BAKTAGenome Explorer: Leptotrichia sp. HMT-221 (GCA_916719885.1)
Select a Genome:
|
BAKTA Annotations for GCA_916719885.1
|
Search & Sort all 2222 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAKAPN010000001.1 | GCA916719885_00001 | CDS | open | 194-361 | _na 55_aa | hypothetical protein | |
| 2 | CAKAPN010000001.1 | GCA916719885_00002 | CDS | open | 1094-1285 | _na 63_aa | hypothetical protein | |
| 3 | CAKAPN010000001.1 | GCA916719885_00003 | CDS | open | 2920-3759 | _na 279_aa | cysW | Sulfate ABC transporter%2C inner membrane subunit |
| 4 | CAKAPN010000001.1 | GCA916719885_00004 | CDS | open | 3774-4622 | _na 282_aa | cysT | sulfate ABC transporter permease subunit CysT |
| 5 | CAKAPN010000001.1 | GCA916719885_00005 | CDS | open | 4654-5685 | _na 343_aa | sbp | Sulfate ABC transporter%2C periplasmic sulfate-binding protein |
| 6 | CAKAPN010000001.1 | GCA916719885_00006 | CDS | open | 5723-7408 | _na 561_aa | cysN | sulfate adenylyltransferase |
| 7 | CAKAPN010000001.1 | GCA916719885_00007 | CDS | open | 7408-8337 | _na 309_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 8 | CAKAPN010000001.1 | GCA916719885_00008 | CDS | open | 8370-8699 | _na 109_aa | nuoI | 4Fe-4S binding domain protein |
| 9 | CAKAPN010000001.1 | GCA916719885_00009 | CDS | open | 8683-10443 | _na 586_aa | sdhA | adenylyl-sulfate reductase subunit alpha |
| 10 | CAKAPN010000001.1 | GCA916719885_00010 | CDS | open | 10468-11532 | _na 354_aa | sulfate ABC transporter ATP-binding protein | |
| 11 | CAKAPN010000001.1 | GCA916719885_00011 | CDS | open | 11571-13214 | _na 547_aa | nitrite/sulfite reductase | |
| 12 | CAKAPN010000001.1 | GCA916719885_00012 | CDS | open | 13790-14443 | _na 217_aa | DUF3298 domain-containing protein | |
| 13 | CAKAPN010000001.1 | GCA916719885_00013 | CDS | open | 14557-15537 | _na 326_aa | LD-carboxypeptidase | |
| 14 | CAKAPN010000001.1 | GCA916719885_00014 | CDS | open | 15558-17270 | _na 570_aa | proS | proline--tRNA ligase |
| 15 | CAKAPN010000001.1 | GCA916719885_00015 | CDS | open | 17364-17954 | _na 196_aa | lprI | lysozyme inhibitor LprI family protein |
| 16 | CAKAPN010000001.1 | GCA916719885_00016 | CDS | open | 18071-19159 | _na 362_aa | gldA | Glycerol dehydrogenase |
| 17 | CAKAPN010000001.1 | GCA916719885_00017 | CDS | open | 19268-20335 | _na 355_aa | fliS | Putative flagellar protein FliS |
| 18 | CAKAPN010000001.1 | GCA916719885_00018 | CDS | open | 20401-20973 | _na 190_aa | DUF5362 domain-containing protein | |
| 19 | CAKAPN010000001.1 | GCA916719885_00019 | CDS | open | 21165-22526 | _na 453_aa | ComEC/Rec2 family competence protein | |
| 20 | CAKAPN010000001.1 | GCA916719885_00020 | CDS | open | 22527-23060 | _na 177_aa | type II secretion system protein | |
| 21 | CAKAPN010000001.1 | GCA916719885_00021 | CDS | open | 23223-23951 | _na 242_aa | hypothetical protein | |
| 22 | CAKAPN010000001.1 | GCA916719885_00022 | CDS | open | 23986-24618 | _na 210_aa | DUF4125 domain-containing protein | |
| 23 | CAKAPN010000001.1 | GCA916719885_00023 | CDS | open | 24703-25650 | _na 315_aa | DUF4037 domain-containing protein | |
| 24 | CAKAPN010000001.1 | GCA916719885_00024 | CDS | open | 25685-26524 | _na 279_aa | tetratricopeptide repeat protein | |
| 25 | CAKAPN010000001.1 | GCA916719885_00025 | CDS | open | 26827-29190 | _na 787_aa | adhE | bifunctional acetaldehyde-CoA/alcohol dehydrogenase |
| 26 | CAKAPN010000001.1 | GCA916719885_00001 | gene | open | 194-361 | |||
| 27 | CAKAPN010000001.1 | GCA916719885_00002 | gene | open | 1094-1285 | |||
| 28 | CAKAPN010000001.1 | GCA916719885_00003 | gene | open | 2920-3759 | cysW | ||
| 29 | CAKAPN010000001.1 | GCA916719885_00004 | gene | open | 3774-4622 | cysT | ||
| 30 | CAKAPN010000001.1 | GCA916719885_00005 | gene | open | 4654-5685 | sbp | ||
| 31 | CAKAPN010000001.1 | GCA916719885_00006 | gene | open | 5723-7408 | cysN | ||
| 32 | CAKAPN010000001.1 | GCA916719885_00007 | gene | open | 7408-8337 | cysD | ||
| 33 | CAKAPN010000001.1 | GCA916719885_00008 | gene | open | 8370-8699 | nuoI | ||
| 34 | CAKAPN010000001.1 | GCA916719885_00009 | gene | open | 8683-10443 | sdhA | ||
| 35 | CAKAPN010000001.1 | GCA916719885_00010 | gene | open | 10468-11532 | |||
| 36 | CAKAPN010000001.1 | GCA916719885_00011 | gene | open | 11571-13214 | |||
| 37 | CAKAPN010000001.1 | GCA916719885_00012 | gene | open | 13790-14443 | |||
| 38 | CAKAPN010000001.1 | GCA916719885_00013 | gene | open | 14557-15537 | |||
| 39 | CAKAPN010000001.1 | GCA916719885_00014 | gene | open | 15558-17270 | proS | ||
| 40 | CAKAPN010000001.1 | GCA916719885_00015 | gene | open | 17364-17954 | lprI | ||
| 41 | CAKAPN010000001.1 | GCA916719885_00016 | gene | open | 18071-19159 | gldA | ||
| 42 | CAKAPN010000001.1 | GCA916719885_00017 | gene | open | 19268-20335 | fliS | ||
| 43 | CAKAPN010000001.1 | GCA916719885_00018 | gene | open | 20401-20973 | |||
| 44 | CAKAPN010000001.1 | GCA916719885_00019 | gene | open | 21165-22526 | |||
| 45 | CAKAPN010000001.1 | GCA916719885_00020 | gene | open | 22527-23060 | |||
| 46 | CAKAPN010000001.1 | GCA916719885_00021 | gene | open | 23223-23951 | |||
| 47 | CAKAPN010000001.1 | GCA916719885_00022 | gene | open | 23986-24618 | |||
| 48 | CAKAPN010000001.1 | GCA916719885_00023 | gene | open | 24703-25650 | |||
| 49 | CAKAPN010000001.1 | GCA916719885_00024 | gene | open | 25685-26524 | |||
| 50 | CAKAPN010000001.1 | GCA916719885_00025 | gene | open | 26827-29190 | adhE | ||
| 51 | CAKAPN010000002.1 | GCA916719885_00026 | CDS | open | 23-541 | _na 172_aa | hypothetical protein | |
| 52 | CAKAPN010000002.1 | GCA916719885_00027 | CDS | open | 493-1179 | _na 228_aa | histidine phosphatase family protein | |
| 53 | CAKAPN010000002.1 | GCA916719885_00028 | CDS | open | 1258-2040 | _na 260_aa | cobalt-precorrin-6A reductase | |
| 54 | CAKAPN010000002.1 | GCA916719885_00029 | CDS | open | 2214-2441 | _na 75_aa | heavy metal-associated domain-containing protein | |
| 55 | CAKAPN010000002.1 | GCA916719885_00030 | CDS | open | 2662-3288 | _na 208_aa | methyltransferase | |
| 56 | CAKAPN010000002.1 | GCA916719885_00031 | CDS | open | 3400-3894 | _na 164_aa | flavodoxin | |
| 57 | CAKAPN010000002.1 | GCA916719885_00032 | CDS | open | 4105-5640 | _na 511_aa | yifB | YifB family Mg chelatase-like AAA ATPase |
| 58 | CAKAPN010000002.1 | GCA916719885_00033 | CDS | open | 5700-6404 | _na 234_aa | N-glycosylase/DNA lyase | |
| 59 | CAKAPN010000002.1 | GCA916719885_00034 | CDS | open | 6471-6812 | _na 113_aa | thioredoxin family protein | |
| 60 | CAKAPN010000002.1 | GCA916719885_00035 | CDS | open | 6805-7833 | _na 342_aa | galE | UDP-glucose 4-epimerase GalE |
| 61 | CAKAPN010000002.1 | GCA916719885_00036 | CDS | open | 7867-9102 | _na 411_aa | ampS | Peptidase M29 aminopeptidase II |
| 62 | CAKAPN010000002.1 | GCA916719885_00037 | CDS | open | 9292-9531 | _na 79_aa | type B 50S ribosomal protein L31 | |
| 63 | CAKAPN010000002.1 | GCA916719885_00038 | CDS | open | 9817-10440 | _na 207_aa | upp | uracil phosphoribosyltransferase |
| 64 | CAKAPN010000002.1 | GCA916719885_00044 | CDS | open | 11544-12266 | _na 240_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 65 | CAKAPN010000002.1 | GCA916719885_00045 | CDS | open | 12303-12782 | _na 159_aa | N-acetyltransferase | |
| 66 | CAKAPN010000002.1 | GCA916719885_00046 | CDS | open | 13043-13831 | _na 262_aa | SDR family oxidoreductase | |
| 67 | CAKAPN010000002.1 | GCA916719885_00047 | CDS | open | 13885-14775 | _na 296_aa | alpha/beta fold hydrolase | |
| 68 | CAKAPN010000002.1 | GCA916719885_00048 | CDS | open | 14833-16251 | _na 472_aa | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase | |
| 69 | CAKAPN010000002.1 | GCA916719885_00049 | CDS | open | 16467-17693 | _na 408_aa | agp | bifunctional glucose-1-phosphatase/inositol phosphatase |
| 70 | CAKAPN010000002.1 | GCA916719885_00050 | CDS | open | 17788-19056 | _na 422_aa | Natural resistance-associated macrophage protein-like | |
| 71 | CAKAPN010000002.1 | GCA916719885_00051 | CDS | open | 19286-20305 | _na 339_aa | hemA | glutamyl-tRNA reductase |
| 72 | CAKAPN010000002.1 | GCA916719885_00052 | CDS | open | 20314-22770 | _na 818_aa | hypothetical protein | |
| 73 | CAKAPN010000002.1 | GCA916719885_00053 | CDS | open | 22840-23220 | _na 126_aa | holo-ACP synthase | |
| 74 | CAKAPN010000002.1 | GCA916719885_00054 | CDS | open | 23346-24686 | _na 446_aa | trkG | potassium transporter TrkG |
| 75 | CAKAPN010000002.1 | GCA916719885_00055 | CDS | open | 24702-25373 | _na 223_aa | trkA | TrkA family potassium uptake protein |
| 76 | CAKAPN010000002.1 | GCA916719885_00056 | CDS | open | 25431-27155 | _na 574_aa | argS | arginine--tRNA ligase |
| 77 | CAKAPN010000002.1 | GCA916719885_00026 | gene | open | 23-541 | |||
| 78 | CAKAPN010000002.1 | GCA916719885_00027 | gene | open | 493-1179 | |||
| 79 | CAKAPN010000002.1 | GCA916719885_00028 | gene | open | 1258-2040 | |||
| 80 | CAKAPN010000002.1 | GCA916719885_00029 | gene | open | 2214-2441 | |||
| 81 | CAKAPN010000002.1 | GCA916719885_00030 | gene | open | 2662-3288 | |||
| 82 | CAKAPN010000002.1 | GCA916719885_00031 | gene | open | 3400-3894 | |||
| 83 | CAKAPN010000002.1 | GCA916719885_00032 | gene | open | 4105-5640 | yifB | ||
| 84 | CAKAPN010000002.1 | GCA916719885_00033 | gene | open | 5700-6404 | |||
| 85 | CAKAPN010000002.1 | GCA916719885_00034 | gene | open | 6471-6812 | |||
| 86 | CAKAPN010000002.1 | GCA916719885_00035 | gene | open | 6805-7833 | galE | ||
| 87 | CAKAPN010000002.1 | GCA916719885_00036 | gene | open | 7867-9102 | ampS | ||
| 88 | CAKAPN010000002.1 | GCA916719885_00037 | gene | open | 9292-9531 | |||
| 89 | CAKAPN010000002.1 | GCA916719885_00038 | gene | open | 9817-10440 | upp | ||
| 90 | CAKAPN010000002.1 | GCA916719885_00044 | gene | open | 11544-12266 | truA | ||
| 91 | CAKAPN010000002.1 | GCA916719885_00045 | gene | open | 12303-12782 | |||
| 92 | CAKAPN010000002.1 | GCA916719885_00046 | gene | open | 13043-13831 | |||
| 93 | CAKAPN010000002.1 | GCA916719885_00047 | gene | open | 13885-14775 | |||
| 94 | CAKAPN010000002.1 | GCA916719885_00048 | gene | open | 14833-16251 | |||
| 95 | CAKAPN010000002.1 | GCA916719885_00049 | gene | open | 16467-17693 | agp | ||
| 96 | CAKAPN010000002.1 | GCA916719885_00050 | gene | open | 17788-19056 | |||
| 97 | CAKAPN010000002.1 | GCA916719885_00051 | gene | open | 19286-20305 | hemA | ||
| 98 | CAKAPN010000002.1 | GCA916719885_00052 | gene | open | 20314-22770 | |||
| 99 | CAKAPN010000002.1 | GCA916719885_00053 | gene | open | 22840-23220 | |||
| 100 | CAKAPN010000002.1 | GCA916719885_00054 | gene | open | 23346-24686 | trkG | ||
| 101 | CAKAPN010000002.1 | GCA916719885_00055 | gene | open | 24702-25373 | trkA | ||
| 102 | CAKAPN010000002.1 | GCA916719885_00056 | gene | open | 25431-27155 | argS | ||
| 103 | CAKAPN010000002.1 | GCA916719885_00039 | gene | open | 10605-10681 | trnP | ||
| 104 | CAKAPN010000002.1 | GCA916719885_00040 | gene | open | 10693-10768 | trnG | ||
| 105 | CAKAPN010000002.1 | GCA916719885_00041 | gene | open | 10814-10889 | trnH | ||
| 106 | CAKAPN010000002.1 | GCA916719885_00042 | gene | open | 10896-10971 | trnK | ||
| 107 | CAKAPN010000002.1 | GCA916719885_00043 | gene | open | 10991-11075 | trnL | ||
| 108 | CAKAPN010000002.1 | GCA916719885_00039 | tRNA | open | 10605-10681 | trnP | tRNA-Pro(tgg) | |
| 109 | CAKAPN010000002.1 | GCA916719885_00040 | tRNA | open | 10693-10768 | trnG | tRNA-Gly(tcc) | |
| 110 | CAKAPN010000002.1 | GCA916719885_00041 | tRNA | open | 10814-10889 | trnH | tRNA-His(gtg) | |
| 111 | CAKAPN010000002.1 | GCA916719885_00042 | tRNA | open | 10896-10971 | trnK | tRNA-Lys(ttt) | |
| 112 | CAKAPN010000002.1 | GCA916719885_00043 | tRNA | open | 10991-11075 | trnL | tRNA-Leu(tag) | |
| 113 | CAKAPN010000003.1 | GCA916719885_00057 | CDS | open | 333-719 | _na 128_aa | Phosphoribosyl-ATP pyrophosphohydrolase | |
| 114 | CAKAPN010000003.1 | GCA916719885_00058 | CDS | open | 853-1584 | _na 243_aa | Bax inhibitor-1/YccA family protein | |
| 115 | CAKAPN010000003.1 | GCA916719885_00059 | CDS | open | 1712-3622 | _na 636_aa | thrS | threonine--tRNA ligase |
| 116 | CAKAPN010000003.1 | GCA916719885_00060 | CDS | open | 3821-7531 | _na 1236_aa | lptD | LPS-assembly protein LptD |
| 117 | CAKAPN010000003.1 | GCA916719885_00061 | CDS | open | 7632-8081 | _na 149_aa | marR | MarR family winged helix-turn-helix transcriptional regulator |
| 118 | CAKAPN010000003.1 | GCA916719885_00062 | CDS | open | 8145-9269 | _na 374_aa | AI-2E family transporter | |
| 119 | CAKAPN010000003.1 | GCA916719885_00063 | CDS | open | 9295-10614 | _na 439_aa | GTPase Der | |
| 120 | CAKAPN010000003.1 | GCA916719885_00064 | CDS | open | 10803-11393 | _na 196_aa | yigZ | YigZ family protein |
| 121 | CAKAPN010000003.1 | GCA916719885_00065 | CDS | open | 11603-12106 | _na 167_aa | Lipoprotein | |
| 122 | CAKAPN010000003.1 | GCA916719885_00066 | CDS | open | 12180-13130 | _na 316_aa | hypothetical protein | |
| 123 | CAKAPN010000003.1 | GCA916719885_00067 | CDS | open | 13106-14005 | _na 299_aa | Type I restriction-modificationenzyme 1%2C R subunit | |
| 124 | CAKAPN010000003.1 | GCA916719885_00068 | CDS | open | 14069-14830 | _na 253_aa | site-2 protease family protein | |
| 125 | CAKAPN010000003.1 | GCA916719885_00069 | CDS | open | 15181-16995 | _na 604_aa | yugI | S1 domain-containing post-transcriptional regulator GSP13 |
| 126 | CAKAPN010000003.1 | GCA916719885_00070 | CDS | open | 17144-17497 | _na 117_aa | hypothetical protein | |
| 127 | CAKAPN010000003.1 | GCA916719885_00071 | CDS | open | 17634-18320 | _na 228_aa | gpmA | 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase |
| 128 | CAKAPN010000003.1 | GCA916719885_00072 | CDS | open | 18445-18732 | _na 95_aa | Tat pathway signal sequence domain protein | |
| 129 | CAKAPN010000003.1 | GCA916719885_00073 | CDS | open | 18858-19604 | _na 248_aa | F-box domain-containing protein | |
| 130 | CAKAPN010000003.1 | GCA916719885_00074 | CDS | open | 19641-21824 | _na 727_aa | ATPase P | |
| 131 | CAKAPN010000003.1 | GCA916719885_00075 | CDS | open | 21855-22226 | _na 123_aa | Cation transporter | |
| 132 | CAKAPN010000003.1 | GCA916719885_00076 | CDS | open | 22253-22738 | _na 161_aa | Heavy metal translocating P-type ATPase | |
| 133 | CAKAPN010000003.1 | GCA916719885_00077 | CDS | open | 22885-23316 | _na 143_aa | zinc transporter 7-A | |
| 134 | CAKAPN010000003.1 | GCA916719885_00078 | CDS | open | 23423-24976 | _na 517_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 135 | CAKAPN010000003.1 | GCA916719885_00057 | gene | open | 333-719 | |||
| 136 | CAKAPN010000003.1 | GCA916719885_00058 | gene | open | 853-1584 | |||
| 137 | CAKAPN010000003.1 | GCA916719885_00059 | gene | open | 1712-3622 | thrS | ||
| 138 | CAKAPN010000003.1 | GCA916719885_00060 | gene | open | 3821-7531 | lptD | ||
| 139 | CAKAPN010000003.1 | GCA916719885_00061 | gene | open | 7632-8081 | marR | ||
| 140 | CAKAPN010000003.1 | GCA916719885_00062 | gene | open | 8145-9269 | |||
| 141 | CAKAPN010000003.1 | GCA916719885_00063 | gene | open | 9295-10614 | |||
| 142 | CAKAPN010000003.1 | GCA916719885_00064 | gene | open | 10803-11393 | yigZ | ||
| 143 | CAKAPN010000003.1 | GCA916719885_00065 | gene | open | 11603-12106 | |||
| 144 | CAKAPN010000003.1 | GCA916719885_00066 | gene | open | 12180-13130 | |||
| 145 | CAKAPN010000003.1 | GCA916719885_00067 | gene | open | 13106-14005 | |||
| 146 | CAKAPN010000003.1 | GCA916719885_00068 | gene | open | 14069-14830 | |||
| 147 | CAKAPN010000003.1 | GCA916719885_00069 | gene | open | 15181-16995 | yugI | ||
| 148 | CAKAPN010000003.1 | GCA916719885_00070 | gene | open | 17144-17497 | |||
| 149 | CAKAPN010000003.1 | GCA916719885_00071 | gene | open | 17634-18320 | gpmA | ||
| 150 | CAKAPN010000003.1 | GCA916719885_00072 | gene | open | 18445-18732 | |||
| 151 | CAKAPN010000003.1 | GCA916719885_00073 | gene | open | 18858-19604 | |||
| 152 | CAKAPN010000003.1 | GCA916719885_00074 | gene | open | 19641-21824 | |||
| 153 | CAKAPN010000003.1 | GCA916719885_00075 | gene | open | 21855-22226 | |||
| 154 | CAKAPN010000003.1 | GCA916719885_00076 | gene | open | 22253-22738 | |||
| 155 | CAKAPN010000003.1 | GCA916719885_00077 | gene | open | 22885-23316 | |||
| 156 | CAKAPN010000003.1 | GCA916719885_00078 | gene | open | 23423-24976 | abc-f | ||
| 157 | CAKAPN010000004.1 | GCA916719885_00079 | CDS | open | 83-724 | _na 213_aa | hypothetical protein | |
| 158 | CAKAPN010000004.1 | GCA916719885_00080 | CDS | open | 750-1661 | _na 303_aa | glycosyltransferase family 4 protein | |
| 159 | CAKAPN010000004.1 | GCA916719885_00081 | CDS | open | 1675-2937 | _na 420_aa | glycosyltransferase | |
| 160 | CAKAPN010000004.1 | GCA916719885_00082 | CDS | open | 2941-3861 | _na 306_aa | ylqF | ribosome biogenesis GTPase YlqF |
| 161 | CAKAPN010000004.1 | GCA916719885_00083 | CDS | open | 3902-4564 | _na 220_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 162 | CAKAPN010000004.1 | GCA916719885_00084 | CDS | open | 4660-6006 | _na 448_aa | S41 family peptidase | |
| 163 | CAKAPN010000004.1 | GCA916719885_00085 | CDS | open | 6043-6786 | _na 247_aa | tlyA | TlyA family RNA methyltransferase |
| 164 | CAKAPN010000004.1 | GCA916719885_00086 | CDS | open | 6968-7429 | _na 153_aa | divergent PAP2 family protein | |
| 165 | CAKAPN010000004.1 | GCA916719885_00087 | CDS | open | 7429-7761 | _na 110_aa | yhbY | ribosome assembly RNA-binding protein YhbY |
| 166 | CAKAPN010000004.1 | GCA916719885_00088 | CDS | open | 7765-9651 | _na 628_aa | ribonuclease J | |
| 167 | CAKAPN010000004.1 | GCA916719885_00089 | CDS | open | 9725-11707 | _na 660_aa | mrdA | penicillin-binding protein 2 |
| 168 | CAKAPN010000004.1 | GCA916719885_00090 | CDS | open | 11738-12085 | _na 115_aa | rsfS | ribosome silencing factor |
| 169 | CAKAPN010000004.1 | GCA916719885_00091 | CDS | open | 12172-12879 | _na 235_aa | 16S rRNA (uracil(1498)-N(3))-methyltransferase | |
| 170 | CAKAPN010000004.1 | GCA916719885_00092 | CDS | open | 12930-13931 | _na 333_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 171 | CAKAPN010000004.1 | GCA916719885_00093 | CDS | open | 14033-14668 | _na 211_aa | DUF445 domain-containing protein | |
| 172 | CAKAPN010000004.1 | GCA916719885_00094 | CDS | open | 14821-15243 | _na 140_aa | flavodoxin domain-containing protein | |
| 173 | CAKAPN010000004.1 | GCA916719885_00095 | CDS | open | 15324-16520 | _na 398_aa | acetate/propionate family kinase | |
| 174 | CAKAPN010000004.1 | GCA916719885_00096 | CDS | open | 16600-17622 | _na 340_aa | pta | phosphate acetyltransferase |
| 175 | CAKAPN010000004.1 | GCA916719885_00097 | CDS | open | 17665-18798 | _na 377_aa | ftsY | signal recognition particle-docking protein FtsY |
| 176 | CAKAPN010000004.1 | GCA916719885_00098 | CDS | open | 18798-19526 | _na 242_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 177 | CAKAPN010000004.1 | GCA916719885_00099 | CDS | open | 19495-19962 | _na 155_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 178 | CAKAPN010000004.1 | GCA916719885_00100 | CDS | open | 20015-20500 | _na 161_aa | D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase | |
| 179 | CAKAPN010000004.1 | GCA916719885_00101 | CDS | open | 20665-21768 | _na 367_aa | ompA | OmpA family protein |
| 180 | CAKAPN010000004.1 | GCA916719885_00102 | CDS | open | 21969-23999 | _na 676_aa | Glycine--tRNA ligase beta subunit | |
| 181 | CAKAPN010000004.1 | GCA916719885_00079 | gene | open | 83-724 | |||
| 182 | CAKAPN010000004.1 | GCA916719885_00080 | gene | open | 750-1661 | |||
| 183 | CAKAPN010000004.1 | GCA916719885_00081 | gene | open | 1675-2937 | |||
| 184 | CAKAPN010000004.1 | GCA916719885_00082 | gene | open | 2941-3861 | ylqF | ||
| 185 | CAKAPN010000004.1 | GCA916719885_00083 | gene | open | 3902-4564 | rsmI | ||
| 186 | CAKAPN010000004.1 | GCA916719885_00084 | gene | open | 4660-6006 | |||
| 187 | CAKAPN010000004.1 | GCA916719885_00085 | gene | open | 6043-6786 | tlyA | ||
| 188 | CAKAPN010000004.1 | GCA916719885_00086 | gene | open | 6968-7429 | |||
| 189 | CAKAPN010000004.1 | GCA916719885_00087 | gene | open | 7429-7761 | yhbY | ||
| 190 | CAKAPN010000004.1 | GCA916719885_00088 | gene | open | 7765-9651 | |||
| 191 | CAKAPN010000004.1 | GCA916719885_00089 | gene | open | 9725-11707 | mrdA | ||
| 192 | CAKAPN010000004.1 | GCA916719885_00090 | gene | open | 11738-12085 | rsfS | ||
| 193 | CAKAPN010000004.1 | GCA916719885_00091 | gene | open | 12172-12879 | |||
| 194 | CAKAPN010000004.1 | GCA916719885_00092 | gene | open | 12930-13931 | ruvB | ||
| 195 | CAKAPN010000004.1 | GCA916719885_00093 | gene | open | 14033-14668 | |||
| 196 | CAKAPN010000004.1 | GCA916719885_00094 | gene | open | 14821-15243 | |||
| 197 | CAKAPN010000004.1 | GCA916719885_00095 | gene | open | 15324-16520 | |||
| 198 | CAKAPN010000004.1 | GCA916719885_00096 | gene | open | 16600-17622 | pta | ||
| 199 | CAKAPN010000004.1 | GCA916719885_00097 | gene | open | 17665-18798 | ftsY | ||
| 200 | CAKAPN010000004.1 | GCA916719885_00098 | gene | open | 18798-19526 | tsaB | ||
| 201 | CAKAPN010000004.1 | GCA916719885_00099 | gene | open | 19495-19962 | tsaE | ||
| 202 | CAKAPN010000004.1 | GCA916719885_00100 | gene | open | 20015-20500 | |||
| 203 | CAKAPN010000004.1 | GCA916719885_00101 | gene | open | 20665-21768 | ompA | ||
| 204 | CAKAPN010000004.1 | GCA916719885_00102 | gene | open | 21969-23999 | |||
| 205 | CAKAPN010000005.1 | GCA916719885_00103 | CDS | open | 1-498 | _na 165_aa | coaE | dephospho-CoA kinase |
| 206 | CAKAPN010000005.1 | GCA916719885_00104 | CDS | open | 525-1358 | _na 277_aa | LCP family protein | |
| 207 | CAKAPN010000005.1 | GCA916719885_00105 | CDS | open | 1408-2007 | _na 199_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 208 | CAKAPN010000005.1 | GCA916719885_00106 | CDS | open | 2038-3858 | _na 606_aa | DUF2207 domain-containing protein | |
| 209 | CAKAPN010000005.1 | GCA916719885_00107 | CDS | open | 3984-5063 | _na 359_aa | prfA | peptide chain release factor 1 |
| 210 | CAKAPN010000005.1 | GCA916719885_00108 | CDS | open | 5056-6156 | _na 366_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 211 | CAKAPN010000005.1 | GCA916719885_00109 | CDS | open | 6403-7452 | _na 349_aa | Tat pathway signal sequence domain protein | |
| 212 | CAKAPN010000005.1 | GCA916719885_00110 | CDS | open | 7480-8499 | _na 339_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 213 | CAKAPN010000005.1 | GCA916719885_00111 | CDS | open | 8699-9397 | _na 232_aa | CARDB domain-containing protein | |
| 214 | CAKAPN010000005.1 | GCA916719885_00112 | CDS | open | 9457-10008 | _na 183_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 215 | CAKAPN010000005.1 | GCA916719885_00113 | CDS | open | 10072-10293 | _na 73_aa | xseB | exodeoxyribonuclease VII small subunit |
| 216 | CAKAPN010000005.1 | GCA916719885_00114 | CDS | open | 10381-11280 | _na 299_aa | farnesyl diphosphate synthase | |
| 217 | CAKAPN010000005.1 | GCA916719885_00115 | CDS | open | 11294-12109 | _na 271_aa | polyphenol oxidase family protein | |
| 218 | CAKAPN010000005.1 | GCA916719885_00116 | CDS | open | 12133-12846 | _na 237_aa | ABC transporter ATP-binding protein | |
| 219 | CAKAPN010000005.1 | GCA916719885_00117 | CDS | open | 12863-13621 | _na 252_aa | ABC transporter ATP-binding protein | |
| 220 | CAKAPN010000005.1 | GCA916719885_00118 | CDS | open | 13633-14682 | _na 349_aa | branched-chain amino acid ABC transporter permease | |
| 221 | CAKAPN010000005.1 | GCA916719885_00119 | CDS | open | 14694-15590 | _na 298_aa | branched-chain amino acid ABC transporter permease | |
| 222 | CAKAPN010000005.1 | GCA916719885_00120 | CDS | open | 15742-16857 | _na 371_aa | ABC transporter substrate-binding protein | |
| 223 | CAKAPN010000005.1 | GCA916719885_00121 | CDS | open | 17202-17768 | _na 188_aa | outer membrane beta-barrel protein | |
| 224 | CAKAPN010000005.1 | GCA916719885_00122 | CDS | open | 18079-18360 | _na 93_aa | cupin domain-containing protein | |
| 225 | CAKAPN010000005.1 | GCA916719885_00103 | gene | open | 1-498 | coaE | ||
| 226 | CAKAPN010000005.1 | GCA916719885_00104 | gene | open | 525-1358 | |||
| 227 | CAKAPN010000005.1 | GCA916719885_00105 | gene | open | 1408-2007 | yihA | ||
| 228 | CAKAPN010000005.1 | GCA916719885_00106 | gene | open | 2038-3858 | |||
| 229 | CAKAPN010000005.1 | GCA916719885_00107 | gene | open | 3984-5063 | prfA | ||
| 230 | CAKAPN010000005.1 | GCA916719885_00108 | gene | open | 5056-6156 | prmC | ||
| 231 | CAKAPN010000005.1 | GCA916719885_00109 | gene | open | 6403-7452 | |||
| 232 | CAKAPN010000005.1 | GCA916719885_00110 | gene | open | 7480-8499 | queA | ||
| 233 | CAKAPN010000005.1 | GCA916719885_00111 | gene | open | 8699-9397 | |||
| 234 | CAKAPN010000005.1 | GCA916719885_00112 | gene | open | 9457-10008 | rsmD | ||
| 235 | CAKAPN010000005.1 | GCA916719885_00113 | gene | open | 10072-10293 | xseB | ||
| 236 | CAKAPN010000005.1 | GCA916719885_00114 | gene | open | 10381-11280 | |||
| 237 | CAKAPN010000005.1 | GCA916719885_00115 | gene | open | 11294-12109 | |||
| 238 | CAKAPN010000005.1 | GCA916719885_00116 | gene | open | 12133-12846 | |||
| 239 | CAKAPN010000005.1 | GCA916719885_00117 | gene | open | 12863-13621 | |||
| 240 | CAKAPN010000005.1 | GCA916719885_00118 | gene | open | 13633-14682 | |||
| 241 | CAKAPN010000005.1 | GCA916719885_00119 | gene | open | 14694-15590 | |||
| 242 | CAKAPN010000005.1 | GCA916719885_00120 | gene | open | 15742-16857 | |||
| 243 | CAKAPN010000005.1 | GCA916719885_00121 | gene | open | 17202-17768 | |||
| 244 | CAKAPN010000005.1 | GCA916719885_00122 | gene | open | 18079-18360 | |||
| 245 | CAKAPN010000006.1 | GCA916719885_00123 | CDS | open | 153-2231 | _na 692_aa | BamA/TamA family outer membrane protein | |
| 246 | CAKAPN010000006.1 | GCA916719885_00124 | CDS | open | 2240-6847 | _na 1535_aa | tamB | translocation/assembly module TamB domain-containing protein |
| 247 | CAKAPN010000006.1 | GCA916719885_00125 | CDS | open | 6878-7687 | _na 269_aa | ParB/RepB/Spo0J family partition protein | |
| 248 | CAKAPN010000006.1 | GCA916719885_00126 | CDS | open | 7843-10101 | _na 752_aa | bifunctional (p)ppGpp synthetase/guanosine-3'%2C5'-bis(diphosphate) 3'-pyrophosphohydrolase | |
| 249 | CAKAPN010000006.1 | GCA916719885_00127 | CDS | open | 10273-10803 | _na 176_aa | adenine phosphoribosyltransferase | |
| 250 | CAKAPN010000006.1 | GCA916719885_00128 | CDS | open | 10818-11270 | _na 150_aa | NUDIX domain-containing protein | |
| 251 | CAKAPN010000006.1 | GCA916719885_00129 | CDS | open | 11257-12558 | _na 433_aa | hemolysin family protein | |
| 252 | CAKAPN010000006.1 | GCA916719885_00130 | CDS | open | 12601-13077 | _na 158_aa | accB | acetyl-CoA carboxylase biotin carboxyl carrier protein |
| 253 | CAKAPN010000006.1 | GCA916719885_00131 | CDS | open | 13158-14009 | _na 283_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 254 | CAKAPN010000006.1 | GCA916719885_00132 | CDS | open | 14003-14677 | _na 224_aa | redox-sensing transcriptional repressor Rex | |
| 255 | CAKAPN010000006.1 | GCA916719885_00133 | CDS | open | 14740-15669 | _na 309_aa | fmt | methionyl-tRNA formyltransferase |
| 256 | CAKAPN010000006.1 | GCA916719885_00134 | CDS | open | 15782-15943 | _na 53_aa | hypothetical protein | |
| 257 | CAKAPN010000006.1 | GCA916719885_00123 | gene | open | 153-2231 | |||
| 258 | CAKAPN010000006.1 | GCA916719885_00124 | gene | open | 2240-6847 | tamB | ||
| 259 | CAKAPN010000006.1 | GCA916719885_00125 | gene | open | 6878-7687 | |||
| 260 | CAKAPN010000006.1 | GCA916719885_00126 | gene | open | 7843-10101 | |||
| 261 | CAKAPN010000006.1 | GCA916719885_00127 | gene | open | 10273-10803 | |||
| 262 | CAKAPN010000006.1 | GCA916719885_00128 | gene | open | 10818-11270 | |||
| 263 | CAKAPN010000006.1 | GCA916719885_00129 | gene | open | 11257-12558 | |||
| 264 | CAKAPN010000006.1 | GCA916719885_00130 | gene | open | 12601-13077 | accB | ||
| 265 | CAKAPN010000006.1 | GCA916719885_00131 | gene | open | 13158-14009 | folD | ||
| 266 | CAKAPN010000006.1 | GCA916719885_00132 | gene | open | 14003-14677 | |||
| 267 | CAKAPN010000006.1 | GCA916719885_00133 | gene | open | 14740-15669 | fmt | ||
| 268 | CAKAPN010000006.1 | GCA916719885_00134 | gene | open | 15782-15943 | |||
| 269 | CAKAPN010000007.1 | GCA916719885_00135 | CDS | open | 1056-1532 | _na 158_aa | hypothetical protein | |
| 270 | CAKAPN010000007.1 | GCA916719885_00136 | CDS | open | 2428-3216 | _na 262_aa | Cof-type HAD-IIB family hydrolase | |
| 271 | CAKAPN010000007.1 | GCA916719885_00137 | CDS | open | 3288-4427 | _na 379_aa | cysteine desulfurase family protein | |
| 272 | CAKAPN010000007.1 | GCA916719885_00138 | CDS | open | 4489-5286 | _na 265_aa | energy-coupling factor ABC transporter ATP-binding protein | |
| 273 | CAKAPN010000007.1 | GCA916719885_00139 | CDS | open | 5468-6304 | _na 278_aa | ABC transporter ATP-binding protein | |
| 274 | CAKAPN010000007.1 | GCA916719885_00140 | CDS | open | 6289-7038 | _na 249_aa | Cobalt transporter | |
| 275 | CAKAPN010000007.1 | GCA916719885_00141 | CDS | open | 7103-7687 | _na 194_aa | ECF transporter S component | |
| 276 | CAKAPN010000007.1 | GCA916719885_00142 | CDS | open | 7875-8282 | _na 135_aa | helix-turn-helix domain-containing protein | |
| 277 | CAKAPN010000007.1 | GCA916719885_00143 | CDS | open | 8387-9088 | _na 233_aa | araD | L-ribulose-5-phosphate 4-epimerase |
| 278 | CAKAPN010000007.1 | GCA916719885_00144 | CDS | open | 9090-9977 | _na 295_aa | L-ribulose-5-phosphate 3-epimerase | |
| 279 | CAKAPN010000007.1 | GCA916719885_00145 | CDS | open | 10004-10663 | _na 219_aa | ulaD | Hexulose-6-phosphate synthase%2C putative |
| 280 | CAKAPN010000007.1 | GCA916719885_00146 | CDS | open | 10749-11204 | _na 151_aa | PTS sugar transporter subunit IIA | |
| 281 | CAKAPN010000007.1 | GCA916719885_00147 | CDS | open | 11279-11560 | _na 93_aa | PTS ascorbate transporter subunit IIB | |
| 282 | CAKAPN010000007.1 | GCA916719885_00148 | CDS | open | 11675-13207 | _na 510_aa | PTS ascorbate transporter subunit IIC | |
| 283 | CAKAPN010000007.1 | GCA916719885_00149 | CDS | open | 13343-14434 | _na 363_aa | ulaG | L-ascorbate 6-phosphate lactonase |
| 284 | CAKAPN010000007.1 | GCA916719885_00135 | gene | open | 1056-1532 | |||
| 285 | CAKAPN010000007.1 | GCA916719885_00136 | gene | open | 2428-3216 | |||
| 286 | CAKAPN010000007.1 | GCA916719885_00137 | gene | open | 3288-4427 | |||
| 287 | CAKAPN010000007.1 | GCA916719885_00138 | gene | open | 4489-5286 | |||
| 288 | CAKAPN010000007.1 | GCA916719885_00139 | gene | open | 5468-6304 | |||
| 289 | CAKAPN010000007.1 | GCA916719885_00140 | gene | open | 6289-7038 | |||
| 290 | CAKAPN010000007.1 | GCA916719885_00141 | gene | open | 7103-7687 | |||
| 291 | CAKAPN010000007.1 | GCA916719885_00142 | gene | open | 7875-8282 | |||
| 292 | CAKAPN010000007.1 | GCA916719885_00143 | gene | open | 8387-9088 | araD | ||
| 293 | CAKAPN010000007.1 | GCA916719885_00144 | gene | open | 9090-9977 | |||
| 294 | CAKAPN010000007.1 | GCA916719885_00145 | gene | open | 10004-10663 | ulaD | ||
| 295 | CAKAPN010000007.1 | GCA916719885_00146 | gene | open | 10749-11204 | |||
| 296 | CAKAPN010000007.1 | GCA916719885_00147 | gene | open | 11279-11560 | |||
| 297 | CAKAPN010000007.1 | GCA916719885_00148 | gene | open | 11675-13207 | |||
| 298 | CAKAPN010000007.1 | GCA916719885_00149 | gene | open | 13343-14434 | ulaG | ||
| 299 | CAKAPN010000008.1 | GCA916719885_00152 | gene | open | 3351-3690 | ssrA | ||
| 300 | CAKAPN010000008.1 | GCA916719885_00152 | tmRNA | open | 3351-3690 | ssrA | transfer-messenger RNA%2C SsrA | |
| 301 | CAKAPN010000008.1 | GCA916719885_00150 | CDS | open | 1792-2373 | _na 193_aa | GNAT family N-acetyltransferase | |
| 302 | CAKAPN010000008.1 | GCA916719885_00151 | CDS | open | 2540-3280 | _na 246_aa | sirohydrochlorin cobaltochelatase | |
| 303 | CAKAPN010000008.1 | GCA916719885_00153 | CDS | open | 3954-4949 | _na 331_aa | phosphate/phosphite/phosphonate ABC transporter substrate-binding protein | |
| 304 | CAKAPN010000008.1 | GCA916719885_00154 | CDS | open | 5218-5973 | _na 251_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 305 | CAKAPN010000008.1 | GCA916719885_00155 | CDS | open | 5970-6677 | _na 235_aa | hypothetical protein | |
| 306 | CAKAPN010000008.1 | GCA916719885_00156 | CDS | open | 6811-7647 | _na 278_aa | ABC transmembrane type-1 domain-containing protein | |
| 307 | CAKAPN010000008.1 | GCA916719885_00157 | CDS | open | 7958-9271 | _na 437_aa | secY | preprotein translocase subunit SecY |
| 308 | CAKAPN010000008.1 | GCA916719885_00158 | CDS | open | 9316-9930 | _na 204_aa | rplO | 50S ribosomal protein L15 |
| 309 | CAKAPN010000008.1 | GCA916719885_00159 | CDS | open | 9937-10116 | _na 59_aa | rpmD | 50S ribosomal protein L30 |
| 310 | CAKAPN010000008.1 | GCA916719885_00160 | CDS | open | 10138-10647 | _na 169_aa | rpsE | 30S ribosomal protein S5 |
| 311 | CAKAPN010000008.1 | GCA916719885_00161 | CDS | open | 10666-11028 | _na 120_aa | rplR | 50S ribosomal protein L18 |
| 312 | CAKAPN010000008.1 | GCA916719885_00162 | CDS | open | 11042-11575 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 313 | CAKAPN010000008.1 | GCA916719885_00163 | CDS | open | 11607-12002 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 314 | CAKAPN010000008.1 | GCA916719885_00164 | CDS | open | 12031-12318 | _na 95_aa | rpsN | 30S ribosomal protein S14 |
| 315 | CAKAPN010000008.1 | GCA916719885_00165 | CDS | open | 12350-12904 | _na 184_aa | rplE | 50S ribosomal protein L5 |
| 316 | CAKAPN010000008.1 | GCA916719885_00166 | CDS | open | 12921-13301 | _na 126_aa | rplX | 50S ribosomal protein L24 |
| 317 | CAKAPN010000008.1 | GCA916719885_00167 | CDS | open | 13318-13686 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 318 | CAKAPN010000008.1 | GCA916719885_00168 | CDS | open | 13728-13988 | _na 86_aa | rpsQ | 30S ribosomal protein S17 |
| 319 | CAKAPN010000008.1 | GCA916719885_00169 | CDS | open | 14000-14191 | _na 63_aa | rpmC | 50S ribosomal protein L29 |
| 320 | CAKAPN010000008.1 | GCA916719885_00170 | CDS | open | 14191-14568 | _na 125_aa | rplP | 50S ribosomal protein L16 |
| 321 | CAKAPN010000008.1 | GCA916719885_00150 | gene | open | 1792-2373 | |||
| 322 | CAKAPN010000008.1 | GCA916719885_00151 | gene | open | 2540-3280 | |||
| 323 | CAKAPN010000008.1 | GCA916719885_00153 | gene | open | 3954-4949 | |||
| 324 | CAKAPN010000008.1 | GCA916719885_00154 | gene | open | 5218-5973 | phnC | ||
| 325 | CAKAPN010000008.1 | GCA916719885_00155 | gene | open | 5970-6677 | |||
| 326 | CAKAPN010000008.1 | GCA916719885_00156 | gene | open | 6811-7647 | |||
| 327 | CAKAPN010000008.1 | GCA916719885_00157 | gene | open | 7958-9271 | secY | ||
| 328 | CAKAPN010000008.1 | GCA916719885_00158 | gene | open | 9316-9930 | rplO | ||
| 329 | CAKAPN010000008.1 | GCA916719885_00159 | gene | open | 9937-10116 | rpmD | ||
| 330 | CAKAPN010000008.1 | GCA916719885_00160 | gene | open | 10138-10647 | rpsE | ||
| 331 | CAKAPN010000008.1 | GCA916719885_00161 | gene | open | 10666-11028 | rplR | ||
| 332 | CAKAPN010000008.1 | GCA916719885_00162 | gene | open | 11042-11575 | rplF | ||
| 333 | CAKAPN010000008.1 | GCA916719885_00163 | gene | open | 11607-12002 | rpsH | ||
| 334 | CAKAPN010000008.1 | GCA916719885_00164 | gene | open | 12031-12318 | rpsN | ||
| 335 | CAKAPN010000008.1 | GCA916719885_00165 | gene | open | 12350-12904 | rplE | ||
| 336 | CAKAPN010000008.1 | GCA916719885_00166 | gene | open | 12921-13301 | rplX | ||
| 337 | CAKAPN010000008.1 | GCA916719885_00167 | gene | open | 13318-13686 | rplN | ||
| 338 | CAKAPN010000008.1 | GCA916719885_00168 | gene | open | 13728-13988 | rpsQ | ||
| 339 | CAKAPN010000008.1 | GCA916719885_00169 | gene | open | 14000-14191 | rpmC | ||
| 340 | CAKAPN010000008.1 | GCA916719885_00170 | gene | open | 14191-14568 | rplP | ||
| 341 | CAKAPN010000009.1 | GCA916719885_00171 | CDS | open | 70-1029 | _na 319_aa | hypothetical protein | |
| 342 | CAKAPN010000009.1 | GCA916719885_00172 | CDS | open | 1133-2365 | _na 410_aa | ilvA | threonine ammonia-lyase |
| 343 | CAKAPN010000009.1 | GCA916719885_00173 | CDS | open | 2398-4119 | _na 573_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 344 | CAKAPN010000009.1 | GCA916719885_00174 | CDS | open | 4112-4600 | _na 162_aa | ilvN | acetolactate synthase small subunit |
| 345 | CAKAPN010000009.1 | GCA916719885_00175 | CDS | open | 4735-5484 | _na 249_aa | Methyltransferase domain protein | |
| 346 | CAKAPN010000009.1 | GCA916719885_00176 | CDS | open | 5519-7126 | _na 535_aa | leuA | 2-isopropylmalate synthase |
| 347 | CAKAPN010000009.1 | GCA916719885_00177 | CDS | open | 7149-8180 | _na 343_aa | DUF1016 domain-containing protein | |
| 348 | CAKAPN010000009.1 | GCA916719885_00178 | CDS | open | 8217-8780 | _na 187_aa | Flavodoxin-like protein | |
| 349 | CAKAPN010000009.1 | GCA916719885_00179 | CDS | open | 8820-9665 | _na 281_aa | Metallophosphoesterase | |
| 350 | CAKAPN010000009.1 | GCA916719885_00180 | CDS | open | 9685-10524 | _na 279_aa | DUF1963 domain-containing protein | |
| 351 | CAKAPN010000009.1 | GCA916719885_00181 | CDS | open | 10551-11474 | _na 307_aa | MORN repeat protein | |
| 352 | CAKAPN010000009.1 | GCA916719885_00182 | CDS | open | 11512-12186 | _na 224_aa | Fic family protein | |
| 353 | CAKAPN010000009.1 | GCA916719885_00183 | CDS | open | 12249-13667 | _na 472_aa | leuC | 3-isopropylmalate dehydratase large subunit |
| 354 | CAKAPN010000009.1 | GCA916719885_00184 | CDS | open | 13719-14294 | _na 191_aa | leuD | 3-isopropylmalate dehydratase small subunit |
| 355 | CAKAPN010000009.1 | GCA916719885_00171 | gene | open | 70-1029 | |||
| 356 | CAKAPN010000009.1 | GCA916719885_00172 | gene | open | 1133-2365 | ilvA | ||
| 357 | CAKAPN010000009.1 | GCA916719885_00173 | gene | open | 2398-4119 | ilvB | ||
| 358 | CAKAPN010000009.1 | GCA916719885_00174 | gene | open | 4112-4600 | ilvN | ||
| 359 | CAKAPN010000009.1 | GCA916719885_00175 | gene | open | 4735-5484 | |||
| 360 | CAKAPN010000009.1 | GCA916719885_00176 | gene | open | 5519-7126 | leuA | ||
| 361 | CAKAPN010000009.1 | GCA916719885_00177 | gene | open | 7149-8180 | |||
| 362 | CAKAPN010000009.1 | GCA916719885_00178 | gene | open | 8217-8780 | |||
| 363 | CAKAPN010000009.1 | GCA916719885_00179 | gene | open | 8820-9665 | |||
| 364 | CAKAPN010000009.1 | GCA916719885_00180 | gene | open | 9685-10524 | |||
| 365 | CAKAPN010000009.1 | GCA916719885_00181 | gene | open | 10551-11474 | |||
| 366 | CAKAPN010000009.1 | GCA916719885_00182 | gene | open | 11512-12186 | |||
| 367 | CAKAPN010000009.1 | GCA916719885_00183 | gene | open | 12249-13667 | leuC | ||
| 368 | CAKAPN010000009.1 | GCA916719885_00184 | gene | open | 13719-14294 | leuD | ||
| 369 | CAKAPN010000010.1 | GCA916719885_00185 | CDS | open | 1108-2133 | _na 341_aa | RnfABCDGE type electron transport complex subunit D | |
| 370 | CAKAPN010000010.1 | GCA916719885_00186 | CDS | open | 2153-2773 | _na 206_aa | hypothetical protein | |
| 371 | CAKAPN010000010.1 | GCA916719885_00187 | CDS | open | 2852-4597 | _na 581_aa | ABC transporter ATP-binding protein | |
| 372 | CAKAPN010000010.1 | GCA916719885_00188 | CDS | open | 4665-5645 | _na 326_aa | glycosyltransferase family 52 | |
| 373 | CAKAPN010000010.1 | GCA916719885_00189 | CDS | open | 5663-6730 | _na 355_aa | polysaccharide deacetylase family protein | |
| 374 | CAKAPN010000010.1 | GCA916719885_00190 | CDS | open | 6791-7528 | _na 245_aa | glycosyltransferase | |
| 375 | CAKAPN010000010.1 | GCA916719885_00191 | CDS | open | 7521-9068 | _na 515_aa | glycosyltransferase | |
| 376 | CAKAPN010000010.1 | GCA916719885_00192 | CDS | open | 9116-10162 | _na 348_aa | glycosyltransferase family 9 protein | |
| 377 | CAKAPN010000010.1 | GCA916719885_00193 | CDS | open | 10185-11192 | _na 335_aa | glycosyltransferase | |
| 378 | CAKAPN010000010.1 | GCA916719885_00194 | CDS | open | 11327-12571 | _na 414_aa | O-antigen ligase | |
| 379 | CAKAPN010000010.1 | GCA916719885_00195 | CDS | open | 12656-13672 | _na 338_aa | glycosyltransferase family 9 protein | |
| 380 | CAKAPN010000010.1 | GCA916719885_00185 | gene | open | 1108-2133 | |||
| 381 | CAKAPN010000010.1 | GCA916719885_00186 | gene | open | 2153-2773 | |||
| 382 | CAKAPN010000010.1 | GCA916719885_00187 | gene | open | 2852-4597 | |||
| 383 | CAKAPN010000010.1 | GCA916719885_00188 | gene | open | 4665-5645 | |||
| 384 | CAKAPN010000010.1 | GCA916719885_00189 | gene | open | 5663-6730 | |||
| 385 | CAKAPN010000010.1 | GCA916719885_00190 | gene | open | 6791-7528 | |||
| 386 | CAKAPN010000010.1 | GCA916719885_00191 | gene | open | 7521-9068 | |||
| 387 | CAKAPN010000010.1 | GCA916719885_00192 | gene | open | 9116-10162 | |||
| 388 | CAKAPN010000010.1 | GCA916719885_00193 | gene | open | 10185-11192 | |||
| 389 | CAKAPN010000010.1 | GCA916719885_00194 | gene | open | 11327-12571 | |||
| 390 | CAKAPN010000010.1 | GCA916719885_00195 | gene | open | 12656-13672 | |||
| 391 | CAKAPN010000011.1 | GCA916719885_00196 | CDS | open | 261-488 | _na 75_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 392 | CAKAPN010000011.1 | GCA916719885_00197 | CDS | open | 488-811 | _na 107_aa | RelE/StbE family addiction module toxin | |
| 393 | CAKAPN010000011.1 | GCA916719885_00198 | CDS | open | 936-1367 | _na 143_aa | DUF4268 domain-containing protein | |
| 394 | CAKAPN010000011.1 | GCA916719885_00199 | CDS | open | 1367-2038 | _na 223_aa | EndoU domain-containing protein | |
| 395 | CAKAPN010000011.1 | GCA916719885_00200 | CDS | open | 2219-3193 | _na 324_aa | ATPase | |
| 396 | CAKAPN010000011.1 | GCA916719885_00201 | CDS | open | 3205-4236 | _na 343_aa | mreB | Cell shape-determining protein MreB |
| 397 | CAKAPN010000011.1 | GCA916719885_00202 | CDS | open | 4364-5821 | _na 485_aa | cysS | cysteine--tRNA ligase |
| 398 | CAKAPN010000011.1 | GCA916719885_00203 | CDS | open | 5834-8176 | _na 780_aa | mutS2 | endonuclease MutS2 |
| 399 | CAKAPN010000011.1 | GCA916719885_00204 | CDS | open | 8437-9318 | _na 293_aa | efeO | iron uptake system protein EfeO |
| 400 | CAKAPN010000011.1 | GCA916719885_00205 | CDS | open | 9340-10578 | _na 412_aa | efeB | iron uptake transporter deferrochelatase/peroxidase subunit |
| 401 | CAKAPN010000011.1 | GCA916719885_00206 | CDS | open | 10589-12250 | _na 553_aa | FTR1 family protein | |
| 402 | CAKAPN010000011.1 | GCA916719885_00207 | CDS | open | 12282-12989 | _na 235_aa | tatC | twin-arginine translocase subunit TatC |
| 403 | CAKAPN010000011.1 | GCA916719885_00208 | CDS | open | 12992-13198 | _na 68_aa | twin-arginine translocase TatA/TatE family subunit | |
| 404 | CAKAPN010000011.1 | GCA916719885_00196 | gene | open | 261-488 | |||
| 405 | CAKAPN010000011.1 | GCA916719885_00197 | gene | open | 488-811 | |||
| 406 | CAKAPN010000011.1 | GCA916719885_00198 | gene | open | 936-1367 | |||
| 407 | CAKAPN010000011.1 | GCA916719885_00199 | gene | open | 1367-2038 | |||
| 408 | CAKAPN010000011.1 | GCA916719885_00200 | gene | open | 2219-3193 | |||
| 409 | CAKAPN010000011.1 | GCA916719885_00201 | gene | open | 3205-4236 | mreB | ||
| 410 | CAKAPN010000011.1 | GCA916719885_00202 | gene | open | 4364-5821 | cysS | ||
| 411 | CAKAPN010000011.1 | GCA916719885_00203 | gene | open | 5834-8176 | mutS2 | ||
| 412 | CAKAPN010000011.1 | GCA916719885_00204 | gene | open | 8437-9318 | efeO | ||
| 413 | CAKAPN010000011.1 | GCA916719885_00205 | gene | open | 9340-10578 | efeB | ||
| 414 | CAKAPN010000011.1 | GCA916719885_00206 | gene | open | 10589-12250 | |||
| 415 | CAKAPN010000011.1 | GCA916719885_00207 | gene | open | 12282-12989 | tatC | ||
| 416 | CAKAPN010000011.1 | GCA916719885_00208 | gene | open | 12992-13198 | |||
| 417 | CAKAPN010000012.1 | repeat_region | open | 11908-12894 | CRISPR array with 15 repeats of length 36%2C consensus sequence GTTTAAATACTATCTGAATTTACACTACTCTCAAAC and spacer length 29 | |||
| 418 | CAKAPN010000012.1 | GCA916719885_00209 | CDS | open | 171-1526 | _na 451_aa | cobyrinate a%2Cc-diamide synthase | |
| 419 | CAKAPN010000012.1 | GCA916719885_00210 | CDS | open | 1724-2380 | _na 218_aa | Putative precorrin-8X methylmutase | |
| 420 | CAKAPN010000012.1 | GCA916719885_00211 | CDS | open | 2536-3642 | _na 368_aa | cbiD | cobalt-precorrin-5B (C(1))-methyltransferase CbiD |
| 421 | CAKAPN010000012.1 | GCA916719885_00212 | CDS | open | 3699-4325 | _na 208_aa | cbiE | Precorrin-6y C5%2C15-methyltransferase (Decarboxylating) subunit CbiE |
| 422 | CAKAPN010000012.1 | GCA916719885_00213 | CDS | open | 4403-4969 | _na 188_aa | cbiT | Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating) subunit CbiT |
| 423 | CAKAPN010000012.1 | GCA916719885_00214 | CDS | open | 5368-6009 | _na 213_aa | metal-dependent transcriptional regulator | |
| 424 | CAKAPN010000012.1 | GCA916719885_00215 | CDS | open | 6023-6976 | _na 317_aa | metal ABC transporter solute-binding protein%2C Zn/Mn family | |
| 425 | CAKAPN010000012.1 | GCA916719885_00216 | CDS | open | 7040-7771 | _na 243_aa | metal ABC transporter ATP-binding protein | |
| 426 | CAKAPN010000012.1 | GCA916719885_00217 | CDS | open | 7773-8684 | _na 303_aa | metal ABC transporter permease | |
| 427 | CAKAPN010000012.1 | GCA916719885_00218 | CDS | open | 8684-9781 | _na 365_aa | metal ABC transporter permease | |
| 428 | CAKAPN010000012.1 | GCA916719885_00219 | CDS | open | 9818-10714 | _na 298_aa | eamA | EamA family transporter |
| 429 | CAKAPN010000012.1 | GCA916719885_00220 | CDS | open | 10914-11690 | _na 258_aa | DUF306 domain-containing protein | |
| 430 | CAKAPN010000012.1 | GCA916719885_00209 | gene | open | 171-1526 | |||
| 431 | CAKAPN010000012.1 | GCA916719885_00210 | gene | open | 1724-2380 | |||
| 432 | CAKAPN010000012.1 | GCA916719885_00211 | gene | open | 2536-3642 | cbiD | ||
| 433 | CAKAPN010000012.1 | GCA916719885_00212 | gene | open | 3699-4325 | cbiE | ||
| 434 | CAKAPN010000012.1 | GCA916719885_00213 | gene | open | 4403-4969 | cbiT | ||
| 435 | CAKAPN010000012.1 | GCA916719885_00214 | gene | open | 5368-6009 | |||
| 436 | CAKAPN010000012.1 | GCA916719885_00215 | gene | open | 6023-6976 | |||
| 437 | CAKAPN010000012.1 | GCA916719885_00216 | gene | open | 7040-7771 | |||
| 438 | CAKAPN010000012.1 | GCA916719885_00217 | gene | open | 7773-8684 | |||
| 439 | CAKAPN010000012.1 | GCA916719885_00218 | gene | open | 8684-9781 | |||
| 440 | CAKAPN010000012.1 | GCA916719885_00219 | gene | open | 9818-10714 | eamA | ||
| 441 | CAKAPN010000012.1 | GCA916719885_00220 | gene | open | 10914-11690 | |||
| 442 | CAKAPN010000013.1 | GCA916719885_00221 | CDS | open | 177-503 | _na 108_aa | PepSY domain-containing protein | |
| 443 | CAKAPN010000013.1 | GCA916719885_00222 | CDS | open | 782-2191 | _na 469_aa | HAMP domain-containing sensor histidine kinase | |
| 444 | CAKAPN010000013.1 | GCA916719885_00223 | CDS | open | 2184-2870 | _na 228_aa | response regulator transcription factor | |
| 445 | CAKAPN010000013.1 | GCA916719885_00224 | CDS | open | 3094-3717 | _na 207_aa | NADPH-dependent FMN reductase-like domain-containing protein | |
| 446 | CAKAPN010000013.1 | GCA916719885_00225 | CDS | open | 3805-4350 | _na 181_aa | NAD(P)H-dependent oxidoreductase | |
| 447 | CAKAPN010000013.1 | GCA916719885_00226 | CDS | open | 4420-5028 | _na 202_aa | TetR/AcrR family transcriptional regulator | |
| 448 | CAKAPN010000013.1 | GCA916719885_00227 | CDS | open | 5491-7191 | _na 566_aa | DUF262 domain-containing protein | |
| 449 | CAKAPN010000013.1 | GCA916719885_00228 | CDS | open | 7395-8939 | _na 514_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 450 | CAKAPN010000013.1 | GCA916719885_00229 | CDS | open | 9059-9628 | _na 189_aa | DUF5105 domain-containing protein | |
| 451 | CAKAPN010000013.1 | GCA916719885_00230 | CDS | open | 10125-12284 | _na 719_aa | anaerobic ribonucleoside triphosphate reductase | |
| 452 | CAKAPN010000013.1 | GCA916719885_00221 | gene | open | 177-503 | |||
| 453 | CAKAPN010000013.1 | GCA916719885_00222 | gene | open | 782-2191 | |||
| 454 | CAKAPN010000013.1 | GCA916719885_00223 | gene | open | 2184-2870 | |||
| 455 | CAKAPN010000013.1 | GCA916719885_00224 | gene | open | 3094-3717 | |||
| 456 | CAKAPN010000013.1 | GCA916719885_00225 | gene | open | 3805-4350 | |||
| 457 | CAKAPN010000013.1 | GCA916719885_00226 | gene | open | 4420-5028 | |||
| 458 | CAKAPN010000013.1 | GCA916719885_00227 | gene | open | 5491-7191 | |||
| 459 | CAKAPN010000013.1 | GCA916719885_00228 | gene | open | 7395-8939 | guaA | ||
| 460 | CAKAPN010000013.1 | GCA916719885_00229 | gene | open | 9059-9628 | |||
| 461 | CAKAPN010000013.1 | GCA916719885_00230 | gene | open | 10125-12284 | |||
| 462 | CAKAPN010000014.1 | GCA916719885_00231 | CDS | open | 612-1949 | _na 445_aa | ffh | signal recognition particle protein |
| 463 | CAKAPN010000014.1 | GCA916719885_00232 | CDS | open | 1949-2305 | _na 118_aa | ylxM | YlxM family DNA-binding protein |
| 464 | CAKAPN010000014.1 | GCA916719885_00233 | CDS | open | 2342-4054 | _na 570_aa | ade | adenine deaminase |
| 465 | CAKAPN010000014.1 | GCA916719885_00234 | CDS | open | 4124-5302 | _na 392_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 466 | CAKAPN010000014.1 | GCA916719885_00235 | CDS | open | 5360-6064 | _na 234_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 467 | CAKAPN010000014.1 | GCA916719885_00236 | CDS | open | 6212-8098 | _na 628_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 468 | CAKAPN010000014.1 | GCA916719885_00237 | CDS | open | 8270-9865 | _na 531_aa | peptide ABC transporter substrate-binding protein | |
| 469 | CAKAPN010000014.1 | GCA916719885_00238 | CDS | open | 10146-11120 | _na 324_aa | hypothetical protein | |
| 470 | CAKAPN010000014.1 | GCA916719885_00231 | gene | open | 612-1949 | ffh | ||
| 471 | CAKAPN010000014.1 | GCA916719885_00232 | gene | open | 1949-2305 | ylxM | ||
| 472 | CAKAPN010000014.1 | GCA916719885_00233 | gene | open | 2342-4054 | ade | ||
| 473 | CAKAPN010000014.1 | GCA916719885_00234 | gene | open | 4124-5302 | tgt | ||
| 474 | CAKAPN010000014.1 | GCA916719885_00235 | gene | open | 5360-6064 | rsmG | ||
| 475 | CAKAPN010000014.1 | GCA916719885_00236 | gene | open | 6212-8098 | mnmG | ||
| 476 | CAKAPN010000014.1 | GCA916719885_00237 | gene | open | 8270-9865 | |||
| 477 | CAKAPN010000014.1 | GCA916719885_00238 | gene | open | 10146-11120 | |||
| 478 | CAKAPN010000015.1 | GCA916719885_00239 | CDS | open | 142-1350 | _na 402_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 479 | CAKAPN010000015.1 | GCA916719885_00240 | CDS | open | 1478-2119 | _na 213_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 480 | CAKAPN010000015.1 | GCA916719885_00241 | CDS | open | 2419-3858 | _na 479_aa | SWIM-type domain-containing protein | |
| 481 | CAKAPN010000015.1 | GCA916719885_00242 | CDS | open | 3883-4980 | _na 365_aa | hypothetical protein | |
| 482 | CAKAPN010000015.1 | GCA916719885_00243 | CDS | open | 5027-6127 | _na 366_aa | mMP0363 | ATPase dynein-related AAA domain-containing protein |
| 483 | CAKAPN010000015.1 | GCA916719885_00244 | CDS | open | 6142-8421 | _na 759_aa | DUF4435 domain-containing protein | |
| 484 | CAKAPN010000015.1 | GCA916719885_00245 | CDS | open | 8577-9506 | _na 309_aa | Abi-like protein | |
| 485 | CAKAPN010000015.1 | GCA916719885_00246 | CDS | open | 9557-10738 | _na 393_aa | viaA | VWA containing CoxE family protein |
| 486 | CAKAPN010000015.1 | GCA916719885_00239 | gene | open | 142-1350 | rfbB | ||
| 487 | CAKAPN010000015.1 | GCA916719885_00240 | gene | open | 1478-2119 | rfbC | ||
| 488 | CAKAPN010000015.1 | GCA916719885_00241 | gene | open | 2419-3858 | |||
| 489 | CAKAPN010000015.1 | GCA916719885_00242 | gene | open | 3883-4980 | |||
| 490 | CAKAPN010000015.1 | GCA916719885_00243 | gene | open | 5027-6127 | mMP0363 | ||
| 491 | CAKAPN010000015.1 | GCA916719885_00244 | gene | open | 6142-8421 | |||
| 492 | CAKAPN010000015.1 | GCA916719885_00245 | gene | open | 8577-9506 | |||
| 493 | CAKAPN010000015.1 | GCA916719885_00246 | gene | open | 9557-10738 | viaA | ||
| 494 | CAKAPN010000016.1 | GCA916719885_00247 | CDS | open | 618-998 | _na 126_aa | hypothetical protein | |
| 495 | CAKAPN010000016.1 | GCA916719885_00248 | CDS | open | 1287-1958 | _na 223_aa | cell division protein FtsQ/DivIB | |
| 496 | CAKAPN010000016.1 | GCA916719885_00249 | CDS | open | 2061-2915 | _na 284_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 497 | CAKAPN010000016.1 | GCA916719885_00250 | CDS | open | 2926-4290 | _na 454_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 498 | CAKAPN010000016.1 | GCA916719885_00251 | CDS | open | 4307-5356 | _na 349_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 499 | CAKAPN010000016.1 | GCA916719885_00252 | CDS | open | 5384-6577 | _na 397_aa | FtsW/RodA/SpoVE family cell cycle protein | |
| 500 | CAKAPN010000016.1 | GCA916719885_00253 | CDS | open | 6630-8000 | _na 456_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |

