HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Hoylesella nanceiensis (GCA_916719955.1)

Select a Genome:
BAKTA Annotations for GCA_916719955.1
Genome Selected: Hoylesella nanceiensis
ContigsBases CDSrRNA tmRNAtRNA
55 2,335,203 1807 0 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3693 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3693 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
2501 CAKAPR010000015.1 GCA916719955_01242 gene open 33049-33795
2502 CAKAPR010000015.1 GCA916719955_01243 gene open 33830-34300 paaI
2503 CAKAPR010000015.1 GCA916719955_01244 gene open 34497-34841
2504 CAKAPR010000015.1 GCA916719955_01245 gene open 35172-36059 dapA
2505 CAKAPR010000015.1 GCA916719955_01246 gene open 36384-37028
2506 CAKAPR010000015.1 GCA916719955_01247 gene open 37100-38038
2507 CAKAPR010000015.1 GCA916719955_01249 gene open 38487-38876 secG
2508 CAKAPR010000015.1 GCA916719955_01250 gene open 38888-39637
2509 CAKAPR010000015.1 GCA916719955_01251 gene open 39660-40205
2510 CAKAPR010000015.1 GCA916719955_01252 gene open 40195-41457
2511 CAKAPR010000015.1 GCA916719955_01253 gene open 41616-42521 menA
2512 CAKAPR010000015.1 GCA916719955_01254 gene open 42578-43204
2513 CAKAPR010000015.1 GCA916719955_01255 gene open 43412-44110 rprY
2514 CAKAPR010000015.1 GCA916719955_01256 gene open 44116-45639
2515 CAKAPR010000015.1 GCA916719955_01257 gene open 45808-46380
2516 CAKAPR010000015.1 GCA916719955_01258 gene open 46396-47091
2517 CAKAPR010000015.1 GCA916719955_01259 gene open 48079-48555
2518 CAKAPR010000015.1 GCA916719955_01248 gene open 38322-38397 trnH
2519 CAKAPR010000015.1 GCA916719955_01248 tRNA open 38322-38397 trnH tRNA-His(gtg)
2520 CAKAPR010000016.1 repeat_region open 179-1616 CRISPR array with 19 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTCCAAATGTATATCTTTGCAATATCATAAGCAAC and spacer length 29
2521 CAKAPR010000016.1 GCA916719955_01260 CDS open 1716-2048 _na     110_aa cas2 CRISPR-associated endonuclease Cas2
2522 CAKAPR010000016.1 GCA916719955_01261 CDS open 2048-2980 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
2523 CAKAPR010000016.1 GCA916719955_01262 CDS open 2977-7254 _na     1425_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2524 CAKAPR010000016.1 GCA916719955_01263 CDS open 8029-8466 _na     145_aa DUF4296 domain-containing protein
2525 CAKAPR010000016.1 GCA916719955_01264 CDS open 8459-8785 _na     108_aa hypothetical protein
2526 CAKAPR010000016.1 GCA916719955_01265 CDS open 10022-10789 _na     255_aa ADP-ribosylglycohydrolase family protein
2527 CAKAPR010000016.1 GCA916719955_01266 CDS open 11572-12327 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
2528 CAKAPR010000016.1 GCA916719955_01267 CDS open 12462-14444 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
2529 CAKAPR010000016.1 GCA916719955_01268 CDS open 14491-15174 _na     227_aa B558 family succinate dehydrogenase (Or fumarate reductase) cytochrome B subunit
2530 CAKAPR010000016.1 GCA916719955_01269 CDS open 15472-17442 _na     656_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2531 CAKAPR010000016.1 GCA916719955_01270 CDS open 17590-18120 _na     176_aa adenine phosphoribosyltransferase
2532 CAKAPR010000016.1 GCA916719955_01271 CDS open 18340-20190 _na     616_aa uvrC excinuclease ABC subunit UvrC
2533 CAKAPR010000016.1 GCA916719955_01272 CDS open 20888-21340 _na     150_aa dtd D-aminoacyl-tRNA deacylase
2534 CAKAPR010000016.1 GCA916719955_01273 CDS open 21383-21766 _na     127_aa NTP pyrophosphohydrolase MazG-like domain-containing protein
2535 CAKAPR010000016.1 GCA916719955_01274 CDS open 21786-22736 _na     316_aa deoC deoxyribose-phosphate aldolase
2536 CAKAPR010000016.1 GCA916719955_01275 CDS open 22874-23857 _na     327_aa Octaprenyl-diphosphate synthase
2537 CAKAPR010000016.1 GCA916719955_01276 CDS open 23938-26703 _na     921_aa polA DNA polymerase I
2538 CAKAPR010000016.1 GCA916719955_01277 CDS open 27103-27591 _na     162_aa Thioredoxin domain-containing protein
2539 CAKAPR010000016.1 GCA916719955_01278 CDS open 27588-29225 _na     545_aa DUF6029 domain-containing protein
2540 CAKAPR010000016.1 GCA916719955_01279 CDS open 29231-30019 _na     262_aa Outer membrane protein Omp28
2541 CAKAPR010000016.1 GCA916719955_01280 CDS open 30103-30789 _na     228_aa T9SS type A sorting domain-containing protein
2542 CAKAPR010000016.1 GCA916719955_01281 CDS open 30811-32118 _na     435_aa Omp28-related outer membrane protein
2543 CAKAPR010000016.1 GCA916719955_01282 CDS open 32201-32482 _na     93_aa hypothetical protein
2544 CAKAPR010000016.1 GCA916719955_01283 CDS open 32624-33547 _na     307_aa Acyltransferase 3 domain-containing protein
2545 CAKAPR010000016.1 GCA916719955_01284 CDS open 33637-34476 _na     279_aa NADP-dependent oxidoreductase domain-containing protein
2546 CAKAPR010000016.1 GCA916719955_01285 CDS open 34895-38098 _na     1067_aa SusC/RagA family TonB-linked outer membrane protein
2547 CAKAPR010000016.1 GCA916719955_01286 CDS open 38127-39890 _na     587_aa RagB/SusD domain-containing protein
2548 CAKAPR010000016.1 GCA916719955_01287 CDS open 40369-41028 _na     219_aa DUF4840 domain-containing protein
2549 CAKAPR010000016.1 GCA916719955_01289 CDS open 42587-42976 _na     129_aa hypothetical protein
2550 CAKAPR010000016.1 GCA916719955_01290 CDS open 42855-44471 _na     538_aa carboxylesterase family protein
2551 CAKAPR010000016.1 GCA916719955_01291 CDS open 45289-47475 _na     728_aa hypothetical protein
2552 CAKAPR010000016.1 GCA916719955_01292 CDS open 47609-47752 _na     47_aa hypothetical protein
2553 CAKAPR010000016.1 GCA916719955_01293 CDS open 48252-48386 _na     44_aa hypothetical protein
2554 CAKAPR010000016.1 GCA916719955_01260 gene open 1716-2048 cas2
2555 CAKAPR010000016.1 GCA916719955_01261 gene open 2048-2980 cas1
2556 CAKAPR010000016.1 GCA916719955_01262 gene open 2977-7254 cas9
2557 CAKAPR010000016.1 GCA916719955_01263 gene open 8029-8466
2558 CAKAPR010000016.1 GCA916719955_01264 gene open 8459-8785
2559 CAKAPR010000016.1 GCA916719955_01265 gene open 10022-10789
2560 CAKAPR010000016.1 GCA916719955_01266 gene open 11572-12327
2561 CAKAPR010000016.1 GCA916719955_01267 gene open 12462-14444 sdhA
2562 CAKAPR010000016.1 GCA916719955_01268 gene open 14491-15174
2563 CAKAPR010000016.1 GCA916719955_01269 gene open 15472-17442 mnmG
2564 CAKAPR010000016.1 GCA916719955_01270 gene open 17590-18120
2565 CAKAPR010000016.1 GCA916719955_01271 gene open 18340-20190 uvrC
2566 CAKAPR010000016.1 GCA916719955_01272 gene open 20888-21340 dtd
2567 CAKAPR010000016.1 GCA916719955_01273 gene open 21383-21766
2568 CAKAPR010000016.1 GCA916719955_01274 gene open 21786-22736 deoC
2569 CAKAPR010000016.1 GCA916719955_01275 gene open 22874-23857
2570 CAKAPR010000016.1 GCA916719955_01276 gene open 23938-26703 polA
2571 CAKAPR010000016.1 GCA916719955_01277 gene open 27103-27591
2572 CAKAPR010000016.1 GCA916719955_01278 gene open 27588-29225
2573 CAKAPR010000016.1 GCA916719955_01279 gene open 29231-30019
2574 CAKAPR010000016.1 GCA916719955_01280 gene open 30103-30789
2575 CAKAPR010000016.1 GCA916719955_01281 gene open 30811-32118
2576 CAKAPR010000016.1 GCA916719955_01282 gene open 32201-32482
2577 CAKAPR010000016.1 GCA916719955_01283 gene open 32624-33547
2578 CAKAPR010000016.1 GCA916719955_01284 gene open 33637-34476
2579 CAKAPR010000016.1 GCA916719955_01285 gene open 34895-38098
2580 CAKAPR010000016.1 GCA916719955_01286 gene open 38127-39890
2581 CAKAPR010000016.1 GCA916719955_01287 gene open 40369-41028
2582 CAKAPR010000016.1 GCA916719955_01289 gene open 42587-42976
2583 CAKAPR010000016.1 GCA916719955_01290 gene open 42855-44471
2584 CAKAPR010000016.1 GCA916719955_01291 gene open 45289-47475
2585 CAKAPR010000016.1 GCA916719955_01292 gene open 47609-47752
2586 CAKAPR010000016.1 GCA916719955_01293 gene open 48252-48386
2587 CAKAPR010000016.1 GCA916719955_01288 gene open 41681-41762 trnL
2588 CAKAPR010000016.1 GCA916719955_01288 tRNA open 41681-41762 trnL tRNA-Leu(caa)
2589 CAKAPR010000017.1 GCA916719955_01294 CDS open 1306-1476 _na     56_aa hypothetical protein
2590 CAKAPR010000017.1 GCA916719955_01295 CDS open 1600-1842 _na     80_aa Carrier domain-containing protein
2591 CAKAPR010000017.1 GCA916719955_01296 CDS open 1912-3405 _na     497_aa Amino acid adenylation domain-containing protein
2592 CAKAPR010000017.1 GCA916719955_01297 CDS open 3611-4636 _na     341_aa DUF5312 domain-containing protein
2593 CAKAPR010000017.1 GCA916719955_01298 CDS open 4775-6160 _na     461_aa Multidrug-efflux transporter
2594 CAKAPR010000017.1 GCA916719955_01299 CDS open 7356-8009 _na     217_aa FKBP-type peptidyl-prolyl cis-trans isomerase
2595 CAKAPR010000017.1 GCA916719955_01300 CDS open 8382-9428 _na     348_aa yeiH YeiH family protein
2596 CAKAPR010000017.1 GCA916719955_01301 CDS open 9740-11311 _na     523_aa glycine--tRNA ligase
2597 CAKAPR010000017.1 GCA916719955_01302 CDS open 11387-14107 _na     906_aa DNA gyrase/topoisomerase IV subunit A
2598 CAKAPR010000017.1 GCA916719955_01303 CDS open 14127-14930 _na     267_aa DUF3316 domain-containing protein
2599 CAKAPR010000017.1 GCA916719955_01304 CDS open 14927-15946 _na     339_aa Tail specific protease domain-containing protein
2600 CAKAPR010000017.1 GCA916719955_01306 CDS open 16413-17072 _na     219_aa NAD(P)H-binding protein
2601 CAKAPR010000017.1 GCA916719955_01307 CDS open 17308-17679 _na     123_aa helix-turn-helix domain-containing protein
2602 CAKAPR010000017.1 GCA916719955_01308 CDS open 18390-19385 _na     331_aa D-lactate dehydrogenase
2603 CAKAPR010000017.1 GCA916719955_01309 CDS open 19995-21002 _na     335_aa aspartate-semialdehyde dehydrogenase
2604 CAKAPR010000017.1 GCA916719955_01310 CDS open 21123-23258 _na     711_aa Cation/H+ exchanger transmembrane domain-containing protein
2605 CAKAPR010000017.1 GCA916719955_01311 CDS open 23275-23979 _na     234_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
2606 CAKAPR010000017.1 GCA916719955_01312 CDS open 23966-24802 _na     278_aa gntR GntR family transcriptional regulator
2607 CAKAPR010000017.1 GCA916719955_01313 CDS open 24805-25755 _na     316_aa hypothetical protein
2608 CAKAPR010000017.1 GCA916719955_01314 CDS open 25972-27429 _na     485_aa Aspartate ammonia-lyase
2609 CAKAPR010000017.1 GCA916719955_01315 CDS open 27717-28943 _na     408_aa Uracil-xanthine permease
2610 CAKAPR010000017.1 GCA916719955_01316 CDS open 29062-30219 _na     385_aa lactonase family protein
2611 CAKAPR010000017.1 GCA916719955_01317 CDS open 30287-31060 _na     257_aa THIF-type NAD/FAD binding fold domain-containing protein
2612 CAKAPR010000017.1 GCA916719955_01318 CDS open 31093-32310 _na     405_aa L-serine ammonia-lyase
2613 CAKAPR010000017.1 GCA916719955_01320 CDS open 33159-36428 _na     1089_aa TonB-dependent receptor
2614 CAKAPR010000017.1 GCA916719955_01321 CDS open 36470-38104 _na     544_aa RagB/SusD family nutrient uptake outer membrane protein
2615 CAKAPR010000017.1 GCA916719955_01322 CDS open 38151-38348 _na     65_aa hypothetical protein
2616 CAKAPR010000017.1 GCA916719955_01323 CDS open 38604-39950 _na     448_aa purB adenylosuccinate lyase
2617 CAKAPR010000017.1 GCA916719955_01324 CDS open 40028-41467 _na     479_aa Pseudouridine synthase
2618 CAKAPR010000017.1 GCA916719955_01325 CDS open 41679-43082 _na     467_aa asnS asparagine--tRNA ligase
2619 CAKAPR010000017.1 GCA916719955_01326 CDS open 43881-44153 _na     90_aa hypothetical protein
2620 CAKAPR010000017.1 GCA916719955_01327 CDS open 44413-44892 _na     159_aa hypothetical protein
2621 CAKAPR010000017.1 GCA916719955_01328 CDS open 44918-45595 _na     225_aa DUF4230 domain-containing protein
2622 CAKAPR010000017.1 GCA916719955_01294 gene open 1306-1476
2623 CAKAPR010000017.1 GCA916719955_01295 gene open 1600-1842
2624 CAKAPR010000017.1 GCA916719955_01296 gene open 1912-3405
2625 CAKAPR010000017.1 GCA916719955_01297 gene open 3611-4636
2626 CAKAPR010000017.1 GCA916719955_01298 gene open 4775-6160
2627 CAKAPR010000017.1 GCA916719955_01299 gene open 7356-8009
2628 CAKAPR010000017.1 GCA916719955_01300 gene open 8382-9428 yeiH
2629 CAKAPR010000017.1 GCA916719955_01301 gene open 9740-11311
2630 CAKAPR010000017.1 GCA916719955_01302 gene open 11387-14107
2631 CAKAPR010000017.1 GCA916719955_01303 gene open 14127-14930
2632 CAKAPR010000017.1 GCA916719955_01304 gene open 14927-15946
2633 CAKAPR010000017.1 GCA916719955_01306 gene open 16413-17072
2634 CAKAPR010000017.1 GCA916719955_01307 gene open 17308-17679
2635 CAKAPR010000017.1 GCA916719955_01308 gene open 18390-19385
2636 CAKAPR010000017.1 GCA916719955_01309 gene open 19995-21002
2637 CAKAPR010000017.1 GCA916719955_01310 gene open 21123-23258
2638 CAKAPR010000017.1 GCA916719955_01311 gene open 23275-23979 lolD
2639 CAKAPR010000017.1 GCA916719955_01312 gene open 23966-24802 gntR
2640 CAKAPR010000017.1 GCA916719955_01313 gene open 24805-25755
2641 CAKAPR010000017.1 GCA916719955_01314 gene open 25972-27429
2642 CAKAPR010000017.1 GCA916719955_01315 gene open 27717-28943
2643 CAKAPR010000017.1 GCA916719955_01316 gene open 29062-30219
2644 CAKAPR010000017.1 GCA916719955_01317 gene open 30287-31060
2645 CAKAPR010000017.1 GCA916719955_01318 gene open 31093-32310
2646 CAKAPR010000017.1 GCA916719955_01320 gene open 33159-36428
2647 CAKAPR010000017.1 GCA916719955_01321 gene open 36470-38104
2648 CAKAPR010000017.1 GCA916719955_01322 gene open 38151-38348
2649 CAKAPR010000017.1 GCA916719955_01323 gene open 38604-39950 purB
2650 CAKAPR010000017.1 GCA916719955_01324 gene open 40028-41467
2651 CAKAPR010000017.1 GCA916719955_01325 gene open 41679-43082 asnS
2652 CAKAPR010000017.1 GCA916719955_01326 gene open 43881-44153
2653 CAKAPR010000017.1 GCA916719955_01327 gene open 44413-44892
2654 CAKAPR010000017.1 GCA916719955_01328 gene open 44918-45595
2655 CAKAPR010000017.1 GCA916719955_01305 gene open 16003-16084 trnL
2656 CAKAPR010000017.1 GCA916719955_01319 gene open 32751-32825 trnV
2657 CAKAPR010000017.1 GCA916719955_01305 tRNA open 16003-16084 trnL tRNA-Leu(tag)
2658 CAKAPR010000017.1 GCA916719955_01319 tRNA open 32751-32825 trnV tRNA-Val(tac)
2659 CAKAPR010000018.1 regulatory_region open 25220-25295 L13-Bacteroidia ribosomal protein leader
2660 CAKAPR010000018.1 GCA916719955_01329 CDS open 3399-5657 _na     752_aa Alpha-1%2C2-mannosidase
2661 CAKAPR010000018.1 GCA916719955_01330 CDS open 5816-6199 _na     127_aa Fluoroacetyl-CoA-specific thioesterase-like domain-containing protein
2662 CAKAPR010000018.1 GCA916719955_01331 CDS open 6376-6852 _na     158_aa Arginine repressor
2663 CAKAPR010000018.1 GCA916719955_01332 CDS open 7282-7836 _na     184_aa HTH cro/C1-type domain-containing protein
2664 CAKAPR010000018.1 GCA916719955_01333 CDS open 7851-9509 _na     552_aa Acetyl-coenzyme A synthetase
2665 CAKAPR010000018.1 GCA916719955_01334 CDS open 9836-10651 _na     271_aa Short chain dehydrogenase
2666 CAKAPR010000018.1 GCA916719955_01335 CDS open 10758-11060 _na     100_aa S8 family serine peptidase
2667 CAKAPR010000018.1 GCA916719955_01336 CDS open 11246-11749 _na     167_aa 5-nitroimidazole antibiotic resistance protein
2668 CAKAPR010000018.1 GCA916719955_01337 CDS open 11801-12322 _na     173_aa Iron-sulfur cluster repair di-iron protein
2669 CAKAPR010000018.1 GCA916719955_01338 CDS open 12771-13745 _na     324_aa Glycosidase
2670 CAKAPR010000018.1 GCA916719955_01339 CDS open 13853-15154 _na     433_aa Major facilitator superfamily (MFS) profile domain-containing protein
2671 CAKAPR010000018.1 GCA916719955_01340 CDS open 15326-16321 _na     331_aa Esterase
2672 CAKAPR010000018.1 GCA916719955_01341 CDS open 16453-17040 _na     195_aa porin family protein
2673 CAKAPR010000018.1 GCA916719955_01342 CDS open 17204-20614 _na     1136_aa Helicase ATP-binding domain-containing protein
2674 CAKAPR010000018.1 GCA916719955_01343 CDS open 20722-20931 _na     69_aa hypothetical protein
2675 CAKAPR010000018.1 GCA916719955_01344 CDS open 21248-22291 _na     347_aa ribonucleotide-diphosphate reductase subunit beta
2676 CAKAPR010000018.1 GCA916719955_01345 CDS open 22368-24887 _na     839_aa ribonucleoside-diphosphate reductase subunit alpha
2677 CAKAPR010000018.1 GCA916719955_01346 CDS open 25349-25810 _na     153_aa rplM 50S ribosomal protein L13
2678 CAKAPR010000018.1 GCA916719955_01347 CDS open 25823-26209 _na     128_aa rpsI 30S ribosomal protein S9
2679 CAKAPR010000018.1 GCA916719955_01348 CDS open 26353-26457 _na     34_aa hypothetical protein
2680 CAKAPR010000018.1 GCA916719955_01349 CDS open 26566-27387 _na     273_aa rpsB 30S ribosomal protein S2
2681 CAKAPR010000018.1 GCA916719955_01350 CDS open 27534-28376 _na     280_aa tsf translation elongation factor Ts
2682 CAKAPR010000018.1 GCA916719955_01351 CDS open 28715-29329 _na     204_aa Thioredoxin domain-containing protein
2683 CAKAPR010000018.1 GCA916719955_01352 CDS open 29373-30002 _na     209_aa hypothetical protein
2684 CAKAPR010000018.1 GCA916719955_01353 CDS open 30554-31375 _na     273_aa pyridoxamine kinase
2685 CAKAPR010000018.1 GCA916719955_01354 CDS open 31478-33295 _na     605_aa AAA+ ATPase domain-containing protein
2686 CAKAPR010000018.1 GCA916719955_01355 CDS open 33297-34982 _na     561_aa phoU PhoU domain-containing protein
2687 CAKAPR010000018.1 GCA916719955_01356 CDS open 35324-37129 _na     601_aa membrane dipeptidase
2688 CAKAPR010000018.1 GCA916719955_01357 CDS open 37182-38192 _na     336_aa Peptidase M28 domain-containing protein
2689 CAKAPR010000018.1 GCA916719955_01358 CDS open 38759-39283 _na     174_aa WG repeat-containing protein
2690 CAKAPR010000018.1 GCA916719955_01359 CDS open 39755-42652 _na     965_aa C10 family peptidase
2691 CAKAPR010000018.1 GCA916719955_01360 CDS open 43026-43916 _na     296_aa pfkB PfkB family carbohydrate kinase
2692 CAKAPR010000018.1 GCA916719955_01361 CDS open 43900-44679 _na     259_aa Outer membrane protein beta-barrel domain-containing protein
2693 CAKAPR010000018.1 GCA916719955_01362 CDS open 44697-45824 _na     375_aa Putative carbohydrate metabolism domain-containing protein
2694 CAKAPR010000018.1 GCA916719955_01329 gene open 3399-5657
2695 CAKAPR010000018.1 GCA916719955_01330 gene open 5816-6199
2696 CAKAPR010000018.1 GCA916719955_01331 gene open 6376-6852
2697 CAKAPR010000018.1 GCA916719955_01332 gene open 7282-7836
2698 CAKAPR010000018.1 GCA916719955_01333 gene open 7851-9509
2699 CAKAPR010000018.1 GCA916719955_01334 gene open 9836-10651
2700 CAKAPR010000018.1 GCA916719955_01335 gene open 10758-11060
2701 CAKAPR010000018.1 GCA916719955_01336 gene open 11246-11749
2702 CAKAPR010000018.1 GCA916719955_01337 gene open 11801-12322
2703 CAKAPR010000018.1 GCA916719955_01338 gene open 12771-13745
2704 CAKAPR010000018.1 GCA916719955_01339 gene open 13853-15154
2705 CAKAPR010000018.1 GCA916719955_01340 gene open 15326-16321
2706 CAKAPR010000018.1 GCA916719955_01341 gene open 16453-17040
2707 CAKAPR010000018.1 GCA916719955_01342 gene open 17204-20614
2708 CAKAPR010000018.1 GCA916719955_01343 gene open 20722-20931
2709 CAKAPR010000018.1 GCA916719955_01344 gene open 21248-22291
2710 CAKAPR010000018.1 GCA916719955_01345 gene open 22368-24887
2711 CAKAPR010000018.1 GCA916719955_01346 gene open 25349-25810 rplM
2712 CAKAPR010000018.1 GCA916719955_01347 gene open 25823-26209 rpsI
2713 CAKAPR010000018.1 GCA916719955_01348 gene open 26353-26457
2714 CAKAPR010000018.1 GCA916719955_01349 gene open 26566-27387 rpsB
2715 CAKAPR010000018.1 GCA916719955_01350 gene open 27534-28376 tsf
2716 CAKAPR010000018.1 GCA916719955_01351 gene open 28715-29329
2717 CAKAPR010000018.1 GCA916719955_01352 gene open 29373-30002
2718 CAKAPR010000018.1 GCA916719955_01353 gene open 30554-31375
2719 CAKAPR010000018.1 GCA916719955_01354 gene open 31478-33295
2720 CAKAPR010000018.1 GCA916719955_01355 gene open 33297-34982 phoU
2721 CAKAPR010000018.1 GCA916719955_01356 gene open 35324-37129
2722 CAKAPR010000018.1 GCA916719955_01357 gene open 37182-38192
2723 CAKAPR010000018.1 GCA916719955_01358 gene open 38759-39283
2724 CAKAPR010000018.1 GCA916719955_01359 gene open 39755-42652
2725 CAKAPR010000018.1 GCA916719955_01360 gene open 43026-43916 pfkB
2726 CAKAPR010000018.1 GCA916719955_01361 gene open 43900-44679
2727 CAKAPR010000018.1 GCA916719955_01362 gene open 44697-45824
2728 CAKAPR010000019.1 GCA916719955_01363 CDS open 54-662 _na     202_aa hypothetical protein
2729 CAKAPR010000019.1 GCA916719955_01364 CDS open 681-2135 _na     484_aa RagB/SusD family nutrient uptake outer membrane protein
2730 CAKAPR010000019.1 GCA916719955_01365 CDS open 2179-2892 _na     237_aa DUF4843 domain-containing protein
2731 CAKAPR010000019.1 GCA916719955_01366 CDS open 2947-4377 _na     476_aa PKD-like domain-containing protein
2732 CAKAPR010000019.1 GCA916719955_01367 CDS open 4389-6929 _na     846_aa zinc-dependent metalloprotease
2733 CAKAPR010000019.1 GCA916719955_01368 CDS open 6926-9457 _na     843_aa zinc-dependent metalloprotease
2734 CAKAPR010000019.1 GCA916719955_01369 CDS open 9705-9998 _na     97_aa YCII-related domain-containing protein
2735 CAKAPR010000019.1 GCA916719955_01370 CDS open 10025-10582 _na     185_aa DJ-1 family glyoxalase III
2736 CAKAPR010000019.1 GCA916719955_01371 CDS open 10706-11593 _na     295_aa NAD kinase
2737 CAKAPR010000019.1 GCA916719955_01372 CDS open 11603-13285 _na     560_aa ABC transporter ATP-binding protein
2738 CAKAPR010000019.1 GCA916719955_01373 CDS open 13282-13806 _na     174_aa Thioredoxin domain-containing protein
2739 CAKAPR010000019.1 GCA916719955_01374 CDS open 14019-15275 _na     418_aa metK methionine adenosyltransferase
2740 CAKAPR010000019.1 GCA916719955_01375 CDS open 15387-16406 _na     339_aa DUF4271 domain-containing protein
2741 CAKAPR010000019.1 GCA916719955_01376 CDS open 16411-17163 _na     250_aa Tetrapyrrole biosynthesis uroporphyrinogen III synthase domain-containing protein
2742 CAKAPR010000019.1 GCA916719955_01377 CDS open 17176-17613 _na     145_aa Ribonuclease P protein component
2743 CAKAPR010000019.1 GCA916719955_01378 CDS open 17871-19172 _na     433_aa tyrS tyrosine--tRNA ligase
2744 CAKAPR010000019.1 GCA916719955_01379 CDS open 19155-19316 _na     53_aa hypothetical protein
2745 CAKAPR010000019.1 GCA916719955_01380 CDS open 19832-22522 _na     896_aa prtT thiol protease/hemagglutinin PrtT
2746 CAKAPR010000019.1 GCA916719955_01381 CDS open 22577-25249 _na     890_aa C10 family peptidase
2747 CAKAPR010000019.1 GCA916719955_01382 CDS open 25535-27181 _na     548_aa Fumarate hydratase class I
2748 CAKAPR010000019.1 GCA916719955_01383 CDS open 27225-30134 _na     969_aa Peptidase M16 inactive domain-containing protein
2749 CAKAPR010000019.1 GCA916719955_01384 CDS open 30131-31993 _na     620_aa DUF4954 domain-containing protein
2750 CAKAPR010000019.1 GCA916719955_01385 CDS open 31990-33240 _na     416_aa hflX GTPase HflX
2751 CAKAPR010000019.1 GCA916719955_01386 CDS open 34135-35778 _na     547_aa beta-N-acetylhexosaminidase
2752 CAKAPR010000019.1 GCA916719955_01387 CDS open 36037-36822 _na     261_aa nagB glucosamine-6-phosphate deaminase
2753 CAKAPR010000019.1 GCA916719955_01388 CDS open 36825-38816 _na     663_aa Glucosamine-6-phosphate deaminase
2754 CAKAPR010000019.1 GCA916719955_01389 CDS open 38930-40018 _na     362_aa Protein kinase domain-containing protein
2755 CAKAPR010000019.1 GCA916719955_01390 CDS open 40032-40685 _na     217_aa Carbohydrate-binding domain-containing protein
2756 CAKAPR010000019.1 GCA916719955_01391 CDS open 40950-43640 _na     896_aa DNA 3'-5' helicase
2757 CAKAPR010000019.1 GCA916719955_01392 CDS open 43667-45256 _na     529_aa DUF6377 domain-containing protein
2758 CAKAPR010000019.1 GCA916719955_01363 gene open 54-662
2759 CAKAPR010000019.1 GCA916719955_01364 gene open 681-2135
2760 CAKAPR010000019.1 GCA916719955_01365 gene open 2179-2892
2761 CAKAPR010000019.1 GCA916719955_01366 gene open 2947-4377
2762 CAKAPR010000019.1 GCA916719955_01367 gene open 4389-6929
2763 CAKAPR010000019.1 GCA916719955_01368 gene open 6926-9457
2764 CAKAPR010000019.1 GCA916719955_01369 gene open 9705-9998
2765 CAKAPR010000019.1 GCA916719955_01370 gene open 10025-10582
2766 CAKAPR010000019.1 GCA916719955_01371 gene open 10706-11593
2767 CAKAPR010000019.1 GCA916719955_01372 gene open 11603-13285
2768 CAKAPR010000019.1 GCA916719955_01373 gene open 13282-13806
2769 CAKAPR010000019.1 GCA916719955_01374 gene open 14019-15275 metK
2770 CAKAPR010000019.1 GCA916719955_01375 gene open 15387-16406
2771 CAKAPR010000019.1 GCA916719955_01376 gene open 16411-17163
2772 CAKAPR010000019.1 GCA916719955_01377 gene open 17176-17613
2773 CAKAPR010000019.1 GCA916719955_01378 gene open 17871-19172 tyrS
2774 CAKAPR010000019.1 GCA916719955_01379 gene open 19155-19316
2775 CAKAPR010000019.1 GCA916719955_01380 gene open 19832-22522 prtT
2776 CAKAPR010000019.1 GCA916719955_01381 gene open 22577-25249
2777 CAKAPR010000019.1 GCA916719955_01382 gene open 25535-27181
2778 CAKAPR010000019.1 GCA916719955_01383 gene open 27225-30134
2779 CAKAPR010000019.1 GCA916719955_01384 gene open 30131-31993
2780 CAKAPR010000019.1 GCA916719955_01385 gene open 31990-33240 hflX
2781 CAKAPR010000019.1 GCA916719955_01386 gene open 34135-35778
2782 CAKAPR010000019.1 GCA916719955_01387 gene open 36037-36822 nagB
2783 CAKAPR010000019.1 GCA916719955_01388 gene open 36825-38816
2784 CAKAPR010000019.1 GCA916719955_01389 gene open 38930-40018
2785 CAKAPR010000019.1 GCA916719955_01390 gene open 40032-40685
2786 CAKAPR010000019.1 GCA916719955_01391 gene open 40950-43640
2787 CAKAPR010000019.1 GCA916719955_01392 gene open 43667-45256
2788 CAKAPR010000020.1 GCA916719955_01393 CDS open 192-1154 _na     320_aa DUF6080 domain-containing protein
2789 CAKAPR010000020.1 GCA916719955_01394 CDS open 1530-1643 _na     37_aa Smalltalk protein
2790 CAKAPR010000020.1 GCA916719955_01395 CDS open 2423-3889 _na     488_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2791 CAKAPR010000020.1 GCA916719955_01396 CDS open 3939-4874 _na     311_aa xerA site-specific tyrosine recombinase/integron integrase
2792 CAKAPR010000020.1 GCA916719955_01397 CDS open 4930-5406 _na     158_aa aroQ type II 3-dehydroquinate dehydratase
2793 CAKAPR010000020.1 GCA916719955_01398 CDS open 5453-6088 _na     211_aa O-methyltransferase
2794 CAKAPR010000020.1 GCA916719955_01399 CDS open 6132-6683 _na     183_aa RNA polymerase sigma-70 factor
2795 CAKAPR010000020.1 GCA916719955_01400 CDS open 6974-7552 _na     192_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
2796 CAKAPR010000020.1 GCA916719955_01401 CDS open 7568-8134 _na     188_aa gmk guanylate kinase
2797 CAKAPR010000020.1 GCA916719955_01402 CDS open 8146-9021 _na     291_aa TIGR00255 family protein
2798 CAKAPR010000020.1 GCA916719955_01403 CDS open 9219-9911 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
2799 CAKAPR010000020.1 GCA916719955_01404 CDS open 10001-10597 _na     198_aa DUF4290 domain-containing protein
2800 CAKAPR010000020.1 GCA916719955_01405 CDS open 10599-11909 _na     436_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2801 CAKAPR010000020.1 GCA916719955_01406 CDS open 11926-12450 _na     174_aa rimM ribosome maturation factor RimM
2802 CAKAPR010000020.1 GCA916719955_01407 CDS open 12450-13604 _na     384_aa 1-deoxy-D-xylulose-5-phosphate reductoisomerase
2803 CAKAPR010000020.1 GCA916719955_01408 CDS open 13745-15121 _na     458_aa rseP RIP metalloprotease RseP
2804 CAKAPR010000020.1 GCA916719955_01409 CDS open 15335-15802 _na     155_aa hypothetical protein
2805 CAKAPR010000020.1 GCA916719955_01410 CDS open 15799-16104 _na     101_aa hypothetical protein
2806 CAKAPR010000020.1 GCA916719955_01411 CDS open 16187-18730 _na     847_aa fimbrillin family protein
2807 CAKAPR010000020.1 GCA916719955_01412 CDS open 18881-19060 _na     59_aa hypothetical protein
2808 CAKAPR010000020.1 GCA916719955_01413 CDS open 19694-20371 _na     225_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2809 CAKAPR010000020.1 GCA916719955_01414 CDS open 20541-22646 _na     701_aa recG ATP-dependent DNA helicase RecG
2810 CAKAPR010000020.1 GCA916719955_01415 CDS open 23101-24048 _na     315_aa lysM LysM domain-containing protein
2811 CAKAPR010000020.1 GCA916719955_01416 CDS open 24409-25185 _na     258_aa Glycosyltransferase 2-like domain-containing protein
2812 CAKAPR010000020.1 GCA916719955_01417 CDS open 25182-26456 _na     424_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
2813 CAKAPR010000020.1 GCA916719955_01418 CDS open 27673-29820 _na     715_aa Alpha-1%2C2-mannosidase
2814 CAKAPR010000020.1 GCA916719955_01419 CDS open 30215-31615 _na     466_aa DUF6242 domain-containing protein
2815 CAKAPR010000020.1 GCA916719955_01420 CDS open 31651-32352 _na     233_aa DUF6089 domain-containing protein
2816 CAKAPR010000020.1 GCA916719955_01421 CDS open 32429-33175 _na     248_aa isoprenyl transferase
2817 CAKAPR010000020.1 GCA916719955_01422 CDS open 33278-35920 _na     880_aa yaeT Outer membrane protein assembly complex%2C YaeT protein
2818 CAKAPR010000020.1 GCA916719955_01423 CDS open 35971-36477 _na     168_aa Outer membrane protein
2819 CAKAPR010000020.1 GCA916719955_01424 CDS open 36512-37012 _na     166_aa Outer membrane protein
2820 CAKAPR010000020.1 GCA916719955_01425 CDS open 37165-37647 _na     160_aa Outer membrane protein
2821 CAKAPR010000020.1 GCA916719955_01426 CDS open 37661-38512 _na     283_aa murI glutamate racemase
2822 CAKAPR010000020.1 GCA916719955_01427 CDS open 38590-38925 _na     111_aa rbfA 30S ribosome-binding factor RbfA
2823 CAKAPR010000020.1 GCA916719955_01428 CDS open 38977-40206 _na     409_aa ABC3 transporter permease protein domain-containing protein
2824 CAKAPR010000020.1 GCA916719955_01429 CDS open 40834-41616 _na     260_aa DUF4595 domain-containing protein
2825 CAKAPR010000020.1 GCA916719955_01430 CDS open 41963-42880 _na     305_aa N-acetylneuraminate lyase
2826 CAKAPR010000020.1 GCA916719955_01431 CDS open 43122-44312 _na     396_aa N-acylglucosamine 2-epimerase
2827 CAKAPR010000020.1 GCA916719955_01432 CDS open 44344-45579 _na     411_aa Major facilitator superfamily (MFS) profile domain-containing protein
2828 CAKAPR010000020.1 GCA916719955_01393 gene open 192-1154
2829 CAKAPR010000020.1 GCA916719955_01394 gene open 1530-1643
2830 CAKAPR010000020.1 GCA916719955_01395 gene open 2423-3889
2831 CAKAPR010000020.1 GCA916719955_01396 gene open 3939-4874 xerA
2832 CAKAPR010000020.1 GCA916719955_01397 gene open 4930-5406 aroQ
2833 CAKAPR010000020.1 GCA916719955_01398 gene open 5453-6088
2834 CAKAPR010000020.1 GCA916719955_01399 gene open 6132-6683
2835 CAKAPR010000020.1 GCA916719955_01400 gene open 6974-7552 nadD
2836 CAKAPR010000020.1 GCA916719955_01401 gene open 7568-8134 gmk
2837 CAKAPR010000020.1 GCA916719955_01402 gene open 8146-9021
2838 CAKAPR010000020.1 GCA916719955_01403 gene open 9219-9911 tsaB
2839 CAKAPR010000020.1 GCA916719955_01404 gene open 10001-10597
2840 CAKAPR010000020.1 GCA916719955_01405 gene open 10599-11909 murA
2841 CAKAPR010000020.1 GCA916719955_01406 gene open 11926-12450 rimM
2842 CAKAPR010000020.1 GCA916719955_01407 gene open 12450-13604
2843 CAKAPR010000020.1 GCA916719955_01408 gene open 13745-15121 rseP
2844 CAKAPR010000020.1 GCA916719955_01409 gene open 15335-15802
2845 CAKAPR010000020.1 GCA916719955_01410 gene open 15799-16104
2846 CAKAPR010000020.1 GCA916719955_01411 gene open 16187-18730
2847 CAKAPR010000020.1 GCA916719955_01412 gene open 18881-19060
2848 CAKAPR010000020.1 GCA916719955_01413 gene open 19694-20371
2849 CAKAPR010000020.1 GCA916719955_01414 gene open 20541-22646 recG
2850 CAKAPR010000020.1 GCA916719955_01415 gene open 23101-24048 lysM
2851 CAKAPR010000020.1 GCA916719955_01416 gene open 24409-25185
2852 CAKAPR010000020.1 GCA916719955_01417 gene open 25182-26456
2853 CAKAPR010000020.1 GCA916719955_01418 gene open 27673-29820
2854 CAKAPR010000020.1 GCA916719955_01419 gene open 30215-31615
2855 CAKAPR010000020.1 GCA916719955_01420 gene open 31651-32352
2856 CAKAPR010000020.1 GCA916719955_01421 gene open 32429-33175
2857 CAKAPR010000020.1 GCA916719955_01422 gene open 33278-35920 yaeT
2858 CAKAPR010000020.1 GCA916719955_01423 gene open 35971-36477
2859 CAKAPR010000020.1 GCA916719955_01424 gene open 36512-37012
2860 CAKAPR010000020.1 GCA916719955_01425 gene open 37165-37647
2861 CAKAPR010000020.1 GCA916719955_01426 gene open 37661-38512 murI
2862 CAKAPR010000020.1 GCA916719955_01427 gene open 38590-38925 rbfA
2863 CAKAPR010000020.1 GCA916719955_01428 gene open 38977-40206
2864 CAKAPR010000020.1 GCA916719955_01429 gene open 40834-41616
2865 CAKAPR010000020.1 GCA916719955_01430 gene open 41963-42880
2866 CAKAPR010000020.1 GCA916719955_01431 gene open 43122-44312
2867 CAKAPR010000020.1 GCA916719955_01432 gene open 44344-45579
2868 CAKAPR010000021.1 GCA916719955_01433 CDS open 66-1136 _na     356_aa aminopeptidase family protein P
2869 CAKAPR010000021.1 GCA916719955_01434 CDS open 1229-3499 _na     756_aa priA primosomal protein N'
2870 CAKAPR010000021.1 GCA916719955_01435 CDS open 3752-5272 _na     506_aa Outer membrane protein beta-barrel domain-containing protein
2871 CAKAPR010000021.1 GCA916719955_01436 CDS open 5676-6290 _na     204_aa porin family protein
2872 CAKAPR010000021.1 GCA916719955_01437 CDS open 6339-7394 _na     351_aa gldN Gliding motility associated protein GldN
2873 CAKAPR010000021.1 GCA916719955_01438 CDS open 7430-8980 _na     516_aa gldM Gliding motility-associated protein GldM
2874 CAKAPR010000021.1 GCA916719955_01439 CDS open 9016-9780 _na     254_aa gldL Gliding motility-associated protein GldL
2875 CAKAPR010000021.1 GCA916719955_01440 CDS open 9782-11233 _na     483_aa gldK Gliding motility-associated lipoprotein GldK
2876 CAKAPR010000021.1 GCA916719955_01441 CDS open 11353-12273 _na     306_aa Bacteroidetes-specific membrane protein
2877 CAKAPR010000021.1 GCA916719955_01442 CDS open 12398-13027 _na     209_aa hypothetical protein
2878 CAKAPR010000021.1 GCA916719955_01443 CDS open 13105-14262 _na     385_aa mutY A/G-specific adenine glycosylase
2879 CAKAPR010000021.1 GCA916719955_01444 CDS open 14405-14581 _na     58_aa hypothetical protein
2880 CAKAPR010000021.1 GCA916719955_01445 CDS open 14562-15650 _na     362_aa hypothetical protein
2881 CAKAPR010000021.1 GCA916719955_01446 CDS open 16122-17930 _na     602_aa AMP-dependent synthetase/ligase domain-containing protein
2882 CAKAPR010000021.1 GCA916719955_01447 CDS open 17997-19118 _na     373_aa prfB peptide chain release factor 2
2883 CAKAPR010000021.1 GCA916719955_01448 CDS open 19221-19358 _na     45_aa hypothetical protein
2884 CAKAPR010000021.1 GCA916719955_01449 CDS open 19359-19874 _na     171_aa CYTH domain-containing protein
2885 CAKAPR010000021.1 GCA916719955_01450 CDS open 19937-20833 _na     298_aa Competence protein ComEA helix-hairpin-helix repeat region
2886 CAKAPR010000021.1 GCA916719955_01451 CDS open 21146-21466 _na     106_aa FeS assembly SUF system protein
2887 CAKAPR010000021.1 GCA916719955_01452 CDS open 21483-22247 _na     254_aa Calcineurin-like phosphoesterase domain-containing protein
2888 CAKAPR010000021.1 GCA916719955_01453 CDS open 22342-23418 _na     358_aa Serine protease
2889 CAKAPR010000021.1 GCA916719955_01454 CDS open 23664-23819 _na     51_aa rpmH 50S ribosomal protein L34
2890 CAKAPR010000021.1 GCA916719955_01455 CDS open 24186-24752 _na     188_aa efp elongation factor P
2891 CAKAPR010000021.1 GCA916719955_01456 CDS open 24841-25845 _na     334_aa Glycosyltransferase 2-like domain-containing protein
2892 CAKAPR010000021.1 GCA916719955_01457 CDS open 25895-26584 _na     229_aa radC DNA repair protein RadC
2893 CAKAPR010000021.1 GCA916719955_01460 CDS open 27316-28074 _na     252_aa Peptidase C39-like domain-containing protein
2894 CAKAPR010000021.1 GCA916719955_01461 CDS open 28205-29422 _na     405_aa 3-deoxy-D-manno-octulosonic acid transferase
2895 CAKAPR010000021.1 GCA916719955_01462 CDS open 29600-31117 _na     505_aa gltX glutamate--tRNA ligase
2896 CAKAPR010000021.1 GCA916719955_01463 CDS open 31232-33280 _na     682_aa HD domain-containing protein
2897 CAKAPR010000021.1 GCA916719955_01464 CDS open 33611-33832 _na     73_aa DUF2795 domain-containing protein
2898 CAKAPR010000021.1 GCA916719955_01465 CDS open 34288-35625 _na     445_aa HD/PDEase domain-containing protein
2899 CAKAPR010000021.1 GCA916719955_01466 CDS open 35810-37453 _na     547_aa RagB/SusD domain-containing protein
2900 CAKAPR010000021.1 GCA916719955_01467 CDS open 37470-39221 _na     583_aa SusC/RagA family TonB-linked outer membrane protein
2901 CAKAPR010000021.1 GCA916719955_01433 gene open 66-1136
2902 CAKAPR010000021.1 GCA916719955_01434 gene open 1229-3499 priA
2903 CAKAPR010000021.1 GCA916719955_01435 gene open 3752-5272
2904 CAKAPR010000021.1 GCA916719955_01436 gene open 5676-6290
2905 CAKAPR010000021.1 GCA916719955_01437 gene open 6339-7394 gldN
2906 CAKAPR010000021.1 GCA916719955_01438 gene open 7430-8980 gldM
2907 CAKAPR010000021.1 GCA916719955_01439 gene open 9016-9780 gldL
2908 CAKAPR010000021.1 GCA916719955_01440 gene open 9782-11233 gldK
2909 CAKAPR010000021.1 GCA916719955_01441 gene open 11353-12273
2910 CAKAPR010000021.1 GCA916719955_01442 gene open 12398-13027
2911 CAKAPR010000021.1 GCA916719955_01443 gene open 13105-14262 mutY
2912 CAKAPR010000021.1 GCA916719955_01444 gene open 14405-14581
2913 CAKAPR010000021.1 GCA916719955_01445 gene open 14562-15650
2914 CAKAPR010000021.1 GCA916719955_01446 gene open 16122-17930
2915 CAKAPR010000021.1 GCA916719955_01447 gene open 17997-19118 prfB
2916 CAKAPR010000021.1 GCA916719955_01448 gene open 19221-19358
2917 CAKAPR010000021.1 GCA916719955_01449 gene open 19359-19874
2918 CAKAPR010000021.1 GCA916719955_01450 gene open 19937-20833
2919 CAKAPR010000021.1 GCA916719955_01451 gene open 21146-21466
2920 CAKAPR010000021.1 GCA916719955_01452 gene open 21483-22247
2921 CAKAPR010000021.1 GCA916719955_01453 gene open 22342-23418
2922 CAKAPR010000021.1 GCA916719955_01454 gene open 23664-23819 rpmH
2923 CAKAPR010000021.1 GCA916719955_01455 gene open 24186-24752 efp
2924 CAKAPR010000021.1 GCA916719955_01456 gene open 24841-25845
2925 CAKAPR010000021.1 GCA916719955_01457 gene open 25895-26584 radC
2926 CAKAPR010000021.1 GCA916719955_01460 gene open 27316-28074
2927 CAKAPR010000021.1 GCA916719955_01461 gene open 28205-29422
2928 CAKAPR010000021.1 GCA916719955_01462 gene open 29600-31117 gltX
2929 CAKAPR010000021.1 GCA916719955_01463 gene open 31232-33280
2930 CAKAPR010000021.1 GCA916719955_01464 gene open 33611-33832
2931 CAKAPR010000021.1 GCA916719955_01465 gene open 34288-35625
2932 CAKAPR010000021.1 GCA916719955_01466 gene open 35810-37453
2933 CAKAPR010000021.1 GCA916719955_01467 gene open 37470-39221
2934 CAKAPR010000021.1 GCA916719955_01458 gene open 26976-27048 trnF
2935 CAKAPR010000021.1 GCA916719955_01459 gene open 27200-27272 trnP
2936 CAKAPR010000021.1 GCA916719955_01458 tRNA open 26976-27048 trnF tRNA-Phe(gaa)
2937 CAKAPR010000021.1 GCA916719955_01459 tRNA open 27200-27272 trnP tRNA-Pro(cgg)
2938 CAKAPR010000022.1 GCA916719955_01468 CDS open 323-1717 _na     464_aa Xaa-Pro aminopeptidase
2939 CAKAPR010000022.1 GCA916719955_01469 CDS open 1796-2998 _na     400_aa Aminopeptidase
2940 CAKAPR010000022.1 GCA916719955_01470 CDS open 3357-4160 _na     267_aa GEVED domain-containing protein
2941 CAKAPR010000022.1 GCA916719955_01471 CDS open 4564-6567 _na     667_aa sialate O-acetylesterase
2942 CAKAPR010000022.1 GCA916719955_01472 CDS open 6833-7561 _na     242_aa YebC/PmpR family DNA-binding transcriptional regulator
2943 CAKAPR010000022.1 GCA916719955_01473 CDS open 7595-10057 _na     820_aa pheT phenylalanine--tRNA ligase subunit beta
2944 CAKAPR010000022.1 GCA916719955_01474 CDS open 10265-11293 _na     342_aa Glycosyltransferase 2-like domain-containing protein
2945 CAKAPR010000022.1 GCA916719955_01475 CDS open 11307-12650 _na     447_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2946 CAKAPR010000022.1 GCA916719955_01476 CDS open 13018-13182 _na     54_aa Entericidin
2947 CAKAPR010000022.1 GCA916719955_01477 CDS open 13669-16230 _na     853_aa Outer membrane protein beta-barrel domain-containing protein
2948 CAKAPR010000022.1 GCA916719955_01478 CDS open 16364-16834 _na     156_aa YutG/PgpA domain-containing protein
2949 CAKAPR010000022.1 GCA916719955_01479 CDS open 16822-17220 _na     132_aa GtrA/DPMS transmembrane domain-containing protein
2950 CAKAPR010000022.1 GCA916719955_01480 CDS open 17217-17849 _na     210_aa CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase
2951 CAKAPR010000022.1 GCA916719955_01481 CDS open 17850-18680 _na     276_aa Inositolphosphotransferase Aur1/Ipt1 domain-containing protein
2952 CAKAPR010000022.1 GCA916719955_01482 CDS open 18816-19634 _na     272_aa head GIN domain-containing protein
2953 CAKAPR010000022.1 GCA916719955_01483 CDS open 19680-19835 _na     51_aa hypothetical protein
2954 CAKAPR010000022.1 GCA916719955_01484 CDS open 20021-21682 _na     553_aa Lysosomal dipeptide transporter MFSD1
2955 CAKAPR010000022.1 GCA916719955_01485 CDS open 21730-23880 _na     716_aa Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
2956 CAKAPR010000022.1 GCA916719955_01486 CDS open 23915-25813 _na     632_aa yidC membrane protein insertase YidC
2957 CAKAPR010000022.1 GCA916719955_01487 CDS open 25813-27420 _na     535_aa CTP synthase
2958 CAKAPR010000022.1 GCA916719955_01488 CDS open 27550-28860 _na     436_aa DUF3078 domain-containing protein
2959 CAKAPR010000022.1 GCA916719955_01489 CDS open 28918-29664 _na     248_aa Nucleotidyl transferase domain-containing protein
2960 CAKAPR010000022.1 GCA916719955_01490 CDS open 29695-31239 _na     514_aa guaA glutamine-hydrolyzing GMP synthase
2961 CAKAPR010000022.1 GCA916719955_01491 CDS open 31580-32500 _na     306_aa phosphotransferase
2962 CAKAPR010000022.1 GCA916719955_01468 gene open 323-1717
2963 CAKAPR010000022.1 GCA916719955_01469 gene open 1796-2998
2964 CAKAPR010000022.1 GCA916719955_01470 gene open 3357-4160
2965 CAKAPR010000022.1 GCA916719955_01471 gene open 4564-6567
2966 CAKAPR010000022.1 GCA916719955_01472 gene open 6833-7561
2967 CAKAPR010000022.1 GCA916719955_01473 gene open 7595-10057 pheT
2968 CAKAPR010000022.1 GCA916719955_01474 gene open 10265-11293
2969 CAKAPR010000022.1 GCA916719955_01475 gene open 11307-12650 mtaB
2970 CAKAPR010000022.1 GCA916719955_01476 gene open 13018-13182
2971 CAKAPR010000022.1 GCA916719955_01477 gene open 13669-16230
2972 CAKAPR010000022.1 GCA916719955_01478 gene open 16364-16834
2973 CAKAPR010000022.1 GCA916719955_01479 gene open 16822-17220
2974 CAKAPR010000022.1 GCA916719955_01480 gene open 17217-17849
2975 CAKAPR010000022.1 GCA916719955_01481 gene open 17850-18680
2976 CAKAPR010000022.1 GCA916719955_01482 gene open 18816-19634
2977 CAKAPR010000022.1 GCA916719955_01483 gene open 19680-19835
2978 CAKAPR010000022.1 GCA916719955_01484 gene open 20021-21682
2979 CAKAPR010000022.1 GCA916719955_01485 gene open 21730-23880
2980 CAKAPR010000022.1 GCA916719955_01486 gene open 23915-25813 yidC
2981 CAKAPR010000022.1 GCA916719955_01487 gene open 25813-27420
2982 CAKAPR010000022.1 GCA916719955_01488 gene open 27550-28860
2983 CAKAPR010000022.1 GCA916719955_01489 gene open 28918-29664
2984 CAKAPR010000022.1 GCA916719955_01490 gene open 29695-31239 guaA
2985 CAKAPR010000022.1 GCA916719955_01491 gene open 31580-32500
2986 CAKAPR010000023.1 GCA916719955_01492 CDS open 870-1439 _na     189_aa L-threonylcarbamoyladenylate synthase
2987 CAKAPR010000023.1 GCA916719955_01493 CDS open 1505-2482 _na     325_aa fmt methionyl-tRNA formyltransferase
2988 CAKAPR010000023.1 GCA916719955_01494 CDS open 2513-3844 _na     443_aa DEAD/DEAH box helicase
2989 CAKAPR010000023.1 GCA916719955_01495 CDS open 3856-5064 _na     402_aa Tetratricopeptide repeat protein
2990 CAKAPR010000023.1 GCA916719955_01496 CDS open 5074-6153 _na     359_aa lapB lipopolysaccharide assembly protein LapB
2991 CAKAPR010000023.1 GCA916719955_01497 CDS open 6202-6798 _na     198_aa GNAT family N-acetyltransferase
2992 CAKAPR010000023.1 GCA916719955_01498 CDS open 7200-9164 _na     654_aa NAD(+) synthase
2993 CAKAPR010000023.1 GCA916719955_01499 CDS open 9164-10354 _na     396_aa Smr domain-containing protein
2994 CAKAPR010000023.1 GCA916719955_01500 CDS open 10378-11592 _na     404_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2995 CAKAPR010000023.1 GCA916719955_01501 CDS open 11624-12319 _na     231_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
2996 CAKAPR010000023.1 GCA916719955_01502 CDS open 12366-14978 _na     870_aa SH3b domain-containing protein
2997 CAKAPR010000023.1 GCA916719955_01503 CDS open 15011-15703 _na     230_aa batC aerotolerance regulator BatC
2998 CAKAPR010000023.1 GCA916719955_01504 CDS open 15703-16722 _na     339_aa VWFA domain-containing protein
2999 CAKAPR010000023.1 GCA916719955_01505 CDS open 16757-17755 _na     332_aa VWFA domain-containing protein
3000 CAKAPR010000023.1 GCA916719955_01506 CDS open 17761-18831 _na     356_aa batD BatD family protein