ABC transporter%2C permease protein | |
| 428 | CAJPSQ010000002.1 | GCA905373405_00262 | CDS | open | 109594-111108 | _na 504_aa | Solute-binding protein family 5 domain-containing protein | |
| 429 | CAJPSQ010000002.1 | GCA905373405_00263 | CDS | open | 111105-111890 | _na 261_aa | ABC transporter%2C ATP-binding protein | |
| 430 | CAJPSQ010000002.1 | GCA905373405_00264 | CDS | open | 111878-112627 | _na 249_aa | ABC transporter ATP-binding protein | |
| 431 | CAJPSQ010000002.1 | GCA905373405_00265 | CDS | open | 112706-114871 | _na 721_aa | priA | primosomal protein N' |
| 432 | CAJPSQ010000002.1 | GCA905373405_00266 | CDS | open | 114883-115443 | _na 186_aa | Acetyltransferase%2C GNAT family | |
| 433 | CAJPSQ010000002.1 | GCA905373405_00267 | CDS | open | 115590-116057 | _na 155_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 434 | CAJPSQ010000002.1 | GCA905373405_00268 | CDS | open | 116054-116989 | _na 311_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 435 | CAJPSQ010000002.1 | GCA905373405_00269 | CDS | open | 116994-117320 | _na 108_aa | ftsL | Cell division protein FtsL |
| 436 | CAJPSQ010000002.1 | GCA905373405_00270 | CDS | open | 117277-119493 | _na 738_aa | Penicillin-binding protein 2B | |
| 437 | CAJPSQ010000002.1 | GCA905373405_00271 | CDS | open | 119506-120471 | _na 321_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 438 | CAJPSQ010000002.1 | GCA905373405_00272 | CDS | open | 120625-120912 | _na 95_aa | hypothetical protein | |
| 439 | CAJPSQ010000002.1 | GCA905373405_00273 | CDS | open | 120916-123216 | _na 766_aa | Multifunctional fusion protein | |
| 440 | CAJPSQ010000002.1 | GCA905373405_00274 | CDS | open | 123267-123920 | _na 217_aa | HAD hydrolase%2C family IA%2C variant 3 | |
| 441 | CAJPSQ010000002.1 | GCA905373405_00275 | CDS | open | 123935-125245 | _na 436_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 442 | CAJPSQ010000002.1 | GCA905373405_00276 | CDS | open | 125242-126834 | _na 530_aa | recJ | Single-stranded-DNA-specific exonuclease RecJ |
| 443 | CAJPSQ010000002.1 | GCA905373405_00277 | CDS | open | 126898-127431 | _na 177_aa | adenine phosphoribosyltransferase | |
| 444 | CAJPSQ010000002.1 | GCA905373405_00278 | CDS | open | 127486-129687 | _na 733_aa | GTP diphosphokinase | |
| 445 | CAJPSQ010000002.1 | GCA905373405_00279 | CDS | open | 129967-131232 | _na 421_aa | hisS | histidine--tRNA ligase |
| 446 | CAJPSQ010000002.1 | GCA905373405_00280 | CDS | open | 131232-132989 | _na 585_aa | aspS | aspartate--tRNA ligase |
| 447 | CAJPSQ010000002.1 | GCA905373405_00281 | CDS | open | 133252-133833 | _na 193_aa | Thioredoxin domain-containing protein | |
| 448 | CAJPSQ010000002.1 | GCA905373405_00282 | CDS | open | 133912-134121 | _na 69_aa | putative protein family (UPF0154) | |
| 449 | CAJPSQ010000002.1 | GCA905373405_00283 | CDS | open | 134327-137890 | _na 1187_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 450 | CAJPSQ010000002.1 | GCA905373405_00284 | CDS | open | 137988-139193 | _na 401_aa | Alcohol dehydrogenase%2C iron-dependent | |
| 451 | CAJPSQ010000002.1 | GCA905373405_00285 | CDS | open | 139242-139826 | _na 194_aa | efp | elongation factor P |
| 452 | CAJPSQ010000002.1 | GCA905373405_00286 | CDS | open | 139957-140856 | _na 299_aa | phospholipase D-like domain-containing protein | |
| 453 | CAJPSQ010000002.1 | GCA905373405_00287 | CDS | open | 140919-141476 | _na 185_aa | phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein | |
| 454 | CAJPSQ010000002.1 | GCA905373405_00288 | CDS | open | 141521-142387 | _na 288_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 455 | CAJPSQ010000002.1 | GCA905373405_00289 | CDS | open | 142563-143489 | _na 308_aa | yhfZ | GntR family transcriptional regulator YhfZ |
| 456 | CAJPSQ010000002.1 | GCA905373405_00290 | CDS | open | 143501-144289 | _na 262_aa | Tyrosine specific protein phosphatases domain-containing protein | |
| 457 | CAJPSQ010000002.1 | GCA905373405_00291 | CDS | open | 144364-144711 | _na 115_aa | PRD domain-containing protein | |
| 458 | CAJPSQ010000002.1 | GCA905373405_00292 | CDS | open | 144728-145096 | _na 122_aa | DUF2620 domain-containing protein | |
| 459 | CAJPSQ010000002.1 | GCA905373405_00293 | CDS | open | 145131-146441 | _na 436_aa | Transport system permease protein | |
| 460 | CAJPSQ010000002.1 | GCA905373405_00294 | CDS | open | 146518-147501 | _na 327_aa | Amidase domain-containing protein | |
| 461 | CAJPSQ010000002.1 | GCA905373405_00295 | CDS | open | 147498-148352 | _na 284_aa | Phosphotriesterase family protein | |
| 462 | CAJPSQ010000002.1 | GCA905373405_00296 | CDS | open | 148355-149461 | _na 368_aa | Aminotransferase class V-fold PLP-dependent enzyme | |
| 463 | CAJPSQ010000002.1 | GCA905373405_00297 | CDS | open | 149448-150605 | _na 385_aa | alanine racemase | |
| 464 | CAJPSQ010000002.1 | GCA905373405_00298 | CDS | open | 150602-151822 | _na 406_aa | phosphopentomutase | |
| 465 | CAJPSQ010000002.1 | GCA905373405_00299 | CDS | open | 151911-152825 | _na 304_aa | Transporter%2C auxin efflux carrier (AEC) family protein | |
| 466 | CAJPSQ010000002.1 | GCA905373405_00300 | CDS | open | 152901-153845 | _na 314_aa | ADP-ribosylglycohydrolase family protein | |
| 467 | CAJPSQ010000002.1 | GCA905373405_00162 | gene | open | 158-658 | |||
| 468 | CAJPSQ010000002.1 | GCA905373405_00163 | gene | open | 795-1493 | |||
| 469 | CAJPSQ010000002.1 | GCA905373405_00164 | gene | open | 1558-1869 | |||
| 470 | CAJPSQ010000002.1 | GCA905373405_00165 | gene | open | 1899-2168 | |||
| 471 | CAJPSQ010000002.1 | GCA905373405_00166 | gene | open | 2193-2660 | |||
| 472 | CAJPSQ010000002.1 | GCA905373405_00167 | gene | open | 2746-3438 | |||
| 473 | CAJPSQ010000002.1 | GCA905373405_00168 | gene | open | 3431-4225 | |||
| 474 | CAJPSQ010000002.1 | GCA905373405_00169 | gene | open | 4222-5025 | yhfC | ||
| 475 | CAJPSQ010000002.1 | GCA905373405_00170 | gene | open | 5144-5497 | rplS | ||
| 476 | CAJPSQ010000002.1 | GCA905373405_00171 | gene | open | 5562-6230 | lepB | ||
| 477 | CAJPSQ010000002.1 | GCA905373405_00172 | gene | open | 6224-7093 | ylqF | ||
| 478 | CAJPSQ010000002.1 | GCA905373405_00173 | gene | open | 7065-7691 | |||
| 479 | CAJPSQ010000002.1 | GCA905373405_00174 | gene | open | 7738-8493 | dprA | ||
| 480 | CAJPSQ010000002.1 | GCA905373405_00175 | gene | open | 8551-10683 | topA | ||
| 481 | CAJPSQ010000002.1 | GCA905373405_00176 | gene | open | 10687-11982 | trmFO | ||
| 482 | CAJPSQ010000002.1 | GCA905373405_00177 | gene | open | 11972-12895 | xerA | ||
| 483 | CAJPSQ010000002.1 | GCA905373405_00178 | gene | open | 12909-13670 | |||
| 484 | CAJPSQ010000002.1 | GCA905373405_00179 | gene | open | 13946-15538 | |||
| 485 | CAJPSQ010000002.1 | GCA905373405_00180 | gene | open | 15778-16728 | rpsB | ||
| 486 | CAJPSQ010000002.1 | GCA905373405_00181 | gene | open | 16731-17618 | tsf | ||
| 487 | CAJPSQ010000002.1 | GCA905373405_00182 | gene | open | 18075-18956 | |||
| 488 | CAJPSQ010000002.1 | GCA905373405_00183 | gene | open | 19059-19772 | pyrH | ||
| 489 | CAJPSQ010000002.1 | GCA905373405_00184 | gene | open | 19775-20323 | frr | ||
| 490 | CAJPSQ010000002.1 | GCA905373405_00185 | gene | open | 20412-21116 | |||
| 491 | CAJPSQ010000002.1 | GCA905373405_00186 | gene | open | 21067-21897 | |||
| 492 | CAJPSQ010000002.1 | GCA905373405_00187 | gene | open | 21899-23056 | |||
| 493 | CAJPSQ010000002.1 | GCA905373405_00188 | gene | open | 23053-24114 | rseP | ||
| 494 | CAJPSQ010000002.1 | GCA905373405_00189 | gene | open | 24130-25143 | galE | ||
| 495 | CAJPSQ010000002.1 | GCA905373405_00190 | gene | open | 25130-25573 | |||
| 496 | CAJPSQ010000002.1 | GCA905373405_00191 | gene | open | 25885-27459 | |||
| 497 | CAJPSQ010000002.1 | GCA905373405_00192 | gene | open | 27603-28754 | |||
| 498 | CAJPSQ010000002.1 | GCA905373405_00193 | gene | open | 28821-30026 | |||
| 499 | CAJPSQ010000002.1 | GCA905373405_00194 | gene | open | 30130-30849 | radC | ||
| 500 | CAJPSQ010000002.1 | GCA905373405_00195 | gene | open | 31001-33616 | polA |

