HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella melaninogenica (GCA_916715705.1)

Select a Genome:
BAKTA Annotations for GCA_916715705.1
Genome Selected: Prevotella melaninogenica
ContigsBases CDSrRNA tmRNAtRNA
116 3070081 2437 2 1 43
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4981 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4981 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAKAPC010000010.1 GCA916715705_00767 CDS open 48483-49949 _na     488_aa degQ putative periplasmic serine endoprotease DegP-like
1502 CAKAPC010000010.1 GCA916715705_00768 CDS open 50329-50445 _na     38_aa hypothetical protein
1503 CAKAPC010000010.1 GCA916715705_00770 CDS open 51143-51571 _na     142_aa Positive regulator of sigma(E)%2C RseC/MucC
1504 CAKAPC010000010.1 GCA916715705_00771 CDS open 51596-52003 _na     135_aa ykvA DUF1232 domain-containing protein
1505 CAKAPC010000010.1 GCA916715705_00772 CDS open 52026-52211 _na     61_aa FeoB-associated Cys-rich membrane protein
1506 CAKAPC010000010.1 GCA916715705_00774 CDS open 53335-56253 _na     972_aa Outer membrane protein beta-barrel domain-containing protein
1507 CAKAPC010000010.1 GCA916715705_00775 CDS open 56351-57691 _na     446_aa mecR1 Peptidase M56 domain-containing protein
1508 CAKAPC010000010.1 GCA916715705_00776 CDS open 57748-58110 _na     120_aa copY Transcriptional regulator
1509 CAKAPC010000010.1 GCA916715705_00779 CDS open 58966-60270 _na     434_aa nCS2 Xanthine/guanine/uracil/vitamin C permease GhxP/GhxQ%2C nucleobase:cation symporter 2 ( NCS2) family
1510 CAKAPC010000010.1 GCA916715705_00780 CDS open 60298-61074 _na     258_aa nudC NAD(+) diphosphatase
1511 CAKAPC010000010.1 GCA916715705_00781 CDS open 61172-62890 _na     572_aa ushA 5'-Nucleotidase C-terminal domain-containing protein
1512 CAKAPC010000010.1 GCA916715705_00782 CDS open 63247-64581 _na     444_aa gdhA NADP-specific glutamate dehydrogenase
1513 CAKAPC010000010.1 GCA916715705_00783 CDS open 64839-64976 _na     45_aa hypothetical protein
1514 CAKAPC010000010.1 GCA916715705_00784 CDS open 65061-65240 _na     59_aa hypothetical protein
1515 CAKAPC010000010.1 GCA916715705_00731 gene open 17-142
1516 CAKAPC010000010.1 GCA916715705_00732 gene open 236-2257 ligA
1517 CAKAPC010000010.1 GCA916715705_00733 gene open 2337-2732 mutT
1518 CAKAPC010000010.1 GCA916715705_00734 gene open 2909-4294 nhaD
1519 CAKAPC010000010.1 GCA916715705_00735 gene open 5416-6492
1520 CAKAPC010000010.1 GCA916715705_00736 gene open 6541-8499
1521 CAKAPC010000010.1 GCA916715705_00737 gene open 8906-9478 rimI
1522 CAKAPC010000010.1 GCA916715705_00738 gene open 9599-10180
1523 CAKAPC010000010.1 GCA916715705_00739 gene open 10809-12341 recD
1524 CAKAPC010000010.1 GCA916715705_00740 gene open 12365-13249 nUC1
1525 CAKAPC010000010.1 GCA916715705_00741 gene open 14080-14901 rbbA
1526 CAKAPC010000010.1 GCA916715705_00742 gene open 15023-15649
1527 CAKAPC010000010.1 GCA916715705_00743 gene open 15670-16461
1528 CAKAPC010000010.1 GCA916715705_00744 gene open 16489-16848 yhcF
1529 CAKAPC010000010.1 GCA916715705_00745 gene open 17167-18171 recA
1530 CAKAPC010000010.1 GCA916715705_00746 gene open 18324-19562
1531 CAKAPC010000010.1 GCA916715705_00747 gene open 19674-20294
1532 CAKAPC010000010.1 GCA916715705_00748 gene open 20347-20808
1533 CAKAPC010000010.1 GCA916715705_00749 gene open 21030-22652 sfcA
1534 CAKAPC010000010.1 GCA916715705_00750 gene open 23594-27169 nifJ
1535 CAKAPC010000010.1 GCA916715705_00751 gene open 27216-28478
1536 CAKAPC010000010.1 GCA916715705_00752 gene open 28555-29619
1537 CAKAPC010000010.1 GCA916715705_00753 gene open 29995-30156
1538 CAKAPC010000010.1 GCA916715705_00754 gene open 30302-31429
1539 CAKAPC010000010.1 GCA916715705_00755 gene open 31682-33223 rlmD
1540 CAKAPC010000010.1 GCA916715705_00756 gene open 33310-36036 ppdK
1541 CAKAPC010000010.1 GCA916715705_00757 gene open 37266-39854 clpB
1542 CAKAPC010000010.1 GCA916715705_00758 gene open 40056-40406
1543 CAKAPC010000010.1 GCA916715705_00759 gene open 40574-40888
1544 CAKAPC010000010.1 GCA916715705_00760 gene open 40885-41796 yhcC
1545 CAKAPC010000010.1 GCA916715705_00761 gene open 41852-44041 dAP2
1546 CAKAPC010000010.1 GCA916715705_00762 gene open 44448-44852 pqqD
1547 CAKAPC010000010.1 GCA916715705_00763 gene open 44896-45381
1548 CAKAPC010000010.1 GCA916715705_00764 gene open 45387-46274
1549 CAKAPC010000010.1 GCA916715705_00765 gene open 46290-46754
1550 CAKAPC010000010.1 GCA916715705_00766 gene open 46783-47646 rpoD
1551 CAKAPC010000010.1 GCA916715705_00767 gene open 48483-49949 degQ
1552 CAKAPC010000010.1 GCA916715705_00768 gene open 50329-50445
1553 CAKAPC010000010.1 GCA916715705_00770 gene open 51143-51571
1554 CAKAPC010000010.1 GCA916715705_00771 gene open 51596-52003 ykvA
1555 CAKAPC010000010.1 GCA916715705_00772 gene open 52026-52211
1556 CAKAPC010000010.1 GCA916715705_00774 gene open 53335-56253
1557 CAKAPC010000010.1 GCA916715705_00775 gene open 56351-57691 mecR1
1558 CAKAPC010000010.1 GCA916715705_00776 gene open 57748-58110 copY
1559 CAKAPC010000010.1 GCA916715705_00779 gene open 58966-60270 nCS2
1560 CAKAPC010000010.1 GCA916715705_00780 gene open 60298-61074 nudC
1561 CAKAPC010000010.1 GCA916715705_00781 gene open 61172-62890 ushA
1562 CAKAPC010000010.1 GCA916715705_00782 gene open 63247-64581 gdhA
1563 CAKAPC010000010.1 GCA916715705_00783 gene open 64839-64976
1564 CAKAPC010000010.1 GCA916715705_00784 gene open 65061-65240
1565 CAKAPC010000010.1 GCA916715705_00773 gene open 52407-52477 trnC
1566 CAKAPC010000010.1 GCA916715705_00777 gene open 58608-58689 trnY
1567 CAKAPC010000010.1 GCA916715705_00778 gene open 58694-58771 trnV
1568 CAKAPC010000010.1 GCA916715705_00773 tRNA open 52407-52477 trnC tRNA-Cys(gca)
1569 CAKAPC010000010.1 GCA916715705_00777 tRNA open 58608-58689 trnY tRNA-Tyr(gta)
1570 CAKAPC010000010.1 GCA916715705_00778 tRNA open 58694-58771 trnV tRNA-Val(tac)
1571 CAKAPC010000011.1 GCA916715705_00785 CDS open 566-2149 _na     527_aa ctpA PDZ domain-containing protein
1572 CAKAPC010000011.1 GCA916715705_00786 CDS open 2317-2700 _na     127_aa GxxExxY protein
1573 CAKAPC010000011.1 GCA916715705_00787 CDS open 2917-4878 _na     653_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
1574 CAKAPC010000011.1 GCA916715705_00788 CDS open 5065-6213 _na     382_aa N-acetyltransferase domain-containing protein
1575 CAKAPC010000011.1 GCA916715705_00789 CDS open 6553-7950 _na     465_aa THUMP-like domain-containing protein
1576 CAKAPC010000011.1 GCA916715705_00790 CDS open 8075-8806 _na     243_aa ddpX D-alanyl-D-alanine dipeptidase
1577 CAKAPC010000011.1 GCA916715705_00791 CDS open 9061-10257 _na     398_aa sPS1 non-specific serine/threonine protein kinase
1578 CAKAPC010000011.1 GCA916715705_00792 CDS open 11363-12121 _na     252_aa sdhB Fumarate reductase subunit B
1579 CAKAPC010000011.1 GCA916715705_00793 CDS open 12256-14238 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
1580 CAKAPC010000011.1 GCA916715705_00794 CDS open 14277-14963 _na     228_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
1581 CAKAPC010000011.1 GCA916715705_00795 CDS open 15737-16282 _na     181_aa Lipoprotein
1582 CAKAPC010000011.1 GCA916715705_00796 CDS open 16442-19027 _na     861_aa chb F5/8 type C domain protein
1583 CAKAPC010000011.1 GCA916715705_00797 CDS open 19337-20566 _na     409_aa Transporter%2C major facilitator family protein
1584 CAKAPC010000011.1 GCA916715705_00798 CDS open 21144-21821 _na     225_aa Transporter
1585 CAKAPC010000011.1 GCA916715705_00799 CDS open 21919-23817 _na     632_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
1586 CAKAPC010000011.1 GCA916715705_00800 CDS open 23934-24464 _na     176_aa apt adenine phosphoribosyltransferase
1587 CAKAPC010000011.1 GCA916715705_00801 CDS open 24769-26604 _na     611_aa uvrC excinuclease ABC subunit UvrC
1588 CAKAPC010000011.1 GCA916715705_00802 CDS open 26636-27088 _na     150_aa dtd D-aminoacyl-tRNA deacylase
1589 CAKAPC010000011.1 GCA916715705_00803 CDS open 27268-27609 _na     113_aa mazG MazG nucleotide pyrophosphohydrolase domain protein
1590 CAKAPC010000011.1 GCA916715705_00804 CDS open 27812-28759 _na     315_aa deoC deoxyribose-phosphate aldolase
1591 CAKAPC010000011.1 GCA916715705_00805 CDS open 29476-30489 _na     337_aa ispA Octaprenyl-diphosphate synthase
1592 CAKAPC010000011.1 GCA916715705_00806 CDS open 30550-33312 _na     920_aa polA DNA polymerase I
1593 CAKAPC010000011.1 GCA916715705_00807 CDS open 33224-33511 _na     95_aa hypothetical protein
1594 CAKAPC010000011.1 GCA916715705_00808 CDS open 34556-36067 _na     503_aa GH3 auxin-responsive promoter
1595 CAKAPC010000011.1 GCA916715705_00809 CDS open 36143-38188 _na     681_aa sbsA SbsA Ig-like domain-containing protein
1596 CAKAPC010000011.1 GCA916715705_00810 CDS open 38471-38785 _na     104_aa Acyltransferase 3 domain-containing protein
1597 CAKAPC010000011.1 GCA916715705_00811 CDS open 39094-40068 _na     324_aa Acyltransferase
1598 CAKAPC010000011.1 GCA916715705_00812 CDS open 40132-42153 _na     673_aa Por secretion system protein
1599 CAKAPC010000011.1 GCA916715705_00813 CDS open 42150-43034 _na     294_aa Glycosyltransferase 2-like domain-containing protein
1600 CAKAPC010000011.1 GCA916715705_00814 CDS open 43236-43424 _na     62_aa hypothetical protein
1601 CAKAPC010000011.1 GCA916715705_00815 CDS open 43367-43951 _na     194_aa rdgB non-canonical purine NTP diphosphatase
1602 CAKAPC010000011.1 GCA916715705_00816 CDS open 44119-45105 _na     328_aa yitT DUF2179 domain-containing protein
1603 CAKAPC010000011.1 GCA916715705_00817 CDS open 45262-48165 _na     967_aa leuS leucine--tRNA ligase
1604 CAKAPC010000011.1 GCA916715705_00818 CDS open 48718-50934 _na     738_aa TonB-dependent receptor
1605 CAKAPC010000011.1 GCA916715705_00819 CDS open 51557-52129 _na     190_aa DUF1819 domain-containing protein
1606 CAKAPC010000011.1 GCA916715705_00820 CDS open 52176-53690 _na     504_aa rpoN RNA polymerase factor sigma-54
1607 CAKAPC010000011.1 GCA916715705_00821 CDS open 53731-54348 _na     205_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
1608 CAKAPC010000011.1 GCA916715705_00822 CDS open 54477-54983 _na     168_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
1609 CAKAPC010000011.1 GCA916715705_00823 CDS open 55151-57079 _na     642_aa ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase
1610 CAKAPC010000011.1 GCA916715705_00824 CDS open 57541-58599 _na     352_aa lytS Histidine kinase
1611 CAKAPC010000011.1 GCA916715705_00825 CDS open 58513-58734 _na     73_aa hypothetical protein
1612 CAKAPC010000011.1 GCA916715705_00826 CDS open 58771-59412 _na     213_aa ybjT NAD(P)H-binding protein%2C PF13460 family
1613 CAKAPC010000011.1 GCA916715705_00827 CDS open 59454-60443 _na     329_aa trpE aminodeoxychorismate synthase component I
1614 CAKAPC010000011.1 GCA916715705_00828 CDS open 60427-61020 _na     197_aa Chorismate-binding protein
1615 CAKAPC010000011.1 GCA916715705_00829 CDS open 61139-62464 _na     441_aa RNA-directed DNA polymerase
1616 CAKAPC010000011.1 GCA916715705_00785 gene open 566-2149 ctpA
1617 CAKAPC010000011.1 GCA916715705_00786 gene open 2317-2700
1618 CAKAPC010000011.1 GCA916715705_00787 gene open 2917-4878 gyrB
1619 CAKAPC010000011.1 GCA916715705_00788 gene open 5065-6213
1620 CAKAPC010000011.1 GCA916715705_00789 gene open 6553-7950
1621 CAKAPC010000011.1 GCA916715705_00790 gene open 8075-8806 ddpX
1622 CAKAPC010000011.1 GCA916715705_00791 gene open 9061-10257 sPS1
1623 CAKAPC010000011.1 GCA916715705_00792 gene open 11363-12121 sdhB
1624 CAKAPC010000011.1 GCA916715705_00793 gene open 12256-14238 sdhA
1625 CAKAPC010000011.1 GCA916715705_00794 gene open 14277-14963
1626 CAKAPC010000011.1 GCA916715705_00795 gene open 15737-16282
1627 CAKAPC010000011.1 GCA916715705_00796 gene open 16442-19027 chb
1628 CAKAPC010000011.1 GCA916715705_00797 gene open 19337-20566
1629 CAKAPC010000011.1 GCA916715705_00798 gene open 21144-21821
1630 CAKAPC010000011.1 GCA916715705_00799 gene open 21919-23817 mnmG
1631 CAKAPC010000011.1 GCA916715705_00800 gene open 23934-24464 apt
1632 CAKAPC010000011.1 GCA916715705_00801 gene open 24769-26604 uvrC
1633 CAKAPC010000011.1 GCA916715705_00802 gene open 26636-27088 dtd
1634 CAKAPC010000011.1 GCA916715705_00803 gene open 27268-27609 mazG
1635 CAKAPC010000011.1 GCA916715705_00804 gene open 27812-28759 deoC
1636 CAKAPC010000011.1 GCA916715705_00805 gene open 29476-30489 ispA
1637 CAKAPC010000011.1 GCA916715705_00806 gene open 30550-33312 polA
1638 CAKAPC010000011.1 GCA916715705_00807 gene open 33224-33511
1639 CAKAPC010000011.1 GCA916715705_00808 gene open 34556-36067
1640 CAKAPC010000011.1 GCA916715705_00809 gene open 36143-38188 sbsA
1641 CAKAPC010000011.1 GCA916715705_00810 gene open 38471-38785
1642 CAKAPC010000011.1 GCA916715705_00811 gene open 39094-40068
1643 CAKAPC010000011.1 GCA916715705_00812 gene open 40132-42153
1644 CAKAPC010000011.1 GCA916715705_00813 gene open 42150-43034
1645 CAKAPC010000011.1 GCA916715705_00814 gene open 43236-43424
1646 CAKAPC010000011.1 GCA916715705_00815 gene open 43367-43951 rdgB
1647 CAKAPC010000011.1 GCA916715705_00816 gene open 44119-45105 yitT
1648 CAKAPC010000011.1 GCA916715705_00817 gene open 45262-48165 leuS
1649 CAKAPC010000011.1 GCA916715705_00818 gene open 48718-50934
1650 CAKAPC010000011.1 GCA916715705_00819 gene open 51557-52129
1651 CAKAPC010000011.1 GCA916715705_00820 gene open 52176-53690 rpoN
1652 CAKAPC010000011.1 GCA916715705_00821 gene open 53731-54348
1653 CAKAPC010000011.1 GCA916715705_00822 gene open 54477-54983 purE
1654 CAKAPC010000011.1 GCA916715705_00823 gene open 55151-57079 ispG
1655 CAKAPC010000011.1 GCA916715705_00824 gene open 57541-58599 lytS
1656 CAKAPC010000011.1 GCA916715705_00825 gene open 58513-58734
1657 CAKAPC010000011.1 GCA916715705_00826 gene open 58771-59412 ybjT
1658 CAKAPC010000011.1 GCA916715705_00827 gene open 59454-60443 trpE
1659 CAKAPC010000011.1 GCA916715705_00828 gene open 60427-61020
1660 CAKAPC010000011.1 GCA916715705_00829 gene open 61139-62464
1661 CAKAPC010000012.1 GCA916715705_00830 CDS open 1485-1949 _na     154_aa tonB Energy transducer TonB
1662 CAKAPC010000012.1 GCA916715705_00831 CDS open 1962-2444 _na     160_aa tonB TonB C-terminal domain-containing protein
1663 CAKAPC010000012.1 GCA916715705_00832 CDS open 2731-3180 _na     149_aa tonB energy transducer TonB
1664 CAKAPC010000012.1 GCA916715705_00833 CDS open 3487-5004 _na     505_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
1665 CAKAPC010000012.1 GCA916715705_00834 CDS open 5151-5753 _na     200_aa Tail tape measure protein
1666 CAKAPC010000012.1 GCA916715705_00835 CDS open 6538-6861 _na     107_aa Lipoprotein
1667 CAKAPC010000012.1 GCA916715705_00836 CDS open 7025-7690 _na     221_aa uracil-DNA glycosylase
1668 CAKAPC010000012.1 GCA916715705_00837 CDS open 7935-8540 _na     201_aa DUF3109 domain-containing protein
1669 CAKAPC010000012.1 GCA916715705_00838 CDS open 8619-9503 _na     294_aa araC Transcriptional regulator%2C AraC family
1670 CAKAPC010000012.1 GCA916715705_00839 CDS open 9720-11693 _na     657_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1671 CAKAPC010000012.1 GCA916715705_00840 CDS open 11924-13981 _na     685_aa cirA TonB-dependent receptor plug domain-containing protein
1672 CAKAPC010000012.1 GCA916715705_00841 CDS open 14093-15295 _na     400_aa Major facilitator superfamily (MFS) profile domain-containing protein
1673 CAKAPC010000012.1 GCA916715705_00842 CDS open 15481-16845 _na     454_aa hemN oxygen-independent coproporphyrinogen III oxidase
1674 CAKAPC010000012.1 GCA916715705_00843 CDS open 16912-18276 _na     454_aa hemG protoporphyrinogen oxidase
1675 CAKAPC010000012.1 GCA916715705_00844 CDS open 18524-18778 _na     84_aa rpsT 30S ribosomal protein S20
1676 CAKAPC010000012.1 GCA916715705_00845 CDS open 18965-19714 _na     249_aa recO DNA repair protein RecO
1677 CAKAPC010000012.1 GCA916715705_00846 CDS open 19972-21018 _na     348_aa yeiH YeiH family sulfate export transporter
1678 CAKAPC010000012.1 GCA916715705_00847 CDS open 21239-21730 _na     163_aa Putative lipoprotein
1679 CAKAPC010000012.1 GCA916715705_00848 CDS open 21966-23273 _na     435_aa ftsZ cell division protein FtsZ
1680 CAKAPC010000012.1 GCA916715705_00849 CDS open 23351-24811 _na     486_aa ftsA cell division protein FtsA
1681 CAKAPC010000012.1 GCA916715705_00850 CDS open 24862-25800 _na     312_aa ftsQ Cell division protein FtsQ
1682 CAKAPC010000012.1 GCA916715705_00851 CDS open 25843-27219 _na     458_aa murC UDP-N-acetylmuramate--L-alanine ligase
1683 CAKAPC010000012.1 GCA916715705_00852 CDS open 27308-28414 _na     368_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1684 CAKAPC010000012.1 GCA916715705_00853 CDS open 28499-29785 _na     428_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1685 CAKAPC010000012.1 GCA916715705_00854 CDS open 29867-31198 _na     443_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1686 CAKAPC010000012.1 GCA916715705_00855 CDS open 31377-32648 _na     423_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1687 CAKAPC010000012.1 GCA916715705_00856 CDS open 32704-34161 _na     485_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1688 CAKAPC010000012.1 GCA916715705_00857 CDS open 34227-36386 _na     719_aa pASTA Penicillin-binding protein%2C transpeptidase domain protein
1689 CAKAPC010000012.1 GCA916715705_00858 CDS open 36390-36983 _na     197_aa ftsL Cell division protein FtsL
1690 CAKAPC010000012.1 GCA916715705_00859 CDS open 36976-37920 _na     314_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1691 CAKAPC010000012.1 GCA916715705_00860 CDS open 37944-38429 _na     161_aa mraZ division/cell wall cluster transcriptional repressor MraZ
1692 CAKAPC010000012.1 GCA916715705_00861 CDS open 39177-40004 _na     275_aa Putative acyltransferase ACT14924-like acyltransferase domain-containing protein
1693 CAKAPC010000012.1 GCA916715705_00862 CDS open 40085-41083 _na     332_aa Hemolysin
1694 CAKAPC010000012.1 GCA916715705_00863 CDS open 41227-43416 _na     729_aa glnA3 Glutamate--ammonia ligase%2C catalytic domain protein
1695 CAKAPC010000012.1 GCA916715705_00864 CDS open 44241-45371 _na     376_aa araC DNA-binding helix-turn-helix protein
1696 CAKAPC010000012.1 GCA916715705_00865 CDS open 45599-47755 _na     718_aa recD AAA+ ATPase domain-containing protein
1697 CAKAPC010000012.1 GCA916715705_00866 CDS open 47955-48080 _na     41_aa Lipoprotein
1698 CAKAPC010000012.1 GCA916715705_00867 CDS open 48551-49462 _na     303_aa TIGR02757 family protein
1699 CAKAPC010000012.1 GCA916715705_00868 CDS open 49594-50049 _na     151_aa bcp thioredoxin-dependent thiol peroxidase
1700 CAKAPC010000012.1 GCA916715705_00869 CDS open 50347-51579 _na     410_aa LL-diaminopimelate aminotransferase
1701 CAKAPC010000012.1 GCA916715705_00870 CDS open 51656-52552 _na     298_aa dapF diaminopimelate epimerase
1702 CAKAPC010000012.1 GCA916715705_00871 CDS open 53174-55204 _na     676_aa pepO Peptidase M13 C-terminal domain-containing protein
1703 CAKAPC010000012.1 GCA916715705_00830 gene open 1485-1949 tonB
1704 CAKAPC010000012.1 GCA916715705_00831 gene open 1962-2444 tonB
1705 CAKAPC010000012.1 GCA916715705_00832 gene open 2731-3180 tonB
1706 CAKAPC010000012.1 GCA916715705_00833 gene open 3487-5004 gpmI
1707 CAKAPC010000012.1 GCA916715705_00834 gene open 5151-5753
1708 CAKAPC010000012.1 GCA916715705_00835 gene open 6538-6861
1709 CAKAPC010000012.1 GCA916715705_00836 gene open 7025-7690
1710 CAKAPC010000012.1 GCA916715705_00837 gene open 7935-8540
1711 CAKAPC010000012.1 GCA916715705_00838 gene open 8619-9503 araC
1712 CAKAPC010000012.1 GCA916715705_00839 gene open 9720-11693 gyrB
1713 CAKAPC010000012.1 GCA916715705_00840 gene open 11924-13981 cirA
1714 CAKAPC010000012.1 GCA916715705_00841 gene open 14093-15295
1715 CAKAPC010000012.1 GCA916715705_00842 gene open 15481-16845 hemN
1716 CAKAPC010000012.1 GCA916715705_00843 gene open 16912-18276 hemG
1717 CAKAPC010000012.1 GCA916715705_00844 gene open 18524-18778 rpsT
1718 CAKAPC010000012.1 GCA916715705_00845 gene open 18965-19714 recO
1719 CAKAPC010000012.1 GCA916715705_00846 gene open 19972-21018 yeiH
1720 CAKAPC010000012.1 GCA916715705_00847 gene open 21239-21730
1721 CAKAPC010000012.1 GCA916715705_00848 gene open 21966-23273 ftsZ
1722 CAKAPC010000012.1 GCA916715705_00849 gene open 23351-24811 ftsA
1723 CAKAPC010000012.1 GCA916715705_00850 gene open 24862-25800 ftsQ
1724 CAKAPC010000012.1 GCA916715705_00851 gene open 25843-27219 murC
1725 CAKAPC010000012.1 GCA916715705_00852 gene open 27308-28414 murG
1726 CAKAPC010000012.1 GCA916715705_00853 gene open 28499-29785 ftsW
1727 CAKAPC010000012.1 GCA916715705_00854 gene open 29867-31198 murD
1728 CAKAPC010000012.1 GCA916715705_00855 gene open 31377-32648 mraY
1729 CAKAPC010000012.1 GCA916715705_00856 gene open 32704-34161 murE
1730 CAKAPC010000012.1 GCA916715705_00857 gene open 34227-36386 pASTA
1731 CAKAPC010000012.1 GCA916715705_00858 gene open 36390-36983 ftsL
1732 CAKAPC010000012.1 GCA916715705_00859 gene open 36976-37920 rsmH
1733 CAKAPC010000012.1 GCA916715705_00860 gene open 37944-38429 mraZ
1734 CAKAPC010000012.1 GCA916715705_00861 gene open 39177-40004
1735 CAKAPC010000012.1 GCA916715705_00862 gene open 40085-41083
1736 CAKAPC010000012.1 GCA916715705_00863 gene open 41227-43416 glnA3
1737 CAKAPC010000012.1 GCA916715705_00864 gene open 44241-45371 araC
1738 CAKAPC010000012.1 GCA916715705_00865 gene open 45599-47755 recD
1739 CAKAPC010000012.1 GCA916715705_00866 gene open 47955-48080
1740 CAKAPC010000012.1 GCA916715705_00867 gene open 48551-49462
1741 CAKAPC010000012.1 GCA916715705_00868 gene open 49594-50049 bcp
1742 CAKAPC010000012.1 GCA916715705_00869 gene open 50347-51579
1743 CAKAPC010000012.1 GCA916715705_00870 gene open 51656-52552 dapF
1744 CAKAPC010000012.1 GCA916715705_00871 gene open 53174-55204 pepO
1745 CAKAPC010000013.1 GCA916715705_00915 gene open 51334-51442 rrf
1746 CAKAPC010000013.1 GCA916715705_00915 rRNA open 51334-51442 rrf 5S ribosomal RNA
1747 CAKAPC010000013.1 GCA916715705_00872 CDS open 247-2631 _na     794_aa cirA TonB-dependent receptor plug domain protein
1748 CAKAPC010000013.1 GCA916715705_00873 CDS open 3667-4134 _na     155_aa Putative 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
1749 CAKAPC010000013.1 GCA916715705_00874 CDS open 4224-4757 _na     177_aa TonB-dependent receptor
1750 CAKAPC010000013.1 GCA916715705_00875 CDS open 5152-6231 _na     359_aa DUF262 domain-containing protein
1751 CAKAPC010000013.1 GCA916715705_00876 CDS open 6228-6896 _na     222_aa MAE_28990/MAE_18760 family HEPN-like nuclease
1752 CAKAPC010000013.1 GCA916715705_00877 CDS open 7912-8157 _na     81_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1753 CAKAPC010000013.1 GCA916715705_00878 CDS open 8416-9390 _na     324_aa Glycosidase
1754 CAKAPC010000013.1 GCA916715705_00879 CDS open 9538-11793 _na     751_aa Putative alpha-1%2C2-mannosidase
1755 CAKAPC010000013.1 GCA916715705_00880 CDS open 12135-14231 _na     698_aa beta-N-acetylhexosaminidase
1756 CAKAPC010000013.1 GCA916715705_00881 CDS open 14307-16457 _na     716_aa Alpha-1%2C2-mannosidase
1757 CAKAPC010000013.1 GCA916715705_00882 CDS open 16632-17723 _na     363_aa Mucin-desulfating sulfatase
1758 CAKAPC010000013.1 GCA916715705_00883 CDS open 17720-18373 _na     217_aa Carbohydrate-binding domain-containing protein
1759 CAKAPC010000013.1 GCA916715705_00885 CDS open 19364-20305 _na     313_aa gph HAD hydrolase%2C family IA%2C variant 3
1760 CAKAPC010000013.1 GCA916715705_00886 CDS open 20490-21554 _na     354_aa purR HTH lacI-type domain-containing protein
1761 CAKAPC010000013.1 GCA916715705_00887 CDS open 21994-23277 _na     427_aa nhaC Na+/H+ antiporter NhaC-like C-terminal domain-containing protein
1762 CAKAPC010000013.1 GCA916715705_00888 CDS open 23403-24218 _na     271_aa DUF4393 domain-containing protein
1763 CAKAPC010000013.1 GCA916715705_00889 CDS open 24404-26014 _na     536_aa chb beta-N-acetylhexosaminidase
1764 CAKAPC010000013.1 GCA916715705_00890 CDS open 26669-28399 _na     576_aa Glycosyl hydrolase family 25
1765 CAKAPC010000013.1 GCA916715705_00891 CDS open 28999-31047 _na     682_aa fepA TonB-dependent receptor-like beta-barrel domain-containing protein
1766 CAKAPC010000013.1 GCA916715705_00892 CDS open 31142-31471 _na     109_aa copZ HMA domain-containing protein
1767 CAKAPC010000013.1 GCA916715705_00893 CDS open 31749-32576 _na     275_aa ydiL CAAX amino terminal protease family protein
1768 CAKAPC010000013.1 GCA916715705_00894 CDS open 32588-33559 _na     323_aa ribF bifunctional riboflavin kinase/FAD synthetase
1769 CAKAPC010000013.1 GCA916715705_00896 CDS open 34196-35419 _na     407_aa xerD Tyr recombinase domain-containing protein
1770 CAKAPC010000013.1 GCA916715705_00897 CDS open 35455-35919 _na     154_aa DUF1896 domain-containing protein
1771 CAKAPC010000013.1 GCA916715705_00898 CDS open 36059-36406 _na     115_aa AI-2E family transporter
1772 CAKAPC010000013.1 GCA916715705_00899 CDS open 36760-37191 _na     143_aa Molybdenum ABC transporter ATP-binding protein
1773 CAKAPC010000013.1 GCA916715705_00900 CDS open 37197-37616 _na     139_aa PcfK-like protein
1774 CAKAPC010000013.1 GCA916715705_00901 CDS open 37621-38895 _na     424_aa PcfJ-like protein
1775 CAKAPC010000013.1 GCA916715705_00902 CDS open 38921-39175 _na     84_aa hypothetical protein
1776 CAKAPC010000013.1 GCA916715705_00903 CDS open 39132-39398 _na     88_aa Helicase
1777 CAKAPC010000013.1 GCA916715705_00904 CDS open 39508-40521 _na     337_aa phage exclusion protein Lit family protein
1778 CAKAPC010000013.1 GCA916715705_00905 CDS open 41033-41890 _na     285_aa hypothetical protein
1779 CAKAPC010000013.1 GCA916715705_00906 CDS open 41919-42341 _na     140_aa Transposase DDE domain-containing protein
1780 CAKAPC010000013.1 GCA916715705_00907 CDS open 42746-44056 _na     436_aa Response receiver domain-containing protein
1781 CAKAPC010000013.1 GCA916715705_00908 CDS open 44060-46219 _na     719_aa sensor histidine kinase
1782 CAKAPC010000013.1 GCA916715705_00909 CDS open 46216-47472 _na     418_aa DNA cytosine methyltransferase
1783 CAKAPC010000013.1 GCA916715705_00910 CDS open 47863-48819 _na     318_aa transposase
1784 CAKAPC010000013.1 GCA916715705_00911 CDS open 48824-49165 _na     113_aa Transposase DDE domain-containing protein
1785 CAKAPC010000013.1 GCA916715705_00912 CDS open 49636-50043 _na     135_aa hypothetical protein
1786 CAKAPC010000013.1 GCA916715705_00913 CDS open 50200-50304 _na     34_aa hypothetical protein
1787 CAKAPC010000013.1 GCA916715705_00914 CDS open 50366-50707 _na     113_aa Transposase DDE domain-containing protein
1788 CAKAPC010000013.1 GCA916715705_00916 CDS open 51450-51800 _na     116_aa Phage protein
1789 CAKAPC010000013.1 GCA916715705_00917 CDS open 51919-52425 _na     168_aa Lysozyme
1790 CAKAPC010000013.1 GCA916715705_00918 CDS open 52437-52895 _na     152_aa traQ Conjugative transposon protein TraQ
1791 CAKAPC010000013.1 GCA916715705_00919 CDS open 52908-53498 _na     196_aa traO Conjugative transposon protein TraO
1792 CAKAPC010000013.1 GCA916715705_00920 CDS open 53492-54478 _na     328_aa traN conjugative transposon protein TraN
1793 CAKAPC010000013.1 GCA916715705_00921 CDS open 54490-55425 _na     311_aa traM conjugative transposon protein TraM
1794 CAKAPC010000013.1 GCA916715705_00872 gene open 247-2631 cirA
1795 CAKAPC010000013.1 GCA916715705_00873 gene open 3667-4134
1796 CAKAPC010000013.1 GCA916715705_00874 gene open 4224-4757
1797 CAKAPC010000013.1 GCA916715705_00875 gene open 5152-6231
1798 CAKAPC010000013.1 GCA916715705_00876 gene open 6228-6896
1799 CAKAPC010000013.1 GCA916715705_00877 gene open 7912-8157
1800 CAKAPC010000013.1 GCA916715705_00878 gene open 8416-9390
1801 CAKAPC010000013.1 GCA916715705_00879 gene open 9538-11793
1802 CAKAPC010000013.1 GCA916715705_00880 gene open 12135-14231
1803 CAKAPC010000013.1 GCA916715705_00881 gene open 14307-16457
1804 CAKAPC010000013.1 GCA916715705_00882 gene open 16632-17723
1805 CAKAPC010000013.1 GCA916715705_00883 gene open 17720-18373
1806 CAKAPC010000013.1 GCA916715705_00885 gene open 19364-20305 gph
1807 CAKAPC010000013.1 GCA916715705_00886 gene open 20490-21554 purR
1808 CAKAPC010000013.1 GCA916715705_00887 gene open 21994-23277 nhaC
1809 CAKAPC010000013.1 GCA916715705_00888 gene open 23403-24218
1810 CAKAPC010000013.1 GCA916715705_00889 gene open 24404-26014 chb
1811 CAKAPC010000013.1 GCA916715705_00890 gene open 26669-28399
1812 CAKAPC010000013.1 GCA916715705_00891 gene open 28999-31047 fepA
1813 CAKAPC010000013.1 GCA916715705_00892 gene open 31142-31471 copZ
1814 CAKAPC010000013.1 GCA916715705_00893 gene open 31749-32576 ydiL
1815 CAKAPC010000013.1 GCA916715705_00894 gene open 32588-33559 ribF
1816 CAKAPC010000013.1 GCA916715705_00896 gene open 34196-35419 xerD
1817 CAKAPC010000013.1 GCA916715705_00897 gene open 35455-35919
1818 CAKAPC010000013.1 GCA916715705_00898 gene open 36059-36406
1819 CAKAPC010000013.1 GCA916715705_00899 gene open 36760-37191
1820 CAKAPC010000013.1 GCA916715705_00900 gene open 37197-37616
1821 CAKAPC010000013.1 GCA916715705_00901 gene open 37621-38895
1822 CAKAPC010000013.1 GCA916715705_00902 gene open 38921-39175
1823 CAKAPC010000013.1 GCA916715705_00903 gene open 39132-39398
1824 CAKAPC010000013.1 GCA916715705_00904 gene open 39508-40521
1825 CAKAPC010000013.1 GCA916715705_00905 gene open 41033-41890
1826 CAKAPC010000013.1 GCA916715705_00906 gene open 41919-42341
1827 CAKAPC010000013.1 GCA916715705_00907 gene open 42746-44056
1828 CAKAPC010000013.1 GCA916715705_00908 gene open 44060-46219
1829 CAKAPC010000013.1 GCA916715705_00909 gene open 46216-47472
1830 CAKAPC010000013.1 GCA916715705_00910 gene open 47863-48819
1831 CAKAPC010000013.1 GCA916715705_00911 gene open 48824-49165
1832 CAKAPC010000013.1 GCA916715705_00912 gene open 49636-50043
1833 CAKAPC010000013.1 GCA916715705_00913 gene open 50200-50304
1834 CAKAPC010000013.1 GCA916715705_00914 gene open 50366-50707
1835 CAKAPC010000013.1 GCA916715705_00916 gene open 51450-51800
1836 CAKAPC010000013.1 GCA916715705_00917 gene open 51919-52425
1837 CAKAPC010000013.1 GCA916715705_00918 gene open 52437-52895 traQ
1838 CAKAPC010000013.1 GCA916715705_00919 gene open 52908-53498 traO
1839 CAKAPC010000013.1 GCA916715705_00920 gene open 53492-54478 traN
1840 CAKAPC010000013.1 GCA916715705_00921 gene open 54490-55425 traM
1841 CAKAPC010000013.1 GCA916715705_00884 gene open 19189-19261 trnfM
1842 CAKAPC010000013.1 GCA916715705_00895 gene open 33812-33885 trnI
1843 CAKAPC010000013.1 GCA916715705_00884 tRNA open 19189-19261 trnfM tRNA-fMet(cat)
1844 CAKAPC010000013.1 GCA916715705_00895 tRNA open 33812-33885 trnI tRNA-Ile2(cat)
1845 CAKAPC010000014.1 GCA916715705_00922 CDS open 32-733 _na     233_aa ragA Membrane receptor RagA
1846 CAKAPC010000014.1 GCA916715705_00923 CDS open 745-1458 _na     237_aa Carboxypeptidase-like regulatory domain-containing protein
1847 CAKAPC010000014.1 GCA916715705_00924 CDS open 1470-2204 _na     244_aa Carboxypeptidase-like regulatory domain-containing protein
1848 CAKAPC010000014.1 GCA916715705_00925 CDS open 2216-2929 _na     237_aa Carboxypeptidase-like regulatory domain-containing protein
1849 CAKAPC010000014.1 GCA916715705_00926 CDS open 3433-4245 _na     270_aa gldB Gliding motility protein GldB
1850 CAKAPC010000014.1 GCA916715705_00927 CDS open 4367-5404 _na     345_aa wcaE Glycosyltransferase 2-like domain-containing protein
1851 CAKAPC010000014.1 GCA916715705_00928 CDS open 5401-6750 _na     449_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
1852 CAKAPC010000014.1 GCA916715705_00929 CDS open 7092-7277 _na     61_aa Entericidin
1853 CAKAPC010000014.1 GCA916715705_00930 CDS open 7961-8827 _na     288_aa araC AraC family transcriptional regulator
1854 CAKAPC010000014.1 GCA916715705_00931 CDS open 9026-10303 _na     425_aa tolC TolC family protein
1855 CAKAPC010000014.1 GCA916715705_00932 CDS open 10323-11339 _na     338_aa hlyD HlyD family secretion protein
1856 CAKAPC010000014.1 GCA916715705_00933 CDS open 11355-12833 _na     492_aa lptB LPS export ABC transporter ATP-binding protein
1857 CAKAPC010000014.1 GCA916715705_00934 CDS open 12867-13925 _na     352_aa Transport permease protein
1858 CAKAPC010000014.1 GCA916715705_00935 CDS open 14025-15020 _na     331_aa ABC-2 family transporter protein
1859 CAKAPC010000014.1 GCA916715705_00936 CDS open 15841-16200 _na     119_aa Lipocalin-like domain-containing protein
1860 CAKAPC010000014.1 GCA916715705_00937 CDS open 16221-16733 _na     170_aa Lipoprotein
1861 CAKAPC010000014.1 GCA916715705_00938 CDS open 16743-17285 _na     180_aa Lipoprotein
1862 CAKAPC010000014.1 GCA916715705_00939 CDS open 17457-17717 _na     86_aa Sugar efflux transporter for intercellular exchange
1863 CAKAPC010000014.1 GCA916715705_00940 CDS open 17907-20597 _na     896_aa polC DNA 3'-5' helicase
1864 CAKAPC010000014.1 GCA916715705_00941 CDS open 20983-21996 _na     337_aa acyltransferase
1865 CAKAPC010000014.1 GCA916715705_00942 CDS open 22173-22664 _na     163_aa dnaQ DNA polymerase III%2C epsilon subunit domain protein
1866 CAKAPC010000014.1 GCA916715705_00943 CDS open 23324-24361 _na     345_aa pheS phenylalanine--tRNA ligase subunit alpha
1867 CAKAPC010000014.1 GCA916715705_00944 CDS open 24503-25360 _na     285_aa DUF4348 domain-containing protein
1868 CAKAPC010000014.1 GCA916715705_00945 CDS open 25511-26521 _na     336_aa murB UDP-N-acetylmuramate dehydrogenase
1869 CAKAPC010000014.1 GCA916715705_00946 CDS open 26638-27468 _na     276_aa MBL fold metallo-hydrolase
1870 CAKAPC010000014.1 GCA916715705_00947 CDS open 27716-30325 _na     869_aa Fimbrillin family protein
1871 CAKAPC010000014.1 GCA916715705_00948 CDS open 30375-30572 _na     65_aa Lasso RiPP family leader peptide-containing protein
1872 CAKAPC010000014.1 GCA916715705_00949 CDS open 31295-32545 _na     416_aa hflX GTPase HflX
1873 CAKAPC010000014.1 GCA916715705_00950 CDS open 32666-34519 _na     617_aa glgC DUF6819 domain-containing protein
1874 CAKAPC010000014.1 GCA916715705_00951 CDS open 34567-37497 _na     976_aa pqqL Insulinase family protein
1875 CAKAPC010000014.1 GCA916715705_00952 CDS open 37594-39240 _na     548_aa ttdA Fumarate hydratase class I
1876 CAKAPC010000014.1 GCA916715705_00953 CDS open 40215-40970 _na     251_aa GLPGLI family protein
1877 CAKAPC010000014.1 GCA916715705_00954 CDS open 40981-43533 _na     850_aa Outer membrane protein beta-barrel domain-containing protein
1878 CAKAPC010000014.1 GCA916715705_00955 CDS open 43583-44317 _na     244_aa Bacterial Pleckstrin-like y domain-containing protein
1879 CAKAPC010000014.1 GCA916715705_00956 CDS open 44323-44475 _na     50_aa Lipoprotein
1880 CAKAPC010000014.1 GCA916715705_00957 CDS open 44575-45321 _na     248_aa ftsE Putative cell division ATP-binding protein FtsE
1881 CAKAPC010000014.1 GCA916715705_00958 CDS open 45368-46684 _na     438_aa metL1 Aspartokinase
1882 CAKAPC010000014.1 GCA916715705_00959 CDS open 46830-47987 _na     385_aa lysA diaminopimelate decarboxylase
1883 CAKAPC010000014.1 GCA916715705_00960 CDS open 48007-49245 _na     412_aa Glycosyltransferase
1884 CAKAPC010000014.1 GCA916715705_00961 CDS open 49246-50403 _na     385_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
1885 CAKAPC010000014.1 GCA916715705_00962 CDS open 50407-52419 _na     670_aa fbpC Fructose-1%2C6-bisphosphatase class 3
1886 CAKAPC010000014.1 GCA916715705_00963 CDS open 52615-54450 _na     611_aa Carboxylic ester hydrolase
1887 CAKAPC010000014.1 GCA916715705_00964 CDS open 54986-55081 _na     31_aa hypothetical protein
1888 CAKAPC010000014.1 GCA916715705_00922 gene open 32-733 ragA
1889 CAKAPC010000014.1 GCA916715705_00923 gene open 745-1458
1890 CAKAPC010000014.1 GCA916715705_00924 gene open 1470-2204
1891 CAKAPC010000014.1 GCA916715705_00925 gene open 2216-2929
1892 CAKAPC010000014.1 GCA916715705_00926 gene open 3433-4245 gldB
1893 CAKAPC010000014.1 GCA916715705_00927 gene open 4367-5404 wcaE
1894 CAKAPC010000014.1 GCA916715705_00928 gene open 5401-6750 mtaB
1895 CAKAPC010000014.1 GCA916715705_00929 gene open 7092-7277
1896 CAKAPC010000014.1 GCA916715705_00930 gene open 7961-8827 araC
1897 CAKAPC010000014.1 GCA916715705_00931 gene open 9026-10303 tolC
1898 CAKAPC010000014.1 GCA916715705_00932 gene open 10323-11339 hlyD
1899 CAKAPC010000014.1 GCA916715705_00933 gene open 11355-12833 lptB
1900 CAKAPC010000014.1 GCA916715705_00934 gene open 12867-13925
1901 CAKAPC010000014.1 GCA916715705_00935 gene open 14025-15020
1902 CAKAPC010000014.1 GCA916715705_00936 gene open 15841-16200
1903 CAKAPC010000014.1 GCA916715705_00937 gene open 16221-16733
1904 CAKAPC010000014.1 GCA916715705_00938 gene open 16743-17285
1905 CAKAPC010000014.1 GCA916715705_00939 gene open 17457-17717
1906 CAKAPC010000014.1 GCA916715705_00940 gene open 17907-20597 polC
1907 CAKAPC010000014.1 GCA916715705_00941 gene open 20983-21996
1908 CAKAPC010000014.1 GCA916715705_00942 gene open 22173-22664 dnaQ
1909 CAKAPC010000014.1 GCA916715705_00943 gene open 23324-24361 pheS
1910 CAKAPC010000014.1 GCA916715705_00944 gene open 24503-25360
1911 CAKAPC010000014.1 GCA916715705_00945 gene open 25511-26521 murB
1912 CAKAPC010000014.1 GCA916715705_00946 gene open 26638-27468
1913 CAKAPC010000014.1 GCA916715705_00947 gene open 27716-30325
1914 CAKAPC010000014.1 GCA916715705_00948 gene open 30375-30572
1915 CAKAPC010000014.1 GCA916715705_00949 gene open 31295-32545 hflX
1916 CAKAPC010000014.1 GCA916715705_00950 gene open 32666-34519 glgC
1917 CAKAPC010000014.1 GCA916715705_00951 gene open 34567-37497 pqqL
1918 CAKAPC010000014.1 GCA916715705_00952 gene open 37594-39240 ttdA
1919 CAKAPC010000014.1 GCA916715705_00953 gene open 40215-40970
1920 CAKAPC010000014.1 GCA916715705_00954 gene open 40981-43533
1921 CAKAPC010000014.1 GCA916715705_00955 gene open 43583-44317
1922 CAKAPC010000014.1 GCA916715705_00956 gene open 44323-44475
1923 CAKAPC010000014.1 GCA916715705_00957 gene open 44575-45321 ftsE
1924 CAKAPC010000014.1 GCA916715705_00958 gene open 45368-46684 metL1
1925 CAKAPC010000014.1 GCA916715705_00959 gene open 46830-47987 lysA
1926 CAKAPC010000014.1 GCA916715705_00960 gene open 48007-49245
1927 CAKAPC010000014.1 GCA916715705_00961 gene open 49246-50403
1928 CAKAPC010000014.1 GCA916715705_00962 gene open 50407-52419 fbpC
1929 CAKAPC010000014.1 GCA916715705_00963 gene open 52615-54450
1930 CAKAPC010000014.1 GCA916715705_00964 gene open 54986-55081
1931 CAKAPC010000015.1 repeat_region open 48509-48706 CRISPR array with 3 repeats of length 41%2C consensus sequence TTCTATCTTCTTTTTTTGTATCACTGTAACAGTTTTCGGTT and spacer length 34
1932 CAKAPC010000015.1 GCA916715705_00965 CDS open 646-1623 _na     325_aa nUC1 DNA/RNA non-specific endonuclease
1933 CAKAPC010000015.1 GCA916715705_00966 CDS open 1837-2088 _na     83_aa rpmE type B 50S ribosomal protein L31
1934 CAKAPC010000015.1 GCA916715705_00967 CDS open 2414-3760 _na     448_aa DNA-binding protein
1935 CAKAPC010000015.1 GCA916715705_00968 CDS open 3784-5019 _na     411_aa DUF5689 domain-containing protein
1936 CAKAPC010000015.1 GCA916715705_00969 CDS open 5041-7620 _na     859_aa TonB-dependent receptor
1937 CAKAPC010000015.1 GCA916715705_00970 CDS open 7916-8959 _na     347_aa Endonuclease/exonuclease/phosphatase family protein
1938 CAKAPC010000015.1 GCA916715705_00971 CDS open 9019-9603 _na     194_aa mug Uracil-DNA glycosylase family protein
1939 CAKAPC010000015.1 GCA916715705_00972 CDS open 9666-10292 _na     208_aa udk uridine kinase
1940 CAKAPC010000015.1 GCA916715705_00973 CDS open 10966-11418 _na     150_aa Lipoprotein
1941 CAKAPC010000015.1 GCA916715705_00974 CDS open 11422-11763 _na     113_aa DNA-directed RNA polymerase subunit omega
1942 CAKAPC010000015.1 GCA916715705_00975 CDS open 11798-12622 _na     274_aa bamD Outer membrane assembly lipoprotein YfiO
1943 CAKAPC010000015.1 GCA916715705_00976 CDS open 12772-14817 _na     681_aa uvrB excinuclease ABC subunit UvrB
1944 CAKAPC010000015.1 GCA916715705_00977 CDS open 15667-16626 _na     319_aa DUF4468 domain-containing protein
1945 CAKAPC010000015.1 GCA916715705_00978 CDS open 16779-17009 _na     76_aa mscS Mechanosensitive ion channel protein MscS
1946 CAKAPC010000015.1 GCA916715705_00979 CDS open 17010-19406 _na     798_aa Porin
1947 CAKAPC010000015.1 GCA916715705_00980 CDS open 19427-20368 _na     313_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
1948 CAKAPC010000015.1 GCA916715705_00981 CDS open 20466-21110 _na     214_aa HD domain-containing protein
1949 CAKAPC010000015.1 GCA916715705_00982 CDS open 21126-21593 _na     155_aa tadA Guanine deaminase
1950 CAKAPC010000015.1 GCA916715705_00983 CDS open 21685-22146 _na     153_aa Lipoprotein
1951 CAKAPC010000015.1 GCA916715705_00984 CDS open 22725-25973 _na     1082_aa fepA SusC/RagA family TonB-linked outer membrane protein
1952 CAKAPC010000015.1 GCA916715705_00985 CDS open 25989-28061 _na     690_aa Starch-binding protein%2C SusD-like family
1953 CAKAPC010000015.1 GCA916715705_00986 CDS open 28337-28486 _na     49_aa hypothetical protein
1954 CAKAPC010000015.1 GCA916715705_00987 CDS open 28530-29951 _na     473_aa tolC TolC family protein
1955 CAKAPC010000015.1 GCA916715705_00988 CDS open 29935-33135 _na     1066_aa acrB Efflux RND transporter permease subunit
1956 CAKAPC010000015.1 GCA916715705_00989 CDS open 33138-34217 _na     359_aa acrA Efflux RND transporter periplasmic adaptor subunit
1957 CAKAPC010000015.1 GCA916715705_00990 CDS open 35075-35215 _na     46_aa hypothetical protein
1958 CAKAPC010000015.1 GCA916715705_00991 CDS open 35595-36893 _na     432_aa mviM Oxidoreductase%2C NAD-binding domain protein
1959 CAKAPC010000015.1 GCA916715705_00992 CDS open 37220-39466 _na     748_aa pflB formate C-acetyltransferase
1960 CAKAPC010000015.1 GCA916715705_00993 CDS open 39513-40241 _na     242_aa pflA pyruvate formate-lyase-activating protein
1961 CAKAPC010000015.1 GCA916715705_00994 CDS open 41077-41583 _na     168_aa nimA Pyridoxamine 5'-phosphate oxidase putative domain-containing protein
1962 CAKAPC010000015.1 GCA916715705_00995 CDS open 41677-42897 _na     406_aa Flavoprotein family protein
1963 CAKAPC010000015.1 GCA916715705_00997 CDS open 43479-45500 _na     673_aa ATP-binding protein
1964 CAKAPC010000015.1 GCA916715705_00998 CDS open 45528-46532 _na     334_aa Toll/interleukin-1 receptor domain-containing protein
1965 CAKAPC010000015.1 GCA916715705_00999 CDS open 46529-46882 _na     117_aa WYL domain-containing protein
1966 CAKAPC010000015.1 GCA916715705_01000 CDS open 47203-48507 _na     434_aa AAA domain-containing protein
1967 CAKAPC010000015.1 GCA916715705_01001 CDS open 49115-49369 _na     84_aa hypothetical protein
1968 CAKAPC010000015.1 GCA916715705_01002 CDS open 49393-49974 _na     193_aa hypothetical protein
1969 CAKAPC010000015.1 GCA916715705_01003 CDS open 50000-50239 _na     79_aa hypothetical protein
1970 CAKAPC010000015.1 GCA916715705_01004 CDS open 50202-50438 _na     78_aa ABC transporter permease
1971 CAKAPC010000015.1 GCA916715705_01005 CDS open 50545-50775 _na     76_aa hypothetical protein
1972 CAKAPC010000015.1 GCA916715705_01006 CDS open 50772-51059 _na     95_aa Excisionase
1973 CAKAPC010000015.1 GCA916715705_01007 CDS open 52059-53333 _na     424_aa hipA HipA-like protein
1974 CAKAPC010000015.1 GCA916715705_01008 CDS open 53337-53654 _na     105_aa DNA-binding helix-turn-helix protein
1975 CAKAPC010000015.1 GCA916715705_00965 gene open 646-1623 nUC1
1976 CAKAPC010000015.1 GCA916715705_00966 gene open 1837-2088 rpmE
1977 CAKAPC010000015.1 GCA916715705_00967 gene open 2414-3760
1978 CAKAPC010000015.1 GCA916715705_00968 gene open 3784-5019
1979 CAKAPC010000015.1 GCA916715705_00969 gene open 5041-7620
1980 CAKAPC010000015.1 GCA916715705_00970 gene open 7916-8959
1981 CAKAPC010000015.1 GCA916715705_00971 gene open 9019-9603 mug
1982 CAKAPC010000015.1 GCA916715705_00972 gene open 9666-10292 udk
1983 CAKAPC010000015.1 GCA916715705_00973 gene open 10966-11418
1984 CAKAPC010000015.1 GCA916715705_00974 gene open 11422-11763
1985 CAKAPC010000015.1 GCA916715705_00975 gene open 11798-12622 bamD
1986 CAKAPC010000015.1 GCA916715705_00976 gene open 12772-14817 uvrB
1987 CAKAPC010000015.1 GCA916715705_00977 gene open 15667-16626
1988 CAKAPC010000015.1 GCA916715705_00978 gene open 16779-17009 mscS
1989 CAKAPC010000015.1 GCA916715705_00979 gene open 17010-19406
1990 CAKAPC010000015.1 GCA916715705_00980 gene open 19427-20368 menA
1991 CAKAPC010000015.1 GCA916715705_00981 gene open 20466-21110
1992 CAKAPC010000015.1 GCA916715705_00982 gene open 21126-21593 tadA
1993 CAKAPC010000015.1 GCA916715705_00983 gene open 21685-22146
1994 CAKAPC010000015.1 GCA916715705_00984 gene open 22725-25973 fepA
1995 CAKAPC010000015.1 GCA916715705_00985 gene open 25989-28061
1996 CAKAPC010000015.1 GCA916715705_00986 gene open 28337-28486
1997 CAKAPC010000015.1 GCA916715705_00987 gene open 28530-29951 tolC
1998 CAKAPC010000015.1 GCA916715705_00988 gene open 29935-33135 acrB
1999 CAKAPC010000015.1 GCA916715705_00989 gene open 33138-34217 acrA
2000 CAKAPC010000015.1 GCA916715705_00990 gene open 35075-35215