HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Gemella sanguinis (GCA_916720615.1)

Select a Genome:
BAKTA Annotations for GCA_916720615.1
Genome Selected: Gemella sanguinis
ContigsBases CDSrRNA tmRNAtRNA
113 1736345 1602 2 0 18
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3278 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 3278 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAKARP010000017.1 GCA916720615_00753 CDS open 12339-12884 _na     181_aa hpt hypoxanthine phosphoribosyltransferase
1502 CAKARP010000017.1 GCA916720615_00754 CDS open 13019-15007 _na     662_aa ftsH ATP-dependent zinc metalloprotease FtsH
1503 CAKARP010000017.1 GCA916720615_00755 CDS open 15184-17418 _na     744_aa ATPase
1504 CAKARP010000017.1 GCA916720615_00756 CDS open 17512-17898 _na     128_aa DUF1310 domain-containing protein
1505 CAKARP010000017.1 GCA916720615_00757 CDS open 17991-18383 _na     130_aa DUF1310 domain-containing protein
1506 CAKARP010000017.1 GCA916720615_00758 CDS open 18687-19082 _na     131_aa DUF1310 domain-containing protein
1507 CAKARP010000017.1 GCA916720615_00759 CDS open 19110-21506 _na     798_aa DUF2974 domain-containing protein
1508 CAKARP010000017.1 GCA916720615_00760 CDS open 21645-22037 _na     130_aa DUF1310 domain-containing protein
1509 CAKARP010000017.1 GCA916720615_00761 CDS open 22314-22700 _na     128_aa DUF1310 domain-containing protein
1510 CAKARP010000017.1 GCA916720615_00762 CDS open 22772-23155 _na     127_aa DUF1310 domain-containing protein
1511 CAKARP010000017.1 GCA916720615_00763 CDS open 23223-23612 _na     129_aa DUF1310 domain-containing protein
1512 CAKARP010000017.1 GCA916720615_00764 CDS open 23618-24007 _na     129_aa DUF1310 domain-containing protein
1513 CAKARP010000017.1 GCA916720615_00765 CDS open 24071-24778 _na     235_aa Lipoprotein
1514 CAKARP010000017.1 GCA916720615_00766 CDS open 28509-28748 _na     79_aa hypothetical protein
1515 CAKARP010000017.1 GCA916720615_00767 CDS open 28773-29246 _na     157_aa hypothetical protein
1516 CAKARP010000017.1 GCA916720615_00741 gene open 484-1299 phnP
1517 CAKARP010000017.1 GCA916720615_00742 gene open 1766-2764 dppD
1518 CAKARP010000017.1 GCA916720615_00743 gene open 2764-3696 yejF
1519 CAKARP010000017.1 GCA916720615_00744 gene open 3696-4661 opp4B
1520 CAKARP010000017.1 GCA916720615_00745 gene open 4676-5581 dppC
1521 CAKARP010000017.1 GCA916720615_00746 gene open 5652-6224
1522 CAKARP010000017.1 GCA916720615_00747 gene open 6212-6781
1523 CAKARP010000017.1 GCA916720615_00748 gene open 6774-7703
1524 CAKARP010000017.1 GCA916720615_00749 gene open 7934-8215 ytxH
1525 CAKARP010000017.1 GCA916720615_00750 gene open 8217-10271
1526 CAKARP010000017.1 GCA916720615_00751 gene open 10417-11025
1527 CAKARP010000017.1 GCA916720615_00752 gene open 11015-12334
1528 CAKARP010000017.1 GCA916720615_00753 gene open 12339-12884 hpt
1529 CAKARP010000017.1 GCA916720615_00754 gene open 13019-15007 ftsH
1530 CAKARP010000017.1 GCA916720615_00755 gene open 15184-17418
1531 CAKARP010000017.1 GCA916720615_00756 gene open 17512-17898
1532 CAKARP010000017.1 GCA916720615_00757 gene open 17991-18383
1533 CAKARP010000017.1 GCA916720615_00758 gene open 18687-19082
1534 CAKARP010000017.1 GCA916720615_00759 gene open 19110-21506
1535 CAKARP010000017.1 GCA916720615_00760 gene open 21645-22037
1536 CAKARP010000017.1 GCA916720615_00761 gene open 22314-22700
1537 CAKARP010000017.1 GCA916720615_00762 gene open 22772-23155
1538 CAKARP010000017.1 GCA916720615_00763 gene open 23223-23612
1539 CAKARP010000017.1 GCA916720615_00764 gene open 23618-24007
1540 CAKARP010000017.1 GCA916720615_00765 gene open 24071-24778
1541 CAKARP010000017.1 GCA916720615_00766 gene open 28509-28748
1542 CAKARP010000017.1 GCA916720615_00767 gene open 28773-29246
1543 CAKARP010000018.1 GCA916720615_00768 CDS open 186-524 _na     112_aa yurZ Carboxymuconolactone decarboxylase-like domain-containing protein
1544 CAKARP010000018.1 GCA916720615_00769 CDS open 645-1328 _na     227_aa TIGR04283 family arsenosugar biosynthesis glycosyltransferase
1545 CAKARP010000018.1 GCA916720615_00770 CDS open 1490-1885 _na     131_aa gntR GntR family transcriptional regulator
1546 CAKARP010000018.1 GCA916720615_00771 CDS open 1866-2582 _na     238_aa ABC transporter
1547 CAKARP010000018.1 GCA916720615_00772 CDS open 2575-3303 _na     242_aa ABC transporter permease
1548 CAKARP010000018.1 GCA916720615_00773 CDS open 3417-4109 _na     230_aa rplA 50S ribosomal protein L1
1549 CAKARP010000018.1 GCA916720615_00774 CDS open 4123-4548 _na     141_aa rplK 50S ribosomal protein L11
1550 CAKARP010000018.1 GCA916720615_00775 CDS open 4984-6537 _na     517_aa rny ribonuclease Y
1551 CAKARP010000018.1 GCA916720615_00776 CDS open 6758-7543 _na     261_aa Formate/nitrite transporter
1552 CAKARP010000018.1 GCA916720615_00777 CDS open 7778-8569 _na     263_aa Formate/nitrite transporter
1553 CAKARP010000018.1 GCA916720615_00778 CDS open 8619-9704 _na     361_aa ilvE branched-chain amino acid aminotransferase
1554 CAKARP010000018.1 GCA916720615_00779 CDS open 9969-11147 _na     392_aa Aminotransferase
1555 CAKARP010000018.1 GCA916720615_00780 CDS open 11160-11786 _na     208_aa tmk dTMP kinase
1556 CAKARP010000018.1 GCA916720615_00781 CDS open 11776-12615 _na     279_aa DNA polymerase III subunit delta
1557 CAKARP010000018.1 GCA916720615_00782 CDS open 12617-13351 _na     244_aa Methyltransferase
1558 CAKARP010000018.1 GCA916720615_00783 CDS open 13338-13652 _na     104_aa GIY-YIG domain-containing protein
1559 CAKARP010000018.1 GCA916720615_00784 CDS open 13652-14482 _na     276_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
1560 CAKARP010000018.1 GCA916720615_00785 CDS open 14466-14792 _na     108_aa Histidine kinase
1561 CAKARP010000018.1 GCA916720615_00786 CDS open 14817-16289 _na     490_aa kefA Potassium transporter KefA
1562 CAKARP010000018.1 GCA916720615_00787 CDS open 16292-17662 _na     456_aa trkA Trk system potassium transporter TrkA
1563 CAKARP010000018.1 GCA916720615_00788 CDS open 17891-19690 _na     599_aa DNA primase
1564 CAKARP010000018.1 GCA916720615_00789 CDS open 19701-20789 _na     362_aa rpoD RNA polymerase sigma factor RpoD
1565 CAKARP010000018.1 GCA916720615_00790 CDS open 20894-21280 _na     128_aa pspE Rhodanese domain-containing protein
1566 CAKARP010000018.1 GCA916720615_00791 CDS open 21423-22178 _na     251_aa RNA methyltransferase
1567 CAKARP010000018.1 GCA916720615_00792 CDS open 22250-23203 _na     317_aa corA magnesium/cobalt transporter CorA
1568 CAKARP010000018.1 GCA916720615_00793 CDS open 23227-23433 _na     68_aa DUF1146 domain-containing protein
1569 CAKARP010000018.1 GCA916720615_00794 CDS open 23452-24612 _na     386_aa AI-2E family transporter
1570 CAKARP010000018.1 GCA916720615_00795 CDS open 24977-25396 _na     139_aa sepF Cell division protein SepF
1571 CAKARP010000018.1 GCA916720615_00796 CDS open 25399-25677 _na     92_aa yggT YggT family protein
1572 CAKARP010000018.1 GCA916720615_00797 CDS open 25683-26453 _na     256_aa RNA-binding protein
1573 CAKARP010000018.1 GCA916720615_00798 CDS open 26585-27268 _na     227_aa Lipoprotein
1574 CAKARP010000018.1 GCA916720615_00799 CDS open 27282-27965 _na     227_aa Lipoprotein
1575 CAKARP010000018.1 GCA916720615_00768 gene open 186-524 yurZ
1576 CAKARP010000018.1 GCA916720615_00769 gene open 645-1328
1577 CAKARP010000018.1 GCA916720615_00770 gene open 1490-1885 gntR
1578 CAKARP010000018.1 GCA916720615_00771 gene open 1866-2582
1579 CAKARP010000018.1 GCA916720615_00772 gene open 2575-3303
1580 CAKARP010000018.1 GCA916720615_00773 gene open 3417-4109 rplA
1581 CAKARP010000018.1 GCA916720615_00774 gene open 4123-4548 rplK
1582 CAKARP010000018.1 GCA916720615_00775 gene open 4984-6537 rny
1583 CAKARP010000018.1 GCA916720615_00776 gene open 6758-7543
1584 CAKARP010000018.1 GCA916720615_00777 gene open 7778-8569
1585 CAKARP010000018.1 GCA916720615_00778 gene open 8619-9704 ilvE
1586 CAKARP010000018.1 GCA916720615_00779 gene open 9969-11147
1587 CAKARP010000018.1 GCA916720615_00780 gene open 11160-11786 tmk
1588 CAKARP010000018.1 GCA916720615_00781 gene open 11776-12615
1589 CAKARP010000018.1 GCA916720615_00782 gene open 12617-13351
1590 CAKARP010000018.1 GCA916720615_00783 gene open 13338-13652
1591 CAKARP010000018.1 GCA916720615_00784 gene open 13652-14482 rsmI
1592 CAKARP010000018.1 GCA916720615_00785 gene open 14466-14792
1593 CAKARP010000018.1 GCA916720615_00786 gene open 14817-16289 kefA
1594 CAKARP010000018.1 GCA916720615_00787 gene open 16292-17662 trkA
1595 CAKARP010000018.1 GCA916720615_00788 gene open 17891-19690
1596 CAKARP010000018.1 GCA916720615_00789 gene open 19701-20789 rpoD
1597 CAKARP010000018.1 GCA916720615_00790 gene open 20894-21280 pspE
1598 CAKARP010000018.1 GCA916720615_00791 gene open 21423-22178
1599 CAKARP010000018.1 GCA916720615_00792 gene open 22250-23203 corA
1600 CAKARP010000018.1 GCA916720615_00793 gene open 23227-23433
1601 CAKARP010000018.1 GCA916720615_00794 gene open 23452-24612
1602 CAKARP010000018.1 GCA916720615_00795 gene open 24977-25396 sepF
1603 CAKARP010000018.1 GCA916720615_00796 gene open 25399-25677 yggT
1604 CAKARP010000018.1 GCA916720615_00797 gene open 25683-26453
1605 CAKARP010000018.1 GCA916720615_00798 gene open 26585-27268
1606 CAKARP010000018.1 GCA916720615_00799 gene open 27282-27965
1607 CAKARP010000019.1 repeat_region open 2400-3230 CRISPR array with 13 repeats of length 36%2C consensus sequence GTTTGAGAGATATGTAAATTTTGAATTCTACAAAAC and spacer length 29
1608 CAKARP010000019.1 GCA916720615_00800 CDS open 49-405 _na     118_aa Cas9 endonuclease PAM-interacting domain-containing protein
1609 CAKARP010000019.1 GCA916720615_00801 CDS open 380-643 _na     87_aa CRISPR-associated endonuclease Cas1
1610 CAKARP010000019.1 GCA916720615_00802 CDS open 723-1250 _na     175_aa cas1 type II CRISPR-associated endonuclease Cas1
1611 CAKARP010000019.1 GCA916720615_00803 CDS open 1255-1560 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
1612 CAKARP010000019.1 GCA916720615_00804 CDS open 1557-2237 _na     226_aa csn2 type II-A CRISPR-associated protein Csn2
1613 CAKARP010000019.1 GCA916720615_00805 CDS open 3394-4605 _na     403_aa hypothetical protein
1614 CAKARP010000019.1 GCA916720615_00806 CDS open 4688-6049 _na     453_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1615 CAKARP010000019.1 GCA916720615_00807 CDS open 6058-7125 _na     355_aa ddlA D-alanine--D-alanine ligase
1616 CAKARP010000019.1 GCA916720615_00808 CDS open 7403-8212 _na     269_aa hypothetical protein
1617 CAKARP010000019.1 GCA916720615_00809 CDS open 8238-10235 _na     665_aa uvrB excinuclease ABC subunit UvrB
1618 CAKARP010000019.1 GCA916720615_00810 CDS open 10393-11796 _na     467_aa Amino acid permease
1619 CAKARP010000019.1 GCA916720615_00811 CDS open 12420-14057 _na     545_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
1620 CAKARP010000019.1 GCA916720615_00812 CDS open 14339-15940 _na     533_aa histidine kinase
1621 CAKARP010000019.1 GCA916720615_00813 CDS open 15943-16623 _na     226_aa Transcriptional regulatory protein
1622 CAKARP010000019.1 GCA916720615_00814 CDS open 16903-17976 _na     357_aa AEC family transporter
1623 CAKARP010000019.1 GCA916720615_00815 CDS open 18082-19098 _na     338_aa 2-hydroxyacid dehydrogenase
1624 CAKARP010000019.1 GCA916720615_00816 CDS open 19188-19634 _na     148_aa hypothetical protein
1625 CAKARP010000019.1 GCA916720615_00817 CDS open 19664-20041 _na     125_aa hypothetical protein
1626 CAKARP010000019.1 GCA916720615_00818 CDS open 20135-20653 _na     172_aa hypothetical protein
1627 CAKARP010000019.1 GCA916720615_00819 CDS open 20750-21091 _na     113_aa hypothetical protein
1628 CAKARP010000019.1 GCA916720615_00820 CDS open 21215-21718 _na     167_aa hypothetical protein
1629 CAKARP010000019.1 GCA916720615_00821 CDS open 21780-22715 _na     311_aa prmA 50S ribosomal protein L11 methyltransferase
1630 CAKARP010000019.1 GCA916720615_00822 CDS open 22999-23760 _na     253_aa Strictosidine synthase
1631 CAKARP010000019.1 GCA916720615_00823 CDS open 23771-24187 _na     138_aa Rrf2 family transcriptional regulator
1632 CAKARP010000019.1 GCA916720615_00824 CDS open 24269-25162 _na     297_aa Oxidoreductase
1633 CAKARP010000019.1 GCA916720615_00825 CDS open 25254-26090 _na     278_aa menH AB hydrolase-1 domain-containing protein
1634 CAKARP010000019.1 GCA916720615_00826 CDS open 26093-26965 _na     290_aa SDR family NAD(P)-dependent oxidoreductase
1635 CAKARP010000019.1 GCA916720615_00800 gene open 49-405
1636 CAKARP010000019.1 GCA916720615_00801 gene open 380-643
1637 CAKARP010000019.1 GCA916720615_00802 gene open 723-1250 cas1
1638 CAKARP010000019.1 GCA916720615_00803 gene open 1255-1560 cas2
1639 CAKARP010000019.1 GCA916720615_00804 gene open 1557-2237 csn2
1640 CAKARP010000019.1 GCA916720615_00805 gene open 3394-4605
1641 CAKARP010000019.1 GCA916720615_00806 gene open 4688-6049
1642 CAKARP010000019.1 GCA916720615_00807 gene open 6058-7125 ddlA
1643 CAKARP010000019.1 GCA916720615_00808 gene open 7403-8212
1644 CAKARP010000019.1 GCA916720615_00809 gene open 8238-10235 uvrB
1645 CAKARP010000019.1 GCA916720615_00810 gene open 10393-11796
1646 CAKARP010000019.1 GCA916720615_00811 gene open 12420-14057
1647 CAKARP010000019.1 GCA916720615_00812 gene open 14339-15940
1648 CAKARP010000019.1 GCA916720615_00813 gene open 15943-16623
1649 CAKARP010000019.1 GCA916720615_00814 gene open 16903-17976
1650 CAKARP010000019.1 GCA916720615_00815 gene open 18082-19098
1651 CAKARP010000019.1 GCA916720615_00816 gene open 19188-19634
1652 CAKARP010000019.1 GCA916720615_00817 gene open 19664-20041
1653 CAKARP010000019.1 GCA916720615_00818 gene open 20135-20653
1654 CAKARP010000019.1 GCA916720615_00819 gene open 20750-21091
1655 CAKARP010000019.1 GCA916720615_00820 gene open 21215-21718
1656 CAKARP010000019.1 GCA916720615_00821 gene open 21780-22715 prmA
1657 CAKARP010000019.1 GCA916720615_00822 gene open 22999-23760
1658 CAKARP010000019.1 GCA916720615_00823 gene open 23771-24187
1659 CAKARP010000019.1 GCA916720615_00824 gene open 24269-25162
1660 CAKARP010000019.1 GCA916720615_00825 gene open 25254-26090 menH
1661 CAKARP010000019.1 GCA916720615_00826 gene open 26093-26965
1662 CAKARP010000020.1 GCA916720615_00827 CDS open 857-1951 _na     364_aa Metallophosphoesterase
1663 CAKARP010000020.1 GCA916720615_00828 CDS open 1998-2528 _na     176_aa hypothetical protein
1664 CAKARP010000020.1 GCA916720615_00829 CDS open 2531-2803 _na     90_aa 50S ribosomal protein L7/L12
1665 CAKARP010000020.1 GCA916720615_00830 CDS open 2966-4180 _na     404_aa Lipid II:glycine glycyltransferase
1666 CAKARP010000020.1 GCA916720615_00831 CDS open 4227-5552 _na     441_aa FAD-containing oxidoreductase
1667 CAKARP010000020.1 GCA916720615_00832 CDS open 5777-6112 _na     111_aa phnA Putative alkylphosphonate utilization operon protein PhnA
1668 CAKARP010000020.1 GCA916720615_00833 CDS open 6425-7627 _na     400_aa Sodium:proton antiporter
1669 CAKARP010000020.1 GCA916720615_00834 CDS open 7663-8733 _na     356_aa Endonuclease
1670 CAKARP010000020.1 GCA916720615_00835 CDS open 8839-9738 _na     299_aa EamA/RhaT family transporter
1671 CAKARP010000020.1 GCA916720615_00836 CDS open 10079-11884 _na     601_aa Peptide ABC transporter substrate-binding protein
1672 CAKARP010000020.1 GCA916720615_00837 CDS open 12152-13948 _na     598_aa Peptide ABC transporter substrate-binding protein
1673 CAKARP010000020.1 GCA916720615_00838 CDS open 14185-15222 _na     345_aa helix-hairpin-helix domain-containing protein
1674 CAKARP010000020.1 GCA916720615_00839 CDS open 15228-16328 _na     366_aa hypothetical protein
1675 CAKARP010000020.1 GCA916720615_00840 CDS open 16699-20709 _na     1336_aa Serine protease
1676 CAKARP010000020.1 GCA916720615_00841 CDS open 20824-27114 _na     2096_aa CshA/CshB family fibrillar adhesin-related protein
1677 CAKARP010000020.1 GCA916720615_00827 gene open 857-1951
1678 CAKARP010000020.1 GCA916720615_00828 gene open 1998-2528
1679 CAKARP010000020.1 GCA916720615_00829 gene open 2531-2803
1680 CAKARP010000020.1 GCA916720615_00830 gene open 2966-4180
1681 CAKARP010000020.1 GCA916720615_00831 gene open 4227-5552
1682 CAKARP010000020.1 GCA916720615_00832 gene open 5777-6112 phnA
1683 CAKARP010000020.1 GCA916720615_00833 gene open 6425-7627
1684 CAKARP010000020.1 GCA916720615_00834 gene open 7663-8733
1685 CAKARP010000020.1 GCA916720615_00835 gene open 8839-9738
1686 CAKARP010000020.1 GCA916720615_00836 gene open 10079-11884
1687 CAKARP010000020.1 GCA916720615_00837 gene open 12152-13948
1688 CAKARP010000020.1 GCA916720615_00838 gene open 14185-15222
1689 CAKARP010000020.1 GCA916720615_00839 gene open 15228-16328
1690 CAKARP010000020.1 GCA916720615_00840 gene open 16699-20709
1691 CAKARP010000020.1 GCA916720615_00841 gene open 20824-27114
1692 CAKARP010000021.1 GCA916720615_00842 CDS open 91-756 _na     221_aa MATE family efflux transporter
1693 CAKARP010000021.1 GCA916720615_00843 CDS open 791-1924 _na     377_aa tRNA(Met) cytidine acetate ligase
1694 CAKARP010000021.1 GCA916720615_00844 CDS open 2045-2662 _na     205_aa Sarcalumenin
1695 CAKARP010000021.1 GCA916720615_00845 CDS open 2900-3511 _na     203_aa Lipoprotein
1696 CAKARP010000021.1 GCA916720615_00846 CDS open 3835-4029 _na     64_aa DUF1659 domain-containing protein
1697 CAKARP010000021.1 GCA916720615_00847 CDS open 4047-4259 _na     70_aa DUF2922 domain-containing protein
1698 CAKARP010000021.1 GCA916720615_00848 CDS open 4261-4467 _na     68_aa yvrJ YvrJ family protein
1699 CAKARP010000021.1 GCA916720615_00849 CDS open 4480-5154 _na     224_aa N-acetylmuramoyl-L-alanine amidase
1700 CAKARP010000021.1 GCA916720615_00850 CDS open 5210-7150 _na     646_aa PTS fructose transporter subunit IIC
1701 CAKARP010000021.1 GCA916720615_00851 CDS open 7183-8100 _na     305_aa Tagatose-6-phosphate kinase
1702 CAKARP010000021.1 GCA916720615_00852 CDS open 8116-8886 _na     256_aa DeoR/GlpR transcriptional regulator
1703 CAKARP010000021.1 GCA916720615_00853 CDS open 9107-10057 _na     316_aa LPXTG cell wall anchor domain-containing protein
1704 CAKARP010000021.1 GCA916720615_00854 CDS open 10184-11623 _na     479_aa Glycosyl transferase family 1 domain-containing protein
1705 CAKARP010000021.1 GCA916720615_00855 CDS open 11806-12963 _na     385_aa DUF308 domain-containing protein
1706 CAKARP010000021.1 GCA916720615_00856 CDS open 13219-14910 _na     563_aa hypothetical protein
1707 CAKARP010000021.1 GCA916720615_00857 CDS open 15019-16260 _na     413_aa DUF4878 domain-containing protein
1708 CAKARP010000021.1 GCA916720615_00858 CDS open 16462-18384 _na     640_aa AAA+ ATPase domain-containing protein
1709 CAKARP010000021.1 GCA916720615_00859 CDS open 18597-19145 _na     182_aa DUF4878 domain-containing protein
1710 CAKARP010000021.1 GCA916720615_00860 CDS open 19180-19710 _na     176_aa DUF4878 domain-containing protein
1711 CAKARP010000021.1 GCA916720615_00861 CDS open 19808-20740 _na     310_aa fabK Enoyl-[acyl-carrier-protein] reductase FabK
1712 CAKARP010000021.1 GCA916720615_00862 CDS open 20902-21888 _na     328_aa Putative sulfate exporter family transporter
1713 CAKARP010000021.1 GCA916720615_00863 CDS open 22218-22481 _na     87_aa hypothetical protein
1714 CAKARP010000021.1 GCA916720615_00864 CDS open 22484-22669 _na     61_aa hypothetical protein
1715 CAKARP010000021.1 GCA916720615_00865 CDS open 22845-23642 _na     265_aa Class I SAM-dependent methyltransferase
1716 CAKARP010000021.1 GCA916720615_00866 CDS open 23882-25057 _na     391_aa Nucleoside recognition protein
1717 CAKARP010000021.1 GCA916720615_00842 gene open 91-756
1718 CAKARP010000021.1 GCA916720615_00843 gene open 791-1924
1719 CAKARP010000021.1 GCA916720615_00844 gene open 2045-2662
1720 CAKARP010000021.1 GCA916720615_00845 gene open 2900-3511
1721 CAKARP010000021.1 GCA916720615_00846 gene open 3835-4029
1722 CAKARP010000021.1 GCA916720615_00847 gene open 4047-4259
1723 CAKARP010000021.1 GCA916720615_00848 gene open 4261-4467 yvrJ
1724 CAKARP010000021.1 GCA916720615_00849 gene open 4480-5154
1725 CAKARP010000021.1 GCA916720615_00850 gene open 5210-7150
1726 CAKARP010000021.1 GCA916720615_00851 gene open 7183-8100
1727 CAKARP010000021.1 GCA916720615_00852 gene open 8116-8886
1728 CAKARP010000021.1 GCA916720615_00853 gene open 9107-10057
1729 CAKARP010000021.1 GCA916720615_00854 gene open 10184-11623
1730 CAKARP010000021.1 GCA916720615_00855 gene open 11806-12963
1731 CAKARP010000021.1 GCA916720615_00856 gene open 13219-14910
1732 CAKARP010000021.1 GCA916720615_00857 gene open 15019-16260
1733 CAKARP010000021.1 GCA916720615_00858 gene open 16462-18384
1734 CAKARP010000021.1 GCA916720615_00859 gene open 18597-19145
1735 CAKARP010000021.1 GCA916720615_00860 gene open 19180-19710
1736 CAKARP010000021.1 GCA916720615_00861 gene open 19808-20740 fabK
1737 CAKARP010000021.1 GCA916720615_00862 gene open 20902-21888
1738 CAKARP010000021.1 GCA916720615_00863 gene open 22218-22481
1739 CAKARP010000021.1 GCA916720615_00864 gene open 22484-22669
1740 CAKARP010000021.1 GCA916720615_00865 gene open 22845-23642
1741 CAKARP010000021.1 GCA916720615_00866 gene open 23882-25057
1742 CAKARP010000022.1 GCA916720615_00867 CDS open 278-3010 _na     910_aa ileS isoleucine--tRNA ligase
1743 CAKARP010000022.1 GCA916720615_00868 CDS open 3355-5925 _na     856_aa secA preprotein translocase subunit SecA
1744 CAKARP010000022.1 GCA916720615_00869 CDS open 6014-6559 _na     181_aa hypothetical protein
1745 CAKARP010000022.1 GCA916720615_00870 CDS open 6577-7125 _na     182_aa Transmembrane protein
1746 CAKARP010000022.1 GCA916720615_00871 CDS open 7142-7660 _na     172_aa hypothetical protein
1747 CAKARP010000022.1 GCA916720615_00872 CDS open 7685-8197 _na     170_aa hypothetical protein
1748 CAKARP010000022.1 GCA916720615_00873 CDS open 8251-8793 _na     180_aa hypothetical protein
1749 CAKARP010000022.1 GCA916720615_00874 CDS open 8848-9579 _na     243_aa NAD-dependent protein deacylase
1750 CAKARP010000022.1 GCA916720615_00875 CDS open 9601-11340 _na     579_aa Multidrug ABC transporter permease/ATP-binding protein
1751 CAKARP010000022.1 GCA916720615_00876 CDS open 11342-13078 _na     578_aa Multidrug ABC transporter ATP-binding protein
1752 CAKARP010000022.1 GCA916720615_00877 CDS open 13186-13974 _na     262_aa cutC PF03932 family protein CutC
1753 CAKARP010000022.1 GCA916720615_00878 CDS open 13961-14347 _na     128_aa VOC family protein
1754 CAKARP010000022.1 GCA916720615_00879 CDS open 14391-15383 _na     330_aa Ornithine cyclodeaminase family protein
1755 CAKARP010000022.1 GCA916720615_00880 CDS open 15509-16270 _na     253_aa DUF4292 domain-containing protein
1756 CAKARP010000022.1 GCA916720615_00881 CDS open 16439-17224 _na     261_aa Lipoprotein
1757 CAKARP010000022.1 GCA916720615_00882 CDS open 17518-18339 _na     273_aa Cof-type HAD-IIB family hydrolase
1758 CAKARP010000022.1 GCA916720615_00883 CDS open 18594-19313 _na     239_aa DUF6612 domain-containing protein
1759 CAKARP010000022.1 GCA916720615_00884 CDS open 19489-20307 _na     272_aa Lipoprotein
1760 CAKARP010000022.1 GCA916720615_00885 CDS open 21025-21843 _na     272_aa DUF5067 domain-containing protein
1761 CAKARP010000022.1 GCA916720615_00886 CDS open 22028-22984 _na     318_aa DUF4097 domain-containing protein
1762 CAKARP010000022.1 GCA916720615_00887 CDS open 22977-23573 _na     198_aa DUF1700 domain-containing protein
1763 CAKARP010000022.1 GCA916720615_00888 CDS open 23566-23883 _na     105_aa padR PadR family transcriptional regulator
1764 CAKARP010000022.1 GCA916720615_00891 CDS open 24426-25316 _na     296_aa Phosphate/phosphite/phosphonate ABC transporter substrate-binding protein
1765 CAKARP010000022.1 GCA916720615_00892 CDS open 25463-26041 _na     192_aa ruvA Holliday junction branch migration protein RuvA
1766 CAKARP010000022.1 GCA916720615_00867 gene open 278-3010 ileS
1767 CAKARP010000022.1 GCA916720615_00868 gene open 3355-5925 secA
1768 CAKARP010000022.1 GCA916720615_00869 gene open 6014-6559
1769 CAKARP010000022.1 GCA916720615_00870 gene open 6577-7125
1770 CAKARP010000022.1 GCA916720615_00871 gene open 7142-7660
1771 CAKARP010000022.1 GCA916720615_00872 gene open 7685-8197
1772 CAKARP010000022.1 GCA916720615_00873 gene open 8251-8793
1773 CAKARP010000022.1 GCA916720615_00874 gene open 8848-9579
1774 CAKARP010000022.1 GCA916720615_00875 gene open 9601-11340
1775 CAKARP010000022.1 GCA916720615_00876 gene open 11342-13078
1776 CAKARP010000022.1 GCA916720615_00877 gene open 13186-13974 cutC
1777 CAKARP010000022.1 GCA916720615_00878 gene open 13961-14347
1778 CAKARP010000022.1 GCA916720615_00879 gene open 14391-15383
1779 CAKARP010000022.1 GCA916720615_00880 gene open 15509-16270
1780 CAKARP010000022.1 GCA916720615_00881 gene open 16439-17224
1781 CAKARP010000022.1 GCA916720615_00882 gene open 17518-18339
1782 CAKARP010000022.1 GCA916720615_00883 gene open 18594-19313
1783 CAKARP010000022.1 GCA916720615_00884 gene open 19489-20307
1784 CAKARP010000022.1 GCA916720615_00885 gene open 21025-21843
1785 CAKARP010000022.1 GCA916720615_00886 gene open 22028-22984
1786 CAKARP010000022.1 GCA916720615_00887 gene open 22977-23573
1787 CAKARP010000022.1 GCA916720615_00888 gene open 23566-23883 padR
1788 CAKARP010000022.1 GCA916720615_00891 gene open 24426-25316
1789 CAKARP010000022.1 GCA916720615_00892 gene open 25463-26041 ruvA
1790 CAKARP010000022.1 GCA916720615_00889 gene open 24107-24182 trnH
1791 CAKARP010000022.1 GCA916720615_00890 gene open 24201-24274 trnC
1792 CAKARP010000022.1 GCA916720615_00889 tRNA open 24107-24182 trnH tRNA-His(gtg)
1793 CAKARP010000022.1 GCA916720615_00890 tRNA open 24201-24274 trnC tRNA-Cys(gca)
1794 CAKARP010000023.1 GCA916720615_00893 CDS open 83-844 _na     253_aa terC TerC family protein
1795 CAKARP010000023.1 GCA916720615_00894 CDS open 869-1627 _na     252_aa Iron ABC transporter permease
1796 CAKARP010000023.1 GCA916720615_00895 CDS open 1627-2472 _na     281_aa ABC transporter ATP-binding protein
1797 CAKARP010000023.1 GCA916720615_00896 CDS open 2646-3980 _na     444_aa brnQ branched-chain amino acid transport system II carrier protein
1798 CAKARP010000023.1 GCA916720615_00897 CDS open 4255-6306 _na     683_aa topA type I DNA topoisomerase
1799 CAKARP010000023.1 GCA916720615_00898 CDS open 6386-7147 _na     253_aa map type I methionyl aminopeptidase
1800 CAKARP010000023.1 GCA916720615_00899 CDS open 7169-7936 _na     255_aa TIGR01457 family HAD-type hydrolase
1801 CAKARP010000023.1 GCA916720615_00900 CDS open 8031-8858 _na     275_aa Thiamine kinase
1802 CAKARP010000023.1 GCA916720615_00901 CDS open 9037-10434 _na     465_aa pepV dipeptidase PepV
1803 CAKARP010000023.1 GCA916720615_00902 CDS open 10449-11156 _na     235_aa Pseudouridine synthase
1804 CAKARP010000023.1 GCA916720615_00903 CDS open 11156-12784 _na     542_aa Polysaccharide biosynthesis protein
1805 CAKARP010000023.1 GCA916720615_00904 CDS open 12818-13045 _na     75_aa hypothetical protein
1806 CAKARP010000023.1 GCA916720615_00905 CDS open 13114-13611 _na     165_aa hypothetical protein
1807 CAKARP010000023.1 GCA916720615_00906 CDS open 13644-14981 _na     445_aa glnA type I glutamate--ammonia ligase
1808 CAKARP010000023.1 GCA916720615_00907 CDS open 15089-15394 _na     101_aa trxA thioredoxin
1809 CAKARP010000023.1 GCA916720615_00908 CDS open 15474-17078 _na     534_aa groL chaperonin GroEL
1810 CAKARP010000023.1 GCA916720615_00909 CDS open 17087-17362 _na     91_aa 10 kDa chaperonin
1811 CAKARP010000023.1 GCA916720615_00910 CDS open 17665-17790 _na     41_aa fadH2 NADH peroxidase
1812 CAKARP010000023.1 GCA916720615_00911 CDS open 18004-19026 _na     340_aa NADH peroxidase
1813 CAKARP010000023.1 GCA916720615_00912 CDS open 19068-23069 _na     1333_aa Eco57I restriction-modification methylase domain-containing protein
1814 CAKARP010000023.1 GCA916720615_00913 CDS open 23071-24063 _na     330_aa hypothetical protein
1815 CAKARP010000023.1 GCA916720615_00914 CDS open 24185-24388 _na     67_aa Tryptophan RNA-binding attenuator protein domain-containing protein
1816 CAKARP010000023.1 GCA916720615_00915 CDS open 24413-24973 _na     186_aa folE GTP cyclohydrolase I FolE
1817 CAKARP010000023.1 GCA916720615_00893 gene open 83-844 terC
1818 CAKARP010000023.1 GCA916720615_00894 gene open 869-1627
1819 CAKARP010000023.1 GCA916720615_00895 gene open 1627-2472
1820 CAKARP010000023.1 GCA916720615_00896 gene open 2646-3980 brnQ
1821 CAKARP010000023.1 GCA916720615_00897 gene open 4255-6306 topA
1822 CAKARP010000023.1 GCA916720615_00898 gene open 6386-7147 map
1823 CAKARP010000023.1 GCA916720615_00899 gene open 7169-7936
1824 CAKARP010000023.1 GCA916720615_00900 gene open 8031-8858
1825 CAKARP010000023.1 GCA916720615_00901 gene open 9037-10434 pepV
1826 CAKARP010000023.1 GCA916720615_00902 gene open 10449-11156
1827 CAKARP010000023.1 GCA916720615_00903 gene open 11156-12784
1828 CAKARP010000023.1 GCA916720615_00904 gene open 12818-13045
1829 CAKARP010000023.1 GCA916720615_00905 gene open 13114-13611
1830 CAKARP010000023.1 GCA916720615_00906 gene open 13644-14981 glnA
1831 CAKARP010000023.1 GCA916720615_00907 gene open 15089-15394 trxA
1832 CAKARP010000023.1 GCA916720615_00908 gene open 15474-17078 groL
1833 CAKARP010000023.1 GCA916720615_00909 gene open 17087-17362
1834 CAKARP010000023.1 GCA916720615_00910 gene open 17665-17790 fadH2
1835 CAKARP010000023.1 GCA916720615_00911 gene open 18004-19026
1836 CAKARP010000023.1 GCA916720615_00912 gene open 19068-23069
1837 CAKARP010000023.1 GCA916720615_00913 gene open 23071-24063
1838 CAKARP010000023.1 GCA916720615_00914 gene open 24185-24388
1839 CAKARP010000023.1 GCA916720615_00915 gene open 24413-24973 folE
1840 CAKARP010000024.1 regulatory_region open 12463-12565 Purine riboswitch aptamer
1841 CAKARP010000024.1 GCA916720615_00916 CDS open 221-520 _na     99_aa hypothetical protein
1842 CAKARP010000024.1 GCA916720615_00917 CDS open 1079-1279 _na     66_aa hypothetical protein
1843 CAKARP010000024.1 GCA916720615_00918 CDS open 2106-2570 _na     154_aa smpB SsrA-binding protein SmpB
1844 CAKARP010000024.1 GCA916720615_00919 CDS open 2583-4709 _na     708_aa rnr ribonuclease R
1845 CAKARP010000024.1 GCA916720615_00920 CDS open 4872-5102 _na     76_aa secG preprotein translocase subunit SecG
1846 CAKARP010000024.1 GCA916720615_00921 CDS open 5180-6268 _na     362_aa pilT Twitching motility protein PilT
1847 CAKARP010000024.1 GCA916720615_00922 CDS open 6511-7893 _na     460_aa radA DNA repair protein RadA
1848 CAKARP010000024.1 GCA916720615_00923 CDS open 7896-10370 _na     824_aa clpA ATP-dependent Clp protease ATP-binding subunit
1849 CAKARP010000024.1 GCA916720615_00924 CDS open 10375-10893 _na     172_aa Transcriptional regulator
1850 CAKARP010000024.1 GCA916720615_00925 CDS open 11060-12427 _na     455_aa Xanthine permease
1851 CAKARP010000024.1 GCA916720615_00926 CDS open 12710-13642 _na     310_aa pyrD dihydroorotate oxidase
1852 CAKARP010000024.1 GCA916720615_00927 CDS open 13794-14345 _na     183_aa GNAT family N-acetyltransferase
1853 CAKARP010000024.1 GCA916720615_00928 CDS open 14356-15405 _na     349_aa ssuD Luciferase-like domain-containing protein
1854 CAKARP010000024.1 GCA916720615_00929 CDS open 15430-16290 _na     286_aa hchA glyoxalase III HchA
1855 CAKARP010000024.1 GCA916720615_00930 CDS open 16385-16765 _na     126_aa marR MarR family transcriptional regulator
1856 CAKARP010000024.1 GCA916720615_00931 CDS open 16912-17274 _na     120_aa Pyrimidine dimer DNA glycosylase
1857 CAKARP010000024.1 GCA916720615_00932 CDS open 17258-17662 _na     134_aa DUF1722 domain-containing protein
1858 CAKARP010000024.1 GCA916720615_00933 CDS open 17784-18719 _na     311_aa lipoprotein
1859 CAKARP010000024.1 GCA916720615_00934 CDS open 18878-19618 _na     246_aa traX Conjugal transfer protein TraX
1860 CAKARP010000024.1 GCA916720615_00935 CDS open 19806-20192 _na     128_aa GAF domain-containing protein
1861 CAKARP010000024.1 GCA916720615_00936 CDS open 20307-20981 _na     224_aa hrtA Putative hemin import ATP-binding protein HrtA
1862 CAKARP010000024.1 GCA916720615_00937 CDS open 20989-22104 _na     371_aa hrtB Putative hemin transport system permease protein HrtB
1863 CAKARP010000024.1 GCA916720615_00938 CDS open 22321-23052 _na     243_aa Alpha/beta hydrolase
1864 CAKARP010000024.1 GCA916720615_00939 CDS open 23146-23676 _na     176_aa DUF3592 domain-containing protein
1865 CAKARP010000024.1 GCA916720615_00916 gene open 221-520
1866 CAKARP010000024.1 GCA916720615_00917 gene open 1079-1279
1867 CAKARP010000024.1 GCA916720615_00918 gene open 2106-2570 smpB
1868 CAKARP010000024.1 GCA916720615_00919 gene open 2583-4709 rnr
1869 CAKARP010000024.1 GCA916720615_00920 gene open 4872-5102 secG
1870 CAKARP010000024.1 GCA916720615_00921 gene open 5180-6268 pilT
1871 CAKARP010000024.1 GCA916720615_00922 gene open 6511-7893 radA
1872 CAKARP010000024.1 GCA916720615_00923 gene open 7896-10370 clpA
1873 CAKARP010000024.1 GCA916720615_00924 gene open 10375-10893
1874 CAKARP010000024.1 GCA916720615_00925 gene open 11060-12427
1875 CAKARP010000024.1 GCA916720615_00926 gene open 12710-13642 pyrD
1876 CAKARP010000024.1 GCA916720615_00927 gene open 13794-14345
1877 CAKARP010000024.1 GCA916720615_00928 gene open 14356-15405 ssuD
1878 CAKARP010000024.1 GCA916720615_00929 gene open 15430-16290 hchA
1879 CAKARP010000024.1 GCA916720615_00930 gene open 16385-16765 marR
1880 CAKARP010000024.1 GCA916720615_00931 gene open 16912-17274
1881 CAKARP010000024.1 GCA916720615_00932 gene open 17258-17662
1882 CAKARP010000024.1 GCA916720615_00933 gene open 17784-18719
1883 CAKARP010000024.1 GCA916720615_00934 gene open 18878-19618 traX
1884 CAKARP010000024.1 GCA916720615_00935 gene open 19806-20192
1885 CAKARP010000024.1 GCA916720615_00936 gene open 20307-20981 hrtA
1886 CAKARP010000024.1 GCA916720615_00937 gene open 20989-22104 hrtB
1887 CAKARP010000024.1 GCA916720615_00938 gene open 22321-23052
1888 CAKARP010000024.1 GCA916720615_00939 gene open 23146-23676
1889 CAKARP010000025.1 GCA916720615_00940 CDS open 147-656 _na     169_aa yceD 23S rRNA accumulation protein YceD
1890 CAKARP010000025.1 GCA916720615_00941 CDS open 689-865 _na     58_aa rpmF 50S ribosomal protein L32
1891 CAKARP010000025.1 GCA916720615_00942 CDS open 957-2033 _na     358_aa asd aspartate-semialdehyde dehydrogenase
1892 CAKARP010000025.1 GCA916720615_00943 CDS open 2116-2997 _na     293_aa thrB homoserine kinase
1893 CAKARP010000025.1 GCA916720615_00944 CDS open 2997-4469 _na     490_aa thrC threonine synthase
1894 CAKARP010000025.1 GCA916720615_00945 CDS open 4716-5867 _na     383_aa Homoserine dehydrogenase
1895 CAKARP010000025.1 GCA916720615_00946 CDS open 5959-7266 _na     435_aa aspartate kinase
1896 CAKARP010000025.1 GCA916720615_00947 CDS open 7347-7964 _na     205_aa Flavodoxin family protein
1897 CAKARP010000025.1 GCA916720615_00948 CDS open 8005-8640 _na     211_aa yigZ YigZ family protein
1898 CAKARP010000025.1 GCA916720615_00949 CDS open 8782-10038 _na     418_aa lytR LytR family transcriptional regulator
1899 CAKARP010000025.1 GCA916720615_00950 CDS open 10199-11059 _na     286_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
1900 CAKARP010000025.1 GCA916720615_00951 CDS open 11078-11926 _na     282_aa DUF2179 domain-containing protein
1901 CAKARP010000025.1 GCA916720615_00952 CDS open 12086-12637 _na     183_aa rnmV ribonuclease M5
1902 CAKARP010000025.1 GCA916720615_00953 CDS open 12637-13497 _na     286_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
1903 CAKARP010000025.1 GCA916720615_00954 CDS open 13509-13793 _na     94_aa Nucleotide pyrophosphohydrolase
1904 CAKARP010000025.1 GCA916720615_00955 CDS open 13832-15031 _na     399_aa MFS transporter
1905 CAKARP010000025.1 GCA916720615_00956 CDS open 15841-16845 _na     334_aa trpX tryptophan ABC transporter substrate-binding protein
1906 CAKARP010000025.1 GCA916720615_00957 CDS open 16964-17839 _na     291_aa Branched-chain amino acid ABC transporter permease
1907 CAKARP010000025.1 GCA916720615_00958 CDS open 17842-18615 _na     257_aa phnK ABC transporter domain-containing protein
1908 CAKARP010000025.1 GCA916720615_00959 CDS open 18809-19258 _na     149_aa response regulator transcription factor
1909 CAKARP010000025.1 GCA916720615_00960 CDS open 19369-20520 _na     383_aa DUF819 domain-containing protein
1910 CAKARP010000025.1 GCA916720615_00961 CDS open 20627-21157 _na     176_aa Polymerase
1911 CAKARP010000025.1 GCA916720615_00962 CDS open 21175-21492 _na     105_aa hypothetical protein
1912 CAKARP010000025.1 GCA916720615_00963 CDS open 21681-22310 _na     209_aa upp uracil phosphoribosyltransferase
1913 CAKARP010000025.1 GCA916720615_00940 gene open 147-656 yceD
1914 CAKARP010000025.1 GCA916720615_00941 gene open 689-865 rpmF
1915 CAKARP010000025.1 GCA916720615_00942 gene open 957-2033 asd
1916 CAKARP010000025.1 GCA916720615_00943 gene open 2116-2997 thrB
1917 CAKARP010000025.1 GCA916720615_00944 gene open 2997-4469 thrC
1918 CAKARP010000025.1 GCA916720615_00945 gene open 4716-5867
1919 CAKARP010000025.1 GCA916720615_00946 gene open 5959-7266
1920 CAKARP010000025.1 GCA916720615_00947 gene open 7347-7964
1921 CAKARP010000025.1 GCA916720615_00948 gene open 8005-8640 yigZ
1922 CAKARP010000025.1 GCA916720615_00949 gene open 8782-10038 lytR
1923 CAKARP010000025.1 GCA916720615_00950 gene open 10199-11059 mutM
1924 CAKARP010000025.1 GCA916720615_00951 gene open 11078-11926
1925 CAKARP010000025.1 GCA916720615_00952 gene open 12086-12637 rnmV
1926 CAKARP010000025.1 GCA916720615_00953 gene open 12637-13497 rsmA
1927 CAKARP010000025.1 GCA916720615_00954 gene open 13509-13793
1928 CAKARP010000025.1 GCA916720615_00955 gene open 13832-15031
1929 CAKARP010000025.1 GCA916720615_00956 gene open 15841-16845 trpX
1930 CAKARP010000025.1 GCA916720615_00957 gene open 16964-17839
1931 CAKARP010000025.1 GCA916720615_00958 gene open 17842-18615 phnK
1932 CAKARP010000025.1 GCA916720615_00959 gene open 18809-19258
1933 CAKARP010000025.1 GCA916720615_00960 gene open 19369-20520
1934 CAKARP010000025.1 GCA916720615_00961 gene open 20627-21157
1935 CAKARP010000025.1 GCA916720615_00962 gene open 21175-21492
1936 CAKARP010000025.1 GCA916720615_00963 gene open 21681-22310 upp
1937 CAKARP010000026.1 GCA916720615_00964 CDS open 157-699 _na     180_aa 5-formyltetrahydrofolate cyclo-ligase
1938 CAKARP010000026.1 GCA916720615_00965 CDS open 1295-2668 _na     457_aa ABC transporter ATP-binding protein
1939 CAKARP010000026.1 GCA916720615_00966 CDS open 2668-3492 _na     274_aa ABC transporter permease
1940 CAKARP010000026.1 GCA916720615_00967 CDS open 3522-4706 _na     394_aa araC AraC family transcriptional regulator
1941 CAKARP010000026.1 GCA916720615_00968 CDS open 4831-5604 _na     257_aa type III pantothenate kinase
1942 CAKARP010000026.1 GCA916720615_00969 CDS open 5802-6677 _na     291_aa hslO Hsp33 family molecular chaperone HslO
1943 CAKARP010000026.1 GCA916720615_00970 CDS open 6699-7376 _na     225_aa xanthine phosphoribosyltransferase
1944 CAKARP010000026.1 GCA916720615_00971 CDS open 7393-8856 _na     487_aa guaB IMP dehydrogenase
1945 CAKARP010000026.1 GCA916720615_00972 CDS open 8933-9598 _na     221_aa hypothetical protein
1946 CAKARP010000026.1 GCA916720615_00973 CDS open 9651-11012 _na     453_aa mntH Nramp family divalent metal transporter
1947 CAKARP010000026.1 GCA916720615_00974 CDS open 11234-12577 _na     447_aa yocR Transporter
1948 CAKARP010000026.1 GCA916720615_00975 CDS open 12975-14426 _na     483_aa aldA aldehyde dehydrogenase
1949 CAKARP010000026.1 GCA916720615_00976 CDS open 14935-16347 _na     470_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
1950 CAKARP010000026.1 GCA916720615_00977 CDS open 16319-17713 _na     464_aa zwf glucose-6-phosphate dehydrogenase
1951 CAKARP010000026.1 GCA916720615_00978 CDS open 17870-18445 _na     191_aa Carbonic anhydrase
1952 CAKARP010000026.1 GCA916720615_00979 CDS open 18458-19420 _na     320_aa L-asparaginase
1953 CAKARP010000026.1 GCA916720615_00980 CDS open 19549-20205 _na     218_aa sbcC Exonuclease SbcC
1954 CAKARP010000026.1 GCA916720615_00964 gene open 157-699
1955 CAKARP010000026.1 GCA916720615_00965 gene open 1295-2668
1956 CAKARP010000026.1 GCA916720615_00966 gene open 2668-3492
1957 CAKARP010000026.1 GCA916720615_00967 gene open 3522-4706 araC
1958 CAKARP010000026.1 GCA916720615_00968 gene open 4831-5604
1959 CAKARP010000026.1 GCA916720615_00969 gene open 5802-6677 hslO
1960 CAKARP010000026.1 GCA916720615_00970 gene open 6699-7376
1961 CAKARP010000026.1 GCA916720615_00971 gene open 7393-8856 guaB
1962 CAKARP010000026.1 GCA916720615_00972 gene open 8933-9598
1963 CAKARP010000026.1 GCA916720615_00973 gene open 9651-11012 mntH
1964 CAKARP010000026.1 GCA916720615_00974 gene open 11234-12577 yocR
1965 CAKARP010000026.1 GCA916720615_00975 gene open 12975-14426 aldA
1966 CAKARP010000026.1 GCA916720615_00976 gene open 14935-16347 gnd
1967 CAKARP010000026.1 GCA916720615_00977 gene open 16319-17713 zwf
1968 CAKARP010000026.1 GCA916720615_00978 gene open 17870-18445
1969 CAKARP010000026.1 GCA916720615_00979 gene open 18458-19420
1970 CAKARP010000026.1 GCA916720615_00980 gene open 19549-20205 sbcC
1971 CAKARP010000027.1 GCA916720615_00981 CDS open 306-1508 _na     400_aa hypothetical protein
1972 CAKARP010000027.1 GCA916720615_00982 CDS open 1560-2588 _na     342_aa acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein
1973 CAKARP010000027.1 GCA916720615_00983 CDS open 2742-4742 _na     666_aa metG methionine--tRNA ligase
1974 CAKARP010000027.1 GCA916720615_00984 CDS open 4972-6198 _na     408_aa pepT peptidase T
1975 CAKARP010000027.1 GCA916720615_00985 CDS open 6428-6751 _na     107_aa lipoprotein
1976 CAKARP010000027.1 GCA916720615_00986 CDS open 6960-7460 _na     166_aa yciA HotDog ACOT-type domain-containing protein
1977 CAKARP010000027.1 GCA916720615_00987 CDS open 7514-9235 _na     573_aa manB Phosphoglucomutase
1978 CAKARP010000027.1 GCA916720615_00988 CDS open 9273-9983 _na     236_aa deoD purine-nucleoside phosphorylase
1979 CAKARP010000027.1 GCA916720615_00989 CDS open 10337-12700 _na     787_aa Sodium:proton antiporter
1980 CAKARP010000027.1 GCA916720615_00990 CDS open 12690-13115 _na     141_aa mnhB Na+/H+ antiporter MnhB subunit-related protein domain-containing protein
1981 CAKARP010000027.1 GCA916720615_00991 CDS open 13115-13474 _na     119_aa Na(+)/H(+) antiporter subunit C
1982 CAKARP010000027.1 GCA916720615_00992 CDS open 13467-14948 _na     493_aa Sodium:proton antiporter
1983 CAKARP010000027.1 GCA916720615_00993 CDS open 14952-15449 _na     165_aa Na+/H+ antiporter subunit E
1984 CAKARP010000027.1 GCA916720615_00994 CDS open 15442-15732 _na     96_aa pH regulation protein F
1985 CAKARP010000027.1 GCA916720615_00995 CDS open 15719-16084 _na     121_aa Cation:proton antiporter
1986 CAKARP010000027.1 GCA916720615_00996 CDS open 16290-17633 _na     447_aa glmM phosphoglucosamine mutase
1987 CAKARP010000027.1 GCA916720615_00997 CDS open 18479-19207 _na     242_aa Manganese ABC transporter ATP-binding protein
1988 CAKARP010000027.1 GCA916720615_00998 CDS open 19200-20036 _na     278_aa ABC 3 transport family protein
1989 CAKARP010000027.1 GCA916720615_00999 CDS open 20242-21177 _na     311_aa Metal ABC transporter substrate-binding protein
1990 CAKARP010000027.1 GCA916720615_00981 gene open 306-1508
1991 CAKARP010000027.1 GCA916720615_00982 gene open 1560-2588
1992 CAKARP010000027.1 GCA916720615_00983 gene open 2742-4742 metG
1993 CAKARP010000027.1 GCA916720615_00984 gene open 4972-6198 pepT
1994 CAKARP010000027.1 GCA916720615_00985 gene open 6428-6751
1995 CAKARP010000027.1 GCA916720615_00986 gene open 6960-7460 yciA
1996 CAKARP010000027.1 GCA916720615_00987 gene open 7514-9235 manB
1997 CAKARP010000027.1 GCA916720615_00988 gene open 9273-9983 deoD
1998 CAKARP010000027.1 GCA916720615_00989 gene open 10337-12700
1999 CAKARP010000027.1 GCA916720615_00990 gene open 12690-13115 mnhB
2000 CAKARP010000027.1 GCA916720615_00991 gene open 13115-13474