HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Parvimonas micra (GCA_905373815.1)

Select a Genome:
BAKTA Annotations for GCA_905373815.1
Genome Selected: Parvimonas micra
ContigsBases CDSrRNA tmRNAtRNA
176 1561631 1506 1 1 36
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3147 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3147 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAJPUJ010000096.1 GCA905373815_01245 gene open 3772-4422 ecfT
2502 CAJPUJ010000097.1 GCA905373815_01246 CDS open 46-1377 _na     443_aa walK histidine kinase
2503 CAJPUJ010000097.1 GCA905373815_01247 CDS open 1374-2030 _na     218_aa ompR Response regulator transcription factor
2504 CAJPUJ010000097.1 GCA905373815_01248 CDS open 2188-3567 _na     459_aa lolE ABC transporter permease
2505 CAJPUJ010000097.1 GCA905373815_01249 CDS open 3578-4222 _na     214_aa lolD ABC transporter ATP-binding protein
2506 CAJPUJ010000097.1 GCA905373815_01250 CDS open 4233-5519 _na     428_aa lolE ABC transporter permease
2507 CAJPUJ010000097.1 GCA905373815_01246 gene open 46-1377 walK
2508 CAJPUJ010000097.1 GCA905373815_01247 gene open 1374-2030 ompR
2509 CAJPUJ010000097.1 GCA905373815_01248 gene open 2188-3567 lolE
2510 CAJPUJ010000097.1 GCA905373815_01249 gene open 3578-4222 lolD
2511 CAJPUJ010000097.1 GCA905373815_01250 gene open 4233-5519 lolE
2512 CAJPUJ010000098.1 GCA905373815_01251 CDS open 60-704 _na     214_aa deoC deoxyribose-phosphate aldolase
2513 CAJPUJ010000098.1 GCA905373815_01252 CDS open 704-1402 _na     232_aa deoD purine-nucleoside phosphorylase
2514 CAJPUJ010000098.1 GCA905373815_01253 CDS open 1483-1950 _na     155_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2515 CAJPUJ010000098.1 GCA905373815_01254 CDS open 1959-2933 _na     324_aa folP dihydropteroate synthase
2516 CAJPUJ010000098.1 GCA905373815_01255 CDS open 3013-4401 _na     462_aa pepD2 Xaa-His dipeptidase
2517 CAJPUJ010000098.1 GCA905373815_01256 CDS open 4403-5614 _na     403_aa pepT peptidase T
2518 CAJPUJ010000098.1 GCA905373815_01251 gene open 60-704 deoC
2519 CAJPUJ010000098.1 GCA905373815_01252 gene open 704-1402 deoD
2520 CAJPUJ010000098.1 GCA905373815_01253 gene open 1483-1950 folK
2521 CAJPUJ010000098.1 GCA905373815_01254 gene open 1959-2933 folP
2522 CAJPUJ010000098.1 GCA905373815_01255 gene open 3013-4401 pepD2
2523 CAJPUJ010000098.1 GCA905373815_01256 gene open 4403-5614 pepT
2524 CAJPUJ010000099.1 GCA905373815_01257 CDS open 133-942 _na     269_aa gloB Metallo-beta-lactamase
2525 CAJPUJ010000099.1 GCA905373815_01258 CDS open 1118-2479 _na     453_aa Aldehyde dehydrogenase
2526 CAJPUJ010000099.1 GCA905373815_01259 CDS open 4251-4895 _na     214_aa hypothetical protein
2527 CAJPUJ010000099.1 GCA905373815_01257 gene open 133-942 gloB
2528 CAJPUJ010000099.1 GCA905373815_01258 gene open 1118-2479
2529 CAJPUJ010000099.1 GCA905373815_01259 gene open 4251-4895
2530 CAJPUJ010000100.1 GCA905373815_01260 gene open 16-348 RNaseP_bact_a
2531 CAJPUJ010000100.1 GCA905373815_01260 ncRNA open 16-348 Bacterial RNase P class A
2532 CAJPUJ010000100.1 GCA905373815_01261 CDS open 411-2504 _na     697_aa rnr ribonuclease R
2533 CAJPUJ010000100.1 GCA905373815_01262 CDS open 2509-2976 _na     155_aa smpB SsrA-binding protein SmpB
2534 CAJPUJ010000100.1 GCA905373815_01263 CDS open 2988-4304 _na     438_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
2535 CAJPUJ010000100.1 GCA905373815_01261 gene open 411-2504 rnr
2536 CAJPUJ010000100.1 GCA905373815_01262 gene open 2509-2976 smpB
2537 CAJPUJ010000100.1 GCA905373815_01263 gene open 2988-4304 miaB
2538 CAJPUJ010000101.1 GCA905373815_01264 CDS open 204-371 _na     55_aa hypothetical protein
2539 CAJPUJ010000101.1 GCA905373815_01265 CDS open 658-2448 _na     596_aa mdlB ABC transporter ATP-binding protein
2540 CAJPUJ010000101.1 GCA905373815_01266 CDS open 2441-4186 _na     581_aa mdlB ABC transporter ATP-binding protein
2541 CAJPUJ010000101.1 GCA905373815_01267 CDS open 4199-5035 _na     278_aa mrp Iron-sulfur cluster carrier protein
2542 CAJPUJ010000101.1 GCA905373815_01264 gene open 204-371
2543 CAJPUJ010000101.1 GCA905373815_01265 gene open 658-2448 mdlB
2544 CAJPUJ010000101.1 GCA905373815_01266 gene open 2441-4186 mdlB
2545 CAJPUJ010000101.1 GCA905373815_01267 gene open 4199-5035 mrp
2546 CAJPUJ010000102.1 GCA905373815_01268 CDS open 78-1217 _na     379_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
2547 CAJPUJ010000102.1 GCA905373815_01269 CDS open 1219-2646 _na     475_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
2548 CAJPUJ010000102.1 GCA905373815_01270 CDS open 2646-3248 _na     200_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
2549 CAJPUJ010000102.1 GCA905373815_01271 CDS open 3229-3699 _na     156_aa yfcE Phosphoesterase
2550 CAJPUJ010000102.1 GCA905373815_01272 CDS open 3760-4791 _na     343_aa ldcA Carboxypeptidase
2551 CAJPUJ010000102.1 GCA905373815_01273 CDS open 4796-5113 _na     105_aa nitrous oxide-stimulated promoter family protein
2552 CAJPUJ010000102.1 GCA905373815_01268 gene open 78-1217 gatA
2553 CAJPUJ010000102.1 GCA905373815_01269 gene open 1219-2646 gatB
2554 CAJPUJ010000102.1 GCA905373815_01270 gene open 2646-3248 rdgB
2555 CAJPUJ010000102.1 GCA905373815_01271 gene open 3229-3699 yfcE
2556 CAJPUJ010000102.1 GCA905373815_01272 gene open 3760-4791 ldcA
2557 CAJPUJ010000102.1 GCA905373815_01273 gene open 4796-5113
2558 CAJPUJ010000103.1 GCA905373815_01274 CDS open 469-1323 _na     284_aa lipA lipoyl synthase
2559 CAJPUJ010000103.1 GCA905373815_01275 CDS open 1334-2320 _na     328_aa lplA lipoate--protein ligase
2560 CAJPUJ010000103.1 GCA905373815_01276 CDS open 2423-3226 _na     267_aa znuB Metal ABC transporter permease
2561 CAJPUJ010000103.1 GCA905373815_01277 CDS open 3226-3897 _na     223_aa znuC ABC transporter
2562 CAJPUJ010000103.1 GCA905373815_01278 CDS open 3988-4119 _na     43_aa hypothetical protein
2563 CAJPUJ010000103.1 GCA905373815_01279 CDS open 4201-4701 _na     166_aa fur Fur family transcriptional regulator
2564 CAJPUJ010000103.1 GCA905373815_01274 gene open 469-1323 lipA
2565 CAJPUJ010000103.1 GCA905373815_01275 gene open 1334-2320 lplA
2566 CAJPUJ010000103.1 GCA905373815_01276 gene open 2423-3226 znuB
2567 CAJPUJ010000103.1 GCA905373815_01277 gene open 3226-3897 znuC
2568 CAJPUJ010000103.1 GCA905373815_01278 gene open 3988-4119
2569 CAJPUJ010000103.1 GCA905373815_01279 gene open 4201-4701 fur
2570 CAJPUJ010000103.1 GCA905373815_01280 gene open 4787-4863 trnH
2571 CAJPUJ010000103.1 GCA905373815_01281 gene open 4869-4952 trnL
2572 CAJPUJ010000103.1 GCA905373815_01280 tRNA open 4787-4863 trnH tRNA-His(gtg)
2573 CAJPUJ010000103.1 GCA905373815_01281 tRNA open 4869-4952 trnL tRNA-Leu(tag)
2574 CAJPUJ010000104.1 GCA905373815_01282 CDS open 10-981 _na     323_aa pta phosphate acetyltransferase
2575 CAJPUJ010000104.1 GCA905373815_01283 CDS open 991-1869 _na     292_aa lCB5 Lipid kinase%2C YegS/Rv2252/BmrU family
2576 CAJPUJ010000104.1 GCA905373815_01284 CDS open 1869-2366 _na     165_aa DUF4446 domain-containing protein
2577 CAJPUJ010000104.1 GCA905373815_01285 CDS open 2366-3514 _na     382_aa csdA cysteine desulfurase
2578 CAJPUJ010000104.1 GCA905373815_01286 CDS open 3519-4349 _na     276_aa parB Chromosome partitioning protein ParB
2579 CAJPUJ010000104.1 GCA905373815_01287 CDS open 4349-5143 _na     264_aa parA Sporulation initiation inhibitor protein Soj
2580 CAJPUJ010000104.1 GCA905373815_01282 gene open 10-981 pta
2581 CAJPUJ010000104.1 GCA905373815_01283 gene open 991-1869 lCB5
2582 CAJPUJ010000104.1 GCA905373815_01284 gene open 1869-2366
2583 CAJPUJ010000104.1 GCA905373815_01285 gene open 2366-3514 csdA
2584 CAJPUJ010000104.1 GCA905373815_01286 gene open 3519-4349 parB
2585 CAJPUJ010000104.1 GCA905373815_01287 gene open 4349-5143 parA
2586 CAJPUJ010000105.1 GCA905373815_01288 CDS open 242-1504 _na     420_aa SLC13 family permease
2587 CAJPUJ010000105.1 GCA905373815_01289 CDS open 1513-2544 _na     343_aa Hemagglutinin
2588 CAJPUJ010000105.1 GCA905373815_01290 CDS open 2546-4522 _na     658_aa aconitate hydratase
2589 CAJPUJ010000105.1 GCA905373815_01291 CDS open 4542-5180 _na     212_aa hypothetical protein
2590 CAJPUJ010000105.1 GCA905373815_01288 gene open 242-1504
2591 CAJPUJ010000105.1 GCA905373815_01289 gene open 1513-2544
2592 CAJPUJ010000105.1 GCA905373815_01290 gene open 2546-4522
2593 CAJPUJ010000105.1 GCA905373815_01291 gene open 4542-5180
2594 CAJPUJ010000106.1 GCA905373815_01292 CDS open 654-1190 _na     178_aa ypbQ Isoprenylcysteine carboxyl methyltransferase family protein
2595 CAJPUJ010000106.1 GCA905373815_01293 CDS open 1304-1489 _na     61_aa DUF3311 domain-containing protein
2596 CAJPUJ010000106.1 GCA905373815_01294 CDS open 1552-2817 _na     421_aa Lipoprotein
2597 CAJPUJ010000106.1 GCA905373815_01295 CDS open 2992-4725 _na     577_aa pepF Oligoendopeptidase%2C pepF/M3 family
2598 CAJPUJ010000106.1 GCA905373815_01296 CDS open 4745-5101 _na     118_aa arsC ArsC family transcriptional regulator
2599 CAJPUJ010000106.1 GCA905373815_01292 gene open 654-1190 ypbQ
2600 CAJPUJ010000106.1 GCA905373815_01293 gene open 1304-1489
2601 CAJPUJ010000106.1 GCA905373815_01294 gene open 1552-2817
2602 CAJPUJ010000106.1 GCA905373815_01295 gene open 2992-4725 pepF
2603 CAJPUJ010000106.1 GCA905373815_01296 gene open 4745-5101 arsC
2604 CAJPUJ010000107.1 GCA905373815_01297 CDS open 77-655 _na     192_aa Lipoprotein
2605 CAJPUJ010000107.1 GCA905373815_01298 CDS open 711-1148 _na     145_aa CpXC domain-containing protein
2606 CAJPUJ010000107.1 GCA905373815_01299 CDS open 1735-2259 _na     174_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2607 CAJPUJ010000107.1 GCA905373815_01300 CDS open 2426-3163 _na     245_aa ymfI elongation factor P 5-aminopentanone reductase
2608 CAJPUJ010000107.1 GCA905373815_01301 CDS open 3275-3874 _na     199_aa rpsD 30S ribosomal protein S4
2609 CAJPUJ010000107.1 GCA905373815_01302 CDS open 3980-5260 _na     426_aa brnQ branched-chain amino acid transport system II carrier protein
2610 CAJPUJ010000107.1 GCA905373815_01297 gene open 77-655
2611 CAJPUJ010000107.1 GCA905373815_01298 gene open 711-1148
2612 CAJPUJ010000107.1 GCA905373815_01299 gene open 1735-2259 hpf
2613 CAJPUJ010000107.1 GCA905373815_01300 gene open 2426-3163 ymfI
2614 CAJPUJ010000107.1 GCA905373815_01301 gene open 3275-3874 rpsD
2615 CAJPUJ010000107.1 GCA905373815_01302 gene open 3980-5260 brnQ
2616 CAJPUJ010000108.1 GCA905373815_01303 CDS open 408-836 _na     142_aa hypothetical protein
2617 CAJPUJ010000108.1 GCA905373815_01304 CDS open 887-1990 _na     367_aa wecH Acyltransferase 3 domain-containing protein
2618 CAJPUJ010000108.1 GCA905373815_01305 CDS open 2021-2809 _na     262_aa phnP MBL fold metallo-hydrolase
2619 CAJPUJ010000108.1 GCA905373815_01306 CDS open 2811-3293 _na     160_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2620 CAJPUJ010000108.1 GCA905373815_01307 CDS open 3301-4218 _na     305_aa ttcA Restriction endonuclease EcoEI subunit S
2621 CAJPUJ010000108.1 GCA905373815_01308 CDS open 4211-5074 _na     287_aa flaA1 Polysaccharide biosynthesis protein CapD-like domain-containing protein
2622 CAJPUJ010000108.1 GCA905373815_01303 gene open 408-836
2623 CAJPUJ010000108.1 GCA905373815_01304 gene open 887-1990 wecH
2624 CAJPUJ010000108.1 GCA905373815_01305 gene open 2021-2809 phnP
2625 CAJPUJ010000108.1 GCA905373815_01306 gene open 2811-3293 rlmH
2626 CAJPUJ010000108.1 GCA905373815_01307 gene open 3301-4218 ttcA
2627 CAJPUJ010000108.1 GCA905373815_01308 gene open 4211-5074 flaA1
2628 CAJPUJ010000109.1 GCA905373815_01309 CDS open 119-817 _na     232_aa alkD DNA alkylation repair enzyme
2629 CAJPUJ010000109.1 GCA905373815_01310 CDS open 834-1352 _na     172_aa nfnB Nitroreductase
2630 CAJPUJ010000109.1 GCA905373815_01311 CDS open 1566-2396 _na     276_aa mscS Transporter
2631 CAJPUJ010000109.1 GCA905373815_01312 CDS open 2389-2661 _na     90_aa Putative Se/S carrier protein-like domain-containing protein
2632 CAJPUJ010000109.1 GCA905373815_01313 CDS open 2673-3650 _na     325_aa Organic solvent tolerance-like N-terminal domain-containing protein
2633 CAJPUJ010000109.1 GCA905373815_01314 CDS open 3659-4951 _na     430_aa Oxidoreductase DRL-like catalytic domain-containing protein
2634 CAJPUJ010000109.1 GCA905373815_01309 gene open 119-817 alkD
2635 CAJPUJ010000109.1 GCA905373815_01310 gene open 834-1352 nfnB
2636 CAJPUJ010000109.1 GCA905373815_01311 gene open 1566-2396 mscS
2637 CAJPUJ010000109.1 GCA905373815_01312 gene open 2389-2661
2638 CAJPUJ010000109.1 GCA905373815_01313 gene open 2673-3650
2639 CAJPUJ010000109.1 GCA905373815_01314 gene open 3659-4951
2640 CAJPUJ010000110.1 GCA905373815_01315 CDS open 173-862 _na     229_aa hypothetical protein
2641 CAJPUJ010000110.1 GCA905373815_01316 CDS open 846-2081 _na     411_aa ybbR YbbR-like domain-containing protein
2642 CAJPUJ010000110.1 GCA905373815_01317 CDS open 2141-4393 _na     750_aa uvrD DNA 3'-5' helicase
2643 CAJPUJ010000110.1 GCA905373815_01315 gene open 173-862
2644 CAJPUJ010000110.1 GCA905373815_01316 gene open 846-2081 ybbR
2645 CAJPUJ010000110.1 GCA905373815_01317 gene open 2141-4393 uvrD
2646 CAJPUJ010000111.1 GCA905373815_01318 CDS open 63-2072 _na     669_aa chlD VWFA domain-containing protein
2647 CAJPUJ010000111.1 GCA905373815_01319 CDS open 2297-2722 _na     141_aa DUF5673 domain-containing protein
2648 CAJPUJ010000111.1 GCA905373815_01320 CDS open 2732-3691 _na     319_aa gpsA Glycerol-3-phosphate dehydrogenase
2649 CAJPUJ010000111.1 GCA905373815_01321 CDS open 3700-4131 _na     143_aa rpiB ribose 5-phosphate isomerase B
2650 CAJPUJ010000111.1 GCA905373815_01322 CDS open 4354-4908 _na     184_aa rpoE RNA polymerase sigma factor%2C sigma-70 family
2651 CAJPUJ010000111.1 GCA905373815_01318 gene open 63-2072 chlD
2652 CAJPUJ010000111.1 GCA905373815_01319 gene open 2297-2722
2653 CAJPUJ010000111.1 GCA905373815_01320 gene open 2732-3691 gpsA
2654 CAJPUJ010000111.1 GCA905373815_01321 gene open 3700-4131 rpiB
2655 CAJPUJ010000111.1 GCA905373815_01322 gene open 4354-4908 rpoE
2656 CAJPUJ010000112.1 GCA905373815_01323 CDS open 25-1701 _na     558_aa ugpQ1 GP-PDE domain-containing protein
2657 CAJPUJ010000112.1 GCA905373815_01324 CDS open 1754-2992 _na     412_aa glyA Serine hydroxymethyltransferase
2658 CAJPUJ010000112.1 GCA905373815_01325 CDS open 3206-4114 _na     302_aa lysR selenium metabolism-associated LysR family transcriptional regulator
2659 CAJPUJ010000112.1 GCA905373815_01326 CDS open 4157-4825 _na     222_aa hypothetical protein
2660 CAJPUJ010000112.1 GCA905373815_01323 gene open 25-1701 ugpQ1
2661 CAJPUJ010000112.1 GCA905373815_01324 gene open 1754-2992 glyA
2662 CAJPUJ010000112.1 GCA905373815_01325 gene open 3206-4114 lysR
2663 CAJPUJ010000112.1 GCA905373815_01326 gene open 4157-4825
2664 CAJPUJ010000113.1 GCA905373815_01327 CDS open 39-227 _na     62_aa hypothetical protein
2665 CAJPUJ010000113.1 GCA905373815_01328 CDS open 286-555 _na     89_aa hypothetical protein
2666 CAJPUJ010000113.1 GCA905373815_01329 CDS open 650-874 _na     74_aa secG preprotein translocase subunit SecG
2667 CAJPUJ010000113.1 GCA905373815_01330 CDS open 893-2902 _na     669_aa oVP1 sodium-translocating pyrophosphatase
2668 CAJPUJ010000113.1 GCA905373815_01331 CDS open 3084-4448 _na     454_aa mpfA CBS domain protein
2669 CAJPUJ010000113.1 GCA905373815_01332 CDS open 4551-4940 _na     129_aa grdX GrdX family protein
2670 CAJPUJ010000113.1 GCA905373815_01327 gene open 39-227
2671 CAJPUJ010000113.1 GCA905373815_01328 gene open 286-555
2672 CAJPUJ010000113.1 GCA905373815_01329 gene open 650-874 secG
2673 CAJPUJ010000113.1 GCA905373815_01330 gene open 893-2902 oVP1
2674 CAJPUJ010000113.1 GCA905373815_01331 gene open 3084-4448 mpfA
2675 CAJPUJ010000113.1 GCA905373815_01332 gene open 4551-4940 grdX
2676 CAJPUJ010000114.1 GCA905373815_01337 gene open 3165-3241 dfrA-dnaX
2677 CAJPUJ010000114.1 GCA905373815_01337 ncRNA open 3165-3241 dfrA-dnaX RNA
2678 CAJPUJ010000114.1 GCA905373815_01333 CDS open 83-484 _na     133_aa rsbW ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
2679 CAJPUJ010000114.1 GCA905373815_01334 CDS open 589-1572 _na     327_aa floA flotillin-like protein FloA
2680 CAJPUJ010000114.1 GCA905373815_01335 CDS open 1585-2094 _na     169_aa hypothetical protein
2681 CAJPUJ010000114.1 GCA905373815_01336 CDS open 2193-3029 _na     278_aa Lipoprotein
2682 CAJPUJ010000114.1 GCA905373815_01338 CDS open 3366-4205 _na     279_aa cvfB S1 motif domain-containing protein
2683 CAJPUJ010000114.1 GCA905373815_01339 CDS open 4219-4962 _na     247_aa surA peptidylprolyl isomerase
2684 CAJPUJ010000114.1 GCA905373815_01333 gene open 83-484 rsbW
2685 CAJPUJ010000114.1 GCA905373815_01334 gene open 589-1572 floA
2686 CAJPUJ010000114.1 GCA905373815_01335 gene open 1585-2094
2687 CAJPUJ010000114.1 GCA905373815_01336 gene open 2193-3029
2688 CAJPUJ010000114.1 GCA905373815_01338 gene open 3366-4205 cvfB
2689 CAJPUJ010000114.1 GCA905373815_01339 gene open 4219-4962 surA
2690 CAJPUJ010000115.1 GCA905373815_01340 CDS open 423-1241 _na     272_aa modA molybdate ABC transporter substrate-binding protein
2691 CAJPUJ010000115.1 GCA905373815_01341 CDS open 1285-1947 _na     220_aa modB molybdate ABC transporter permease subunit
2692 CAJPUJ010000115.1 GCA905373815_01342 CDS open 1968-3011 _na     347_aa cysA Molybdenum ABC transporter permease
2693 CAJPUJ010000115.1 GCA905373815_01343 CDS open 3049-3990 _na     313_aa moaA GTP 3'%2C8-cyclase MoaA
2694 CAJPUJ010000115.1 GCA905373815_01344 CDS open 3992-4477 _na     161_aa moaC cyclic pyranopterin monophosphate synthase MoaC
2695 CAJPUJ010000115.1 GCA905373815_01345 CDS open 4477-4908 _na     143_aa MOSC domain-containing protein
2696 CAJPUJ010000115.1 GCA905373815_01340 gene open 423-1241 modA
2697 CAJPUJ010000115.1 GCA905373815_01341 gene open 1285-1947 modB
2698 CAJPUJ010000115.1 GCA905373815_01342 gene open 1968-3011 cysA
2699 CAJPUJ010000115.1 GCA905373815_01343 gene open 3049-3990 moaA
2700 CAJPUJ010000115.1 GCA905373815_01344 gene open 3992-4477 moaC
2701 CAJPUJ010000115.1 GCA905373815_01345 gene open 4477-4908
2702 CAJPUJ010000116.1 GCA905373815_01346 CDS open 238-1296 _na     352_aa afuA ABC transporter substrate-binding protein
2703 CAJPUJ010000116.1 GCA905373815_01347 CDS open 1387-3072 _na     561_aa fbpB ABC transmembrane type-1 domain-containing protein
2704 CAJPUJ010000116.1 GCA905373815_01348 CDS open 3081-4151 _na     356_aa potA Iron ABC transporter ATP-binding protein
2705 CAJPUJ010000116.1 GCA905373815_01349 CDS open 4260-4844 _na     194_aa DUF3841 domain-containing protein
2706 CAJPUJ010000116.1 GCA905373815_01346 gene open 238-1296 afuA
2707 CAJPUJ010000116.1 GCA905373815_01347 gene open 1387-3072 fbpB
2708 CAJPUJ010000116.1 GCA905373815_01348 gene open 3081-4151 potA
2709 CAJPUJ010000116.1 GCA905373815_01349 gene open 4260-4844
2710 CAJPUJ010000117.1 repeat_region open 2826-4789 CRISPR array with 30 repeats of length 30%2C consensus sequence ATTTATGTATTTCTATATTAGAATTTAAAT and spacer length 36
2711 CAJPUJ010000117.1 GCA905373815_01350 CDS open 341-610 _na     89_aa hypothetical protein
2712 CAJPUJ010000117.1 GCA905373815_01351 CDS open 653-1147 _na     164_aa cas4 CRISPR-associated protein Cas4
2713 CAJPUJ010000117.1 GCA905373815_01352 CDS open 1135-2151 _na     338_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
2714 CAJPUJ010000117.1 GCA905373815_01353 CDS open 2156-2434 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
2715 CAJPUJ010000117.1 GCA905373815_01350 gene open 341-610
2716 CAJPUJ010000117.1 GCA905373815_01351 gene open 653-1147 cas4
2717 CAJPUJ010000117.1 GCA905373815_01352 gene open 1135-2151 cas1b
2718 CAJPUJ010000117.1 GCA905373815_01353 gene open 2156-2434 cas2
2719 CAJPUJ010000118.1 GCA905373815_01354 CDS open 52-987 _na     311_aa fepB ABC transporter substrate-binding protein
2720 CAJPUJ010000118.1 GCA905373815_01355 CDS open 1104-2198 _na     364_aa ychF redox-regulated ATPase YchF
2721 CAJPUJ010000118.1 GCA905373815_01356 CDS open 2397-2810 _na     137_aa yjhB NUDIX hydrolase
2722 CAJPUJ010000118.1 GCA905373815_01357 CDS open 2810-3733 _na     307_aa whiA DNA-binding protein WhiA
2723 CAJPUJ010000118.1 GCA905373815_01358 CDS open 3879-4469 _na     196_aa DUF4230 domain-containing protein
2724 CAJPUJ010000118.1 GCA905373815_01359 CDS open 4502-4759 _na     85_aa hypothetical protein
2725 CAJPUJ010000118.1 GCA905373815_01354 gene open 52-987 fepB
2726 CAJPUJ010000118.1 GCA905373815_01355 gene open 1104-2198 ychF
2727 CAJPUJ010000118.1 GCA905373815_01356 gene open 2397-2810 yjhB
2728 CAJPUJ010000118.1 GCA905373815_01357 gene open 2810-3733 whiA
2729 CAJPUJ010000118.1 GCA905373815_01358 gene open 3879-4469
2730 CAJPUJ010000118.1 GCA905373815_01359 gene open 4502-4759
2731 CAJPUJ010000119.1 GCA905373815_01360 CDS open 272-2158 _na     628_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2732 CAJPUJ010000119.1 GCA905373815_01361 CDS open 2151-2864 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2733 CAJPUJ010000119.1 GCA905373815_01362 CDS open 3856-4503 _na     215_aa Ig-like domain-containing protein
2734 CAJPUJ010000119.1 GCA905373815_01360 gene open 272-2158 mnmG
2735 CAJPUJ010000119.1 GCA905373815_01361 gene open 2151-2864 rsmG
2736 CAJPUJ010000119.1 GCA905373815_01362 gene open 3856-4503
2737 CAJPUJ010000120.1 rep_origin open 1469-1743
2738 CAJPUJ010000120.1 GCA905373815_01363 CDS open 53-1468 _na     471_aa dnaA chromosomal replication initiator protein DnaA
2739 CAJPUJ010000120.1 GCA905373815_01364 CDS open 1744-2850 _na     368_aa dnaN DNA polymerase III subunit beta
2740 CAJPUJ010000120.1 GCA905373815_01365 CDS open 2860-3081 _na     73_aa ybcJ S4 domain-containing protein YaaA
2741 CAJPUJ010000120.1 GCA905373815_01366 CDS open 3084-4184 _na     366_aa recF DNA replication/repair protein RecF
2742 CAJPUJ010000120.1 GCA905373815_01363 gene open 53-1468 dnaA
2743 CAJPUJ010000120.1 GCA905373815_01364 gene open 1744-2850 dnaN
2744 CAJPUJ010000120.1 GCA905373815_01365 gene open 2860-3081 ybcJ
2745 CAJPUJ010000120.1 GCA905373815_01366 gene open 3084-4184 recF
2746 CAJPUJ010000121.1 GCA905373815_01367 CDS open 414-1133 _na     239_aa trmN6 Methyltransferase small domain-containing protein
2747 CAJPUJ010000121.1 GCA905373815_01368 CDS open 1218-3065 _na     615_aa uvrD DNA 3'-5' helicase
2748 CAJPUJ010000121.1 GCA905373815_01369 CDS open 3098-4609 _na     503_aa Urocanate reductase
2749 CAJPUJ010000121.1 GCA905373815_01367 gene open 414-1133 trmN6
2750 CAJPUJ010000121.1 GCA905373815_01368 gene open 1218-3065 uvrD
2751 CAJPUJ010000121.1 GCA905373815_01369 gene open 3098-4609
2752 CAJPUJ010000122.1 GCA905373815_01370 CDS open 858-1076 _na     72_aa DUF1858 domain-containing protein
2753 CAJPUJ010000122.1 GCA905373815_01372 CDS open 1593-2519 _na     308_aa Putative amidase domain-containing protein
2754 CAJPUJ010000122.1 GCA905373815_01373 CDS open 2458-2673 _na     71_aa Amidase domain-containing protein
2755 CAJPUJ010000122.1 GCA905373815_01374 CDS open 2818-3420 _na     200_aa elyC DUF218 domain-containing protein
2756 CAJPUJ010000122.1 GCA905373815_01375 CDS open 3430-3915 _na     161_aa msrC GAF domain-containing protein
2757 CAJPUJ010000122.1 GCA905373815_01376 CDS open 4022-4393 _na     123_aa DUF6483 domain-containing protein
2758 CAJPUJ010000122.1 GCA905373815_01370 gene open 858-1076
2759 CAJPUJ010000122.1 GCA905373815_01372 gene open 1593-2519
2760 CAJPUJ010000122.1 GCA905373815_01373 gene open 2458-2673
2761 CAJPUJ010000122.1 GCA905373815_01374 gene open 2818-3420 elyC
2762 CAJPUJ010000122.1 GCA905373815_01375 gene open 3430-3915 msrC
2763 CAJPUJ010000122.1 GCA905373815_01376 gene open 4022-4393
2764 CAJPUJ010000122.1 GCA905373815_01371 gene open 1266-1342 trnP
2765 CAJPUJ010000122.1 GCA905373815_01371 tRNA open 1266-1342 trnP tRNA-Pro(tgg)
2766 CAJPUJ010000123.1 GCA905373815_01377 CDS open 50-1729 _na     559_aa licC Choline kinase
2767 CAJPUJ010000123.1 GCA905373815_01378 CDS open 1923-2768 _na     281_aa ecfA2 energy-coupling factor transporter ATPase
2768 CAJPUJ010000123.1 GCA905373815_01379 CDS open 2768-3622 _na     284_aa ecfA2 energy-coupling factor transporter ATPase
2769 CAJPUJ010000123.1 GCA905373815_01380 CDS open 3622-4440 _na     272_aa ecfT Transporter
2770 CAJPUJ010000123.1 GCA905373815_01377 gene open 50-1729 licC
2771 CAJPUJ010000123.1 GCA905373815_01378 gene open 1923-2768 ecfA2
2772 CAJPUJ010000123.1 GCA905373815_01379 gene open 2768-3622 ecfA2
2773 CAJPUJ010000123.1 GCA905373815_01380 gene open 3622-4440 ecfT
2774 CAJPUJ010000124.1 GCA905373815_01381 CDS open 218-1093 _na     291_aa 5'-nucleotidase%2C lipoprotein e(P4) family
2775 CAJPUJ010000124.1 GCA905373815_01382 CDS open 1256-2629 _na     457_aa lAP4 aminopeptidase
2776 CAJPUJ010000124.1 GCA905373815_01383 CDS open 2703-3965 _na     420_aa DUF4097 domain-containing protein
2777 CAJPUJ010000124.1 GCA905373815_01384 CDS open 3958-4269 _na     103_aa padR PadR family transcriptional regulator
2778 CAJPUJ010000124.1 GCA905373815_01381 gene open 218-1093
2779 CAJPUJ010000124.1 GCA905373815_01382 gene open 1256-2629 lAP4
2780 CAJPUJ010000124.1 GCA905373815_01383 gene open 2703-3965
2781 CAJPUJ010000124.1 GCA905373815_01384 gene open 3958-4269 padR
2782 CAJPUJ010000125.1 GCA905373815_01385 CDS open 189-1490 _na     433_aa nlpC SH3 domain-containing C40 family peptidase
2783 CAJPUJ010000125.1 GCA905373815_01385 gene open 189-1490 nlpC
2784 CAJPUJ010000126.1 GCA905373815_01386 CDS open 384-1499 _na     371_aa ATP-NAD kinase
2785 CAJPUJ010000126.1 GCA905373815_01387 CDS open 1913-2290 _na     125_aa General stress protein
2786 CAJPUJ010000126.1 GCA905373815_01388 CDS open 2301-2771 _na     156_aa DUF948 domain-containing protein
2787 CAJPUJ010000126.1 GCA905373815_01389 CDS open 2830-3582 _na     250_aa focA Formate/nitrite transporter
2788 CAJPUJ010000126.1 GCA905373815_01390 CDS open 3594-3956 _na     120_aa modE LysR family transcriptional regulator
2789 CAJPUJ010000126.1 GCA905373815_01391 CDS open 4095-4430 _na     111_aa yurZ Alkylhydroperoxidase
2790 CAJPUJ010000126.1 GCA905373815_01386 gene open 384-1499
2791 CAJPUJ010000126.1 GCA905373815_01387 gene open 1913-2290
2792 CAJPUJ010000126.1 GCA905373815_01388 gene open 2301-2771
2793 CAJPUJ010000126.1 GCA905373815_01389 gene open 2830-3582 focA
2794 CAJPUJ010000126.1 GCA905373815_01390 gene open 3594-3956 modE
2795 CAJPUJ010000126.1 GCA905373815_01391 gene open 4095-4430 yurZ
2796 CAJPUJ010000127.1 GCA905373815_01392 CDS open 32-820 _na     262_aa norM putative multidrug resistance protein NorM
2797 CAJPUJ010000127.1 GCA905373815_01393 CDS open 979-4350 _na     1123_aa Gram-positive signal peptide protein%2C YSIRK family
2798 CAJPUJ010000127.1 GCA905373815_01392 gene open 32-820 norM
2799 CAJPUJ010000127.1 GCA905373815_01393 gene open 979-4350
2800 CAJPUJ010000128.1 GCA905373815_01394 CDS open 185-1732 _na     515_aa abc-f ribosomal protection-like ABC-F family protein
2801 CAJPUJ010000128.1 GCA905373815_01395 CDS open 1875-3416 _na     513_aa pepD C69 family dipeptidase
2802 CAJPUJ010000128.1 GCA905373815_01394 gene open 185-1732 abc-f
2803 CAJPUJ010000128.1 GCA905373815_01395 gene open 1875-3416 pepD
2804 CAJPUJ010000129.1 GCA905373815_01396 CDS open 148-687 _na     179_aa Chemotaxis protein
2805 CAJPUJ010000129.1 GCA905373815_01397 CDS open 708-1220 _na     170_aa Chemotaxis protein
2806 CAJPUJ010000129.1 GCA905373815_01398 CDS open 1446-2636 _na     396_aa Site-specific integrase
2807 CAJPUJ010000129.1 GCA905373815_01399 CDS open 2774-3397 _na     207_aa hypothetical protein
2808 CAJPUJ010000129.1 GCA905373815_01400 CDS open 3424-3879 _na     151_aa ImmA/IrrE family metallo-endopeptidase
2809 CAJPUJ010000129.1 GCA905373815_01401 CDS open 3872-4255 _na     127_aa helix-turn-helix transcriptional regulator
2810 CAJPUJ010000129.1 GCA905373815_01396 gene open 148-687
2811 CAJPUJ010000129.1 GCA905373815_01397 gene open 708-1220
2812 CAJPUJ010000129.1 GCA905373815_01398 gene open 1446-2636
2813 CAJPUJ010000129.1 GCA905373815_01399 gene open 2774-3397
2814 CAJPUJ010000129.1 GCA905373815_01400 gene open 3424-3879
2815 CAJPUJ010000129.1 GCA905373815_01401 gene open 3872-4255
2816 CAJPUJ010000130.1 GCA905373815_01402 CDS open 7-249 _na     80_aa hypothetical protein
2817 CAJPUJ010000130.1 GCA905373815_01403 CDS open 271-1824 _na     517_aa Methyltransferase
2818 CAJPUJ010000130.1 GCA905373815_01405 CDS open 2028-3056 _na     342_aa amidohydrolase
2819 CAJPUJ010000130.1 GCA905373815_01406 CDS open 3087-4106 _na     339_aa DUF819 domain-containing protein
2820 CAJPUJ010000130.1 GCA905373815_01402 gene open 7-249
2821 CAJPUJ010000130.1 GCA905373815_01403 gene open 271-1824
2822 CAJPUJ010000130.1 GCA905373815_01405 gene open 2028-3056
2823 CAJPUJ010000130.1 GCA905373815_01406 gene open 3087-4106
2824 CAJPUJ010000131.1 GCA905373815_01407 CDS open 1258-2073 _na     271_aa hypothetical protein
2825 CAJPUJ010000131.1 GCA905373815_01407 gene open 1258-2073
2826 CAJPUJ010000132.1 GCA905373815_01408 CDS open 61-957 _na     298_aa Glycerophosphodiester phosphodiesterase family protein
2827 CAJPUJ010000132.1 GCA905373815_01409 CDS open 1245-2630 _na     461_aa cysS cysteine--tRNA ligase
2828 CAJPUJ010000132.1 GCA905373815_01410 CDS open 2632-3369 _na     245_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2829 CAJPUJ010000132.1 GCA905373815_01411 CDS open 3359-3880 _na     173_aa NYN domain-containing protein
2830 CAJPUJ010000132.1 GCA905373815_01408 gene open 61-957
2831 CAJPUJ010000132.1 GCA905373815_01409 gene open 1245-2630 cysS
2832 CAJPUJ010000132.1 GCA905373815_01410 gene open 2632-3369 rlmB
2833 CAJPUJ010000132.1 GCA905373815_01411 gene open 3359-3880
2834 CAJPUJ010000133.1 GCA905373815_01412 CDS open 1549-1740 _na     63_aa hypothetical protein
2835 CAJPUJ010000133.1 GCA905373815_01413 CDS open 2954-3775 _na     273_aa draG Adhesin
2836 CAJPUJ010000133.1 GCA905373815_01414 CDS open 3772-4068 _na     98_aa hypothetical protein
2837 CAJPUJ010000133.1 GCA905373815_01412 gene open 1549-1740
2838 CAJPUJ010000133.1 GCA905373815_01413 gene open 2954-3775 draG
2839 CAJPUJ010000133.1 GCA905373815_01414 gene open 3772-4068
2840 CAJPUJ010000134.1 GCA905373815_01415 CDS open 231-1334 _na     367_aa gcvT glycine cleavage system aminomethyltransferase GcvT
2841 CAJPUJ010000134.1 GCA905373815_01416 CDS open 1361-2704 _na     447_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
2842 CAJPUJ010000134.1 GCA905373815_01417 CDS open 2921-3385 _na     154_aa hypothetical protein
2843 CAJPUJ010000134.1 GCA905373815_01415 gene open 231-1334 gcvT
2844 CAJPUJ010000134.1 GCA905373815_01416 gene open 1361-2704 gcvPA
2845 CAJPUJ010000134.1 GCA905373815_01417 gene open 2921-3385
2846 CAJPUJ010000135.1 GCA905373815_01418 CDS open 96-1271 _na     391_aa dacC serine-type D-Ala-D-Ala carboxypeptidase
2847 CAJPUJ010000135.1 GCA905373815_01419 CDS open 1281-2546 _na     421_aa serS serine--tRNA ligase
2848 CAJPUJ010000135.1 GCA905373815_01420 CDS open 2549-3475 _na     308_aa perM ATP synthase F0%2C A subunit
2849 CAJPUJ010000135.1 GCA905373815_01421 CDS open 3463-3729 _na     88_aa hypothetical protein
2850 CAJPUJ010000135.1 GCA905373815_01422 CDS open 3739-4062 _na     107_aa hypothetical protein
2851 CAJPUJ010000135.1 GCA905373815_01418 gene open 96-1271 dacC
2852 CAJPUJ010000135.1 GCA905373815_01419 gene open 1281-2546 serS
2853 CAJPUJ010000135.1 GCA905373815_01420 gene open 2549-3475 perM
2854 CAJPUJ010000135.1 GCA905373815_01421 gene open 3463-3729
2855 CAJPUJ010000135.1 GCA905373815_01422 gene open 3739-4062
2856 CAJPUJ010000136.1 GCA905373815_01423 CDS open 44-514 _na     156_aa type II restriction endonuclease
2857 CAJPUJ010000136.1 GCA905373815_01424 CDS open 531-1274 _na     247_aa trm11 Methyltransferase
2858 CAJPUJ010000136.1 GCA905373815_01425 CDS open 1316-1741 _na     141_aa comEB CMP deaminase
2859 CAJPUJ010000136.1 GCA905373815_01426 CDS open 1804-2685 _na     293_aa yaaT Stage 0 sporulation protein
2860 CAJPUJ010000136.1 GCA905373815_01427 CDS open 2871-3935 _na     354_aa ABC transporter permease
2861 CAJPUJ010000136.1 GCA905373815_01423 gene open 44-514
2862 CAJPUJ010000136.1 GCA905373815_01424 gene open 531-1274 trm11
2863 CAJPUJ010000136.1 GCA905373815_01425 gene open 1316-1741 comEB
2864 CAJPUJ010000136.1 GCA905373815_01426 gene open 1804-2685 yaaT
2865 CAJPUJ010000136.1 GCA905373815_01427 gene open 2871-3935
2866 CAJPUJ010000137.1 GCA905373815_01428 CDS open 285-842 _na     185_aa lysoplasmalogenase family protein
2867 CAJPUJ010000137.1 GCA905373815_01429 CDS open 1092-1277 _na     61_aa DUF1659 domain-containing protein
2868 CAJPUJ010000137.1 GCA905373815_01430 CDS open 1288-1503 _na     71_aa DUF2922 domain-containing protein
2869 CAJPUJ010000137.1 GCA905373815_01431 CDS open 1551-1685 _na     44_aa yvrJ YvrJ family protein
2870 CAJPUJ010000137.1 GCA905373815_01432 CDS open 1694-2482 _na     262_aa Gametolysin
2871 CAJPUJ010000137.1 GCA905373815_01428 gene open 285-842
2872 CAJPUJ010000137.1 GCA905373815_01429 gene open 1092-1277
2873 CAJPUJ010000137.1 GCA905373815_01430 gene open 1288-1503
2874 CAJPUJ010000137.1 GCA905373815_01431 gene open 1551-1685 yvrJ
2875 CAJPUJ010000137.1 GCA905373815_01432 gene open 1694-2482
2876 CAJPUJ010000138.1 GCA905373815_01433 CDS open 79-1305 _na     408_aa hypothetical protein
2877 CAJPUJ010000138.1 GCA905373815_01434 CDS open 1315-3744 _na     809_aa gyrA DNA gyrase subunit A
2878 CAJPUJ010000138.1 GCA905373815_01433 gene open 79-1305
2879 CAJPUJ010000138.1 GCA905373815_01434 gene open 1315-3744 gyrA
2880 CAJPUJ010000139.1 GCA905373815_01435 CDS open 9-1253 _na     414_aa ABC transporter ATP-binding protein
2881 CAJPUJ010000139.1 GCA905373815_01436 CDS open 1201-2937 _na     578_aa mdlB ABC transporter ATP-binding protein
2882 CAJPUJ010000139.1 GCA905373815_01437 CDS open 2975-3454 _na     159_aa Lipoprotein
2883 CAJPUJ010000139.1 GCA905373815_01438 CDS open 3641-3898 _na     85_aa Zinc-ribbon 15 domain-containing protein
2884 CAJPUJ010000139.1 GCA905373815_01435 gene open 9-1253
2885 CAJPUJ010000139.1 GCA905373815_01436 gene open 1201-2937 mdlB
2886 CAJPUJ010000139.1 GCA905373815_01437 gene open 2975-3454
2887 CAJPUJ010000139.1 GCA905373815_01438 gene open 3641-3898
2888 CAJPUJ010000140.1 GCA905373815_01439 CDS open 76-2172 _na     698_aa hypothetical protein
2889 CAJPUJ010000140.1 GCA905373815_01440 CDS open 2377-2649 _na     90_aa rpsT 30S ribosomal protein S20
2890 CAJPUJ010000140.1 GCA905373815_01439 gene open 76-2172
2891 CAJPUJ010000140.1 GCA905373815_01440 gene open 2377-2649 rpsT
2892 CAJPUJ010000141.1 GCA905373815_01441 CDS open 205-615 _na     136_aa Sigma-70 family RNA polymerase sigma factor
2893 CAJPUJ010000141.1 GCA905373815_01442 CDS open 867-1448 _na     193_aa TIGR02185 family protein
2894 CAJPUJ010000141.1 GCA905373815_01443 CDS open 1466-2167 _na     233_aa ecfT Cobalt transport protein
2895 CAJPUJ010000141.1 GCA905373815_01444 CDS open 2164-3672 _na     502_aa energy-coupling factor transporter ATPase
2896 CAJPUJ010000141.1 GCA905373815_01445 CDS open 3681-3893 _na     70_aa hypothetical protein
2897 CAJPUJ010000141.1 GCA905373815_01441 gene open 205-615
2898 CAJPUJ010000141.1 GCA905373815_01442 gene open 867-1448
2899 CAJPUJ010000141.1 GCA905373815_01443 gene open 1466-2167 ecfT
2900 CAJPUJ010000141.1 GCA905373815_01444 gene open 2164-3672
2901 CAJPUJ010000141.1 GCA905373815_01445 gene open 3681-3893
2902 CAJPUJ010000142.1 GCA905373815_01448 gene open 2088-2162 dfrA-dnaX
2903 CAJPUJ010000142.1 GCA905373815_01448 ncRNA open 2088-2162 dfrA-dnaX RNA
2904 CAJPUJ010000142.1 GCA905373815_01446 CDS open 7-912 _na     301_aa Peptidase C39-like domain-containing protein
2905 CAJPUJ010000142.1 GCA905373815_01447 CDS open 916-1986 _na     356_aa prfA peptide chain release factor 1
2906 CAJPUJ010000142.1 GCA905373815_01449 CDS open 2275-3885 _na     536_aa mdlB ABC transporter ATP-binding protein
2907 CAJPUJ010000142.1 GCA905373815_01446 gene open 7-912
2908 CAJPUJ010000142.1 GCA905373815_01447 gene open 916-1986 prfA
2909 CAJPUJ010000142.1 GCA905373815_01449 gene open 2275-3885 mdlB
2910 CAJPUJ010000143.1 GCA905373815_01450 CDS open 121-291 _na     56_aa hypothetical protein
2911 CAJPUJ010000143.1 GCA905373815_01451 CDS open 219-473 _na     84_aa EF-hand domain-containing protein
2912 CAJPUJ010000143.1 GCA905373815_01452 CDS open 537-737 _na     66_aa helix-turn-helix transcriptional regulator
2913 CAJPUJ010000143.1 GCA905373815_01453 CDS open 770-958 _na     62_aa Helix-turn-helix domain-containing protein
2914 CAJPUJ010000143.1 GCA905373815_01454 CDS open 973-1737 _na     254_aa BRO family protein
2915 CAJPUJ010000143.1 GCA905373815_01455 CDS open 1741-1902 _na     53_aa hypothetical protein
2916 CAJPUJ010000143.1 GCA905373815_01456 CDS open 1918-2319 _na     133_aa yopX YopX protein domain-containing protein
2917 CAJPUJ010000143.1 GCA905373815_01457 CDS open 2300-2530 _na     76_aa hypothetical protein
2918 CAJPUJ010000143.1 GCA905373815_01458 CDS open 2532-2696 _na     54_aa hypothetical protein
2919 CAJPUJ010000143.1 GCA905373815_01459 CDS open 2716-3045 _na     109_aa DUF1874 domain-containing protein
2920 CAJPUJ010000143.1 GCA905373815_01460 CDS open 3048-3803 _na     251_aa Radical SAM protein
2921 CAJPUJ010000143.1 GCA905373815_01450 gene open 121-291
2922 CAJPUJ010000143.1 GCA905373815_01451 gene open 219-473
2923 CAJPUJ010000143.1 GCA905373815_01452 gene open 537-737
2924 CAJPUJ010000143.1 GCA905373815_01453 gene open 770-958
2925 CAJPUJ010000143.1 GCA905373815_01454 gene open 973-1737
2926 CAJPUJ010000143.1 GCA905373815_01455 gene open 1741-1902
2927 CAJPUJ010000143.1 GCA905373815_01456 gene open 1918-2319 yopX
2928 CAJPUJ010000143.1 GCA905373815_01457 gene open 2300-2530
2929 CAJPUJ010000143.1 GCA905373815_01458 gene open 2532-2696
2930 CAJPUJ010000143.1 GCA905373815_01459 gene open 2716-3045
2931 CAJPUJ010000143.1 GCA905373815_01460 gene open 3048-3803
2932 CAJPUJ010000144.1 GCA905373815_01464 gene open 1992-2339 ssrA
2933 CAJPUJ010000144.1 GCA905373815_01464 tmRNA open 1992-2339 ssrA transfer-messenger RNA%2C SsrA
2934 CAJPUJ010000144.1 GCA905373815_01461 CDS open 661-1041 _na     126_aa DUF2752 domain-containing protein
2935 CAJPUJ010000144.1 GCA905373815_01462 CDS open 1045-1380 _na     111_aa TM2 domain-containing protein
2936 CAJPUJ010000144.1 GCA905373815_01463 CDS open 1546-1932 _na     128_aa hypothetical protein
2937 CAJPUJ010000144.1 GCA905373815_01465 CDS open 2627-2875 _na     82_aa hypothetical protein
2938 CAJPUJ010000144.1 GCA905373815_01466 CDS open 2922-3584 _na     220_aa AP2 domain-containing protein
2939 CAJPUJ010000144.1 GCA905373815_01461 gene open 661-1041
2940 CAJPUJ010000144.1 GCA905373815_01462 gene open 1045-1380
2941 CAJPUJ010000144.1 GCA905373815_01463 gene open 1546-1932
2942 CAJPUJ010000144.1 GCA905373815_01465 gene open 2627-2875
2943 CAJPUJ010000144.1 GCA905373815_01466 gene open 2922-3584
2944 CAJPUJ010000145.1 GCA905373815_01467 CDS open 49-687 _na     212_aa hypothetical protein
2945 CAJPUJ010000145.1 GCA905373815_01468 CDS open 737-2683 _na     648_aa thrS threonine--tRNA ligase
2946 CAJPUJ010000145.1 GCA905373815_01469 CDS open 2877-3629 _na     250_aa hisS HisS family protein
2947 CAJPUJ010000145.1 GCA905373815_01467 gene open 49-687
2948 CAJPUJ010000145.1 GCA905373815_01468 gene open 737-2683 thrS
2949 CAJPUJ010000145.1 GCA905373815_01469 gene open 2877-3629 hisS
2950 CAJPUJ010000146.1 GCA905373815_01470 CDS open 120-1139 _na     339_aa fadH NADPH dehydrogenase
2951 CAJPUJ010000146.1 GCA905373815_01471 CDS open 1462-2148 _na     228_aa hypothetical protein
2952 CAJPUJ010000146.1 GCA905373815_01472 CDS open 2164-2862 _na     232_aa Lipoprotein
2953 CAJPUJ010000146.1 GCA905373815_01473 CDS open 2881-3312 _na     143_aa DUF1508 domain-containing protein
2954 CAJPUJ010000146.1 GCA905373815_01470 gene open 120-1139 fadH
2955 CAJPUJ010000146.1 GCA905373815_01471 gene open 1462-2148
2956 CAJPUJ010000146.1 GCA905373815_01472 gene open 2164-2862
2957 CAJPUJ010000146.1 GCA905373815_01473 gene open 2881-3312
2958 CAJPUJ010000147.1 GCA905373815_01474 CDS open 15-788 _na     257_aa dnaJ DnaJ domain-containing protein
2959 CAJPUJ010000147.1 GCA905373815_01475 CDS open 790-1011 _na     73_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
2960 CAJPUJ010000147.1 GCA905373815_01476 CDS open 1021-1839 _na     272_aa Viral A-type inclusion protein
2961 CAJPUJ010000147.1 GCA905373815_01477 CDS open 1836-2123 _na     95_aa yhbQ Endonuclease
2962 CAJPUJ010000147.1 GCA905373815_01478 CDS open 2120-2617 _na     165_aa recX Regulatory protein RecX
2963 CAJPUJ010000147.1 GCA905373815_01479 CDS open 2720-2815 _na     31_aa DUF4044 domain-containing protein
2964 CAJPUJ010000147.1 GCA905373815_01480 CDS open 2820-3578 _na     252_aa prfB peptide chain release factor 2
2965 CAJPUJ010000147.1 GCA905373815_01474 gene open 15-788 dnaJ
2966 CAJPUJ010000147.1 GCA905373815_01475 gene open 790-1011
2967 CAJPUJ010000147.1 GCA905373815_01476 gene open 1021-1839
2968 CAJPUJ010000147.1 GCA905373815_01477 gene open 1836-2123 yhbQ
2969 CAJPUJ010000147.1 GCA905373815_01478 gene open 2120-2617 recX
2970 CAJPUJ010000147.1 GCA905373815_01479 gene open 2720-2815
2971 CAJPUJ010000147.1 GCA905373815_01480 gene open 2820-3578 prfB
2972 CAJPUJ010000148.1 GCA905373815_01481 CDS open 56-751 _na     231_aa rplA 50S ribosomal protein L1
2973 CAJPUJ010000148.1 GCA905373815_01482 CDS open 798-1223 _na     141_aa rplK 50S ribosomal protein L11
2974 CAJPUJ010000148.1 GCA905373815_01483 CDS open 1324-1863 _na     179_aa nusG transcription termination/antitermination protein NusG
2975 CAJPUJ010000148.1 GCA905373815_01484 CDS open 1897-2103 _na     68_aa secE preprotein translocase subunit SecE
2976 CAJPUJ010000148.1 GCA905373815_01485 CDS open 2126-2275 _na     49_aa rpmG 50S ribosomal protein L33
2977 CAJPUJ010000148.1 GCA905373815_01486 CDS open 2427-3206 _na     259_aa udp uridine phosphorylase
2978 CAJPUJ010000148.1 GCA905373815_01487 CDS open 3207-3584 _na     125_aa hypothetical protein
2979 CAJPUJ010000148.1 GCA905373815_01481 gene open 56-751 rplA
2980 CAJPUJ010000148.1 GCA905373815_01482 gene open 798-1223 rplK
2981 CAJPUJ010000148.1 GCA905373815_01483 gene open 1324-1863 nusG
2982 CAJPUJ010000148.1 GCA905373815_01484 gene open 1897-2103 secE
2983 CAJPUJ010000148.1 GCA905373815_01485 gene open 2126-2275 rpmG
2984 CAJPUJ010000148.1 GCA905373815_01486 gene open 2427-3206 udp
2985 CAJPUJ010000148.1 GCA905373815_01487 gene open 3207-3584
2986 CAJPUJ010000149.1 GCA905373815_01488 CDS open 175-510 _na     111_aa hypothetical protein
2987 CAJPUJ010000149.1 GCA905373815_01489 CDS open 2794-3090 _na     98_aa hypothetical protein
2988 CAJPUJ010000149.1 GCA905373815_01488 gene open 175-510
2989 CAJPUJ010000149.1 GCA905373815_01489 gene open 2794-3090
2990 CAJPUJ010000150.1 GCA905373815_01490 CDS open 74-1186 _na     370_aa tPR Tetratricopeptide repeat protein
2991 CAJPUJ010000150.1 GCA905373815_01491 CDS open 1193-2458 _na     421_aa argS arginine--tRNA ligase
2992 CAJPUJ010000150.1 GCA905373815_01492 CDS open 2476-2925 _na     149_aa hypothetical protein
2993 CAJPUJ010000150.1 GCA905373815_01493 CDS open 2935-3456 _na     173_aa Smr/MutS family protein
2994 CAJPUJ010000150.1 GCA905373815_01490 gene open 74-1186 tPR
2995 CAJPUJ010000150.1 GCA905373815_01491 gene open 1193-2458 argS
2996 CAJPUJ010000150.1 GCA905373815_01492 gene open 2476-2925
2997 CAJPUJ010000150.1 GCA905373815_01493 gene open 2935-3456
2998 CAJPUJ010000151.1 GCA905373815_01494 CDS open 52-744 _na     230_aa Lipoprotein
2999 CAJPUJ010000151.1 GCA905373815_01495 CDS open 1220-1717 _na     165_aa queT QueT transporter
3000 CAJPUJ010000151.1 GCA905373815_01496 CDS open 1954-2592 _na     212_aa wrbA Flavodoxin